CN1361286A - Construction and application of recombinant probiotics strain to express human endothelial cell inhibin - Google Patents
Construction and application of recombinant probiotics strain to express human endothelial cell inhibin Download PDFInfo
- Publication number
- CN1361286A CN1361286A CN 01130834 CN01130834A CN1361286A CN 1361286 A CN1361286 A CN 1361286A CN 01130834 CN01130834 CN 01130834 CN 01130834 A CN01130834 A CN 01130834A CN 1361286 A CN1361286 A CN 1361286A
- Authority
- CN
- China
- Prior art keywords
- endothelial cell
- gene
- human endothelial
- promotor
- usp45
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The present invention describes expression vector containing human endostatin gene, which is transferred via electrical transferring process into probiotics to obtain recombinant probiotic strain to express endostatin gene stably. One or several recombinant strains are fermentation treated to obtain oral preparation and the oral preparation is taken orally for in vivo expression of active endostatin. The expressed endostatin can inhibit the amplification of endodermal cell inside vessel and thus inhibit the growth of tumor vessel, so that it may be used in development of medicine for angioma formation in gstrointestinal tract and other entity.
Description
The recombinant probiotics strain and the application thereof that the present invention relates to contain the expression vector establishment of human endothelial cell inhibin gene, transform with this carrier.
Endostatin (Endostatin) is a kind of protein that suppresses vasculogenesis, can be used for preparing antitumor drug.It contains 183 amino-acid residues, and molecular weight is 18494D, is the C end fragment of collagen protein XVIII.Endostatin has the function that optionally suppresses endothelial cell division propagation and migration, thereby can suppress the formation inhibition primary tumor of new vessel and growth [Folkman J.et al.Cell, 1997 of metastatic tumor; 88:277-285.].Use endostatin treatment tumour and have advantages such as have no drug resistance and toxic side effect is few, can unite use, strengthen and after treatment effect [Thomas B..Nature, 1997 with radiation and chemotherapy; 390 (6658): 404].
Begun to utilize intestinal bacteria or saccharomycetes to make fermentation to produce endostatin at present abroad, subcutaneous or intravenous injection treatment tumour after extracting purifying.But there are some problems in the endostatin treatment tumour of using vitro recombination: 1) effective dose is very big, the cost height; 2) treatment cycle is long, and heavy dose of prolonged and repeated administration meeting causes allergic reaction etc.Therefore be necessary to develop the methods of treatment of convenient drug administration, high specificity, long action time.
We have invented and have transmitted activated human endothelial cell inhibin in vivo by experiment repeatedly, and are used for the treatment of the method for human gastrointestinal tract and other solid tumor.
Method of the present invention is at first human endothelial cell inhibin gene to be cloned on the expression vector of probiotic bacterium, and the electricity consumption method for transformation obtains to change the recombinant probiotics of human endothelial cell inhibin gene.Measure by protein hybridization and cytoactive, prove that the recombinant bacterial strain that obtains can produce activated human endothelial cell inhibin albumen really.By oral this recombinant probiotics, make probiotic bacterium continuous expression human endothelial cell inhibin albumen in enteron aisle then, suppress the generation of human intestinal and other solid tumor blood vessel, thereby reach the purpose of treatment human body solid tumor.
Also do not utilize milk-acid bacteria self carrier expressing human endothelial cell inhibin gene in milk-acid bacteria at present both at home and abroad, obtain stable, recombinant lactic acid bacteria and be used for the report of oncotherapy efficiently.The inventive method may further comprise the steps: make up the lactic acid bacteria expression vectors that has human endothelial cell inhibin gene 1..
