CN114262683B

CN114262683B - Bacterial preparation for expressing VEGFR 3D 2 polypeptide and construction method and application thereof

Info

Publication number: CN114262683B
Application number: CN202210191147.8A
Authority: CN
Inventors: 金万洙; 董孟; 张瀚林; 程子昱
Original assignee: Institute of Zoology of CAS
Current assignee: Institute of Zoology of CAS
Priority date: 2022-03-01
Filing date: 2022-03-01
Publication date: 2022-06-17
Anticipated expiration: 2042-03-01
Also published as: CN114262683A; WO2023165502A1

Abstract

The invention discloses a bacterial preparation for expressing VEGFR 3D 2 polypeptide, and a construction method and application thereof, and belongs to the technical field of molecular biology. The bacterial preparation for expressing the VEGFR 3D 2 polypeptide combines a biological medicine carrier with anti-tumor polypeptide, is constructed by integrating a gene for encoding the VEGFR 3D 2 polypeptide into the genome of bacterial thallus or transferring a recombinant expression carrier for expressing the VEGFR 3D 2 polypeptide into the bacterial thallus, can stably express the VEGFR 3D 2 polypeptide and release the polypeptide, can convert the traditional anti-tumor medicine into oral administration through an injection administration mode, enables the administration mode to be simpler and more convenient, and can realize better anti-tumor effect. The bacterial preparation expressing the VEGFR 3D 2 polypeptide provided by the invention can be used for preparing antitumor drugs.

Description

Bacterial preparation for expressing VEGFR 3D 2 polypeptide and construction method and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a bacterial preparation for expressing VEGFR 3D 2 polypeptide, and a construction method and application thereof.

Background

Dysfunction of the lymphatic vasculature can lead to congenital or acquired diseases such as lymphedema, cancer, obesity, atherosclerosis, hypertension, and the like. It is currently the prevailing view that lymphangiogenesis promotes tumor development. The existence of tumor cells in lymph nodes after various cancer operations is a key factor for poor prognosis of patients, and the expression of lymphangiogenic growth factors, high lymphatic density and high lymph node invasion rate are generally related to lymph node metastasis and low survival rate. A large amount of lymphatic vessels are generated in the interior of the tumor and surrounding tissues, and the tumor cells and stromal cells release lymphatic vessel growth factors (such as VEGFC) which promote the proliferation and migration of Lymphatic Endothelial Cells (LECs) to cause the generation and angiogenesis of the tumor lymphatic vessels, thereby promoting the metastasis of the tumor lymphatic vessels. In one aspect, lymphatic vessels provide a physical pathway for tumor cell metastasis: mediates the lymphatic dissemination of primary tumor cells to tumor draining lymph nodes to further cause the invasion-metastasis of tumors. On the other hand, lymphatic endothelial cells are involved in regulating host immune responses: inhibiting T cell function by secreting immunosuppressive factors and inhibiting dendritic cell maturation; regulate and control the trans-endothelial transport, control the transport of tumor antigens from chronic inflammatory tissues to draining lymph nodes and maintain immune tolerance. Therefore, the development of the tumor can be inhibited by inhibiting the growth of the tumor-related lymphatic vessels, and the aim of treating the tumor is fulfilled.

However, most of the existing antitumor drugs targeting lymphatic vessels are in the research and development stage, and mainly antibody drugs, which have the disadvantages of high production cost, uncertain in vivo metabolism, undesirable antitumor effect, etc.

Disclosure of Invention

In view of one or more problems in the prior art, an aspect of the present invention provides a bacterial preparation expressing VEGFR 3D 2 polypeptide, wherein a gene encoding VEGFR 3D 2 polypeptide and expression-related elements are integrated into the genome of the bacterial preparation, or the bacterial preparation comprises a recombinant expression vector for expressing VEGFR 3D 2 polypeptide transferred into bacterial thallus; wherein:

the recombinant expression vector comprises a backbone plasmid and a gene encoding a VEGFR 3D 2 polypeptide;

the bacterial thallus can be one or more bacteria selected from the following genera: lactococcus, Lactobacillus, Streptococcus, Bifidobacterium, Bacillus, enterococcus, Bacteroides, Prevotella, Ekermansia and Escherichia.

In some embodiments, the gene encoding the VEGFR 3D 2 polypeptide may comprise the nucleotide sequence set forth as SEQ ID No. 1, and optionally the nucleotide sequence of the gene encoding the VEGFR 3D 2 polypeptide is set forth as SEQ ID No. 1.

In some embodiments, the recombinant expression vector may comprise a nucleotide sequence as set forth in SEQ ID NO. 2.

In some embodiments, the bacterial cells may be selected from one or more of the following: lactococcus lactisLactococcus lactisLactobacillus acidophilusLactobacillus acidophilusLactobacillus plantarumLactobacillu plantarumLactobacillus caseiLactobacillus caseiLactobacillus delbrueckiiLactobacillus delbrueckiiStreptococcus pyogenesStreptococcus pyogenesStreptococcus thermophilusStreptococcus thermophilusBifidobacterium adolescentisBifidobacterium adolescentisBifidobacterium bifidumBifidobacterium bifidumBacillus coagulansBacillus coagulansBacillus smithiiBacillus smithiBacillus stearothermophilusBacillus stearothermophilusEnterococcus faecalisEnterococcus faecalisEnterococcus faeciumEnterococcus faeciumEnterococcus aviumEnterococcus avium、Bacteroides fragilisBacteroides fragilis、Prevotella histicolaEscherichia coliEscherichia coliAnd Ackermanella muciniphilaAkkermansia muciniphila。

In some embodiments, the backbone plasmid of the recombinant expression vector can be any one selected from the group consisting of: pGAPA8149, pNZ8148, pNZ8149, pNZ8150, pNZ8151, pNZ8152, pNZ9530, pNZ8120, pNZ8121, pNZ8122, pNZ8123, pNZ8124, pNZ124, pNZ2105, pNZ2103, pNZ7021, pNZ2122, pNZ2123, pNZ2125, pNZ7025, pMG36e, pEPR, pLEISS, pLEB590, pPG611.1, pPG612.3871, pPG555 pA, pSLP111.3, pLEB590, pIA beta 5, pW425et, pW t, pW425, pVA838, pMB1, pRM2, pDR, pHR, pHT304, pXM 04, pXMJ19, pXMT 425, pW 19, pPLS-pHTIS 7375, pPLS-pTIP-pI-pPTS 43, pPLS-pTIP-PIT-7375, pPLS-pTIP-PIS-PII-PIS.

