CN111518801B

CN111518801B - Constitutive lactobacillus promoter, recombinant vector, recombinant bacterium and application thereof

Info

Publication number: CN111518801B
Application number: CN201910288779.4A
Authority: CN
Inventors: 金万洙
Original assignee: Institute of Zoology of CAS
Current assignee: Institute of Zoology of CAS
Priority date: 2019-04-11
Filing date: 2019-04-11
Publication date: 2021-05-28
Anticipated expiration: 2039-04-11
Also published as: CN111518801A

Abstract

The invention provides a constitutive lactobacillus promoter, a recombinant vector, recombinant bacteria and application thereof, and belongs to the field of genetic engineering. The promoter P provided by the invention_gapAThe nucleotide sequence of (A) is shown in SEQ ID No. 1. The promoter P_gapACan start the high-efficiency expression of downstream genes in lactic acid bacteria, and the protein expression activity is obviously higher than that of the traditional inducible P_NisinAIs an ultra-efficient promoter. The protein expression frame, the expression vector and the host bacterium formed by the promoter PgapA and the target gene can be used for oral drug delivery of peptide and protein drugs, have good application prospect in genetic engineering, can improve the drug administration compliance of patients, and are expected to generate considerable social and economic benefits.

Description

Constitutive lactobacillus promoter, recombinant vector, recombinant bacterium and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a constitutive lactobacillus promoter, a recombinant vector, recombinant bacteria and application thereof.

Background

With the development of biotechnology, many active polypeptides and proteins are developed into drugs and applied clinically. Drugs such as polypeptides, proteins, enzymes, hormones, vaccines, cell growth factors, and monoclonal antibodies for therapeutic or diagnostic use are continuously emerging, and nearly hundreds of polypeptide and protein drugs represented by erythropoietin, interferon, and insulin have been clinically used. Compared with the traditional chemical synthesis medicines, the polypeptide and protein medicines have the advantages of specific action target, definite in-vivo action, strong drug effect, little toxic and side effect and the like, so the polypeptide and protein medicines are increasingly widely applied to the prevention and treatment of modern diseases. However, polypeptides and proteins such as antibodies for immunotherapy have large molecular weight, relatively complex structure and special physicochemical properties, so that the body generates various barriers such as acid barrier, enzyme barrier and membrane barrier to the polypeptides and proteins, and the oral absorption of the drugs is limited. Therefore, at present, such drugs are still limited to invasive administration modes such as intravenous, subcutaneous and intramuscular injection, which results in high production, transportation and storage costs and risks of disease infection, and is a big disadvantage.

In recent years, with the continuous development of bacterial genomics and the continuous abundance of genetic manipulation tools, drug delivery using live probiotics as a delivery carrier is gradually a hot spot of application research. Compared to traditional antibody drug delivery systems, probiotic oral drug delivery systems have the following advantages: the probiotics is widely applied in the food field, and has low acquisition cost, high safety and no toxic or side effect; secondly, the liquid or solid microbial inoculum prepared by the recombinant probiotics can be directly orally taken without injection, so that adverse reaction of an injection part is avoided; and thirdly, the oral delivery system cannot generate drug resistance, so that the probiotics is a very good delivery carrier of polypeptide and protein drugs. However, the prior art has the problem of low protein expression efficiency, and the application of the system is greatly limited.

The promoter is a key DNA sequence for RNA polymerase to recognize, combine and start transcription, and has important regulation and control effect on gene expression. Researches show that the influence of the promoter in various sequences for controlling gene expression is over 45 percent, so that the screening of the high-activity promoter is important for improving the gene expression and realizing the clinical application of an oral drug delivery system taking probiotics as a carrier. At present, the promoter in the probiotics has the problem of starting performance, and the effect of the probiotics delivery vector on treating diseases is influenced.

Disclosure of Invention

In view of the above, the invention provides an ultra-efficient constitutive lactic acid bacteria promoter to solve the problem of low protein expression level in the existing lactic acid bacteria system. Meanwhile, based on the constitutive lactobacillus promoter, the invention also provides a recombinant vector containing the promoter, recombinant bacteria containing the promoter and application of the recombinant vector, wherein the recombinant vector or the recombinant bacteria can be used for oral drug delivery of protein drugs and can be used for preparing drugs for treating various diseases based on efficient downstream gene expression.

The invention provides a constitutive lactobacillus promoter, wherein the nucleotide sequence of the promoter is shown in a sequence table SEQ ID No.1 or a complementary sequence shown in the sequence table SEQ ID No. 1.

The invention provides a recombinant vector containing the promoter.

Preferably, the basic vector in the recombinant vector is pNZ 8149;

the recombinant vector further comprises a target gene;

the target gene is a sequence encoding an inhibitor of the human PD-1/PD-L1 signaling pathway or a sequence encoding the PD-1/PD-L1 signaling pathway and a TGF beta/TGF beta R2 signaling pathway inhibitor.

Preferably, the sequence encoding the inhibitor of the human PD-1/PD-L1 signaling pathway comprises a nucleotide sequence of a human PD-1 ectodomain structural protein or a sequence encoding a fusion protein comprising a human PD-1 ectodomain structural protein;

the nucleotide sequence of the human PD-1 ectodomain structural protein is shown in SEQ ID No. 2;

the sequence for encoding the fusion protein containing the human PD-1 ectodomain structural protein is a sequence for encoding human PD-1 ectodomain-human TGF beta R2 ectodomain fusion protein.