1) colE1 and pAM β 1 replicon are arranged on the plasmid pLA136, in intestinal bacteria and milk-acid bacteria, can both duplicate, band
Galactococcus P59 promotor and galactococcus Usp45 signal peptide are arranged, human endothelial cell inhibin gene is inserted startup
Corresponding restriction enzyme site behind son and the signal peptide makes up the recombinant expression vector that has human endothelial cell inhibin gene
PLA147, and it is transferred among the Lactococcus lactis MG1363, the sustainable expression-secretion of this recombinant lactic acid bacteria arrives
The human endothelial cell inhibin that born of the same parents are outer
2) colE1 and pWV01 replicon are arranged on the plasmid pLA133, in intestinal bacteria and milk-acid bacteria, can both duplicate, band
Galactococcus NisA promotor and galactococcus Usp45 signal peptide are arranged.The human endothelial cell inhibin gene access is opened
Corresponding restriction enzyme site behind mover and the signal peptide makes up recombinant expressed year that has human endothelial cell inhibin gene
Body pLA148.But this carrier in milk-acid bacteria through inducing the expressing human endothelial cell inhibin gene, in the people of generation
The chrotoplast statin can be secreted into outside the born of the same parents.
3) colE1 and pWV01 replicon are arranged on the plasmid pLA1512, can in intestinal bacteria and milk-acid bacteria, duplicate,
Have galactococcus NisA promotor, induce the expression that can start downstream gene down at Nisin.Will be by PCR side
The human endothelial cell inhibin gene that method obtains inserts the corresponding restriction enzyme site after this plasmid promotor, construct through
Induce can be in lactic-acid bacteria cells the recombinant expression vector pLA175 of expressing human endothelial cell inhibin gene.
4) pAM β 1 replicon is arranged on the plasmid pNuc7, can in milk-acid bacteria, duplicate, have P59 promotor and Nuclease
Signal peptide.To insert this plasmid promotor and signal peptide by the human endothelial cell inhibin gene that PCR method obtains
After corresponding restriction enzyme site, construct can be in milk-acid bacteria recombinant expressed year of expressing human endothelial cell inhibin gene
Body pLA191.Because the foreign gene front has signal peptide in the constructed recombinant vectors, so people's endothelium of expressing
The cell statin can be secreted into outside the born of the same parents.
5) plasmid pFUN has colE1 and pAM β 1 replicon, can duplicate in intestinal bacteria and milk-acid bacteria, has breast
Coccus Usp45 promotor and Usp45 signal peptide insert human endothelial cell inhibin gene, structure behind signal peptide
Build recombinant expression vector pLA195.This carrier is sustainable expressing human endothelial cell inhibin gene in milk-acid bacteria,
The human endothelial cell inhibin albumen of expressing can be secreted to born of the same parents.2. obtain to stablize, efficiently express the recombinant bacterial strain of human endothelial cell inhibin.
With the above-mentioned corresponding expression vectors that contains human endothelial cell inhibin gene, method by the electricity conversion, change over to respectively in galactococcus, Bacterium lacticum, suis, faecalis and the staphylococcus, collect reorganization bacterium thalline and supernatant liquor, detect protein expression situation and biological activity thereof by protein hybridization, cell growth inhibition test.3. provide and produced reorganization galactococcus, Bacterium lacticum, suis, faecalis and staphylococcic method and the application thereof that has human endothelial cell inhibin gene.
Reorganization galactococcus and Bacterium lacticum leave standstill cultivation with GM17 and MRS substratum respectively, to having the recombinant bacterial strain of NisA promotor, when treating that it reaches growth logarithmic phase O.D. value and is 0.5 left and right sides, add inductor Nisin, induce 2-3 individual hour, gather in the crops thalline.To non-inductive recombinant bacterial strain, treat to gather in the crops when its growth arrives plateau.The bacterium that obtains can directly be prepared into oral liquid or capsule is made in the thalline freeze-drying.The present invention has the following advantages:
1. adopt probiotic bacterium oneself expression carrier, can the stability and high efficiency expression alien gene.
2. extracellular toxin in used probiotic bacterium such as galactococcus and Bacterium lacticum itself do not have, very safe to human body.
3. directly oral genetic engineering bacterium that can the expressing human endostatin need not pass through protein purification, this product
Production technique is simple, and cost is low.