Another aspect of the present invention provides a recombinant expression vector for expressing VEGFR 3D 2 polypeptide, which may comprise a nucleotide sequence set forth in SEQ ID NO. 2.

Yet another aspect of the present invention provides a method of constructing a bacterial formulation that expresses VEGFR 3D 2 polypeptide, which may comprise the steps of:

s1: constructing a gene for encoding VEGFR 3D 2 polypeptide into a skeleton plasmid to obtain a recombinant expression vector for expressing VEGFR 3D 2 polypeptide;

s2: and (4) transforming the recombinant expression vector expressing the VEGFR 3D 2 polypeptide obtained in the step S1 into bacterial thallus to obtain a bacterial preparation expressing the VEGFR 3D 2 polypeptide.

The invention also provides applications of the bacterial preparation for expressing the VEGFR 3D 2 polypeptide and the recombinant expression vector for expressing the VEGFR 3D 2 polypeptide in preparation of antitumor drugs. Based on this, the present invention also provides an antitumor drug comprising the above-mentioned VEGFR 3D 2 polypeptide-expressing bacterial preparation as an active ingredient.

In some embodiments, the anti-tumor drug is capable of enhancing T cell activity via DC cell and/or intestinal immunity, thereby exerting anti-tumor efficacy.

In some embodiments, the dosage form of the anti-tumor drug may include tablets, granules, pills, capsules, oral liquids, suppositories, injection dosage forms (for example, dosage forms in which the anti-tumor drug can be delivered to the intestinal tract by injection), and nasal spray dosage forms.

In some embodiments, the tumor includes, but is not limited to, gastric cancer, pancreatic cancer, lung cancer, liver cancer, colorectal cancer, breast cancer, nasopharyngeal cancer, cervical cancer, lymphoma, melanoma, renal cancer, esophageal cancer, oral squamous cell carcinoma, brain glioma, and head and neck cancer.

The bacterial preparation expressing the VEGFR 3D 2 polypeptide (VEGFR 3 ectodomain D2 polypeptide) provided by the technical scheme is constructed by integrating a gene encoding VEGFR 3D 2 polypeptide into the genome of bacterial thallus or transferring a recombinant expression vector expressing the VEGFR 3D 2 polypeptide into the bacterial thallus, the bacterial preparation can stably express VEGFR 3D 2 polypeptide and release the VEGFR 3D 2 polypeptide, a biological drug carrier (such as orally-administrable bacterial thallus) can be combined with the anti-tumor polypeptide, the combined action of the two in intestinal tracts can convert the traditional anti-tumor drug administration mode into oral administration, so that the administration mode is simpler and more convenient, and the example results show that compared with the traditional anti-tumor drug (such as antibody drug VEGFR3 protein), the bacterial preparation provided by the invention can realize better anti-tumor effect, and has better anti-tumor effect compared with the combined mode of the biological drug carrier and VEGFR 2D 2 polypeptide, in addition, the preparation method has the advantages of low cost, clear in vivo metabolic pathway and the like, overcomes the defects of long production period, high cost and uncertainty of in vivo metabolism of the antitumor drugs in the current market, and can meet the medication requirements of first-line clinical and tumor patients in a wider range. On the other hand, in the mode of constructing and obtaining the bacterial preparation by transferring the recombinant expression vector expressing the VEGFR 3D 2 polypeptide into bacterial thallus, the VEGFR 3D 2 polypeptide is orderly synthesized and released, and meanwhile, the signal peptide sequences SPusp45, LEISS sequences and the like which can be contained in the recombinant expression vector can be separated by enzyme digestion under the action of enterokinase in intestinal tracts, so that the VEGFR 3D 2 polypeptide obtained by expression does not contain other modified or labeled components, and therefore, the bacterial preparation has the advantages of low antigenicity, high safety and the like.

Drawings

FIGS. 1A-B are Western detection graphs of secretion expression of pGAPA8149-VEGFR 3D 2 recombinant expression vector in recombinant Escherichia coli and recombinant lactococcus lactis, wherein FIG. 1A shows purification of VEGFR 3D 2 polypeptide expressed by recombinant Escherichia coli, and FIG. 1B shows identification of VEGFR 3D 2 expressed by recombinant lactococcus lactis.

FIGS. 2A-D show the anti-tumor effect of pGAPA8149 XVEGFR 3D 2 recombinant lactococcus lactis, wherein FIG. 2A shows the photographs of tumors in model mice after different treatments, FIG. 2B shows the histogram of tumor weight statistics in model mice after different treatments, FIG. 2C shows the curves of tumor volume changes with time in model mice under different treatment conditions, and FIG. 2D shows the relative inhibition of tumors in model mice after different treatments.

FIG. 3 is a graph showing the survival curves of model mice after gavage of pGAPA8149 × VEGFR 3D 2 recombinant lactococcus lactis.

FIGS. 4A-K show the changes in tumor cells and immune cells in mice after gavage of pGAPA 8149X VEGFR 3D 2 recombinant lactococcus lactis; wherein FIG. 4A shows the ratio of tumor cells in the mice of different treatment groups, FIG. 4B shows the ratio of immune cells in the mice of different treatment groups, and FIGS. 4C-K show the ratios of dendritic cells (DC cells), T lymphocytes, macrophages, natural killer cells, natural killer T lymphocytes, cross-presenting dendritic cells, migratory dendritic cells, cytotoxic T cells and CD8 effector T lymphocytes in the mice of different treatment groups, respectively.

Detailed Description

Aiming at the defect that an anti-tumor medicament taking lymphatic vessels as targets is still lacked in the prior art, the invention provides a bacterial preparation for expressing VEGFR 3D 2 polypeptide, the bacterial preparation can be orally administered, VEGFR 3D 2 polypeptide can be stably expressed and released, a biological medicine carrier is combined with the anti-tumor polypeptide, and the VEGFC/VEGFR3 signal axis in LECs can be effectively inhibited through the combined action of the VEGFR 3D 2 polypeptide and the anti-tumor polypeptide in intestinal tracts, so that the growth of new lymphatic vessels can be effectively inhibited, and tumors can be effectively treated. In another aspect, the present invention provides a bacterial formulation expressing VEGFR 3D 2 polypeptide that induces significant upregulation of immune cells, particularly DC cells and T cells, in a subject, wherein the proportion of cross-presenting DC cells to migrating DC cells is increased in DC cells and the proportion of CD 8T cells (cytotoxic T cells and effector T cells) is increased in T cells; therefore, the bacterial preparation expressing the VEGFR 3D 2 polypeptide provided by the invention can also exert an anti-tumor curative effect by inducing the remarkable up-regulation of DC cells in a subject so as to activate a mechanism of CD8+ T cells. The invention also provides a method for constructing the bacterial preparation expressing the VEGFR 3D 2 polypeptide, and provides an anti-tumor drug taking lymphatic vessels as targets on the basis of the bacterial preparation.

