CN103710351B - Urogastron recombinant lactic acid bacteria and application thereof - Google Patents
Urogastron recombinant lactic acid bacteria and application thereof Download PDFInfo
- Publication number
- CN103710351B CN103710351B CN201310716679.XA CN201310716679A CN103710351B CN 103710351 B CN103710351 B CN 103710351B CN 201310716679 A CN201310716679 A CN 201310716679A CN 103710351 B CN103710351 B CN 103710351B
- Authority
- CN
- China
- Prior art keywords
- acid bacteria
- urogastron
- growth factor
- gene
- pig
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention provides a kind of encoding gene of Recombinant Swine Urogastron, the milk-acid bacteria containing described encoding gene and application thereof, belong to biological gene engineering field.Recombinant Swine Urogastron is a kind of very important peptide growth factor, in maintenance animal intestinal health, play very important effect, but equally with most genetically engineered veterinary drug there is turnout deficiency, expensive, product needs the problem such as purifying, administration difficulty.For obtaining a large amount of Recombinant Swine Urogastrons, the present invention adopts lactic acid bacteria expression system to carry out heterogenous expression to the Recombinant Swine epidermal growth factor gene after codon optimized, and utilizes above-mentioned recombinant lactic acid bacteria as active bacteria formulation or fodder additives to strengthen pig non-specific immunity.
Description
Technical field
The present invention relates to biological technical field, particularly a kind of milk-acid bacteria containing Urogastron, and the encoding gene of Urogastron through optimizing and albumen expression method and application in recombinant lactic acid bacteria.
Background technology
Animal intestinal is not only and maximumly in animal body is digested and assimilated organ, and be the final absorption place of all nutritive substances, be also immune organ maximum in body simultaneously, and intestine of young pigs healthy development is growth fast and the physiological foundation of high-survival rate.Newborn piglet is among Rapid development due to enteron aisle, structure and fuction imperfection, and digesting and assimilating of nutrient has significant limitation with immunization barrier function, is difficult to the change adapting to nutrition and environment, adds the difficulty of raising.Between Piglet at Lactation Period, high-caliber, can to promote intestinal growth and maturation somatomedin is all contained in colostrum and normal Ruzhong, as glutamine, Urogastron, insulin-like growth factor and polyamines etc., after wean, these factors disappear, to intestinal cells growth, differentiation and cell function growth produce detrimentally affect.
Urogastron (epidermalgrowthfactor, EGF) is a kind of very important peptide growth factor, in maintenance animal intestinal health, play very important effect.In enteron aisle, the secretion of digestive gland can be regulated, irritates nucous membrane hyperplasia, affect the transhipment of nutritive substance, and all play an important role in the maturation of intestinal tissue, regeneration and reparation are with process.Pig's epidermal growth factor is as one of higher somatomedin of pig Ruzhong content, and it has impact of crucial importance to newborn piglet gastrointestinal development.Early weaning is the important means shortening sow breeding cycle, and the ablactation stress that early weaning causes is the major cause affecting early-weaned piglets production performance, can alleviate ablactation stress by adding Urogastron in feed.Although pig's epidermal growth factor relies on the physicochemical property of its uniqueness and significant physiological action, as fodder additives, there is vast potential for future development, but the pig's epidermal growth factor produced at present is all obtain or utilize escherichia expression system to express gained from milk product, these two kinds of approach all have certain limitation, the amount being separated pig's epidermal growth factor from Ruzhong is limited, be difficult to meet market demand, and the pig's epidermal growth factor utilizing escherichia expression system to express, directly can not add as feed due to the colibacillary limitation of Host Strains and use, there is a difficult problem for separation and purification, add cost, be difficult to meet market demand.Therefore, develop effective, lower-cost pig's epidermal growth factor and will expand its application in pig-breeding and disease defence further.
Milk-acid bacteria (lacticacidbacteria, LAB) is a class fermentable carbohydrate and produces the general designation of the gram positive bacterium of a large amount of lactic acid.They are extensive in distributed in nature, very high with human lives's closely-related key areas using value in industry, agricultural and pharmaceutical industries etc.Milk-acid bacteria is widely used in the food industry, is to be acknowledged as safe (generallyrecognizedassafe, GRAS) food-grade microorganisms.Milk-acid bacteria is beneficial bacteria of intestinal tract, has different physiological roles, as controlled intestinal infection, anti-tumor activity etc., can also promote the immunity of small intestine local cells and humoral immunization.Utilize milk-acid bacteria to adhere to survival and the features such as not pathogenic in intestines and stomach, uropoiesis, reproductive system or mucosal sites, developed the research becoming protein and peptide drugs mucosa delivery delivery vehicle, receive and pay attention to widely.Therefore, contriver attempts adopting recombinant lactic acid bacteria to express pig's epidermal growth factor, and utilizes recombinant lactic acid bacteria to be applied to pig-breeding and disease prevention field as the drug delivery system of pig's epidermal growth factor.But, the mode that contriver directly proceeds to recombinant lactic acid bacteria with gene pool pig's epidermal growth factor gene through experiment trial expresses pig's epidermal growth factor, but due to species variation, the expression amount of pig's epidermal growth factor is extremely low, therefore needs to find out the pig's epidermal growth factor gene be more suitable for.
Summary of the invention
Technical problem to be solved by this invention is: first, is to provide a kind of pig's epidermal growth factor gene being more suitable for lactic acid bacteria expression system and expressing; Secondly, be develop effective, lower-cost Urogastron form of administration or route of administration.
Therefore, an object of the present invention is to provide a kind of gene of Recombinant Swine Urogastron of encoding, described gene is:
1) nucleotide sequence as shown in SEQIDNO:1; Or
2) there is the homology of more than 90% and the nucleotide sequence of Recombinant Swine Urogastron of encoding with the nucleotide sequence shown in SEQIDNO:1.
Present invention also offers a kind of plasmid containing the gene of coding Recombinant Swine Urogastron described above.Described plasmid is preferably prokaryotic expression plasmid.Most preferably be PCYT plasmid.
Present invention also offers a kind of lactic bacterium strains including plasmid described above.Described milk-acid bacteria is Lactococcus lactis, plant lactobacillus lactis, lactobacillus bulgaricus, lactobacterium helveticus, Lactobacterium acidophilum, lactobacterium casei, lactobacillus reuteri or lactobacillus fermentum.Preferably, described bacterial strain is Lactococcus lactis, and preferred described bacterial strain is Lactococcus lactis L.lactisNZ9000.
Present invention also offers a kind of expression method of Recombinant Swine Urogastron, comprise the steps:
1) with lactic bacterium strains inoculation culture described above, add Nisin and carry out abduction delivering;
2) Recombinant Swine egf protein is collected.
Present invention also offers lactic bacterium strains described above and prepare the novelty teabag in food and animal-feed.
Present invention also offers a kind of animal-feed containing milk-acid bacteria, described milk-acid bacteria is can the recombinant lactic acid bacteria of the express cell factor.Be the recombinant lactic acid bacteria can expressing pig's epidermal growth factor as preferred described milk-acid bacteria.
Beneficial effect of the present invention mainly contains:
The present invention utilizes milk-acid bacteria as the advantage of beneficial bacteria of intestinal tract, has prepared the recombinant lactic acid bacteria of expressing pig's epidermal growth factor.This recombinant lactic acid bacteria even directly can add in feed without inactivation treatment, and after pig feed, this recombinant lactic acid bacteria can in enteron aisle internal breeding, and stable expression Urogastron, effective promotion live pig intestinal growth, thus improve pig growth speed, bring good economic benefit.Also reduce the cost of manufacture containing pig's epidermal growth factor feed to a great extent simultaneously.Based on theory of the present invention, the milk-acid bacteria that also can add the Urogastron containing other sources is completely prepared into corresponding source animal feed or even people's food.
Pig's epidermal growth factor expressed in situ in chitling road that the present invention expresses, avoids the separation and purification process of the complexity needed for traditional Urogastron preparation process, loaded down with trivial details, high cost, has greatly saved the preparation cost of Urogastron.
Pig's epidermal growth factor provided by the invention is expressed by recombinant lactic acid bacteria and effectively promotes live pig intestinal growth in enteron aisle, improves pig growth speed.The submission mode of this Urogastron is low relative to cost, more easily accepts, and without invasive.Meanwhile, so also can avoid directly taking the former albumen of Urogastron and the loss in Digestive tract caused as far as possible.
In addition, milk-acid bacteria self, as a kind of common pig feed addictive, can improve pigling immunity, promotes the quick formation of normal intestinal flora.This just from inhibit pernicious bacteria in the breeding of enteron aisle on the one hand in addition, prevents the generation of grice diarrhoea and other gastrointestinal tract disease to a certain extent.
Accompanying drawing explanation
Fig. 1 represents that Recombinant Swine Urogastron optimizes front and back nucleotide sequence comparison.
Wherein, even number line (row that namely " original series " is corresponding) is pig's epidermal growth factor natural gene nucleotide sequence, i.e. codon optimized front sequence; Odd-numbered line (i.e. " majorizing sequence " corresponding row) is the gene nucleotide series of Recombinant Swine Urogastron of the present invention, the sequence after namely codon optimized.
Fig. 2-a, Fig. 2-b are the restructuring codon optimized front and back of pig's epidermal growth factor CAI index in milk-acid bacteria expressive host.
Wherein, Fig. 2-a represent pig's epidermal growth factor natural gene nucleotides sequence to be listed in milk-acid bacteria expressive host CAI index through program computation be 0.48; Recombinant Swine Urogastron codon of the present invention after Fig. 2-b represents optimization in milk-acid bacteria expressive host CAI index through program computation be 0.94.
Fig. 3-a, Fig. 3-b are the codon optimized front and back of pig's epidermal growth factor optimal codon frequency distribution areal maps in milk-acid bacteria expressive host.
Wherein, Fig. 3-a represents that pig's epidermal growth factor natural gene nucleotides sequence is listed in optimal codon frequency distribution areal map in milk-acid bacteria expressive host, as can be seen from the figure: the poor efficiency codon of pig's epidermal growth factor natural gene nucleotide sequence occurs that per-cent is 54%; Fig. 3-b represents the Recombinant Swine Urogastron codon of the present invention optimal codon frequency distribution areal map in milk-acid bacteria expressive host after optimization, and the poor efficiency codon of the Recombinant Swine Urogastron Codon sequences of the present invention after optimization occurs that per-cent is 1%.
Fig. 4-a, Fig. 4-b are the restructuring codon optimized front and back of pig's epidermal growth factor average GC base contents distributed areas figure in milk-acid bacteria expressive host.
Wherein, Fig. 4-a represents that pig's epidermal growth factor natural gene nucleotides sequence is listed in average GC base contents in milk-acid bacteria expressive host and is: 52.93%; Recombinant Swine Urogastron codon of the present invention after Fig. 4-b represents optimization average GC base contents in milk-acid bacteria expressive host is: 32.63%.
Fig. 5-a, Fig. 5-b are the secondary structure prediction figure of the codon optimized front and back mRNA of restructuring pig's epidermal growth factor.
The secondary structure prediction figure of Fig. 5-a pig's epidermal growth factor natural gene mRNA, Fig. 5-b be codon optimized after the secondary structure prediction figure of Recombinant Swine Urogastron mRNA of the present invention.
Fig. 6 is restructuring pig's epidermal growth factor expression plasmid building process figure.
Fig. 7 is the agarose gel electrophoresis figure of restructuring pig's epidermal growth factor gene PCR primer.
Wherein, swimming lane 1 is 500bpDNALadder; Swimming lane 2 is for containing the Recombinant Swine epidermal growth factor gene PCR primer of NsiI and XhoI restriction enzyme site in two ends.
Fig. 8 is that the enzyme of expression vector PCYT-poEGF cuts qualification figure.
Wherein, swimming lane 1 is 500bpDNALadder; Swimming lane 2 is the electroresis appraisal figure of NsiI and XhoI double digestion PCYT-poEGF carrier.
Fig. 9 is the Activity determination (mtt assay) that restructuring pig's epidermal growth factor urgees BALB/3T3 cells propagation.Experimental result shows, and compared with negative control, the pig's epidermal growth factor that the present invention expresses can obviously promote that BALB/3T3 cells is bred.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further, should be understood that quoting embodiment is only not used in for illustration of the present invention and limits the scope of the invention.
The gene optimization design of embodiment 1 Recombinant Swine Urogastron
Contriver is according to the published pig's epidermal growth factor (epidermalgrowthfactor of GenBank, EGF) cDNA sequence (GenBank accession number: NP_999185.1), to this gene carry out codon optimized after obtain Recombinant Swine epidermal growth factor gene of the present invention, as shown in SEQIDNo:1.Here is carried out codon optimized to pig's epidermal growth factor gene, and before and after optimizing, each parameter comparison is as follows:
1. codon adaptation indexI (CodonAdaptationIndex, CAI)
From Fig. 2-a, before codon is not optimized, pig's epidermal growth factor gene codon adaptation indexI (CAI) in milk-acid bacteria is 0.48.From Fig. 2-b, after codon optimized, pig's epidermal growth factor gene of the present invention CAI index in milk-acid bacteria is made to be 0.94.Be considered to this gene during usual CAI=1 is optimal high expression state in this expression system, CAI index is lower shows that this gene expression level in this host is poorer, therefore can find out have passed through codon optimized after the gene order that obtains can improve the expression level of pig's epidermal growth factor gene in milk-acid bacteria.
2. optimal codon frequency of utilization (FrequencyofOptimalCodons, FOP)
From Fig. 3-a, based on lactic acid bacteria expression vectors, before codon is not optimized, the poor efficiency codon of pig's epidermal growth factor gene sequence occurs that per-cent is 54%.This gene be not optimized contains series connection rare codon, and these codons may reduce translation efficiency, even can dismiss translation assemblage.From Fig. 3-b, after codon optimized, pig's epidermal growth factor gene of the present invention occurs that in milk-acid bacteria system the frequency of poor efficiency codon is 1%.
3.GC base contents (GCcurve)
GC content ideal distribution region is 30%-70%, all can affect to some extent transcribe and translation efficiency at this any peak of extra-regional appearance.Contrasted from the GC base average content distributed areas figure of the pig's epidermal growth factor gene of Fig. 4-a, Fig. 4-b, be 52.93% by showing in pig's epidermal growth factor gene GC base average content before optimization in figure, by show in Fig. 4-b be finally optimized after the GC base average content of heavy pig's epidermal growth factor gene be 32.63%, be more conducive to the expression of pig's epidermal growth factor gene.
4. before and after optimizing, cis-acting elements situation is as follows:
| Cis-acting elements | After optimization | Before optimization |
| Binding site (GGTAAG) | 0 | 0 |
| Binding site (GGTGAT) | 0 | 0 |
| PolyA(AATAAA) | 0 | 0 |
| PolyA(ATTAAA) | 0 | 0 |
| Unstable sequence (ATTTA) | 0 | 0 |
| PolyT(TTTTTT) | 0 | 0 |
| PolyA(AAAAAAA) | 0 | 1 |
5. optimize before and after the palindrome and tumor-necrosis factor glycoproteins situation as follows:
| After optimization | Before optimization | |
| Maximum direct repeat | None | Size:8Distance:78Frequency:2 |
| Maximum reverse tumor-necrosis factor glycoproteins | None | None |
| Maximum subtend tumor-necrosis factor glycoproteins | None | None |
The secondary structure prediction figure of 6.mRNA
After DNA is transcribed into mRNA, because mRNA is strand linear molecule, by folded back on itself, complementary base pair is met, by the hairpin structure (Hairpin) of hydrogen bonded.5 ' hairpin structure can play regulating and controlling effect in the translation initiation stage.If but hairpin structure is very long, the required energy that unwinds is very high, just likely has influence on translation.So need the sequence expressed should avoid long and that energy is high hairpin structure as far as possible.After codon optimized, from the secondary structure prediction figure of Fig. 5-a, the codon optimized front and back mRNA of Fig. 5-b pig's epidermal growth factor, 5 ' hairpin structure after optimization and the required energy that unwinds are more suitable for the expression of target protein.
The expression plasmid of embodiment 2 Recombinant Swine epidermal growth factor gene builds
By the fragment that the Recombinant Swine Urogastron full genome (as shown in SEQIDNo:1) after optimizing synthesizes, be building up in pUC57 plasmid (purchased from Nanjing Jin Sirui Science and Technology Ltd.), obtain one and preserve plasmid for a long time, be designated as pUC57-poEGF plasmid.With pUC57-poEGF plasmid for template, upstream and downstream primer introduces NsiI and XhoI restriction enzyme site respectively, carries out pcr amplification, and the primer sequence is as follows:
Upstream primer:
P1：GCCATGCATTGAATTCTTATTCTG
Downstream primer:
P2：GTTCTCGAGTTATCTAAGTTCCCAC
Reaction cumulative volume 50 μ L, wherein concentration is that 10 μm of ol/L primers respectively add 2.5 μ L, and concentration is that the dNTP of 10mmol/L adds 1 μ L, and archaeal dna polymerase PhusionHigh-FidelityDNApolymerase(used is purchased from Theromo-Fisherscientific), 2U/ μ L, adds 0.5 μ L.Reaction conditions is 98 DEG C of 5s, 56 DEG C of 30s, 72 DEG C of 15s, and after 25 circulations, product is through 1.0% agarose gel electrophoresis analysis, and result display product size is consistent with expection size (159bp).(as shown in Figure 7)
The gene product DNA gel obtained is reclaimed test kit (purchased from Beijing Tian Gen biochemical technology company limited) purifying.After purifying, with NsiI and XhoI(purchased from NewEnglandBiolabs company) double digestion, be connected in PCYT plasmid (purchased from Chinese plasmid vector strain cell pnca gene preservation center) with T4 ligase enzyme (purchased from NewEnglandBiolabs company), be transformed in bacillus coli DH 5 alpha competent cell (purchased from Beijing Tian Gen biochemical technology company limited), 37 DEG C of overnight incubation in the LB solid medium of the paraxin (purchased from Amersco company) containing 25 μ g/mL.Screening positive clone bacterium order-checking in second day, extracts plasmid, and enzyme cuts rear electrophoresis qualification target stripe size correct (as shown in Figure 8).Through order-checking, completely the same with expected sequence, namely obtain the expression plasmid of Recombinant Swine Urogastron, be designated as PCYT-poEGF.
The competent preparation of embodiment 3 Lactococcus lactis and conversion
1, the preparation of Lactococcus lactis bacterium competence cell
To store L.lacticsNZ9000 glycerol stock (purchased from Chinese plasmid vector strain cell pnca gene preservation center) and be inoculated in 10mLGM17 substratum (rich biological purchased from sea, Qingdao), 30 DEG C of overnight stand are cultivated.1mL overnight culture is inoculated in 50mL containing in the SGM17 substratum (rich biological purchased from sea, Qingdao) of 2.5% glycine, 30 DEG C of quiescent culture are to OD
600value is about 0.5, ice bath, washs thalline, then use OSPS damping fluid re-suspended cell with OSPS damping fluid (0.5M sucrose, 10% glycerine), preserves or directly uses for-70 DEG C.
2, the electricity of Lactococcus lactis transforms
Plasmid PCYT-poEGF and Lactococcus lactis bacterium competence cell are mixed in electricity conversion cup, use 2500V(electric capacity 25 μ, resistance 200 Ω) pulse output, electricity transforms Lactococcus lactis.By the thalline after conversion, add the SMG17MC(GM17+20mMCaCl of precooling
2+ 2mMMgCl
2), 30 DEG C of stationary incubation 2h.Washed cell, coating is containing the GM17 agarose solid medium of paraxin (7.5mg/mL).
The flat board of coating after transforming there is the positive colony of chloramphenicol resistance.Single colony inoculation will be recombinated in the liquid GM17 substratum containing paraxin (final concentration 7.5 μ g/mL), 30 DEG C of constant temperature quiescent culture spend the night, be transferred to fresh the containing in the liquid GM17 substratum of paraxin (final concentration 7.5 μ g/mL) of 5mL by the inoculum size of 1% again, Nisin(is purchased from Sigma) induce the expression detecting pig's epidermal growth factor.
The expression of embodiment 4 Recombinant Swine Urogastron in milk-acid bacteria and assay
By the Lactococcus lactis Recombinant Swine Urogastron expression strain that builds with the inoculum size incubated overnight of 1:100, within second day, get nutrient solution to inoculate by 3:100, the Nisin adding 50ng/mL after 4h carries out abduction delivering, after induction 5h, by bacterium liquid in 4 DEG C of centrifugal 5min of 4000rgm, wash thalline 3 times with the PBS damping fluid of precooling; Thalline after collection is placed in and stirs 20min on ice.With the broken thalline of probe type ultrasonication ripple instrument, sample is placed on ice, ultrasonic 120 times, each 5s interval 5s, circulates three times, is circulated between cooling sample at every turn and waits for 2min, wait for sample cooling.
The content of Recombinant Swine Urogastron measures by ELISA kit (pig's epidermal growth factor test kit, purchased from Dong Ge bio tech ltd, Beijing).The standard step operation that measuring method provides according to test kit.By detecting, recording Nisin abduction delivering group every gram of wet thallus expression EGF is 1.2ug; And the control group not adding Nisin induction is not expressed.
Embodiment 5 milk-acid bacteria expresses Recombinant Swine Urogastron Determination of biological activity
The present invention measures its biologic activity by detecting the proliferation function of Recombinant Swine Urogastron to BALB/3T3 cells.Cell strain used is BALB/3T3 cells (inoblast of mouse, purchased from Shanghai cell institute of the Chinese Academy of Sciences).BALB/3T3 cells is cultivated on 24 orifice plates according to the concentration in 50000/hole.After 12h, add the 50uL detected sample (PCYT-poEGF) or negative control (PCYT-NUC prepared by embodiment 4 method, wherein NUC is the nucleic acid-protein enzyme gene of milk-acid bacteria, and as unrelated protein control group in this research, the preparation method of control sample is consistent with embodiment 4).After 24h, adding MTT(final concentration is 500ug/ml, purchased from Sigma), continue to hatch 4h, stop cultivating, careful suction abandons culture supernatant in hole.Inhale again after centrifugal for suspension cell needs and abandon culture supernatant in hole.Every hole adds 400uLDMSO, and vibration 10min, makes crystallisate fully melt.Select 490nm wavelength, enzyme linked immunological monitor measures each hole absorbance value, and light absorption value larger explanation cell viability is stronger, and proliferation is more obvious.
As seen from Figure 9, the propagation of PCYT-poEGF energy obvious stimulation BALB/3T3 cells, and negative control group (PCYT-NUC) is bred not obvious.This illustrates, the pig's epidermal growth factor that Lactococcus lactis is expressed has biologic activity.The milk-acid bacteria preparation technology of expression pig's epidermal growth factor prepared by the present invention is simple, do not need through loaded down with trivial details separation purifying technique, recombinant lactic acid bacteria is fed in the mode of fodder additives the intestinal growth that live pig can promote pig, thus increases the speed of growth, have broad application prospects.
Claims (9)
1. encode the gene of Recombinant Swine Urogastron, it is characterized in that, described gene is the nucleotide sequence such as shown in SEQIDNO:1.
2. one kind contains the plasmid of the gene of Recombinant Swine Urogastron of encoding as claimed in claim 1.
3. plasmid as claimed in claim 2, it is characterized in that, described plasmid is PCYT.
4. one kind contains the lactic bacterium strains of plasmid as claimed in claim 2.
5. lactic bacterium strains as claimed in claim 4, it is characterized in that, described bacterial strain is Lactococcus lactis.
6. lactic bacterium strains as claimed in claim 4, it is characterized in that, described bacterial strain is Lactococcus lactis NZ9000.
7. an expression method for Recombinant Swine Urogastron, comprises the steps:
1) with lactic bacterium strains inoculation culture according to any one of claim 4 to 6, add Nisin and carry out abduction delivering;
2) Recombinant Swine egf protein is collected.
8. the lactic bacterium strains according to any one of claim 4 to 6 is preparing the novelty teabag in animal-feed.
9. the animal-feed containing milk-acid bacteria, it is characterized in that, described milk-acid bacteria is the lactic bacterium strains such as according to any one of claim 4 to 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310716679.XA CN103710351B (en) | 2013-12-23 | 2013-12-23 | Urogastron recombinant lactic acid bacteria and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310716679.XA CN103710351B (en) | 2013-12-23 | 2013-12-23 | Urogastron recombinant lactic acid bacteria and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103710351A CN103710351A (en) | 2014-04-09 |
| CN103710351B true CN103710351B (en) | 2015-12-09 |
Family
ID=50403708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310716679.XA Active CN103710351B (en) | 2013-12-23 | 2013-12-23 | Urogastron recombinant lactic acid bacteria and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103710351B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104031962A (en) * | 2014-05-05 | 2014-09-10 | 四川农业大学 | Optimized pEGF gene engineering Lactococcus lactis fermentation medium |
| CN106337054A (en) * | 2016-08-22 | 2017-01-18 | 四川华德生物工程有限公司 | Method for preparing high activity recombinant porcine epidermal growth factor |
| CN107325998A (en) * | 2017-06-20 | 2017-11-07 | 江西嘉博生物工程有限公司 | A kind of Recombinant Lactococcus lactis and construction method for expressing pig's epidermal growth factor gene |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004001020A2 (en) * | 2002-06-19 | 2003-12-31 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Methods and means to promote gut absorption |
| CN101284021A (en) * | 2007-04-09 | 2008-10-15 | 康贝株式会社 | Villi elongation agent |
| CN103014010A (en) * | 2012-12-11 | 2013-04-03 | 深圳比利美英伟营养饲料有限公司 | Artificial porcine epidermal growth factor eukaryotic expression vector and preparation method and brewers yeast engineering bacteria thereof |
| CN103146738A (en) * | 2013-01-31 | 2013-06-12 | 武汉工业学院 | Construction method and purpose of recombinant lactobacillus acidophilus expressing pig epidermal growth factors |
-
2013
- 2013-12-23 CN CN201310716679.XA patent/CN103710351B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004001020A2 (en) * | 2002-06-19 | 2003-12-31 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Methods and means to promote gut absorption |
| CN101284021A (en) * | 2007-04-09 | 2008-10-15 | 康贝株式会社 | Villi elongation agent |
| CN103014010A (en) * | 2012-12-11 | 2013-04-03 | 深圳比利美英伟营养饲料有限公司 | Artificial porcine epidermal growth factor eukaryotic expression vector and preparation method and brewers yeast engineering bacteria thereof |
| CN103146738A (en) * | 2013-01-31 | 2013-06-12 | 武汉工业学院 | Construction method and purpose of recombinant lactobacillus acidophilus expressing pig epidermal growth factors |
Non-Patent Citations (4)
| Title |
|---|
| Ping Kang et al.Epidermal growth factor-expressing Lactococcus lactis enhances intestinal development of early-weaned pigs.《The Journal of Nutrition》.2010,806-811. * |
| Queenie CK Cheung et al.Generation of epidermal growth factor-expressing Lactococcus lactis and its enhancement on intestinal development and growth of early-weaned mice.《Am J Clin Nutr》.2009,摘要、第872页左栏第3段、图2. * |
| 李树民 等.优化密码子提高EGF-PE35KDEL表达量.《中国生物制品学杂志》.2005,第18卷107-110. * |
| 槐玉英 等.重组生长因子对早期断奶仔猪小肠黏膜形态和二糖酶活性的影响.《畜牧与兽医》.2013,72-75. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103710351A (en) | 2014-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102741407B (en) | Transformation plasmid | |
| CN103710351B (en) | Urogastron recombinant lactic acid bacteria and application thereof | |
| CN103146738B (en) | Construction method and purpose of recombinant lactobacillus acidophilus expressing pig epidermal growth factors | |
| CN103627711B (en) | RhIGF-1 recombinant lactic acid bacteria and application thereof | |
| CN109548955A (en) | A kind of additive for farm animal feed and preparation method thereof | |
| CN109549024A (en) | A kind of fish feed additive and preparation method thereof | |
| CN103571776B (en) | The bacterial strain of high bile tolerance ability and bile salt hydrolase gene | |
| CN1407108A (en) | Genetic engineering recombination strain expression of lactoferritin and use thereof | |
| CN103602603A (en) | Preparation method of bovine lactoferricin pichia pastoris engineering bacterium | |
| CN102220276B (en) | Genetic engineering bacteria generating bile salt hydrolase as well as construction method and application thereof | |
| CN102329766A (en) | Recombination food-grade lactic acid bacterium capable of being used for preventing or treating human ulcerative colitis as well as preparation method and application of recombination food-grade lactic acid bacterium | |
| CN101638665B (en) | Construction and usage of lactobacillus single-plasmid Nisin inducible expression vector | |
| CN103012577B (en) | Recombinant porcine interleukin 4, and encoding gene and expression method thereof | |
| CN103265637B (en) | A kind of Recombinant Swine IL-4-Fc fusion rotein and encoding gene thereof and expression method | |
| CN107287176A (en) | A kind of high temperature resistant neutral phytase Physh-A and its gene and application | |
| CN103012578B (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
| CN108041319B (en) | Chicken alpha interferon-containing composite probiotic and preparation method thereof | |
| CN103103210B (en) | Construction method and application of recombinant lactobacillus acidophilus for expressing glucagon-like peptide-2 | |
| CN103060219A (en) | Manufacturing method of fermented milk beverage and Lactobacillus casei used by same | |
| CN102363762A (en) | Modified bacillus source and Alpha-amylase gene recombination lactobacillus as well as product and application thereof | |
| CN110607306A (en) | Expression method of recombinant porcine epidermal growth factor | |
| CN103689247B (en) | A kind of expression lactoferrin recombination lactic acid bacteria composition as delactational piglets feed addictive | |
| CN105349564B (en) | A method of enhancing lactic acid bacteria bile tolerant ability | |
| CN101985630B (en) | Recombinant Lactobacillus acidophilus for expressing highly pathogenic avian influenza virus H5 subtype hemagglutinin (HA) protein | |
| CN1361286A (en) | Construction and application of recombinant probiotics strain to express human endothelial cell inhibin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP02 | Change in the address of a patent holder |
Address after: 213125 Jiangsu city of Changzhou Province Cloud River New District No. 518 Changzhou Qianhong biochemical pharmaceutical biological all red Patentee after: ZonHon Biopharma Institute Inc. Patentee after: Changzhou Qianhong Biopharma Co., Ltd. Address before: 213022 the Yellow River Middle Road, Xinbei District, Jiangsu, China, No. 132, No. Patentee before: ZonHon Biopharma Institute Inc. Patentee before: Changzhou Qianhong Biopharma Co., Ltd. |
|
| CP02 | Change in the address of a patent holder |
Address after: 213125, Yunhe Road, Xinbei District, Jiangsu, Changzhou, 518 Co-patentee after: Changzhou Qianhong Biopharma Co., Ltd. Patentee after: ZonHon Biopharma Institute Inc. Address before: 213125 Jiangsu city of Changzhou Province Cloud River New District No. 518 Changzhou Qianhong biochemical pharmaceutical biological all red Co-patentee before: Changzhou Qianhong Biopharma Co., Ltd. Patentee before: ZonHon Biopharma Institute Inc. |
|
| CP02 | Change in the address of a patent holder |