4. milk-acid bacteria can be in human intestinal, and continuous expression endostatin over a period to come is directly in tumour
The local angiogenesis inhibitor medium that produces has higher specificity.Below by way of embodiments and drawings the present invention is described in further detail:
Fig. 1 is the building process of recombinant expression vector pLA147.Wherein P59 is that promotor, SPusp45 are signal peptide sequence.Fig. 2 is the building process of recombinant expression vector pLA148.Wherein PnisA is that promotor, SPusp45 are signal peptide sequence.Fig. 3 is the building process of recombinant expression vector pLA175.Wherein PnisA is a promotor.Fig. 4 is the building process of recombinant expression vector pLA191.Wherein P59 is that promotor, SPnuc are signal peptide sequence.Fig. 5 is the building process of recombinant expression vector pLA195.Wherein usp45 promoter is that promotor and signal peptide sequence, usp-Terminator are transcription terminator.
Embodiment 1: the structure of recombinant expression vector pLA147
According to the human collagen XVIII cDNA sequence of having delivered, the synthetic two sections primers of design
Upstream: 5 ' CATATGCATCTCACAGCCACCGCGACTTC 3 ' (29 base)
Downstream: 5 ' GGCATGCATTACTTGGAGGCAGTCATGAAGCT 3 ' (32 base)
Introducing the NsiI site respectively in two sections primers, is template with human collagen XVIII cDNA, in the pcr amplification people
The chrotoplast statin.
Reaction conditions is 94 ℃ of sex change 5 minutes, and below 94 ℃ of sex change of circulation are 1 minute, anneals 1 minute for 55 ℃, and 72 ℃ are prolonged
Stretched 1.5 minutes, totally 30 circulations.
PCR product flush end is directly connected into the pUC18 plasmid, transformed into escherichia coli, the external source fragment is inserted in blue hickie screening
Transformant, extract plasmid, obtain the pUC18-Endostatin plasmid.
With restriction enzyme NsiI digestion pUC18-Endostatin, the Endostatin fragment that obtains is connected to pLA136
The NsiI site of plasmid, electricity transforms Lactococcus lactis MG1363, and the transformant of screening erythromycin resistance extracts plasmid,
Cut evaluation through enzyme, pcr amplification and order-checking prove that Endostatin has inserted pLA136, and sequence is correct, reorganization matter
Grain called after pLA147.
Detailed process is seen Fig. 1 embodiment 2: the structure of recombinant expression vector pLA148
With restriction enzyme NsiI digestion pUC18-endostatin, the Endostatin fragment that obtains is connected to pLA133
The NsiI site of plasmid, electricity transforms Lactococcus lactis NZ9000, and the transformant of screening chlorampenicol resistant extracts plasmid,
Cut evaluation through enzyme, pcr amplification and order-checking prove that Endostatin has inserted pLA133, and sequence is correct, reorganization matter
Grain called after pLA148.
Detailed process is seen Fig. 2 embodiment 3: the structure of recombinant expression vector pLA175
According to human collagen XVIII cDNA sequence, the synthetic two sections primers of design
Upstream: 5 ' CATATGCATCACAGCCACCGCGACTTC 3 ' (27 base)
Downstream: 5 ' GGCGAATTCTACTTGGAGGCAGTCATGAAGCT 3 ' (32 base)
Introducing NsiI site and EcoRI site in two sections primers respectively, is template with pUC18-endostatin, and PCR expands
Increase Endostatin.
Reaction conditions is 94 ℃ of sex change 5 minutes, and below 94 ℃ of sex change of circulation are 1 minute, anneals 1 minute for 55 ℃, and 72 ℃ are prolonged
Stretched 1.5 minutes, totally 30 circulations.
The PCR product is connected with the AT carrier, transformed into escherichia coli, the segmental transformant of external source is inserted in blue hickie screening, extract plasmid, with restriction enzyme NsiI and EcoRI digestion, the pLA1512 plasmid that the Endostatin fragment and the same enzyme that obtain are cut is connected, and electricity transforms Lactococcus lactis NZ9000, the transformant of screening chlorampenicol resistant, extract plasmid, cut evaluation through enzyme, pcr amplification and order-checking, proof Endostatin correctly inserts pLA1512, recombinant plasmid called after pLA175.