In a first aspect of the invention, a bacterial preparation expressing a VEGFR 3D 2 polypeptide is provided, wherein a gene encoding a VEGFR 3D 2 polypeptide and expression-related elements are integrated into the genome of the bacterial preparation, or the bacterial preparation comprises a recombinant expression vector for expressing a VEGFR 3D 2 polypeptide transferred into bacterial cells; wherein:

the bacterial body is not particularly limited as long as the bacterial body can be used as a biological drug carrier in pharmacy, can be orally administered, and can enable a recombinant expression vector transferred into the bacterial body to express and secrete a target polypeptide in the intestinal tract, and optionally, the bacterial body can be one or more bacteria selected from the following genera: lactococcus, Lactobacillus, Streptococcus, Bifidobacterium, Bacillus, enterococcus, Bacteroides, Prevotella, Ekermansia, and Escherichia, etc.

In some embodiments, the bacterial cell may be one or more selected from the group consisting of: lactococcus lactis of the genus lactococcus: (Lactococcus lactis) And the like; lactobacillus acidophilus of the genus lactobacillus: (Lactobacillus acidophilus) Lactobacillus plantarum (II)Lactobacillu plantarum) Lactobacillus casei (L.casei) ((L.casei))Lactobacillus casei) Lactobacillus delbrueckii: (A), (B)Lactobacillus delbrueckii) And the like; streptococcus pyogenes (S. pyogenes)Streptococcus pyogenes) Streptococcus thermophilus (b)Streptococcus thermophilus) And the like; bifidobacterium adolescentis of the genus Bifidobacterium: (Bifidobacterium adolescentis) Bifidobacterium bifidum (b)Bifidobacterium bifidum) And the like; bacillus coagulans of the genus Bacillus: (A), (B)Bacillus coagulans) Bacillus smithii: (Bacillus smithi) Bacillus stearothermophilus (B.stearothermophilus) (B.stearothermophilus)Bacillus stearothermophilus) And the like; enterococcus faecalis of the genus enterococcus (Enterococcus faecalis) Enterococcus faecium (C. faecium)Enterococcus faecium) Enterococcus avium（Enterococcus avium）And the like; bacteroides fragilis of the genus Bacteroides: (Bacteroides fragilis) And the like; in the genus PrzewalskiPrevotella histicolaAnd the like; escherichia coli (E.coli)Escherichia coli) (ii) a Akkermansia muciniphila of genus akkermansia (a)Akkermansia muciniphila) And the like.

In some embodiments, the mode of integrating the foreign gene into the genome of the host (e.g., the bacterial cell described above) is not particularly limited as long as the foreign gene can be integrated into the genome of the host and stably expressed.

In some embodiments, the gene encoding the VEGFR 3D 2 polypeptide is well known to those skilled in the art as long as it is capable of expressing the VEGFR 3D 2 polypeptide, alternatively, the gene encoding the VEGFR 3D 2 polypeptide may comprise the nucleotide sequence set forth in SEQ ID No. 1, and further alternatively, the nucleotide sequence of the gene encoding the VEGFR 3D 2 polypeptide is set forth in SEQ ID No. 1.

In some embodiments, the backbone plasmid of the recombinant expression vector is not limited so long as the recombinant expression vector is capable of expressing the VEGFR 3D 2 polypeptide, alternatively the backbone plasmid of the recombinant expression vector can be any one selected from the group consisting of: pGAPA8149, pNZ8148, pNZ8149, pNZ8150, pNZ8151, pNZ8152, pNZ9530, pNZ8120, pNZ8121, pNZ8122, pNZ8123, pNZ8124, pNZ124, pNZ2105, pNZ2103, pNZ7021, pNZ2122, pNZ2123, pNZ2125, pNZ7025, pMG36e, pEPR, pLEISS, pLEB590, pPG611.1, pPG612.3871, pPG555 pA, pSLP111.3, pLEB590, pIA beta 5, pW425et, pW t, pW425, pVA838, pMB1, pRM2, pDR, pHR, pHT304, pXM 04, pXMJ19, pXMT 425, pW 19, pPLS-pHTIS 7375, pPLS-pTIP-pI-pPTS 43, pPLS-pTIP-PIT-7375, pPLS-pTIP-PIS-PII-PIS.

In a second aspect of the present invention, there is provided a recombinant expression vector expressing a VEGFR 3D 2 polypeptide, which may comprise a nucleotide sequence as set forth in SEQ ID No. 2.

In a third aspect of the present invention, a method of constructing a bacterial formulation that expresses VEGFR 3D 2 polypeptide is provided, which may comprise the steps of:

The invention also provides applications of the bacterial preparation for expressing the VEGFR 3D 2 polypeptide and the recombinant expression vector for expressing the VEGFR 3D 2 polypeptide in preparation of antitumor drugs. Based on this, in the fourth aspect of the present invention, there is provided an antitumor agent comprising the above-mentioned bacterial preparation expressing VEGFR 3D 2 polypeptide as an active ingredient.

In some embodiments, the dosage form of the antitumor drug may include tablets, granules, pills, capsules, oral liquids, suppositories, injection dosage forms (for example, dosage forms in which the antitumor drug can be delivered to the intestinal tract by injection), and nasal spray dosage forms.

The invention is further illustrated by the following examples. It should be understood that the specific examples are intended to be illustrative of the invention and are not intended to limit the scope of the invention.

The methods used in the following examples are conventional methods unless otherwise specified. The specific steps can be seen in: a Molecular Cloning Laboratory Manual (Molecular Cloning: A Laboratory Manual, Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

The various biological materials described in the examples are obtained by way of experimental acquisition for the purposes of this disclosure and should not be construed as limiting the source of the biological material of the invention. In fact, the sources of the biological materials used are wide and any biological material that can be obtained without violating the law and ethics can be used instead as suggested in the examples. The test materials used in the following examples are all conventional biochemical reagents, and are commercially available, unless otherwise specified.