Preferably, the sequence encoding the inhibitor for inhibiting the PD-1/PD-L1 signaling pathway and the TGF beta/TGF beta R2 signaling pathway is a sequence encoding a human PD-1 ectodomain-human TGF beta R2 ectodomain fusion protein.

Preferably, the sequence encoding the fusion protein of human PD-1 ectodomain-human TGF beta R2 ectodomain is shown as SEQ ID No. 3.

The present invention provides a recombinant cell comprising preferably said promoter or preferably said recombinant vector.

Preferably, the basal cells in the recombinant cells comprise intestinal normal bacteria;

the normal intestinal bacteria include Bifidobacterium, Lactobacillus, or Streptococcus.

The invention provides application of the promoter, the recombinant vector or the recombinant cell in expressing a target gene or an anabolic product.

The invention provides application of the promoter, the recombinant vector or the recombinant cell in preparation of protein or polypeptide drugs.

The invention provides a constitutive lactobacillus promoter, the function and the expression efficiency of the promoter are discovered and verified for the first time, and experiments show that the promoter can efficiently start the expression of downstream genes. With the conventional promoter P_NisinACompared with the prior art, the protein expression activity is obviously improved, and the protein is an ultra-efficient promoter. The promoter provided by the invention can be used for high-efficiency expression of endogenous or exogenous proteins of prokaryotes, and provides a favorable tool for development of protein medicine oral drugs taking probiotics as a delivery system.

Drawings

FIG. 1 is a graph comparing results of expression of human PD-1 ectodomain protein using different kinds of promoters, wherein FIG. 1-A is an electrophoretogram of expression of a gene encoding human PD-1 ectodomain protein using different kinds of promoters; FIG. 1-B is a bar graph showing the expression level of the gene encoding human PD-1 ectodomain protein using different types of promoters;

FIG. 2 is a graph comparing the results of the expression of fusion proteins of human PD-1 ectodomain and human TGF-beta R2 ectodomain using different promoters; wherein FIG. 2-A is an electrophoretogram of the fusion protein expressed using different promoters, and FIG. 2-B is a histogram of the expression level of the fusion protein expressed using different promoters;

in the above figures, denotes p < 0.05.

Detailed Description

The invention provides a constitutive lactobacillus promoter, wherein the nucleotide sequence of the promoter is shown in a sequence table SEQ ID No.1 or a complementary sequence shown in the sequence table SEQ ID No. 1. The above sequence limitations of the promoter should not be understood as limitations of the promoter, but also include a nucleotide sequence having at least 70% homology with the nucleotide sequence shown as SEQ ID No. 1; the promoter comprises a nucleotide sequence obtained by modifying, substituting, deleting or adding one or more nucleotides on the basis of the sequence shown as SEQ ID No. 1. The source of the promoter is not particularly limited in the present invention, and a promoter sequence synthesis method well known in the art may be used. In the examples of the present invention, the promoter was synthesized by Shanghai Bioengineering Co., Ltd.

The invention provides a recombinant vector containing the promoter.

In the present invention, the basic vector of the recombinant vector is not particularly limited, and a vector well known in the art may be used. In order to ensure the safety of subsequent application, the basic vector in the recombinant vector is preferably pNZ 8149; the pNZ8149 is a food grade plasmid; the recombinant vector uses the promoter to replace the original promoter P in pNZ8149_NisinA。

In the present invention, the recombinant vector further includes a target gene. The recombinant vector comprising the promoter of the present invention can be used for expressing any target gene. In order to better show that the promoter can efficiently express genes, the invention takes the expression sequence of an inhibitor of a human PD-1/PD-L1 signal pathway or the expression sequence of the inhibitor of a PD-1/PD-L1 signal pathway and a TGF beta/TGF beta R2 signal pathway as a target gene for description.

In the invention, the target gene is a sequence encoding an inhibitor of the human PD-1/PD-L1 signaling pathway or a sequence encoding an inhibitor of the PD-1/PD-L1 signaling pathway and the TGF beta/TGF beta R2 signaling pathway. The sequence encoding an inhibitor of the human PD-1/PD-L1 signaling pathway preferably comprises a nucleotide sequence of a human PD-1 ectodomain structural protein or a sequence encoding a fusion protein comprising a human PD-1 ectodomain structural protein; the nucleotide sequence of the human PD-1 ectodomain structural protein is shown in SEQ ID No. 2; the sequence for encoding the fusion protein containing the human PD-1 ectodomain structural protein is a sequence for encoding human PD-1 ectodomain-human TGF beta R2 ectodomain fusion protein; the sequence encoding the fusion protein comprising the human PD-1 ectodomain structural protein is representative of an antibody/antibody fragment-factor fusion protein. The PD-1 ectodomain structural protein also comprises an analogue shown as SEQ ID No. 2; the analogue comprises a nucleotide sequence which has at least 70 percent of homology with the nucleotide sequence shown as SEQ ID No.1 or a nucleotide sequence which is obtained by modifying, substituting, deleting or adding one or more nucleotides on the basis of the sequence shown as SEQ ID No. 1. The sequence for coding the inhibitor for inhibiting the PD-1/PD-L1 signal pathway and the TGF beta/TGF beta R2 signal pathway is preferably a sequence for coding a human PD-1 ectodomain-human TGF beta R2 ectodomain fusion protein. The sequence of the fusion protein for encoding the human PD-1 ectodomain-human TGF beta R2 ectodomain is preferably shown as SEQ ID No. 3.