Detailed process is seen Fig. 3 embodiment 4: the structure of recombinant expression vector pLA191
With restriction enzyme NsiI digestion pUC18-endostatin, the Endostatin fragment that obtains is connected to the NsiI site of pNuc7 plasmid, electricity transforms galactococcus MG1363, the transformant of screening erythromycin resistance, extract plasmid, cut evaluation and order-checking through enzyme, prove that Endostatin has inserted pNuc7, recombinant plasmid called after pLA191.
Detailed process is seen Fig. 4 embodiment 5: the structure of recombinant expression vector p LA195
Usp45 promotor, signal peptide and terminator with PCR method amplification galactococcus MG1363.
Be template at first,, in upstream primer and downstream primer, introduce restriction enzyme EcoRI and KpnI restriction enzyme site respectively according to known Usp45 gene promoter and signal peptide sequence design primer with galactococcus MG1363 genomic dna.
Upstream primer: 5 ' GAGAATTCTAATGTATAGTGTCACTCAGCACAGGC 3 ' (35 base)
Downstream primer: 5 ' AAGGGTACCTCAGCGTAAACACCTGACAACCGGGCTG 3 ' (37 base)
The PCR reaction conditions is 94 ℃ of sex change 5 minutes, and below 94 ℃ of sex change of circulation are 1 minute, anneals 1 minute for 65 ℃, and 72 ℃ were extended totally 30 circulations 1 minute.Amplification obtains Usp45 promotor and signal peptide fragment.Be template with galactococcus MG1363 genomic dna again,, in upstream primer and downstream primer, introduce restriction enzyme BamHI and XbaI enzyme cutting site respectively according to known Usp45 gene terminator sequences Design primer.Upstream primer: 5 ' CTGGATCCAAAAAAGTCTTAATAAATAAAAAATAG 3 ' (35 base) downstream primer: 5 ' AGTCTAGATATCATTTTTCCTTATTATTATACCAC 3 ' (35 base) reaction conditions is 94 ℃ of sex change 5 minutes, below 94 ℃ of sex change of circulation are 1 minute, annealed 1 minute for 55 ℃, 72 ℃ were extended totally 30 circulations 1 minute.Amplification obtains Usp45 terminator fragment.Earlier the Usp45 promotor and the signal peptide fragment that obtain are cut with restriction enzyme EcoRI and KpnI enzyme, the pUC18 that cuts with same enzyme is connected.Transformed into escherichia coli, screening has the transformant of amicillin resistance, extracts plasmid and identifies, confirms to obtain the pUC18-usp45 plasmid.The Endostatin fragment that to cut through restriction enzyme KpnI and BamHI enzyme, be connected to the corresponding restriction enzyme site of plasmid pUC18-usp45, transformed into escherichia coli, screening has the transformant of amicillin resistance, extract plasmid, enzyme is cut evaluation, confirms to obtain plasmid pUC18-usp45-endostatin.With restriction enzyme EcoRI and BamHI Usp45 promotor and Endostatin fragment are downcut from plasmid pUC18-usp45-endostatin, connect into the plasmid pFUN that same enzyme is cut, transformed into escherichia coli, screening has the transformant of ammonia benzyl resistance, extract plasmid, enzyme is cut evaluation, confirms to obtain pFun-usp-endostatin.The Usp45 terminator fragment that PCR method is obtained is with restriction endonuclease BamHI and XbaI enzyme cutting, the pFun-usp-endostatin that cuts with same enzyme is connected, transformed into escherichia coli, screening has the transformant of ammonia benzyl resistance, extract plasmid, enzyme is cut evaluation, confirms to obtain recombinant plasmid pFun-usp45 promoter-endostatin-usp45 terminator, called after pLA195.
Detailed process is seen Fig. 5 embodiment 6: adopt electrotransformation, above-mentioned several recombinant plasmids are changed in the galactococcus respectively.