The sequences referred to in the examples below were all synthesized using known techniques.

In the following examples, lactococcus lactis is taken as an example of a biological drug carrier, recombinant lactococcus lactis for expressing a polypeptide is constructed as a bacterial preparation, and bacterial preparations for expressing a polypeptide can be constructed by using other bacterial cells as a biological drug carrier according to the same operation method, and can exert functions similar to those of recombinant lactococcus lactis, namely, can stably express and secrete a polypeptide in an intestinal tract, so that the growth of a newborn lymphatic vessel can be effectively inhibited, and tumors can be effectively treated.

Example 1: construction of recombinant expression vectors for expression of polypeptides

In the embodiment, a recombinant expression vector for expressing the VEGFR 3D 2 polypeptide and a recombinant expression vector for expressing the VEGFR 2D 2 polypeptide are constructed, and the method specifically comprises the following steps.

1.1, synthesizing the whole sequence SPusp45-LEISS-DDDDK-VEGFR 3D 2 (the nucleotide sequence is shown in SEQ ID NO: 2), and synthesizing the whole sequence SPusp45-LEISS-DDDDK-VEGFR 2D 2 (the nucleotide sequence is shown in SEQ ID NO: 4), and respectively connecting enzyme cutting sites NcoI and XbaI at the upstream and downstream of the sequences of the SPusp45-LEISS-DDDDK-VEGFR 2D 2. Among the two sequences synthesized VEGFR 3D 2 represents the gene encoding VEGFR 3D 2 polypeptide, whose nucleotide sequence is set forth in SEQ ID NO:1, VEGFR 2D 2 shows a gene encoding VEGFR 2D 2 polypeptide, the nucleotide sequence of which is shown in SEQ ID NO. 3, SPusp45 shows a signal peptide, the nucleotide sequence of which is shown in SEQ ID NO. 5, LEISS shows a leader peptide which is integrally negatively charged, the leader peptide is fused between SPusp45 and the polypeptide to enhance the expression level of the polypeptide, the nucleotide sequence of which is shown in SEQ ID NO. 6, DDK shows an enterokinase recognition site, and the nucleotide sequence of which is shown in SEQ ID NO. 7. Then, the two synthesized sequences were ligated to pUC57 vectors, respectively, to obtain recombinant plasmids carrying a gene encoding VEGFR 3D 2 polypeptide and a gene encoding VEGFR 2D 2 polypeptide, which were designated as pUC57-VEGFR 3D 2 plasmid and pUC57-VEGFR 2D 2 plasmid, respectively. This step is performed by Shanghai Bioengineering Co., Ltd.

1.2, extracting pGAPA8149 plasmid (CN 111518801A, based on edible protein expression vector pNZ8149 (MoBiTec, Germany)) by adopting a small root plasmid extraction kit according to the instruction operation, and extracting a strong promoter P based on the extracted pGAPA8149 plasmid_gapAFor inducible promoter p on pNZ8149_NisinSubstitution), the pUC57-VEGFR 3D 2 plasmid and pUC57-VEGFR 2D 2 plasmid obtained from the construction of step 1.1.

1.3, the pGAPA8149 plasmid, the pUC57-VEGFR 3D 2 plasmid and the pUC57-VEGFR 2D 2 plasmid were digested with NcoI and XbaI, respectively. And (3) carrying out electrophoresis by using 1% agarose gel after enzyme digestion, carrying out electrophoresis for 30min at the voltage of 120V, cutting the gel and recovering to obtain respective enzyme digestion products. The cleavage system is shown in Table 1 below.

Table 1: enzyme digestion system

Components	Volume (μ l)
		10XCutSmart buffer	5
NcoI	1
		XbaI	1
Plasmids	3 μg
		Water (W)	-
Sum of	50

1.4, enzyme-cutting the enzyme-cutting product of pGAPA8149 plasmid obtained in the step 1.3 and pUC57-VEGFR 3D 2 plasmid, or enzyme-cutting the enzyme-cutting product of pGAPA8149 plasmid obtained in the step 1.3 and pUC57-VEGFR 2D 2 plasmid under the action of T4 ligase at 16 ℃ for overnight.

1.5, purifying and recovering a connection product obtained in the step 1.4: adding 2.5 times of anhydrous ethanol and 1/10 times of 2.5mol/L sodium acetate into the prepared connecting product, uniformly mixing, placing at 20 ℃ for L h, centrifuging at 12000 r/min for 5min, and removing supernatant; precipitating with 1mL of 75% ethanol once, centrifuging at 12000 r/min for 5min, discarding supernatant, drying at room temperature for 20 min, and dissolving precipitate with deionized water. After sequencing verification, obtaining recombinant expression vectors pGAPA8149-SPusp45-LEISS-DDDDK-VEGFR 3D 2 for expressing VEGFR 3D 2 polypeptide respectively, and naming the recombinant expression vectors as pGAPA8149-VEGFR 3D 2; the recombinant expression vector pGAPA8149-Spusp 45-LEISS-DDDDDDK-VEGFR 2D 2 expressing VEGFR 2D 2 polypeptide is named pGAPA8149-VEGFR 2D 2.

Example 2: recombinant lactococcus lactis for expressing polypeptide and recombinant escherichia coli construction

In this example, recombinant lactococcus lactis expressing VEGFR 3D 2 polypeptide, recombinant lactococcus lactis expressing VEGFR 2D 2 polypeptide, and recombinant escherichia coli expressing VEGFR 3D 2 polypeptide were constructed, specifically including the following steps.

2.1 construction of recombinant lactococcus lactis for expressing the polypeptide

2.1.1 competent preparation of lactococcus lactis NZ3900

1) Inoculating lactococcus lactis NZ3900 cryopreserved at the temperature of minus 80 ℃ in 5 mL of M17 liquid culture medium containing 5% of glucose, and culturing overnight at the temperature of 30 ℃;

2) inoculating the obtained bacterial liquid into M17 liquid culture medium containing 2.5% Gly and 5% glucose according to 1%, standing at 30 deg.C, culturing until thallus OD 600 value is 0.3-0.4, and collecting;

3) ice-bath the collected thallus culture for 10min, centrifuging at 4 deg.C at 5000 rpm/min for 5 min; collecting the thallus precipitate;

4) washing the collected thallus precipitate twice with ice-cold mixed solution 1/10 of 10% sucrose and 10% glycerol, centrifuging at 4 deg.C at 8000 rpm/min for 5min, and collecting precipitate;

5) the pellet was resuspended in 1/100 volumes of a 10% sucrose and 10% glycerol mixed solution and used after 10min in ice bath.