In the present invention, the method for preparing the recombinant vector is preferably a method in which a promoter (P)_gapA) The nucleotide sequence is inserted into restriction sites BstYI and NcoI of the plasmid to form a recombinant vector pGapa;

when a recombinant vector containing a target gene is prepared, it is preferable that the target gene is inserted between the protein expression vector pNZ8149, the pGapa restriction site SphI and the XbaI restriction site.

In the present invention, the basal cells in the recombinant cells preferably include intestinal normal bacteria; the intestinal normal bacteria preferably include Bifidobacterium, Lactobacillus, or Streptococcus.

In the present invention, the Bifidobacterium includes Bifidobacterium adolescentis (Bifidobacterium adolescentis), Bifidobacterium animalis (Bifidobacterium animalis), Bifidobacterium bifidum (Bifidobacterium bifidum), Bifidobacterium breve (Bifidobacterium breve), Bifidobacterium infantis (Bifidobacterium infantis), and Bifidobacterium longum (Bifidobacterium longum).

The Lactobacillus (Lactobacillus) includes Lactobacillus acidophilus (Lactobacillus acidophilus), Lactobacillus casei (Lactobacillus casei), Lactobacillus crispatus (Lactobacillus crispus), Lactobacillus bulgaricus (Lactobacillus bulgaricus), Lactobacillus delbrueckii (Lactobacillus delbrueckii), Lactobacillus fermentum (Lactobacillus fermentum), Lactobacillus grisea (Lactobacillus gasseri), Lactobacillus helveticus (Lactobacillus helveticus), Lactobacillus johnsonii (Lactobacillus johnsonii), Lactobacillus paracasei (Lactobacillus paracasei), Lactobacillus plantarum (Lactobacillus plantarum), Lactobacillus reuteri (Lactobacillus reuteri), Lactobacillus rhamnosus (Lactobacillus rhamnosus), Lactobacillus salivarius (Lactobacillus salivarius).

The Streptococcus (Streptococcus) includes Streptococcus thermophilus (Streptococcus thermophilus) and Staphylococcus calves (Staphylococcus vitulinus), Staphylococcus xylosus (Staphylococcus xylosus), Staphylococcus carnosus (Staphylococcus carnosus), Bacillus coagulans (Bacillus coagulons), Bacillus subtilis (Bacillus subtilis) and Lactococcus lactis (Lactobacillus lactis). The lactic acid bacterium is preferably L.1actas NZ 3900.

In the present invention, the method for preparing the recombinant cell comprises introducing the recombinant vector into a host cell by electrotransformation to obtain the recombinant cell. The method of the electric conversion is not particularly limited in the present invention, and a method of electric conversion well known in the art may be used.

The present invention does not impose any limitation on the kind of the target gene and the kind of the metabolite.

In the present invention, the kind of the protein-based or polypeptide-based drug is not particularly limited. The diseases treated by the drug are not limited at all, and the types of the diseases treated by the drug comprise metabolic diseases, cancers, infectious diseases, immune diseases, polypeptide and protein drugs used for nervous system diseases; the metabolic disease is preferably selected from diabetes, obesity, diabetic kidney injury, diabetic macroangiopathy, diabetic microvascular injury, diabetic retinopathy, glucagon blood disease, necrotic wandering erythema, glucagonomas and other metabolic diseases, coronary heart disease, hypertensive heart disease, valvular heart disease, alcoholic cardiomyopathy or diabetic cardiovascular complications. The cancer is preferably lung cancer, liver cancer, ovarian cancer, cervical cancer, skin cancer, bladder cancer, colorectal cancer, breast cancer, melanoma, glioma, kidney cancer, stomach cancer, esophageal cancer, oral squamous cell carcinoma or head and neck cancer. The infectious disease is preferably an HIV viral infection and a viral hepatitis viral infection, a rabies viral infection or varicella. The immune diseases are preferably autoimmune hepatitis, viral hepatitis, hepatic fibrosis, acute lung injury, asthma, inflammatory bowel disease, psoriasis, systemic lupus erythematosus or rheumatoid arthritis. The neurological disease is preferably epilepsy, stroke, Huntington's disease, Alzheimer's disease or Parkinson's disease.

In the invention, the preparation of the protein or polypeptide medicament takes probiotics as a platform, and the polypeptide or protein with a therapeutic effect is expressed by utilizing the recombinant vector carrying the promoter, so that the oral medicament delivery of the peptide or protein medicament is realized.

The preparation method of the drug delivery system comprises the following steps: the method comprises the following steps:

1) synthesizing a nucleotide sequence of a polypeptide or protein of interest;

2) inserting the nucleotide sequence synthesized in the step 1) into the vector containing the promoter to construct a recombinant expression vector;

3) transforming the recombinant expression vector in the step 2) into intestinal normal bacteria;

4) inoculating the recombinant bacteria obtained in the step 3) into a culture medium for culture and expression.

Alternatively, the method comprises the steps of:

1) synthesizing a promoter-nucleotide sequence of a polypeptide or protein of interest;

2) inserting and integrating the nucleotide sequence synthesized in the step 1) into a chromosome of the intestinal tract normal bacteria;

3) inoculating the recombinant bacteria obtained in the step 2) into a culture medium for culture and expression.