With recombinant expression vector pLA147, pLA191, pLA195 respectively with Lactococcus lactis MG1363 competent cell mixing in electric revolving cup, electric shock is coated onto on the substratum that contains erythromycin, screening changes the bacterial strain of recombinant plasmid over to.Lactococcus lactis NZ9000 changes the Nisin resistant gene over to obtain in the MG1363 karyomit(e) engineering bacteria, can be under the condition that Nisin exists normal growth, the recombinant plasmid that will have the PnisA promotor changes among the NZ9000, can add Nisin and induce the plasmid expression foreign gene.With recombinant expression vector pLA148, pLA175 and Lactococcus lactis NZ9000 competent cell mixing in electric revolving cup, electric shock is coated onto on the substratum that contains paraxin respectively, and screening changes the bacterial strain of recombinant plasmid over to.Embodiment 7: adopt electrotransformation, above-mentioned several recombinant plasmids are changed in the Bacterium lacticum respectively.
With recombinant expression vector pLA147, pLA191, pLA195 respectively with lactobacterium casei competent cell mixing in electric revolving cup, electric shock is coated onto on the MRS substratum that contains erythromycin, cultivates in anaerobic box, screening changes the bacterial strain of recombinant plasmid over to.
Lactobacterium casei NY1000 changes the Nisin resistant gene over to obtain in the lactobacterium casei karyomit(e) engineering bacteria, can be under the condition that Nisin exists normal growth, the recombinant plasmid that will have the Pnis promotor changes among the NY1000, can add Nisin and induce the plasmid expression foreign gene.With recombinant expression vector pLA148, pLA175 and lactobacterium casei NY1000 competent cell mixing in electric revolving cup, electric shock is coated onto on the substratum that contains paraxin respectively, cultivates in anaerobic box, and screening changes the bacterial strain of recombinant plasmid over to.Embodiment 8: detect the expression of human endothelial cell inhibin gene in recombinant bacterial strain
The reorganization galactococcus, the Bacterium lacticum that obtain are left standstill cultivation respectively in containing corresponding antibiotic GM17 and MRS substratum.To having the recombinant bacterial strain of NisA promotor, when treating that it reaches growth logarithmic phase O.D. value and is 0.5 left and right sides,
Add inductor Nisin, induced the results thalline 2-3 hour.To non-inductive recombinant bacterial strain, treat to gather in the crops when it grows into plateau.Sample carries out the expression of protein hybridization identifier endostatin after routine is handled: at first carry out sds polyacrylamide gel electrophoresis, change film then, with the anti-human endothelial cell inhibin antibody hybridization of rabbit.
The results are shown in Figure 6.Embodiment 9: the bioactive mensuration of the human endothelial cell inhibin of expressing in the recombinant probiotics
Adopt human umbilical vein endothelial cell, be cultured on 96 well culture plates, cell concn is every milliliter of 25000 cells, every hole adds the recombinant human endothelial cell statin albumen of 1ng VEGF and 0.008ug to 1ug different concns, cultivates after 3 days and measures the activity that suppresses vascular endothelial cell proliferation by cell counting.
The results are shown in Figure 7.Embodiment 10: the application of recombinant bacterial strain.
Reorganization galactococcus, Bacterium lacticum leave standstill cultivation with GM17 and MRS substratum respectively, and the fermented liquid that obtains can directly prepare oral liquid; Or add protective material and make lyophilized powder, make capsule or tablet then; Offer tumour patient, suppress growth of tumor.
Claims (17)
1. method with probiotic bacterium expressing human endothelial cell inhibin gene, the feature of this method is that human endothelial cell inhibin gene is cloned on the expression vector of probiotic bacterium self, changes the recombinant probiotics strain that obtains the stably express human endothelial cell inhibin in the probiotic bacterium then over to.
2. probiotic bacterium described in the claim 1 is comprising Staphylococcus, lactococcus, lactobacillus, streptococcus and enterococcus spp.
3. the lactococcus described in the claim 2 is comprising Lactococcus lactis (Lactococcus lactis).
4. the lactobacillus described in the claim 2 is comprising lactobacterium casei (Lactobacillus casei).