2.1.2 lactococcus lactis NZ3900 competent electrotransformation

1) Sucking 40 μ l of freshly prepared competent lactococcus lactis NZ3900 suspension into an ice-cold sterile EP tube, and carrying out ice-bath for 5 min;

2) pipetting 1. mu.l of the purified ligation product (pGAPA 8149-VEGFR 3D 2 or pGAPA8149-VEGFR 2D 2 obtained in example 1) into the competent lactococcus lactis NZ3900, mixing, and placing on ice for 5 min;

3) adding the mixed solution obtained in the step 2) into an ice-cold electric rotating cup, and putting into an electric shock instrument under the setting conditions of 2500V, 200 omega and 25 muF;

4) after the electric shock is finished, 1ml of ice-cold GM17-MC is quickly added to recover the culture medium; after mixing uniformly, transferring the mixture into an EP tube for ice bath for 5-10 min; culturing at 30 deg.C for 2 h;

5) 100 mul of the recovered and cultured bacterial liquid is inoculated in an Elliker selective medium, cultured overnight at 30 ℃, and yellow colonies are picked for identification.

2.1.3 validation of the transformed bacteria

Extracting plasmid from the cultured transformed thallus, and then amplifying by PCR, wherein the PCR amplification primer is SEQ ID NO: 8 (F: cttattgagaaagggaaacgacgg) and SEQ ID NO: 9 (R: tcaactgctgctttttggcta); reaction procedure for the PCR amplification: 94 ℃ for 3 min; {94 ℃,30 s; at 58 ℃ for 30 s; 72 ℃, 1min 30s } 38 cycles; 72 ℃ for 5 min. And sequencing and identifying the PCR products to obtain plasmids with nucleotide sequences consistent with the expected nucleotide sequences, namely pGAPA8149-VEGFR 3D 2 and pGAPA8149-VEGFR 2D 2, and finally obtaining the lactococcus lactis which are transformed into recombinant expression vectors pGAPA8149-VEGFR 3D 2 and pGAPA8149-VEGFR 2D 2 and named as pGAPA8149 multiplied by VEGFR 3D 2 strain and pGAPA8149 multiplied by VEGFR 2D 2 strain.

2.2 recombinant E.coli construction expressing VEGFR 3D 2 polypeptide

2.2.1 construction of prokaryotic expression vector VEGFR 3D 2-PMAL-C5X

The plasmid backbone PMAL-C5X was used, and the nucleotide sequence VEGFR 3D 2 (SEQ ID NO: 1) was inserted between the BamHI and EcoRI sites. The recombinant plasmid VEGFR3-PMAL-C5X was synthesized by Kinsley Biotechnology Ltd.

2.2.2 transformation of prokaryotic expression plasmids

1) Sucking 1 μ l of the recombinant plasmid VEGFR3-PMAL-C5X and BL21(DE3) PlysS sensing escherichia coli, and mixing uniformly;

2) ice-bath the competent cells for 25 min;

3) taking out the competent cells, immediately putting the competent cells into a water bath kettle, and thermally shocking the competent cells for 60s at 42 ℃;

4) placing the competent cells on ice again for 2 min;

5) taking out the competent cells, and adding 500 mul of LB liquid culture medium into the competent cells which are transferred with the plasmids;

6) placing into a shaking table, heating at 37 deg.C and 200 rpm for 45 min, and baking for 20 min in advance;

7) taking out the competent cells, centrifuging at 4000 r/min for 1 min;

8) removing 400 μ l of supernatant, leaving about 100 μ l of supernatant for resuspension, and plating 20 μ l of supernatant;

9) the plate was inverted and incubated overnight at 37 deg.C (12 h to 16 h).

2.2.3 VEGFR 3D 2 polypeptide expression identification

1) A single colony was picked from each plate into a correspondingly resistant LB (3 ml) tube;

2) placing the test tube in a shaking table, measuring OD value with visible spectrophotometer after 3h at 37 deg.C and 200 rpm, adding IPTG (IPTG mother liquor concentration of 0.8M) at 1:1000 for induction (25 deg.C and 10-16 h) or inducing at 37 deg.C for 3-4h when OD value is 0.4-0.6;

3) centrifuging the induced bacterial liquid at 12000 rpm for 2 min, and removing the supernatant and leaving precipitate;

4) adding 80 μ l of water-resuspended bacterial liquid, adding 20 μ l of 5Xloading buffer, mixing, decocting at 100 deg.C for 10min, and preparing SDS-PAGE sample protein;

5) the sample was loaded with 15. mu.l, and protein expression was checked by SDS-PAGE.

2.2.4 VEGFR 3D 2 polypeptide purification

1) Amplifying recombinant Escherichia coli expressing VEGFR 3D 2 polypeptide in large amount by the above 2.2.2 and 2.2.3 methods, centrifuging at 12000 rpm for 5min, and collecting thallus;

2) re-suspending the collected thallus with PBS, ultrasonically crushing, crushing with an ultrasonic probe in ice water for 5s, stopping for 9s, pausing for 2 min after each time of ultrasonic treatment, and ultrasonically treating 100 ml bacterial liquid with a medium probe for 8-10 times until the bacterial liquid becomes clear and transparent;

3) centrifuging the obtained bacterial liquid at 12000 rpm at 4 ℃ for 20 min, and collecting supernatant;

4) filtering the supernatant with a filter membrane to remove impurities;

5) protein hanging columns: adding the supernatant of the bacterial liquid onto a His column, and hanging the column. Repeating for 6-8 times;

6) washing His column with 100 ml 20 mM imidazole for 15-20 times;

7) eluting protein: respectively eluting with imidazole (100,150,200,300,400 and 500 mM) with different concentrations, and sequentially adding into His column from low concentration to high concentration;

8) and (3) ultrafiltration: and (3) ultrafiltering the eluted solution by using a 10 ml ultrafiltration tube, centrifuging at 4000 rpm for 20-30 min, concentrating to about 2 ml volume, and taking 10 mu l to perform SDS-PAGE to detect the situation of the hybrid protein.