In the present invention, the pharmaceutical composition comprises a promoter-nucleotide sequence expression cassette for a polypeptide or protein of interest and a host cell. In the present invention, the pharmaceutical composition is preferably an oral pharmaceutical composition; the pharmaceutical composition preferably comprises a pharmaceutically acceptable carrier and/or adjuvant. The dosage form of the medicament is preferably a capsule or other acceptable preparation.

The constitutive lactic acid bacteria promoter, the recombinant vector, the recombinant bacteria thereof and the application thereof provided by the present invention will be described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention.

Example 1

P_gapACloning of promoter and P-containing_gapAConstruction of the promoter vector pGapa

The food-grade expression vector pGapa is obtained by modifying and constructing on the basis of an edible-grade protein expression vector pNZ8149(MoBiTec, Germany). The food-grade expression vector pNZ8149 limits the application thereof to a certain extent due to lower protein expression level, and in order to solve the problem, a strong promoter P screened by the laboratory is used_gapAThe inducible promoter pNisin on the pNZ8149 is replaced to obtain a food-grade protein expression vector with higher expression level, and the food-grade protein expression vector is named as pGapa.

First, BstYI-P was artificially synthesized_gapA-the nucleotide sequence of NcoI (SEQ ID No. 4:ggatctaataaaaactccttaaacatttttagtaaaaaaaattgacactaaataaaaaaagtagtatcatttatattagagataagagatgtctccaataactataaattcattatttatattataccacagcagttgacctgaaacaatgtttcgtattacgaagagtgatatttgtagtagaaaaagagaaattctcatcatctaaataaaaaaacggaggactacatcccatggwherein the underlined indicates the cleavage site); wherein, the P_gapAIs a constitutive promoter of lactobacillus, and has a nucleotide sequence shown as SEQ ID NO.1 (aataaaaactccttaaacatttttagtaaaaaaaattgacactaaataaaaaaagtagtatcatttatattagagataagagatgtctccaataactataaattcattatttatattataccacagcagttgacctgaaacaatgtttcgtattacgaagagtgatatttgtagtagaaaaagagaaattctcatcatctaaataaaaaaacggaggactacatc); p is inserted between restriction sites BstYI and NcoI of a protein expression vector pNZ8149_gapA。SEQ ID No1 was synthesized by kasuga biotechnology limited.

Example 2

Design and construction of sPD-1 protein expression vector pNZ8149-sPD-1 and PgapA-sPD-1

Using human PD-1 ectodomain (sPD-1) as an example, sPD-1 as a reporter gene was used to test the activity of the promoter of the present invention.

First, the nucleotide sequence of SphI-Spusp45-DDDDK-sPD-1-XbaI was artificially synthesized (SEQ ID No. 5: gcatgctcatgaaaaaaaagattatctcagctattttaatgtctacagtgatactttctgctgcagccccgttgtcaggtgtttacgctgatactaattctgatttggaaatatcgtcgacttgtgatgctgacgatgacgataagccaggatggttcttagactccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgcagcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccgaggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagagctcagggtgacagagagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggtgtaatctaga).

Wherein the sPD-1 is an extracellular domain of PD-1, which is a natural human PD-1/PD-L1 signal pathway inhibitor, and the nucleotide sequence is shown as SEQ ID No.2 (ccaggatggttcttagactccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgcagcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccgaggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagagctcagggtgacagagagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggtgtaa).

sPD-1(SEQ ID No.2) was inserted between the protein expression vector pNZ8149, the pGapa restriction site SphI and the XbaI restriction site. The DNA is synthesized by Shanghai Bioengineering Co., Ltd.

In order to verify whether the construction of the vector is successful, the synthesized gene ligation product is transformed into L.lactis NZ3900 strain competent cells (purchased from MoBiTec) by an electroporation method, an Elliker selection culture medium is adopted to screen positive transformation bacteria, the screened transformation bacteria are cultured, plasmids are extracted from the bacteria, SphI and XbaI double enzyme digestion, PCR amplification and amplification product sequencing identification are carried out, the plasmid with the nucleotide sequence conforming to the expectation is the constructed strain of the extracellular domain structural protein with the same PD-1 secreted and expressed by NZ3900 L.Iact, and the strain is named according to the difference of the vector: NZ3900-8149-sPD-1, NZ 3900-pGapa-sPD-1.

The specific method comprises the following steps:

1) artificially synthesizing a nucleotide sequence of SphI-Spusp 45-DDDDDDK-sPD-1-XbaI; obtaining a pUC57-sPD-1 recombinant plasmid;

2) inserting the nucleotide sequence synthesized in the step 1) into pNZ8149 and pGapa plasmids to construct pNZ8149-sPD-1 and PgapA-sPD-1 recombinant plasmids, wherein the method comprises the following steps

A. Extracting pNZ8149, pGapa and pUC57-sPD-1 plasmids by adopting a small radix plasmid extraction kit;

B. enzyme digestion; the enzyme cutting systems of pNZ8149, pGapa and pUC57-sPD-1 are shown in the following table 1; the total volume of the enzyme digestion system is 50 mu L, and the enzyme digestion is carried out for 3h at 37 ℃;

TABLE 1 enzyme digestion System

C. Recovering; preparing 1% agarose gel electrophoresis, and performing electrophoresis at 120V for 30 min; cutting and recovering gel at 609bp and 2500 bp;

D. connecting; the attachment system is shown in table 2 below; the total volume of the enzyme linked system was 20. mu.l, insert: carrier molar ratio 7: 1, 16 ℃ overnight;

TABLE 2 connection System

E. Purification and recovery of ligation product

Adding 2.5 times of anhydrous ethanol and 1/10 times of 2.5mol/L sodium acetate into the prepared connecting product, uniformly mixing, standing at-20 ℃ for lh, centrifuging at 12000r/min for 5min, and removing the supernatant; precipitating with 1ml 75% ethanol once, centrifuging at 12000r/min for 5min, discarding supernatant, drying at room temperature for 20min, and dissolving precipitate with deionized water.

3) Electrotransformation of pNZ8149-sPD-1, pGapa-sPD-1 into lactococcus lactis NZ 3900;

preparation of L.lactis MG1363 competence

A. Inoculating lactococcus lactis MG1363 (purchased from Mo Bi Tec) cryopreserved at-80 ℃ into 5mL of M17 liquid medium containing 5% (g/100mL) of glucose, and culturing overnight at 30 ℃;

B. inoculating the obtained bacterial liquid at 1% volume ratio in M17 liquid culture medium containing 2.5% (g/100ml) glycine and 5% (g/100ml) glucose, and standing at 30 deg.C for culture until the thallus OD₆₀₀The value is 0.3-0.4, and the mixture is collected for later use;

C. ice-bath the collected thallus culture for 10min, centrifuging at 4 deg.C at 5000rpm/min for 5 min; collecting thalli;

D. washing thallus twice with ice-cold mixed solution 1/10 of 10% (g/100ml) sucrose and 10% (volume ratio) glycerol, centrifuging at 4 deg.C for 5min at 8000rpm, and collecting thallus;

E. finally, the thalli is resuspended in 1/100 volume of 10 percent (g/100ml) sucrose and 10 percent (volume ratio glycerol mixed solution, and the mixed solution is used after ice bath for 10 min;

② lactococcus lactis MG1363 electrotransformation

A. Aspirate 40. mu.L of freshly prepared competent bacterial suspension into an ice-cold sterile EP tube with ice bath for 5 min.

B. 1 mul of the purified expression vector was pipetted and added to the competent bacteria, mixed well and placed on ice for 5 min.

C. Adding the mixed solution of the bacterial suspension and the expression vector into an ice-cold electric rotating cup, and putting the electric rotating cup into an electric shock instrument under the setting conditions of 2500V, 200 omega and 25 mu F;

D. after the electric shock is finished, 1ml of ice-cold GM17-MC is quickly added to recover the culture medium; after mixing uniformly, transferring the mixture into an EP tube for ice bath for 5-10 min; culturing at 30 deg.C for 2 h.

E.100 mul of the recovered culture solution was inoculated into Elliker selection medium, cultured overnight at 30 ℃ and yellow colonies were picked for identification. The preparation method of the Elliker selection medium is as follows: weighing 2g of tryptone (Sammarfei et Georgi), 0.5g of yeast extract (Sammarfei et Georgi), 0.4g of sodium chloride (Beijing chemical industry), 0.15g of anhydrous sodium acetate (Sigma in America), 0.05g of ascorbic acid (Sigma in America), 1.5g of agar powder (Oboxing in Beijing), and fixing the volume to 100 ml. Sterilizing at 121 deg.C for 20min, cooling to 50-60 deg.C, and adding 2.5ml 20% lactose (Sigma in USA) and 1ml 0.4% bromcresol purple (Sigma in USA).

(iii) verification of the transformed bacteria

Extracting plasmid from the cultured transformed thallus, performing double enzyme digestion by SphI and XbaI, and amplifying the enzyme digestion product by PCR (polymerase chain reaction), wherein the PCR amplification primers are SEQ ID No.7(F: cttattgagaaagggaaacgacgg) and SEQ ID No.8 (R: tcaactgctgctttttggcta); reaction procedure for the PCR amplification: 94 ℃ for 3 min; {94 ℃, 30 s; at 58 ℃ for 30 s; 72 ℃ for 1min and 30 s; 38 cycles; 72 ℃ for 5 min.

Sequencing and identifying the obtained amplification product, wherein the identification result is that the plasmid with the nucleotide sequence conforming to the expectation is the constructed strain of the extracellular domain structural protein with the same NZ3900 L.Iactas secretion expression PD-1, and the strains are respectively named as: NZ3900-8149-sPD-1, NZ 3900-pGapa-sPD-1.

Example 3:

functional verification of PgapA-sPD-1 protein expression vector

In order to verify the expression ability of the pNZ8149-sPD-1 and pGapa-sPD-1 recombinant vectors in lactic acid bacteria, the recombinant strains obtained in example 2 were expressed in vitro.

NZ3900-8149-sPD-1 and NZ3900-pGapa-sPD-1 strains are cultured in a 30-DEG M17 broth (21.125 g M17 broth is weighed, dissolved in 400ml of distilled water, the pH value is adjusted to 7.2 by 10mol/LNaOH, the volume is adjusted to 500ml, the solution is autoclaved, the culture medium is purchased from Oboxing Biotechnology Limited liability company, Beijing) overnight, then bacterial liquid supernatant is collected and precipitated, and Western Blot detection is carried out on the obtained supernatant protein by using a specific PD-1 antibody (ProSci, RF 16002). The specific method comprises the following steps:

the Western Blot method is used for detecting the secretory expression of the pNZ8149-sPD-1 and pGapa-sPD-1 recombinant vectors in lactococcus lactis.

1. Induced secretory expression of pNZ8149-sPD-1, pGapa-sPD-1 in lactococcus lactis

A. The strain is inoculated into an M17 liquid culture medium, when the strain is statically cultured at 30 ℃ until OD600 is 0.4-0.6, Nisin with the concentration of 25ng/ml is added into the NZ3900-8149-sPD-1 strain, and the NZ3900-pGapa-sPD-1 strain is continuously cultured.

B. Culturing for 5h, centrifuging at 10000rpm for 20min, collecting supernatant, filtering with 0.22 μm filter membrane, adding N-lauroyl sarcosine sodium to final concentration of 0.1%, and standing at room temperature for 15 min;

C. adding trichloroacetic acid to a final concentration of 7.5%, mixing, and ice-cooling for 2 h;

centrifuging at 10000rpm for 10min, discarding the supernatant, adding 2ml tetrahydrofuran, and centrifuging at 10000rpm for 10 min;

e.10000rpm centrifuging for 10min, discarding the supernatant, adding 2ml tetrahydrofuran, 10000rpm centrifuging for 10 min;

F. the supernatant was discarded, air-dried, and dissolved in 1ml of 8mol L urea.

2. Electrophoresis

A. Preparation of 12% SDS-PAGE gels

B. Adding a 5 xSDS-PAGE protein loading buffer solution into the collected protein sample, and heating at 100 ℃ for 5-10 min.

C. After cooling to room temperature, directly loading the protein sample into an SDS-PAGE gel loading hole; performing 80V electrophoresis for 30min and 120V electrophoresis for 50 min;

D. transferring a film, and performing transfer printing by using PVDF (polyvinylidene fluoride), wherein the voltage is 100V and the time is 60 min;

e.5% skimmed milk powder is sealed for 1 h;

pd-1 antibody incubation overnight;

G. and (6) imaging.

As shown in FIG. 1-A, the PD-1 ectodomain protein is specifically expressed in the Nisin-induced NZ3900-8149-sPD-1 strain, and the PD-1 ectodomain protein is also specifically expressed in the NZ3900-8149-sPD-1 strain (lane 1 is the supernatant protein of the PNZ8149 empty vector recombinant strain, lane 2 is the supernatant protein of the Nisin-induced pZ 8149 empty vector recombinant strain, lane 3 is the supernatant protein of the pNZ8149-sPD-1 recombinant strain, lane 4 is the supernatant protein of the Nisin-induced pNZ8149-sPD-1 recombinant strain, and lane 5 is the supernatant protein of the pGapa-sPD-1 recombinant strain). In addition, the expression level of the NZ3900-pGapa-sPD-1 strain is obviously higher than that of the NZ3900-8149-sPD-1 strain, and the expression capacity is 2.22 times that of the NZ3900-8149-sPD-1 strain (as shown in a figure 1-B).

Example 4

Functional verification of PgapA-sPD-TGF beta R2 protein expression vector

In order to further verify whether the promoter provided by the invention has universality, the expression efficiency verification is performed again by taking the sPD-1-sTGF beta R2 fusion protein as an example.

First, the nucleotide sequence of SphI-SPuspp 45-DDK-sPD-1-sTGF β R2-XbaI (SEQ ID No.6 gcatgctcagaaaaaagattctccaggcttagtctccaggccaggccctcccagtgcctcagtggtcagtgactgccaggccagtgcgcagtgactgccatgttggtcaggtcgatccagtggctggctggctggctggctggctggctgactgctgaggcctgagcctgagctggctggctggctggctggctggctggctggcctgccgatcgcctgccgaggcctgctggcctgctggctggcctgcgctggcctgcgctggcctgccgaggcctgcctgcctgccggcctgcctgcgcgcgctggcctgcgcgctggctggcctgcgcgcgcgcgcgcgcgctggcctgcgcgcgcgcgcgcgcgcgcgcgctggctggcctgcgcgcgcgcgcctgcgcgcgcgctggcctgcgcgcgcgcgcgcgcgcgcgcgctggcgcgcgcgcgcgcctgcgcgcgcgcgcgcgctggctggcctgcgcgcgcgcgcctgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggcgcgcgcgctggctggctggcgcgcgcgcctgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgctggcgcgcgcgcgctggctggcctgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgc.

Wherein, the sPD-1 is an ectodomain of PD-1, which is a natural human PD-1/PD-L1 signal pathway inhibitor, the sTGF beta R2 is an ectodomain partial sequence of human TGF beta R2, and the nucleotide sequence of the fusion protein is shown as SEQ ID No.3 (atgaaaaaaaagattatctcagctattttaatgtctacagtgatactttctgctgcagccccgttgtcaggtgtttacgctgatactaattctgatttggaaatatcgtcgacttgtgatgctgacgatgacgataagccaggatggttcttagactccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgcagcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccgaggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagagctcagggtgacagagagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggtgggcggaggcggaagcggcggaggcggaagcggcggaggcggaagcacgatcccaccgcacgttcagaagtcggttaataacgacatgatagtcactgacaacaacggtgcagtcaagtttccacaactgtgtaaattttgtgatgtgagattttccacctgtgacaaccagaaatcctgcatgagcaactgcagcatcacctccatctgtgagaagccacaggaagtctgtgtggctgtatggagaaagaatgacgagaacataacactagagacagtttgccatgaccccaagctcccctaccatgactttattctggaagatgctgcttctccaaagtgcattatgaaggaaaaaaaaaagcctggtgagactttcttcatgtgttcctgtagctctgatgagtgcaatgacaacatcatcttctcagaagaatataacaccagcaatcctgacttgttgctagtcatatttcaataa).

sPD-1-sTGF beta R2(SEQ ID No.3) was inserted between the protein expression vector pNZ8149, the pGapa restriction site SphI and the XbaI restriction site. The above sequence was synthesized by the biosciences of Kingsler, Inc.

As shown in the concrete method of example 2, recombinant strains NZ3900-8149-sPD-1-sTGF beta R2, NZ3900-pGapa-sPD-1-sTGF beta R2 were obtained by electrotransformation, and were subjected to protein-induced expression by the method of example 3, followed by Western Blot assay using TGF beta R2 antibody (R & D, AF-241-NA).

As shown in FIG. 2-A, the recombinant strain NZ3900-pGapa-sPD-1-sTGF β R2 specifically expresses the fusion protein (lane 1 is the supernatant of PNZ8149 empty vector recombinant strain, lane 2 is the supernatant of Nisin-induced PNZ8149 empty vector recombinant strain, lane 3 is the supernatant of pNZ 8149-sPD-1-sTGF β R2 recombinant strain, lane 4 is the supernatant of Nisin-induced pNZ 8149-sPD-1-sTGF β R2 recombinant strain, and lane 5 is the supernatant of pGapa-sPD-1-sTGF β R2 recombinant strain). Compared with the strain NZ3900-8149-sPD-1-sTGF beta R2, the expression level was increased by 2.38 times (FIG. 2-B).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of animal research of Chinese academy of sciences

<120> constitutive lactic acid bacteria promoter, recombinant vector, recombinant bacteria and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aataaaaact ccttaaacat ttttagtaaa aaaaattgac actaaataaa aaaagtagta 60

tcatttatat tagagataag agatgtctcc aataactata aattcattat ttatattata 120

ccacagcagt tgacctgaaa caatgtttcg tattacgaag agtgatattt gtagtagaaa 180

aagagaaatt ctcatcatct aaataaaaaa acggaggact acatc 225

<210> 2

<211> 453

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccaggatggt tcttagactc cccagacagg ccctggaacc cccccacctt ctccccagcc 60

ctgctcgtgg tgaccgaagg ggacaacgcc accttcacct gcagcttctc caacacatcg 120

gagagcttcg tgctaaactg gtaccgcatg agccccagca accagacgga caagctggcc 180

gccttccccg aggaccgcag ccagcccggc caggactgcc gcttccgtgt cacacaactg 240

cccaacgggc gtgacttcca catgagcgtg gtcagggccc ggcgcaatga cagcggcacc 300

tacctctgtg gggccatctc cctggccccc aaggcgcaga tcaaagagag cctgcgggca 360

gagctcaggg tgacagagag aagggcagaa gtgcccacag cccaccccag cccctcaccc 420

aggccagccg gccagttcca aaccctggtg taa 453

<210> 3

<211> 1068

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgaaaaaaa agattatctc agctatttta atgtctacag tgatactttc tgctgcagcc 60

ccgttgtcag gtgtttacgc tgatactaat tctgatttgg aaatatcgtc gacttgtgat 120

gctgacgatg acgataagcc aggatggttc ttagactccc cagacaggcc ctggaacccc 180

cccaccttct ccccagccct gctcgtggtg accgaagggg acaacgccac cttcacctgc 240

agcttctcca acacatcgga gagcttcgtg ctaaactggt accgcatgag ccccagcaac 300

cagacggaca agctggccgc cttccccgag gaccgcagcc agcccggcca ggactgccgc 360

ttccgtgtca cacaactgcc caacgggcgt gacttccaca tgagcgtggt cagggcccgg 420

cgcaatgaca gcggcaccta cctctgtggg gccatctccc tggcccccaa ggcgcagatc 480

aaagagagcc tgcgggcaga gctcagggtg acagagagaa gggcagaagt gcccacagcc 540

caccccagcc cctcacccag gccagccggc cagttccaaa ccctggtggg cggaggcgga 600

agcggcggag gcggaagcgg cggaggcgga agcacgatcc caccgcacgt tcagaagtcg 660

gttaataacg acatgatagt cactgacaac aacggtgcag tcaagtttcc acaactgtgt 720

aaattttgtg atgtgagatt ttccacctgt gacaaccaga aatcctgcat gagcaactgc 780

agcatcacct ccatctgtga gaagccacag gaagtctgtg tggctgtatg gagaaagaat 840

gacgagaaca taacactaga gacagtttgc catgacccca agctccccta ccatgacttt 900

attctggaag atgctgcttc tccaaagtgc attatgaagg aaaaaaaaaa gcctggtgag 960

actttcttca tgtgttcctg tagctctgat gagtgcaatg acaacatcat cttctcagaa 1020

gaatataaca ccagcaatcc tgacttgttg ctagtcatat ttcaataa 1068

<210> 4

<211> 237

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggatctaata aaaactcctt aaacattttt agtaaaaaaa attgacacta aataaaaaaa 60