5. the expression vector described in the claim 1 wherein comprises following from 5 ' to the 3 ' integral part that connects whole or in part:
A. promotor
B. signal peptide
C. human endothelial cell inhibin gene
D. transcription terminator
E. replication initiation
6. the described promotor of claim 5 is comprising being selected from galactococcus NisA gene, galactococcus P59 or galactococcus Usp45 promotor.
7. the described signal peptide of claim 5 is comprising the signal peptide that is selected from streptococcal nucleinase (Nuclease) gene or galactococcus Usp45 gene.
8. the described terminator of claim 5 is comprising the terminator that is selected from human papillomavirus E7 gene or galactococcus Usp45 gene.
9. described replication initiation of claim 5 is comprising being selected from milk-acid bacteria pWV01 or pAM β 1 replication initiation.
10. the expression vector described in the claim 1, comprising plasmid pLA147, pLA148, pLA175, pLA191, and pLA195.
11. the pLA147 of plasmid described in the claim 10 is characterized by and comprises following integral part:
The a.P59 promotor
The b.Usp45 signal peptide
C. human endothelial cell inhibin gene
D. milk-acid bacteria replicon pAM β 1
12. the described plasmid pLA148 of claim 10 is characterized by and comprises following integral part:
The a.NisA promotor
The b.Usp45 signal peptide
C. human endothelial cell inhibin gene
D. milk-acid bacteria replicon pWV01
13. the pLA175 of plasmid described in the claim 10 is characterized by and comprises following integral part:
The a.NisA promotor
B. human endothelial cell inhibin gene
C. milk-acid bacteria replicon pWV01
The d.E7 transcription terminator
14. the pLA191 of plasmid described in the claim 10 is characterized by and comprises following integral part:
The a.P59 promotor
The b.Nuclease signal peptide
C. human endothelial cell inhibin gene
D. milk-acid bacteria replicon pAM β 1
The e.Nuclease transcription terminator
15. the pLA195 of plasmid described in the claim 10 is characterized by and comprises following integral part:
The a.Usp45 promotor
The b.Usp45 signal peptide
C. human endothelial cell inhibin gene
D. milk-acid bacteria replicon pAM β 1
The e.Usp45 transcription terminator
16. with the recombinant probiotics strain of the described method acquisition of claim 1, comprising CGMCC NO.0614, CGMCC NO.0615, CGMCC NO.0616, CGMCC NO.0617, CGMCC NO.0618.
17. one or more probiotic bacteriums described in the claim 16 are after fermentative processing, can be used as oral preparations,, express activated human endothelial cell inhibin in vivo by oral, be used for medicine, can suppress tumor vascular growth as anti-gastrointestinal tract and other solid tumor vasculogenesis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 01130834 CN1361286A (en) | 2000-09-15 | 2001-08-27 | Construction and application of recombinant probiotics strain to express human endothelial cell inhibin |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN00124788 | 2000-09-15 | ||
| CN00124788.3 | 2000-09-15 | ||
| CN 01130834 CN1361286A (en) | 2000-09-15 | 2001-08-27 | Construction and application of recombinant probiotics strain to express human endothelial cell inhibin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1361286A true CN1361286A (en) | 2002-07-31 |
Family
ID=25739555
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 01130834 Pending CN1361286A (en) | 2000-09-15 | 2001-08-27 | Construction and application of recombinant probiotics strain to express human endothelial cell inhibin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1361286A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100374570C (en) * | 2004-07-07 | 2008-03-12 | 新疆农业科学院微生物应用研究所 | Electric conversion method of making shuttle plasmid guide into yellow brevibacterium |
| CN103103210A (en) * | 2013-01-31 | 2013-05-15 | 武汉工业学院 | Construction method and application of recombinant lactobacillus acidophilus for expressing glucagon-like peptide-2 |
| CN109706166A (en) * | 2018-12-28 | 2019-05-03 | 华子春 | A kind of Recombinant Lactococcus lactis and its construction method and application |