The VEGFR 3D 2 polypeptide purification results are shown in fig. 1A, and represent the VEGFR 3D 2 protein expression levels after elution by imidazole with different concentrations from left to right, and it can be seen that VEGFR 3D 2 protein purity obtained after elution by 400 mM and 500 mM imidazole is the highest.

Example 3: western detection of secretory expression of recombinant expression vector in lactococcus lactis

In this embodiment, taking the recombinant lactococcus lactis pGAPA8149 × VEGFR 3D 2 expressing VEGFR 3D 2 polypeptide constructed in example 2 as an example, the method for detecting the secretory expression of VEGFR 3D 2 polypeptide in the recombinant lactococcus lactis by a Western method specifically includes the following steps.

3.1 induced secretory expression of pGAPA8149-VEGFR 3D 2 in lactococcus lactis

1) Inoculating recombinant lactococcus lactis pGAPA8149 XVEGFR 3D 2 which is transformed into a recombinant expression vector pGAPA8149-VEGFR 3D 2 into an M17 liquid culture medium (21.125 g M17 broth culture medium is weighed, dissolved in 400 ml of distilled water, the pH value is adjusted to 7.2 by 10 mol/L NaOH, the volume is adjusted to 500 ml, and autoclaving is performed), and standing and culturing at 30 ℃ overnight; in this step, lactococcus lactis transformed into pGAPA8149 empty vector (the transformation method was the same as in example 2) was used as a control;

2) centrifuging at 10000 rpm/min for 20 min after the culture is finished, taking the supernatant, filtering the supernatant by using a 0.22-micron filter membrane, adding N-sodium lauroyl sarcosine to the final concentration of 0.1%, and keeping the temperature at room temperature for 15 min;

3) adding trichloroacetic acid to a final concentration of 7.5%, mixing, and standing on ice for 2 h;

4) centrifuging at 10000 rpm/min for 10min, discarding the supernatant, adding 2 ml tetrahydrofuran, and centrifuging at 10000 rpm/min for 10 min;

5) centrifuging at 10000 rpm/min for 10min, discarding the supernatant, adding 2 ml tetrahydrofuran, and centrifuging at 10000 rpm/min for 10 min;

6) and (4) discarding the supernatant, airing, and adding 1ml of 8M urea for dissolving to obtain an induced expression protein sample.

3.2 electrophoresis

1) Preparing 10% SDS-PAGE gel;

2) adding a 5 xSDS-PAGE protein loading buffer solution with the concentration into the protein sample collected in the step 3.1, and heating for 5-10 min at 100 ℃;

3) after cooling to room temperature, directly loading the protein sample into an SDS-PAGE gel loading hole; performing electrophoresis at 100V for 90-120 min;

4) the SDS-PAGE gels were silver stained as per the Pierce silver staining kit (Thermo, # 24600).

The results are shown in FIG. 1B, which is an electrophoretic image of SDS-PAGE gels of the VEGFR3-D2 polypeptide specifically expressed by pGAPA8149 XVEGFR 3D 2 strain, wherein lane 1 is the supernatant of pGAPA8149 XVEGFR 3D 2 strain, i.e., the target band with a molecular weight of about 13 kDa (indicated by the arrow in FIG. 1B), and lane 2 is the supernatant of pGAPA8149 empty vector recombinant strain. As shown in FIG. 1B, the recombinant lactococcus lactis pGAPA8149 XVEGFR 3D 2 expressing the VEGFR3-D2 polypeptide can successfully induce and express VEGFR3-D2 polypeptide.

Following the above procedure, it was also verified that recombinant lactococcus lactis pGAPA8149 × VEGFR 2D 2 expressing VEGFR2-D2 polypeptide was also able to successfully induce the expression of VEGFR2-D2 polypeptide.

Example 4: antitumor effect of recombinant lactococcus lactis pGAPA8149 × VEGFR 3D 2

The example takes the recombinant lactococcus lactis pGAPA8149 × VEGFR 3D 2 expressing the VEGFR3-D2 polypeptide constructed in example 2 as an example to verify the anti-tumor effect, and takes the recombinant lactococcus lactis pGAPA8149 × VEGFR 2D 2 and VEGFR 3D 2 protein (obtained by inducing expression in example 3) injection constructed in example 2 as comparative examples, and specifically comprises the following steps.

4.1, molding: male BALB/c mice (purchased from Vitronlia) at 6 weeks of age were selected and injected with 1X 10 injections into the right axilla of mice⁵CT26 cells (mouse colon cancer cell line, purchased from Beijing coordination cell resource center) were measured for tumor size one week later until the tumor volume increased to 100 mm³Then, the administration can be started;

4.2, administration: the gavage dose of pGAPA8149 × VEGFR 3D 2 strain was: 10¹⁰Live bacteria/day (corresponding to VR3 oral probiotic bacteria); the gavage dose of pGAPA8149 × VEGFR 2D 2 strain was: 10¹⁰Live bacteria/day (corresponding to VR2 oral probiotic bacteria); the gavage dose of the pGAPA8149 no-load strain was: 10¹⁰Viable bacteria/day, as negative control (corresponding to PNZ bacteria)Strain control); the VEGFR3 protein injection was injected at the following doses: 25 μ g/day, injection sites: peritumoral subcutaneous (corresponding to VR3 protein injection); blank control was also set. Mice were dosed daily and tumor volume was measured every other day, after 10 consecutive days of dosing, mice were sacrificed and tumors were removed and weighed for statistics.

The results are shown in fig. 2A-D, where fig. 2A shows the tumor photographs of different mice after 10 days of different dosing treatments (blank control, gavage pGAPA8149 × VEGFR 3D 2 strain and pGAPA8149 empty strain), fig. 2B shows the tumor weight statistics of model mice after 10 days of different dosing treatments (blank control, gavage pGAPA8149 × VEGFR 3D 2 strain and pGAPA8149 empty strain), fig. 2C shows the tumor volume curves over time of model mice after different dosing treatments (blank control, gavage pGAPA8149 × VEGFR 3D 2 strain and pGAPA8149 empty strain), and fig. 2D shows the relative tumor inhibition rates of the model mice after 10 days of different dosing treatments (blank control, gavage pGAPA8149 × VEGFR 3D 2 strain, pGAPA8149 × 2D 2 strain and pGAPA8149 strain, and pGAPA 3 protein). As shown in FIGS. 2A-C, the tumor volume and tumor recurrence of mice in the pGAPA8149 × VEGFR 3D 2 strain group after administration were significantly lower than those in the pGAPA8149 null strain group, indicating that the pGAPA8149 × VEGFR 3D 2 strain had good in vivo anti-tumor effects. As shown in fig. 2D, compared to gavage pGAPA8149 × VEGFR 2D 2 strain and pGAPA8149 null strain, and injection of VEGFR3 protein, gavage pGAPA8149 × VEGFR 3D 2 strain to model mice was more able to significantly inhibit tumor growth in model mice. The pGAPA 8149X VEGFR 3D 2 strain provided by the invention can effectively combine the biological drug carrier lactococcus lactis and the VEGFR 3D 2 polypeptide, and the two polypeptides can play an excellent anti-tumor effect under the combined action.

Example 5: effect of recombinant lactococcus lactis pGAPA8149 × VEGFR 3D 2 on prolonging survival time of model mice

In this embodiment, the recombinant lactococcus lactis pGAPA8149 × VEGFR 3D 2 expressing VEGFR3-D2 polypeptide constructed in example 2 was used as an example to verify the effect of extending the survival time of model mice, and specifically includes the following steps.

5.1, molding: selecting 6 weeks oldMale BALB/c mice of (1X 10) were injected into the right underarm of the mice⁵CT26 cells (colon cancer cell line) are measured for tumor size after one week, and the tumor volume is increased to 100 mm³Then, the administration can be started;

5.2, administration: the gavage dose of pGAPA8149 × VEGFR 3D 2 strain was: 10¹⁰Live bacteria/day; the gavage dose of the pGAPA8149 no-load strain was: 10¹⁰Live bacteria/day; blank control was also set. Mice were dosed daily.

5.3, measurement: measuring the tumor volume every other day until the tumor volume reaches 1500 mm³(mice are considered dead), the mice are sacrificed and the number of surviving and dead groups of mice is counted.

The results are shown in fig. 3, and it can be seen that, compared with the pGAPA8149 no-load strain and blank control, pGAPA8149 × VEGFR 3D 2 strain can significantly prolong the survival time of mice, indicating that pGAPA8149 × VEGFR 3D 2 strain has a good effect of prolonging the survival time of tumor-bearing mice.

Example 6: anti-tumor mechanism of recombinant lactococcus lactis pGAPA8149 × VEGFR 3D 2

In this embodiment, the recombinant lactococcus lactis pGAPA8149 × VEGFR 3D 2 expressing VEGFR3-D2 polypeptide constructed in example 2 was used as an example to explore its anti-tumor mechanism, and specifically includes the following steps.

6.1, molding: selecting male BALB/c mice of 6 weeks old, injecting GFP-labeled CT26 cells (mouse colon cancer cell line) 1X 10 into right axilla of the mice⁵Measuring the size of the tumor after one week, randomly grouping according to the tumor volume, and starting administration;

6.2, administration: the gavage dose of pGAPA8149 × VEGFR 3D 2 strain was: 10¹⁰Viable bacteria/day; the gavage dose of the pGAPA8149 no-load strain was: 10¹⁰Live bacteria/day; blank control was also set. Mice were dosed daily and after 9 consecutive days, mice were sacrificed. Taking out tumor tissue, grinding, sieving, staining, detecting the percentage of immunocytes and tumor cells (CT 26-GFP) in each group of tumor tissue and various immunocytes in each group of tumor tissue with unit mass (g) by using a flow cytometer(macrophages, NK cells, NKT cells, DC cells and T cells).

The results are shown in fig. 4A-K, and it can be seen that pGAPA8149 × VEGFR 3D 2 strain was able to significantly reduce the percentage of tumor cells in tumor tissue and increase the percentage of immune cells in tumor tissue (shown in fig. 4A-B); wherein the ratio of DC cells to T cells is significantly up-regulated per mass (G) of tumor tissue (shown in FIGS. 4C-D), while macrophages, NK cells and NKT cells are not statistically different compared to the control group (shown in FIGS. 4E-G); among the DC cells, the proportion of cross-presenting DC cells and migratory DC cells was increased (shown in FIGS. 4H-I); among the T cells, the proportion of CD 8T cells (cytotoxic T cells and effector T cells) was increased (fig. 4J-K). The result shows that the pGAPA8149 XVEGFR 3D 2 strain can be obviously up-regulated by regulating DC cells, and further activates CD8⁺T cells, thereby exerting an antitumor effect.

The results of the embodiments show that the bacterial preparation expressing the VEGFR 3D 2 polypeptide provided by the present invention can combine a biological drug carrier with an anti-tumor polypeptide, and on one hand, the bacterial preparation expressing the VEGFR 3D 2 polypeptide provided by the present invention can be orally administered, and can stably express the VEGFR 3D 2 polypeptide in the intestinal tract and release the polypeptide, so that the VEGFC/VEGFR3 signal axis in LECs can be effectively inhibited through the intestinal tract immunization route, and further, the growth of a neonatal lymphatic vessel can be effectively inhibited, and thus, tumors can be effectively treated. In another aspect, the present invention provides a bacterial formulation that expresses VEGFR 3D 2 polypeptide, which upon administration induces a significant upregulation of immune cells, particularly DC cells and T cells, in a subject, wherein the predominance of cross-presenting DC cells and migratory DC cells is increased in DC cells and the predominance of CD 8T cells (cytotoxic T cells and effector T cells) is increased in T cells; therefore, the bacterial preparation expressing VEGFR 3D 2 polypeptide provided by the invention can also activate CD8 by inducing the remarkable up-regulation of DC cells in a subject⁺The mechanism of T cells exerts anti-tumor efficacy. Therefore, based on the bacterial preparation expressing VEGFR 3D 2 polypeptide provided by the invention, the anti-tumor drug taking lymphatic vessels as targets can be prepared, and the anti-tumor drug can pass through DC cells and/or through DC cellsGut immune-enhancing T cell activity, can be used to treat tumors including but not limited to the following types: gastric cancer, pancreatic cancer, lung cancer, liver cancer, colorectal cancer, breast cancer, nasopharyngeal cancer, cervical cancer, lymphoma, melanoma, renal cancer, esophageal cancer, oral squamous cell carcinoma, brain glioma, and head and neck cancer. In addition, the anti-tumor medicament provided by the invention can be prepared into the following dosage forms: tablets, granules, pills, capsules, oral liquid, suppositories, injection formulations (for example, formulations capable of delivering the antitumor drug to the intestinal tract by injection) and nasal spray formulations, so that the traditional mode of administration of the antitumor drug by intravenous injection can be converted into oral administration or intestinal administration, and the administration mode is simpler and more convenient.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art will understand that various changes, modifications and substitutions can be made without departing from the spirit and scope of the invention as defined by the appended claims. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> institute of animal research of Chinese academy of sciences

<120> bacterial preparation for expressing VEGFR 3D 2 polypeptide and construction method and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 222

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atcaacaagc ctgacacgct cttggtcaac aggaaggacg ccatgtgggt gccctgtctg 60

gtgtccatcc ccggcctcaa tgtcacgctg cgctcgcaaa gctcggtgct gtggccagac 120

gggcaggagg tggtgtggga tgaccggcgg ggcatgctcg tgtccacgcc actgctgcac 180

gatgccctgt acctgcagtg cgagaccacc tggggagacc ag 222

<210> 2

<211> 363

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaaaaaaa agattatctc agctatttta atgtctacag tgatactttc tgctgcagcc 60

ccgttgtcag gtgtttacgc tgatactaat tctgatttgg aaatatcgtc gacttgtgat 120

gctgacgatg acgataagat caacaagcct gacacgctct tggtcaacag gaaggacgcc 180

atgtgggtgc cctgtctggt gtccatcccc ggcctcaatg tcacgctgcg ctcgcaaagc 240

tcggtgctgt ggccagacgg gcaggaggtg gtgtgggatg accggcgggg catgctcgtg 300

tccacgccac tgctgcacga tgccctgtac ctgcagtgcg agaccacctg gggagaccag 360

taa 363

<210> 3

<211> 240

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aacaaaaaca aaactgtggt gattccatgt ctcgggtcca tttcaaatct caacgtgtca 60

ctttgtgcaa gatacccaga aaagagattt gttcctgatg gtaacagaat ttcctgggac 120

agcaagaagg gctttactat tcccagctac atgatcagct atgctggcat ggtcttctgt 180

gaagcaaaaa ttaatgatga aagttaccag tctattatgt acatagttgt cgttgtaggg 240

<210> 4

<211> 381

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaaaaaaa agattatctc agctatttta atgtctacag tgatactttc tgctgcagcc 60

ccgttgtcag gtgtttacgc tgatactaat tctgatttgg aaatatcgtc gacttgtgat 120

gctgacgatg acgataagaa caaaaacaaa actgtggtga ttccatgtct cgggtccatt 180

tcaaatctca acgtgtcact ttgtgcaaga tacccagaaa agagatttgt tcctgatggt 240

aacagaattt cctgggacag caagaagggc tttactattc ccagctacat gatcagctat 300

gctggcatgg tcttctgtga agcaaaaatt aatgatgaaa gttaccagtc tattatgtac 360

atagttgtcg ttgtagggta a 381

<210> 5

<211> 96

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaaaaaaa agattatctc agctatttta atgtctacag tgatactttc tgctgcagcc 60

ccgttgtcag gtgtttacgc tgatactaat tctgat 96

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttggaaatat cgtcgacttg tgatgct 27

<210> 7

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gacgatgacg ataag 15

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cttattgaga aagggaaacg acgg 24

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcaactgctg ctttttggct a 21

Claims

1. A bacterial preparation for expressing VEGFR 3D 2 polypeptide, which is characterized by comprising a recombinant expression vector which is transferred into bacterial thallus and expresses VEGFR 3D 2 polypeptide; wherein:

the recombinant expression vector comprises a skeleton plasmid and a gene for coding VEGFR 3D 2 polypeptide, wherein the nucleotide sequence of the gene for coding VEGFR 3D 2 polypeptide is shown as SEQ ID NO. 1, and the recombinant expression vector comprises the nucleotide sequence shown as SEQ ID NO. 2;

the bacterial cells are lactococcus lactis (A), (B)Lactococcus lactis) Or Escherichia coli (Escherichia coli）。

2. The bacterial formulation expressing VEGFR 3D 2 polypeptide of claim 1, wherein the backbone plasmid of the recombinant expression vector is any one selected from the group consisting of: pGAPA8149, pNZ8148, pNZ8149, pNZ8150, pNZ8151, pNZ8152, pNZ9530, pNZ8120, pNZ8121, pNZ8122, pNZ8123, pNZ8124, pNZ124, pNZ2105, pNZ2103, pNZ7021, pNZ2122, pNZ2123, pNZ2125, pNZ7025, pMG36e, pEPR, pLEISS, pLEB590, pPG611.1, pPG612.3871, pPG555, pSLP111.3, pSLP pIA β 5, pW425et, pW425t, pW425, pVA838, pMB1, pRM2, pDOJHR, pDOpHT 304, pH 04, pXM4625, pXMT 19, pWT 1525, pW425, pVA838, pPLIPT-PTS-980, pPLS-PIT-7375, pIPT-PIT-PIS-PIT-PIS.

3. A recombinant expression vector for expressing VEGFR 3D 2 polypeptide, wherein the recombinant expression vector comprises a nucleotide sequence as set forth in SEQ ID NO. 2.

4. A method of constructing a bacterial formulation that expresses VEGFR 3D 2 polypeptide, said method comprising the steps of:

s1: constructing a gene with a nucleotide sequence shown as SEQ ID NO. 2 into a skeleton plasmid to obtain a recombinant expression vector for expressing VEGFR 3D 2 polypeptide;

5. The use of the bacterial formulation of claim 1 or 2 expressing VEGFR 3D 2 polypeptide and the recombinant expression vector of claim 3 expressing VEGFR 3D 2 polypeptide in the preparation of an anti-tumor medicament, wherein the bacterial thallus of claim 1 or 2 is lactococcus lactis.

6. An antitumor agent comprising, as an active ingredient, the bacterial preparation according to claim 1 or 2 expressing VEGFR 3D 2 polypeptide, wherein the bacterial cell according to claim 1 or 2 is lactococcus lactis.

7. The antitumor agent as claimed in claim 6, wherein the dosage form of the antitumor agent comprises tablets, granules, pills, capsules, oral liquid, suppositories, injections and nasal sprays.

8. Antineoplastic drug according to claim 6 or 7, characterized in that said tumor comprises the following types: gastric cancer, pancreatic cancer, lung cancer, liver cancer, colorectal cancer, breast cancer, nasopharyngeal cancer, cervical cancer, lymphoma, melanoma, renal cancer, esophageal cancer, oral squamous cell carcinoma, brain glioma, and head and neck cancer.