gtagtatcat ttatattaga gataagagat gtctccaata actataaatt cattatttat 120

attataccac agcagttgac ctgaaacaat gtttcgtatt acgaagagtg atatttgtag 180

tagaaaaaga gaaattctca tcatctaaat aaaaaaacgg aggactacat cccatgg 237

<210> 5

<211> 605

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcatgctcat gaaaaaaaag attatctcag ctattttaat gtctacagtg atactttctg 60

ctgcagcccc gttgtcaggt gtttacgctg atactaattc tgatttggaa atatcgtcga 120

cttgtgatgc tgacgatgac gataagccag gatggttctt agactcccca gacaggccct 180

ggaacccccc caccttctcc ccagccctgc tcgtggtgac cgaaggggac aacgccacct 240

tcacctgcag cttctccaac acatcggaga gcttcgtgct aaactggtac cgcatgagcc 300

ccagcaacca gacggacaag ctggccgcct tccccgagga ccgcagccag cccggccagg 360

actgccgctt ccgtgtcaca caactgccca acgggcgtga cttccacatg agcgtggtca 420

gggcccggcg caatgacagc ggcacctacc tctgtggggc catctccctg gcccccaagg 480

cgcagatcaa agagagcctg cgggcagagc tcagggtgac agagagaagg gcagaagtgc 540

ccacagccca ccccagcccc tcacccaggc cagccggcca gttccaaacc ctggtgtaat 600

ctaga 605

<210> 6

<211> 1082

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcatgctcat gaaaaaaaag attatctcag ctattttaat gtctacagtg atactttctg 60

ctgcagcccc gttgtcaggt gtttacgctg atactaattc tgatttggaa atatcgtcga 120

cttgtgatgc tgacgatgac gataagccag gatggttctt agactcccca gacaggccct 180

ggaacccccc caccttctcc ccagccctgc tcgtggtgac cgaaggggac aacgccacct 240

tcacctgcag cttctccaac acatcggaga gcttcgtgct aaactggtac cgcatgagcc 300

ccagcaacca gacggacaag ctggccgcct tccccgagga ccgcagccag cccggccagg 360

actgccgctt ccgtgtcaca caactgccca acgggcgtga cttccacatg agcgtggtca 420

gggcccggcg caatgacagc ggcacctacc tctgtggggc catctccctg gcccccaagg 480

cgcagatcaa agagagcctg cgggcagagc tcagggtgac agagagaagg gcagaagtgc 540

ccacagccca ccccagcccc tcacccaggc cagccggcca gttccaaacc ctggtgggcg 600

gaggcggaag cggcggaggc ggaagcggcg gaggcggaag cacgatccca ccgcacgttc 660

agaagtcggt taataacgac atgatagtca ctgacaacaa cggtgcagtc aagtttccac 720

aactgtgtaa attttgtgat gtgagatttt ccacctgtga caaccagaaa tcctgcatga 780

gcaactgcag catcacctcc atctgtgaga agccacagga agtctgtgtg gctgtatgga 840

gaaagaatga cgagaacata acactagaga cagtttgcca tgaccccaag ctcccctacc 900

atgactttat tctggaagat gctgcttctc caaagtgcat tatgaaggaa aaaaaaaagc 960

ctggtgagac tttcttcatg tgttcctgta gctctgatga gtgcaatgac aacatcatct 1020

tctcagaaga atataacacc agcaatcctg acttgttgct agtcatattt caataatcta 1080

ga 1082

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cttattgaga aagggaaacg acgg 24

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tcaactgctg ctttttggct a 21

Claims

1. The constitutive lactobacillus promoter is characterized in that the nucleotide sequence of the promoter is shown in a sequence table SEQ ID No.1 or is a complementary sequence shown in the sequence table SEQ ID No. 1.

2. A recombinant vector comprising the promoter of claim 1.

3. The recombinant vector according to claim 2, wherein the basic vector in the recombinant vector is pNZ 8149;

the recombinant vector further comprises a target gene;

4. The recombinant vector according to claim 3, wherein the sequence encoding the inhibitor of the human PD-1/PD-L1 signaling pathway comprises a nucleotide sequence of a human PD-1 ectodomain structural protein or a sequence encoding a fusion protein comprising a human PD-1 ectodomain structural protein;

5. The recombinant vector according to claim 3, wherein the sequences encoding inhibitors of the PD-1/PD-L1 signaling pathway and the TGF β/TGF β R2 signaling pathway are sequences encoding human PD-1 ectodomain-human TGF β R2 ectodomain fusion proteins.

6. The recombinant vector according to claim 4 or 5, wherein the sequence encoding the fusion protein of human PD-1 ectodomain-human TGF β R2 ectodomain is shown as SEQ ID No. 3.

7. A recombinant cell comprising the promoter of claim 1 or the recombinant vector of any one of claims 2 to 6.

8. The recombinant cell of claim 7, wherein the basal cell of the recombinant cell comprises a normal gut bacterium;

9. Use of the promoter according to claim 1, the recombinant vector according to any one of claims 2 to 6 or the recombinant cell according to claim 7 or 8 for expressing a gene or an anabolic product of interest.

10. Use of the promoter of claim 1, the recombinant vector of any one of claims 2 to 6, or the recombinant cell of claim 7 or 8 for the preparation of a protein or polypeptide drug.