| CN114262683A (en) * | 2022-03-01 | 2022-04-01 | 中国科学院动物研究所 | Bacterial preparation for expressing VEGFR 3D 2 polypeptide and construction method and application thereof |
-
2001
- 2001-08-27 CN CN 01130834 patent/CN1361286A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100374570C (en) * | 2004-07-07 | 2008-03-12 | 新疆农业科学院微生物应用研究所 | Electric conversion method of making shuttle plasmid guide into yellow brevibacterium |
| CN103103210A (en) * | 2013-01-31 | 2013-05-15 | 武汉工业学院 | Construction method and application of recombinant lactobacillus acidophilus for expressing glucagon-like peptide-2 |
| CN103103210B (en) * | 2013-01-31 | 2015-03-04 | 武汉工业学院 | Construction method and application of recombinant lactobacillus acidophilus for expressing glucagon-like peptide-2 |
| CN109706166A (en) * | 2018-12-28 | 2019-05-03 | 华子春 | A kind of Recombinant Lactococcus lactis and its construction method and application |
| CN114262683A (en) * | 2022-03-01 | 2022-04-01 | 中国科学院动物研究所 | Bacterial preparation for expressing VEGFR 3D 2 polypeptide and construction method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1314705C (en) | Peptide for high performance inhibition of angiogenesis and method for preparing same and use thereof | |
| Huang et al. | Alteration of the gut microbiome and immune factors of grass carp infected with Aeromonas veronii and screening of an antagonistic bacterial strain (Streptomyces flavotricini) | |
| CN109837306A (en) | Contain the excretion body and its preparation method and application of miRNA-204-5p | |
| CN102741407A (en) | Transformation plasmid | |
| CN107574138A (en) | One plant of Escherichia coli antineoplastic target engineered strain and its construction method and application | |
| CN112501098A (en) | Engineering probiotics with phenylalanine degrading capability | |
| CN105624192A (en) | Preparation of mammary cancer cell strain capable of stably secreting near-infrared fluorescence labeled exosomes | |
| CN1407108A (en) | Genetic engineering recombination strain expression of lactoferritin and use thereof | |
| CN115820645A (en) | Method for preparing NK (natural killer) cells capable of silencing NKG2A genes and application of NK cells | |
| CN118222588A (en) | Attenuated toxoplasma vaccine strain, preparation method thereof and application thereof in resisting tumors | |
| CN1361286A (en) | Construction and application of recombinant probiotics strain to express human endothelial cell inhibin | |
| CN111518801B (en) | Constitutive lactobacillus promoter, recombinant vector, recombinant bacterium and application thereof | |
| CN103627711B (en) | RhIGF-1 recombinant lactic acid bacteria and application thereof | |
| CN103710351B (en) | Urogastron recombinant lactic acid bacteria and application thereof | |
| CN109593725A (en) | A kind of recombination mescenchymal stem cell and its application | |
| CN107858352B (en) | shRNA-cluster sequence, expression vector and application thereof | |
| CN113969292B (en) | Engineering probiotics for treating phenylketonuria and construction method and application thereof | |
| CN116837029A (en) | SINV vector for expressing IL-7 and GM-CSF and application thereof in preparation of antitumor drugs | |
| CN107502596A (en) | Express T cell and its application of the specificity TCRs of NY ESO 1 | |
| CN114540422A (en) | Preparation and application of mesenchymal stem cell exosome for delivering RNA (ribonucleic acid) medicament to damaged part in targeted manner | |
| CN115717120A (en) | Controllable growth engineering bacterium and construction method and application thereof | |
| CN110643623B (en) | Human soluble CD80 fusion gene transformed lactobacillus and application thereof | |
| CN1339583A (en) | Recombined smegmatis mycobacterium, its preparation and use in medicine for treating bladder tumor | |
| CN114958698A (en) | Attenuated salmonella recombinant engineering bacterium for expressing anti-PD 1 nano antibody and preparation method and application thereof | |
| CN111394295B (en) | Preparation of immobilized arginine deiminase and production thereof 14/15 N]Method for producing L-citrulline |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |