CN106414487A - Ligand binding molecules and uses thereof - Google Patents

Abstract

The present invention is directed to ligand binding molecules and uses thereof to modulate angiogenesis and/or lymphangiogenesis.

Description

Ligand binding molecules and application thereof

Invention field

Present invention relates in general to the regulation of angiogenic growth, especially in ophthalmology and oncology.

Sequence table

E-serial table constitutes the part of this description.

Background of invention

VEGF (VEGF) protein and its receptor (VEGFR) are in blood vessel generation (in early differentiation Chrotoplast embryonic development vascular system), angiogenesis (from the process of existing vascularization neovascularity) and lymphatic vessel generation (shape Become new vasculolymphatic process) in play an important role.Platelet-derived growth factor (PDGF) protein and its receptor (PDGFR) ginseng With cell proliferation, survival and the migration adjusting several cell types.

The dysfunction of endotheliocyte regulating system is cancer and is given birth to abnormal blood vessel generation, angiogenesis and lymphatic vessel Become the key feature of relevant various diseases.

Angiogenesis occur in the growth of fetal development and normal structure, reparation and regeneration, female reproductive cycle, gestation In the reparation of foundation and maintenance, wound and fracture.Except there are the angiogenesis in healthy individuals, angiogenesis event is also joined With many pathological processes, especially growth and metastasis of tumours, and wherein blood vessel hyperplasia (especially Microvasculature blood vessel increase Raw) increased other condition of illness, such as diabetic retinopathy, psoriasiss and arthrosiss.Suppression angiogenesis can be used for pre- Prevent or mitigate these pathological processes or the progress slowing down them.

Although being related to by its receptor come the therapy of blocking VEGF/PDGF signal transduction for suppression angiogenesis and tumor Growth has shown that prospect, but remains a need for the new or improved compound for treating these diseases and therapy.

Brief summary of the invention

The present invention relates to for suppressing abnormal angiogenesis, lymphatic vessel generation or the two and suppression vascular endothelial growth The new compositions of other effects of the factor-C (VEGF-C) and VEGF-D (VEGF-D) and its using method, Described VEGF each can in conjunction with least one growth factor receptor tyrosine kinase (that is, VEGFR-2 or ) and stimulate its phosphorylation VEGFR-3.The compositionss of the present invention include with reference to one of people VEGF-C and people VEGF-D or the two Ligand binding molecules.In some embodiments, described ligand binding molecules comprise polypeptide, for example, growth factor receptorses cheese ammonia The fragment of acid kinase extracellular domain (ECD).Described fragment can be differently configured from wild-type sequence, not eliminate somatomedin knot Close mode, and described fragment preferably transformed in a manner described herein in need tested as being administered to improve it The property of the therapeutic agent of person/patient.

Present invention also offers encoding the nucleic acid of such ligand binding molecules.Described nucleic acid can be used for express polypeptide part knot Close molecule, and in some embodiments, be also used as the internal expression for realizing polypeptide ligand binding molecule is in The therapeutic agent of biologically active form.

Apply the group comprising ligand binding molecules as herein described (or encoding its polynucleotide) to patient in need Compound suppresses the factors stimulated growth (for example, suppressing the phosphorylation of receptor) of vegf receptor and thus suppresses to pass through described receptor Mediation biological respinse, including but not limited to VEGFR mediation angiogenesis, lymphatic vessel generation or the two.

VEGF-C and VEGF-D with high-affinity combine selected from VEGFR-2 and VEGFR-3 at least one vegf receptor (or Receptor heterodimer) and stimulate its phosphorylation.This statement refers to somatomedin to property known to its homoreceptor, and no Meaning is as the restricted feature of ligand binding molecules of the present invention itself.However, it is preferred that the ligand binding molecules of the present invention are not only It is simply to combine its target somatomedin.Preferably ligand binding molecules also suppress factors stimulated growth and the institute that it is combined State the phosphorylation of at least one (and being preferably all) receptor tyrosine kinase of somatomedin combination.Tyrosine phosphorylation Stimulate and easily measured using cell in vitro analysis and antiphosphotyrosine antibody.Because the phosphorylation of receptor tyrosine kinase is Initial step in signal transduction cascade, so it easily indicates whether ligand binding molecules being capable of the mediations of the Developing restraint factor The signal transduction leading to cell migration, cell growth and other reaction.Many other analyses based on cell and internal analysis Can be used in the somatomedin of ligand binding molecules confirm the present invention and property.

The ligand binding molecules to particular growth factor with " specificity " are the activity of this somatomedin of specific recognition The ligand binding molecules of form (for example, being found in the form of body-internal-circulation).Preferably, ligand binding molecules also specificity knot Close the somatomedin of other forms.For example, VEGF-C (and VEGF-D) is translated for thering is extensive amino terminal and carboxylic The front original molecule of base CICP, described pro peptide cleavage produces the form of " processing completely " of VEGF-C (or VEGF-D), its knot Merge and stimulate VEGFR-2 and VEGFR-3.To VEGF C (or VEGF-D), there are specific ligand binding molecules to be attached to At least complete form processing of VEGF-C (or VEGF-D), and preferably it is also coupled to part form processing and undressed form.

In one aspect, ligand binding molecules as herein described are purification or detached ligand binding polypeptide, its comprise with By SEQ ID NO：2 position 47-115 or SEQ ID NO：The sequence of the aminoacid that 2 position 25-115 limits has at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least 97% or at least First aminoacid sequence of 98% or at least 99% homogeneity, condition is described polypeptide corresponding to SEQ ID NO：2 position The position of 104-106 is not identical with N-X-S or N-X-T (X represents any aminoacid), and wherein said polypeptide is attached to selected from VEGF Or PDGF family somatomedin (such as people VEGF-A (VEGF), VEGF-B, VEGF-C, VEGF-D, PIGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D) at least one ligand polypeptide.SEQ ID NO：The 2 aminoacid sequences comprising human VEGFR-3-3 Row, wherein SEQ ID NO：2 position 1-24 corresponds to presumption signal peptide and SEQ ID NO：2 forward location 25 corresponds to and lacks The presumption adult form of the receptor of presumption signal peptide less.SEQ ID NO：2 foregoing segments correspond roughly to or include human VEGFR-3-3 ECD the first immunoglobulin like domain (" D1 of VEGFR-3 ").It is expressly contemplated that comprising to produce ligand binding polypeptide Other Ig spline structure domains of VEGFR-3 of being attached of mode or other receptor construct, and combine the structure of different ligands Body is to be built for forming the receptor components of ligand binding polypeptide by change.In some variations, ligand binding polypeptide is It is based primarily upon the extracellular domain of VEGFR-3, and in other embodiments, ligand binding polypeptide is based on other receptors The fusions of the fragment of tyrosine kinase such as VEGFR-1 and/or VEGFR-2 and/or PDGFR- α and/or PDGFR- β.Main Based in the embodiment of VEGFR-3, at least one part described is the native ligand of VEGFR-3, such as VEGF-C or VEGF- D polypeptide.

In some embodiments, ligand binding polypeptide comprises and by SEQ ID NO：2 position 154-210 or SEQ ID NO：2 sequence at least 80% or at least 85% or at least 90% or at least 92% of aminoacid of position 248-314 restriction, Or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% identical the second aminoacid sequence, its In the N-terminal residue of this second aminoacid sequence connect to the C-terminal of described first aminoacid sequence directly or via spacer Residue, wherein said polypeptide is attached to somatomedin (such as people VEGF-A (VEGF), VEGF- selected from VEGF or PDGF family B, VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D) at least one ligand polypeptide.By described many The sequence of the aminoacid that the position corresponding to position 154-210 of peptide is limited corresponds roughly to or includes the ECD of human VEGFR-3-3 The second immunoglobulin like domain (" D2 of VEGFR-3 ").By described polypeptide corresponding to position 248-314 position institute Limit aminoacid sequence correspond roughly to or include human VEGFR-3-3 ECD the 3rd immunoglobulin like domain (" D3 of VEGFR-3).When the second aminoacid sequence comprises to correspond roughly to or include the sequence of the aminoacid of the D2 of VEGFR-3 When it is preferred that ligand binding polypeptide comprise with by SEQ ID NO：The sequence of the aminoacid that 2 position 248-314 limits is extremely Few 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least 97% or extremely Few 98% or at least 99% identical triamido acid sequence, wherein the N-terminal residue of this triamido acid sequence are directly or warp Connected by spacer to the C-terminal residue of the second aminoacid sequence, wherein said polypeptide is attached to selected from VEGF or PDGF family Somatomedin (such as people VEGF-A (VEGF), VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-B, PDGF-C And PDGF-D) at least one ligand polypeptide.In other words, ligand binding polypeptide comprises to correspond roughly to or includes wherein It is preferred that ligand binding polypeptide also comprises to correspond roughly in the embodiment of the aminoacid sequence of D1 and D2 of VEGFR-3 Or include the aminoacid sequence of the D3 of VEGFR-3.

Ligand binding polypeptide comprises to correspond roughly to the amino of two or more composition domains of VEGFR-3 wherein In the embodiment of acid sequence, described composition domain can be connected directly to one another or can be via one or more spacers phase Connect.Preferably, composition domain is connected by one or more spacers.In one embodiment, spacer comprises Be located at composition domain between one or more peptide sequences, its length between 1-100 aminoacid, preferably 1-50 amino Acid.In one embodiment, the spacer between two composition domains is generally connected in natural VE GFR-3 by natural Composition domain peptide sequence composition.

(for example, ligand binding polypeptide comprises to correspond roughly to or include the continuous composition domain of VEGFR-3 wherein D1-D2 or D1-D2-D3) the embodiment of aminoacid sequence in, described composition domain via one or more spacers phase Connect, described spacer comprises the one or more peptide sequences between composition domain, and its length is in 1-100 aminoacid Between, preferably 1-50 aminoacid.In one embodiment, the spacer between two composition domains is generally by as follows Peptide sequence forms, and it corresponds to the peptide sequence continuously forming domain accordingly connecting in natural VE GFR-3.In some enforcements In scheme, the spacer between two continuous composition domains comprises the ammonia with the continuous structure domain being connected in natural VE GFR-3 The sequence at least 80% of base acid or at least 85% at least 90% or at least 92% at least 95% or at least 96% or At least 97% or at least 98% or at least 99% identical aminoacid sequence.

In one embodiment, when ligand binding polypeptide comprises to correspond roughly to or include D1's and D2 of VEGFR-3 During aminoacid sequence, composition domain D1 with D2 be connected via spacer amino acids sequence, this spacer amino acids sequence with By SEQ ID NO：The sequence of the cyano group acid that 2 position 116-153 limits has at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% same Property.When ligand binding polypeptide comprises the aminoacid sequence corresponding roughly to or including D1, D2 and D3 of VEGFR-3, composition knot Structure domain D2 with D3 is connected via spacer amino acids sequence, this spacer amino acids sequence with by SEQ ID NO：2 position The sequence of the aminoacid that 211-247 limits has at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% homogeneity.

In some embodiments, purification or detached ligand binding polypeptide comprise and by SEQ ID NO：2 position 47- 210 or SEQ ID NO：2 position 25-210 or SEQ ID NO：2 position 47-314 or SEQ ID NO：2 position 25-314 or SEQ ID NO：2 position 47-752 or 47-775 or SEQ ID NO：2 position 25-752 or 25-775 limit The sequence of fixed aminoacid at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% identical aminoacid sequence, condition is corresponding to of described polypeptide SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T, and wherein said polypeptide is attached to selected from people At least one ligand polypeptide of VEGF-A, VEGF-C, VEGF-C, VEGF-D and PlGF.In a modification, corresponding to SEQ ID NO：The aminoacid of 2 position 104 be deleted and replace with another kind of aminoacid (such as L-Glutamine, aspartic acid, glutamic acid, Arginine and lysine).Position 47-210 includes the first two immunoglobulin like domain of human VEGFR-3-3 ECD, Yi Ji VEGFR-3ECD sequence between the first two Ig sample motif.Position 47-314 includes first three immune ball of human VEGFR-3-3 ECD Protein-like structural domain, and the VEGFR-3 ECD sequence between these Ig sample motifs.

More generally, the ligand binding polypeptide of the present invention comprises and in SEQ ID NO：The VEGFR-3 amino listed in 2 The fragment of acid sequence at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96%, Or at least 97% or at least 98% or at least 99% identical aminoacid sequence, the amino terminal of wherein said fragment is to be selected from SEQ ID NO：2 position 25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44, 45th, 46,47,48,49 and 50 any aminoacid；And the carboxyl terminal of wherein said fragment is selected from SEQ ID NO：2 position Put 110-775 (for example, position 110,111,112,113,114,115,116 ... .747,748,749,750,751, 752nd, 753,754,755,756,757,758,759,760,761,762,763,764,765,766,767,768,769,770, 771st, 772,773,774,775) any aminoacid, condition is described polypeptide corresponding to SEQ ID NO：2 position 104- 106 position is not identical with N-X-S or N-X-T.For by easily from description herein apparent the reason it is allowed to change Change the change of new glycosylation sequences not being introduced into not finding in wild type VEGFR-3.

In yet another aspect, ligand binding molecules as herein described are purification or detached ligand binding polypeptide, and it comprises With by corresponding to SEQ ID NO：2 position 47-115, SEQ ID NO：2 position 47-210, SEQ ID NO：2 position 47-314、SEQ ID NO：2 position 47-752 or 47-775 or SEQ ID NO：The polypeptide of 2 position 25-752 or 25-775 The aminoacid of position restriction sequence identical aminoacid sequence, condition is described polypeptide corresponding to SEQ ID NO：2 The position of position 104-106 is not identical with N-X-S or N-X-T.In a modification, corresponding to SEQ ID NO：2 position 104 Aminoacid be deleted and replace with another kind of aminoacid (such as L-Glutamine, aspartic acid, glutamic acid, arginine and bad ammonia Acid).

In yet another aspect, ligand binding molecules as herein described are purification or detached ligand binding polypeptide, and it comprises With by SEQ ID NO：The sequence of the aminoacid that 2 position 47-115 limits has at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% homogeneity Aminoacid sequence, wherein correspond to SEQ ID NO：The position of 2 polypeptide of position 104-106 is the VEGFR-3 sugar of presumption Base sequence is sub, and glycosylation sequences of wherein said presumption is disappeared from the aminoacid sequence of described ligand binding polypeptide Remove.As used within a context, term " elimination " means that change at least one position for the primary amino acid sequences (is passed through Substitute, delete or insert) to destroy N-X-T sequence subbase sequence.

Present invention additionally comprises comprising the polymer ligand binding of two or more ligand binding molecules as described herein Construct, described two or more ligand bindings divide 6 covalently or non-covalently to connect each other, thus forming dimer or polymer Structure.In some variations, connect and occur between the VEGFR-3 sample sequence of ligand binding polypeptide；In other modifications, connect Occur be attached between the heterologous polypeptide of one or two VEGFR-3 sample sequence.

Referenced herein ligand binding molecules as herein described or ligand binding polypeptide include its change as defined above Body, condition be such ligand binding polypeptide or molecule (either monomer, dimer or higher level polymer) at least contain with Ig sample motif 1 (for example, the SEQ ID NO of VEGFR-3：2 about 47-115) it is similar to or identical Ig sample motif, condition is polypeptide Corresponding to SEQ ID NO：2 position 104-106 (its N- representing in natural VE GFR-3 sequence connects glycosylation sequences) Position not identical with N-X-S or N-X-T.

In yet another aspect, this document describes a kind of ligand binding molecules, it comprises VEGFR-3 Δ for isolated or purified The ligand binding polypeptide of the first immunoglobulin like domain of N2 polypeptide.As used herein, term " VEGFR-3 Δ N2 Polypeptide " refers to and the sequence of the aminoacid of ECD that limits human VEGFR-3-3 has the polypeptide of at least 95% homogeneity, and condition is institute The part corresponding to the second presumption sub- NDT of glycosylation sequences stating the sequence of polypeptide is mutation, and so it is no longer complies with N-X- S/T SEQUON motif (for example due to the replacement at a position wherein).In some embodiments, the polypeptide bag of purification The first two immunoglobulin like domain of the N2 polypeptide of Δ containing VEGFR-3, and be preferably included between these domains VEGFR-3 sequence.In some embodiments, the polypeptide of purification comprises first three immunoglobulin of VEGFR-3 Δ N2 polypeptide Spline structure domain, and it is preferably included in the VEGFR-3 sequence between these domains.

In yet another aspect, this document describes a kind of ligand binding molecules, it is to comprise people with fusion partner merges The aminoacid sequence of the ECD fragment of the polypeptide of the ECD fragment of VEGFR-3, wherein VEGFR-3 is to modify from wild type VEGFR-3 Obtain, glycosylation sequences is connected with the N- eliminating second presumption of wild type VEGFR-3, wherein said polypeptide soluble is in human blood In clear and with reference to people VEGF-C or people VEGF-D；And wherein said fusion partner improves dissolubility or the serum of ECD fragment Half-life (for example, compared to the same clip not merged with fusion partner).In some embodiments, fusion partner is Heterologous polypeptide.

In some embodiments, described ligand binding polypeptide or ligand binding molecules combine people VEGF-C or people VEGF- D.In some embodiments, described ligand binding polypeptide or ligand binding molecules are to express the cell of VEGFR-3 on surface The stimulation that middle suppression VEGF-C or VEGF-D is attached to VEGFR-3 or suppresses the VEGFR-3 by VEGF-C or VEGF-D mediation.Thorn Sharp inhibitory action can for example be passed through to measure receptor phosphorylation, or passes through to measure external or cells in vivo growth, or by survey Measure internal angiogenic growth or the level of other tissue changes to show.

Described ligand binding molecules preferably with about 1nM or less (for example, 500pM, 400pM, 300pM, 200pM, 100pM, 50pM, 10pM or less) K_dIn conjunction with people VEGF～C.Described ligand binding molecules preferably with about 5nM or less (for example, 2nM, 1nM, 500pM, 400pM, 300pM, 200pM, 100pM, 50pM, 10pM or less) K_dIn conjunction with people VEGF-D.

In yet another aspect, purification or detached ligand binding molecules comprise SEQ ID NO：3 aminoacid 22-290, SEQ ID NO：3 aminoacid 23-290, SEQ ID NO：3 cyano group acid 23-537 or SEQ ID NO：3 aminoacid 22- 537.In other modifications, described molecule comprises and any one of above-mentioned sequence at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% identical Aminoacid sequence, condition is the sequence corresponding to VEGFR-3 N2 sequence (aligning) of polypeptide is not glycosylation sequences.

As described in this article, ligand binding molecules can be chemically modified with (for example, glycosylation, Pegylation Deng) to give desirable characteristics, maintain its specific somatomedin binding property simultaneously.The Ig spline structure domain I-III of VEGFR-3 The N- glycosylation site (being herein known respectively as N1, N2, N3, N4 and N5 sequence of VEGFR-3) comprising five presumptions. N1 corresponds to SEQ ID NO：2 aminoacid 33-35；N2 corresponds to SEQ ID NO：2 amino acid/11 04-106；N3 corresponds to SEQ ID NO：2 hydrogen-based acid 166-168；N4 corresponds to SEQ ID NO：2 hydrogen-based acid 251-253, and N5 corresponds to SEQ ID NO：2 aminoacid 299-301.In some embodiments, ligand binding molecules as herein described are included in this molecule Modification in N2 sequence.For example, in some embodiments, correspond to SEQ ID NO in ligand binding molecules：2 position 104 aminoacid is deleted and replaces with another kind of aminoacid.It is preferred that conservative substitutes.In some embodiments, right Should be in SEQ ID NO：The aminoacid of 2 position 104 be deleted and replace with selected from L-Glutamine, aspartic acid, glutamic acid, The aminoacid of the group of arginine and lysine composition.SEQ ID NO wherein：The sub reality modified as mentioned above of 2 N2 sequence Apply in scheme, SEQ ID NO：The aminoacid sequence of 2 N1, N3, N4 and N5 sequence is preferably unchanged.

As described herein, ligand binding molecules directly or via connexon can connect fusion partner.Merge spouse Body can be any heterologous component of the function of strengthening ligand binding molecules.Exemplary peptides fusion partner comprises immunoglobulin Constant domain (Fc) fragment.In some embodiments, immunoglobulin constant fragment comprises and SEQ ID NO：3 amino Sour 306-537 has at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96%, Or at least 97% or at least 98% or at least 99% homogeneity or the aminoacid sequence with 100% homogeneity.

As described in this article, ligand binding molecules can be chemically modified for example to promote to connect to fusion spouse Body (such as, heterologouss peptide) or imparting desirable characteristics (such as, increase serum half-life, increase in an aqueous medium Dissolubility and allow targeting specific cell colony, such as tumor cell or retina cell).

In some embodiments, ligand binding molecules as herein described optionally comprise be attached to this molecule at least one Individual peg moiety.For example, in some embodiments, the PEG of about 20-40kDa is attached to the amino terminal of ligand binding molecules.

In some embodiments, ligand binding molecules as described herein optionally comprise fusion partner such as example Connect as heterologouss peptide to the connexon of ligand binding polypeptide, such as factor Xa connects subsequence PIEGRGGGGG (SEQ ID NO：4).In other embodiments, ligand binding molecules comprise polypeptide, and the C-terminal aminoacid of wherein ligand binding polypeptide passes through Peptide bond is directly attached to the N-terminal aminoacid of heterologouss peptide fusion partner.In some embodiments, ligand binding polypeptide and Heterologouss peptide is attached (directly or via connexon polypeptide) by amide bond, thus forming Single polypeptide chain.

In some variations, ligand binding molecules comprise to instruct molecule from the signal peptide of the cell secretion expressing this molecule.

The nucleic acid (polynucleotide) of the present invention includes the nucleic acid of coded polypeptide ligand binding molecules, and it can be used for such as base Application because of the restructuring vivoexpression for the treatment of and polypeptide ligand binding molecule.In some embodiments, nucleic acid is purified or divides From.In some embodiments, polynucleotide comprise to may be operably coupled to opening of the nucleotide sequence of coded polypeptide further Transcription in host cell for the sequence of promoter sequences, wherein this promoter sequence promotion coded polypeptide.Polynucleotide are acceptable Comprise polyadenylation signal sequence.In some variations, described nucleic acid has the core similar to encoding wild type human VEGFR-3-3 The coding nucleotide sequence of acid.For example, described nucleic acid comprises and SEQ ID NO：Human VEGFR-3-3 sequence listed in 1 or its piece Section has at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least The coding nucleotide sequence of 97% or at least 98% or at least 99% homogeneity.For example, in coding SEQ ID NO：2 In the case of the nucleotide sequence of aminoacid 47-314 (modifying at N2 sequence), exemplary nucleic acid comprises and SEQ ID NO： Human VEGFR-3-3 sequence listed in 1 position 157 to 961 (corresponding to codon 47-314) has at least 80% or at least 85% or at least 90% or at least 92% or at least 95% or at least 96% or at least 97% or at least 98% or at least The coding nucleotide sequence of 99% homogeneity.

The carrier comprising polynucleotide is also the aspect of the present invention.Examples of such carriers can comprise to be operably connected to coding The expression control sequenc of the sequence of polypeptide.In some variations, select carrier to optimize in selected host cell (as eucaryon place Chief cell) in in-vitro recombination expression.In some variations, carrier is selected for delivering in vivo.For example, carrier can select The group of free slow virus carrier, gland relevant viral vector, adenovirus vector, liposome vectors and combinations thereof composition.Real at some Apply in scheme, carrier comprises replication-defective adenoviral, described adenoviruss comprise to may be operably coupled to promoter and both sides There are the polynucleotide of adenoviruss polynucleotide sequence.

The host cell that comprises polynucleotide, carrier and other nucleic acid and use them to expression and isolating ligands combine The method of molecule is also the aspect of the present invention.It is expressly contemplated that comprising to encode ligand binding polypeptide as herein described or part knot Close the eukaryotic host cell of the polynucleotide of molecule, including Chinese hamster ovary (CHO) cell and other mammal cell line. In some variations, select or engineered cells system introduces people or proper manners with glycosylation sequences of the polypeptide producing in cell Glycosylation.

Also contemplate the method preparing ligand binding polypeptide as herein described or molecule.(such method can also be described Polynucleotide for the present invention or the purposes of cell.) in one aspect, methods described is included therein expression by described many nucleoside Grow under conditions of the described ligand binding polypeptide of acid encoding or ligand binding molecules by polynucleotide as herein described or Carrier conversion or the cell of transfection.In some embodiments, methods described further includes from described cell or described cell Growth medium purification or isolating ligands Binding peptide or ligand binding molecules.In some embodiments, methods described is entered One step includes one or more Polyethylene Glycol (PEG) or other parts are attached to be expressed and purification/detached polypeptide.

Present invention additionally comprises comprising polypeptide, ligand binding molecules or encoding their nucleic acid together with pharmaceutically acceptable dilute Release the compositionss of agent, adjuvant or carrier medium.In some embodiments, described compositionss are formulated for local application extremely Eyes (for example, external preparation such as ointment or eye drop, or the preparation being suitable for intravitreal injection).In other embodiments In, described compositionss are formulated for local application and have passed through the surgical operation therefrom organ of tumor resection or group to tumor or Knit, for example, by intravenous injection or be injected directly in affected tissue, or applied by device in lumpectomy procedure.

Present invention additionally comprises it is (polypeptide, molecule and construct, many using material described herein in treating and preventing environment Nucleotide and carrier, transformed cell, compositionss) inhibition of angiogenesis (blood vessel and/or lymphatic vessel) method.As described herein Using method in addition can be characterized as being various materials for specifying the purposes of indication.Exemplary treatment experimenter includes People and other primate, domestic animal (for example, cattle, horse, pig), zoo animal (for example, felid, Canis animalss, pachydermia Animal, animal in deer family), and house pet (for example, Canis familiaris L., cat) and rodent.

In some variations, the present invention includes the method that the new vesselses in a kind of suppression experimenter are formed, methods described Including to experimenter apply consumption can effectively suppress in above-mentioned material that the new vesselses in experimenter are formed or compositionss times One.Exemplary pathogenic neovascular condition of illness includes those condition of illness and the tumor angiogenesis of eyes.

In some variations, the method that the present invention includes the retinal neovascularazation in a kind of suppression experimenter, institute The method of stating include to experimenter apply consumption can effectively suppress the retinal neovascularazation in experimenter as retouched herein The material stated or compositionss.In related version, the present invention includes a kind for the treatment of with relevant with retinal neovascularazation The experimenter of eye disorders method, methods described include to experimenter apply consumption can effectively suppress the view in experimenter Film new vesselses formed as described herein with material outlined above or compositionss.For example, combine as described herein Thing is locally applied to the eyes of experimenter, such as passes through eye drop or other local application, passes through to apply (for example, under conjunctiva Injection), by intravitreal injection or pass through intravitreal implant.

Compositionss are preferably attached to VEGF-C and/or VEGF-D in effective suppression subject eye or stimulate in eyes Cell or eyes blood vessel in expression the amount of VEGFR-2 and/or VEGFR-3 and repeat administration frequency and the persistent period Apply.This beneficial effect can be according to eye pathologies situation (such as degeneration of macula, diabetic retinopathy and macula lutea hair Thin vasodilation) being slowed or shut off of deterioration/progress, or the improvement of clinical symptoms is weighing.Can also be by monitoring target group Knit the angiogenic growth of inside and around to observe beneficial effect.

Method described herein and purposes can be come in fact with other therapeutic agents or treatment (for example, radial shape) combination Apply, as herein described in detail.

Invention as described herein method (or purposes) can utilize one or more ligand binding molecules, or using at least One ligand binding molecules (is such as used for treating cancer or the nursing mark for treating the rear portion of eye disorders with another kind for the treatment of Quasi- treatment) combination implementing.Ligand binding molecules are in the embodiment at the rear portion for treating ocular disorder wherein, in advance Other treatments of phase include focal argon laser treatment (or light coagulates), scattering laser treatment (or full retinal photocoagulation) and vitreous excision Art.In some embodiments, antibiotic is also administered to accept the experimenter for the treatment of.

Wherein ligand binding molecules as herein described be in the embodiment for the treatment of cancer it is contemplated that nursing standard Therapy includes antisense RNA, RNA interference, bi-specific antibody, other Antibody types and targeting somatomedin and/or its receptor Small molecule such as chemotherapeutics.Cytokine, radiotherapy dose or radiotherapy can also be with ligand binding molecules as herein described It is applied in combination.Chemotherapeutant or radiotherapy dose can be the members of the reagent classification including following material：Antimetabolite； DNA damage agent；Cytokine or somatomedin；Covalently DNA bound drug；Topoisomerase enzyme inhibitor；Antimitotic agent；Anti- Anti-neoplastic antibiotic；Differentiation agent；Alkylating agent；Methylating agent；Hormone or hormone antagonist；Chlormethine；Radiosensitizer；And photosensitizer. Describe the instantiation of these reagent in other places of the application.Combined therapy is preferably synergistic, but they Need not be such, and additional treatment is also considered as the aspect of the present invention.

Except their purposes in method, described ligand binding molecules can also be with other therapeutic combinations or be packaged in In test kit or as unit dose.Tumor disease is not can be using unique disease of ligand binding molecules treatment.Described join Body binding molecule can serve as the therapeutic agent of any disease related to abnormal vascular generation or lymphatic vessel generation.

The present invention can also be described in embodiment additionally below：

A kind of purification or detached ligand binding polypeptide, it comprises and by SEQ ID NO：2 position 47-115 limits The sequence of aminoacid has the aminoacid sequence of at least 95% homogeneity, and condition is described polypeptide corresponding to SEQ ID NO：2 Position 104-106 position not identical with N-X-S or N-X-T, wherein said polypeptide is attached to selected from people VEGF-C, VEGF-D At least one ligand polypeptide with PlGF.

Purification according to paragraph [0048] or detached ligand binding polypeptide, it comprises and by SEQ ID NO：2 The sequence of the hydrogen-based acid that position 47-210 limits has the hydrogen-based acid sequence of at least 95% homogeneity, and condition is the right of described polypeptide Should be in SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T.

Purification according to paragraph [0048] or detached ligand binding polypeptide, it comprises and by SEQ ID NO：2 The sequence of the hydrogen-based acid that position 47-314 limits has the hydrogen-based acid sequence of at least 95% homogeneity, and condition is the right of described polypeptide Should be in SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T.

Purification according to paragraph [0048] or detached ligand binding polypeptide, it comprises and by SEQ ID NO：2 The sequence of the hydrogen-based acid that position 47-752 limits has the hydrogen-based acid sequence of at least 95% homogeneity, and condition is the right of described polypeptide Should be in SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0051], its reservation is right Should be in SEQ ID NO：2 position 33-35, SEQ ID NO：2 position 166-168, SEQ ID NO：2 position 251-253 With SEQ ID NO：The sub- site of four N- glycosylation sequences of 2 position 299-301.

Purification according to paragraph [0052] or detached ligand binding polypeptide, it is in described four N- glycosylation sequences Sub- site is glycosylated.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0053], it is solvable Property polypeptide.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0054], its comprise with By SEQ ID NO：2 position 47-115, SEQ ID NO：2 position 47-210, SEQ ID NO：2 position 47-314 or SEQ ID NO：The sequence identical aminoacid sequence of the aminoacid that 2 position 47-752 limits, condition is the right of described polypeptide Should be in SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0055], it combines people VEGF-C or people VEGF-D.

Purification according to paragraph [0056] or detached ligand binding polypeptide, it is on its surface to express VEGFR- In 3 cell, suppression VEGF-C or VEGF-D is attached to VEGFR-3 or suppresses by the VEGFR-3's of VEGF-C or VEGF-D mediation Stimulate.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0057], it is with 1nM Or less Kd combines people VEGF-C.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0057], it is with 5nM Or less Kd combines people VEGF-D.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0059], wherein said SEQ ID NO is corresponded in polypeptide：The aminoacid of 2 position 104 is deleted or substituted with another kind of hydrogen-based acid.

Purification according to paragraph [0055] or detached ligand binding polypeptide, wherein in SEQ ID NO：2 position Aminoacid at 104 is deleted or substituted with forming selected from L-Glutamine, aspartic acid, glutamic acid, arginine and lysine Group another kind of aminoacid.

According to any one described purification or detached ligand polypeptide, wherein said polypeptide in paragraph [0048] to [0056] Comprise SEQ ID NO：3 aminoacid 23-290.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0062], it is further Comprise signal peptide.

According to any one described purification or detached ligand binding polypeptide in paragraph [0048] to [0063], it is further Comprise at least one polyalkylene glycol moiety being attached to described polypeptide.

Purification according to paragraph [0064] or detached ligand binding polypeptide, it comprises to be attached to the ammonia of described polypeptide The Polyethylene Glycol of the about 20-40kDa of base end.

A kind of ligand binding molecules, its comprise connect to heterologouss peptide according in paragraph [0048] to [0065] any one Described ligand binding polypeptide.

Ligand binding molecules according to paragraph [0066], wherein said heterologouss peptide comprises the constant knot of immunoglobulin Structure domain fragment.

Ligand binding molecules according to paragraph [0066], wherein said immunoglobulin constant domains fragment is IgG constant domain fragment.

Ligand binding molecules according to paragraph [0067], wherein said immunoglobulin constant fragment comprises SEQ ID NO：3 aminoacid 306-537.

Ligand binding molecules according to paragraph 19, wherein said ligand binding molecules comprise SEQ ID NO：3 ammonia Base acid 22-537.

According to any one described ligand binding molecules in paragraph [0066] to [0070], it optionally comprises will be described different Property peptide in source connects to the connexon of described ligand binding polypeptide.

According to any one described ligand binding molecules in paragraph [0066] to [0070], it comprises wherein said part knot The C-terminal aminoacid of conjunction polypeptide is directly attached to the polypeptide of the N-terminal aminoacid of described heterologouss peptide by peptide bond.

According to any one described ligand binding molecules in paragraph [0066] to [0072], it is described that it comprises guidance further Molecule is from the signal peptide of the cell secretion expressing described molecule.

Ligand binding molecules according to paragraph [0066], wherein said molecule is included in SEQ ID NO：List in 3 Aminoacid sequence.

According to any one described ligand binding molecules, wherein said ligand binding polypeptide in paragraph [0066] to [0070] Connected by amide bond with described heterologouss peptide and form Single polypeptide chain.

Appoint according to any one described ligand binding polypeptide in paragraph [0048] to [0065] or according in paragraph 19 to 28 Ligand binding molecules described in one, it comprises detectable label further.

A kind of conjugate, it comprises according to any one described ligand binding polypeptide in paragraph 1 to 18 or according to paragraph [0066] any one described ligand binding molecules and chemotherapeutant in [0075].

A kind of detached polynucleotide, it comprises coding according to any one described ligand binding polypeptide in paragraph 1 to 18 Or the coding nucleotide sequence according to any one described ligand binding molecules in paragraph [0066] to [0075].

Polynucleotide according to paragraph [0078], it comprises to may be operably coupled to described coding nucleotide further The promoter sequence of sequence, to promote transcription in host cell for the described coding nucleotide sequence.

A kind of carrier, it comprises paragraph [0078] or the polynucleotide of paragraph [0079].

Carrier according to paragraph [0080], it comprises to may be operably coupled to described coding nucleotide sequence further Expression control sequenc.

Carrier according to paragraph [0080], wherein said carrier be selected from slow virus carrier, gland relevant viral vector, The group of adenovirus vector, liposome vectors and combinations thereof composition.

Carrier according to paragraph [0080], wherein said carrier comprises replication-defective adenoviral, described adenoviruss Comprise to may be operably coupled to promoter and both sides have the polynucleotide of adenoviruss polynucleotide sequence.

A kind of detached cell or cell line, its by the polynucleotide according to paragraph [0078] or [0079] or according to Carrier described in [0083] for the paragraph [0080] converts or transfects.

Detached cell according to paragraph [0084] or cell line, it is eukaryotic cell.

Detached cell according to paragraph [0084] or cell line, it is people's cell.

Detached cell according to paragraph [0084] or cell line, it is Chinese hamster ovary (CHO) cell.

A kind of method preparing ligand binding polypeptide, it is included therein expression and joins described in described polynucleotide encoding Grow under conditions of body Binding peptide or ligand binding molecules according to any one described cell in paragraph [0084] to [0087].

Method according to paragraph [0088], it further includes the growth medium from described cell or described cell Purification or the described ligand binding polypeptide of separation or ligand binding molecules.

A kind of compositionss, the ligand binding that it comprises according to any one described purification in paragraph [0048] to [0076] is many Peptide or ligand binding molecules and pharmaceutically acceptable diluent, adjuvant, excipient or supporting agent.

A kind of compositionss, its comprise according to any one described polynucleotide in paragraph [0078] to [0083] or carrier and Pharmaceutically acceptable diluent, adjuvant, excipient or supporting agent.

Compositionss according to paragraph [0090] or paragraph [0091], it is formulated for local application.

Compositionss according to paragraph [0092], it is solid, paste, ointment, gel, liquid, aerosol, spraying Agent, polymer, thin film, emulsion or suspension formation.

Compositionss according to paragraph [0090] or paragraph [0091], it is formulated for intravitreal administration.

The method that a kind of new vesselses in suppression experimenter are formed, methods described includes suppressing described experimenter with effective In new vesselses formed amount to described experimenter apply according to any one described combination in paragraph [0090] to [0094] Thing.

A kind of method of the retinal neovascularazation in suppression experimenter, methods described includes suppressing described with effective The amount of the retinal neovascularazation in experimenter is applied according to arbitrary in paragraph [0090] to [0094] to described experimenter Individual described compositionss.

A kind of method with the experimenter of eye disorders relevant with retinal neovascularazation for treatment, methods described Apply according to paragraph to described experimenter including with effective amount suppressing the retinal neovascularazation in described experimenter [0090] any one described compositions in [0095].

One kind is used for suppressing experimenter in need according to any one described compositions in paragraph [0090] to [0094] In new vesselses form the purposes as retinal neovascularazation or tumor angiogenesis.

According to any one described method or purposes in paragraph [0096] to [0098], wherein said compositionss are locally applied Eyes for described experimenter.

Method according to paragraph [0099] or purposes, wherein pass through intravitreal injection applying said compositions.

Method according to paragraph [0099] or purposes, wherein by local application come applying said compositions.

According to any one described method or purposes in paragraph [0096] to [00101], wherein said compositionss are to have Effect suppresses VEGF-C and/or VEGF-D in the eyes of described experimenter to be attached to or stimulate the blood of cell in eyes or eyes In pipe, the amount of VEGFR-2 and/or VEGFR-3 of expression is applying.

Method according to paragraph [0097] or [0098] or purposes, wherein said eye disorders are selected from macula lutea and become Property, diabetic retinopathy and macula lutea telangiectasis composition group.

According to any one described method or purposes in paragraph [0096] to [00103], it further includes to be subject to described Examination person's administration of antibiotics.

Method according to paragraph [00104], wherein said antibiotic is selected from following formed group：A meter Ka Star, gentamycin, kanamycin, neomycin, netilmicin, streptomycin, tobramycin, teicoplanin, vancomycin, Zitromax Element, clarithromycin, clarithromycin, dirithromycin, erythromycin, Roxithromycin, triacetyloleandomycin, amoxicillin, ampicillin, XiLin is pricked in azlocillin, Carbenicillin, chlorine, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, penicillin, piperazine draw XiLin, ticarcillin, bacitracin, colistin, polymyxin B, Ciprofloxacin, enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, norfloxacin, Ofloxacin, trovafloxacin, mafenide, sulfacetamide, sulfamethizole, willow Nitrogen sulfapyridine, ganda, trimethoprim, sulfamethoxazole, demeclocycline, doxycycline, minocycline, Oxytetracycline and tetracycline.

Method according to paragraph [0095] or [0098] or purposes, wherein said experimenter has been diagnosed as with swollen Tumor, and wherein said compositionss are effectively to suppress the amount of the new vesselses formation in described tumor to apply.

Method according to paragraph [00106] or purposes, wherein said compositionss be applied topically to described tumor or Pass through the organ or tissue of surgical operation therefrom tumor resection.

Method according to paragraph [00106] or purposes, wherein said compositionss are to suppress described experimenter with effective Tumor in VEGF-C and/or VEGF-D be attached to or stimulate in tumor cell VEGFR-2 and/or VEGFR-3 of expression Amount applying.

The brief summary of the invention of the present invention is not intended to as restricted or comprehensively, and in the drawings and specific embodiments bag Include and in embodiment, describe other embodiments.All such embodiments are all the aspects of the present invention.Additionally, rising in order to succinct See, do not repeat to be applied to the various details of multiple embodiments for each embodiment.Reflect embodiment party as herein described The combination of case and the change rearranging are intended to the aspect as the present invention.In addition to the foregoing, the present invention is included with any side All embodiments of the formula present invention more narrower than specifically mentioned range of variations above are as other side.For example, for quilt It is described as the aspect of genus or scope, each subgenus, subrange or species are clearly thought of as embodiment of the present invention.

Brief description

Figure 1A shows the PK curve of the VGX-300 and VGX-301- Δ N2 being produced by instantaneous CHO expression.Figure 1B shows The PK curve of the VGX-300 and VGX-301- Δ N2 being produced by instantaneous HEK expression.

Fig. 2 shows that VGX-300 and VGX-301- Δ N2 is all specifically bound to both VEGF-C and VEGF-D.

Fig. 3 shows that VGX-300 blocks a) VEGFR-2 and b) combination of VEGFR-3 and VEGF-C and VEGF-D and crosslinking.

Fig. 4 shows VGX-300 and VGX-300-N2 blocking VEGF R-3 and a) VEGF- in the Ba/F3 analysis based on cell The combination of C and b) VEGF-D and crosslinking.Data point represents the meansigma methodss ± SD of n >=2.

Fig. 5 shows pharmacokineticss after intravitreal administration for the rabbit and eye bio distribution.

Specific embodiment

The present invention is based partially on the fragment of the ECD of confirmer VEGFR-3, and (it has one in the N- polysaccharide region of ECD Individual or modify) can be attached to and neutralize people VEGF-C and people VEGF-D in vitro, and age-related macular can also be suppressed Vascular development in the animal model of degeneration.

Growth factor receptor tyrosine kinase generally comprises three main domains：Extracellular domain (ECD), cross-film knot Structure domain and intracellular domain.ECD binding partner, receptor is anchored into cell membrane by membrane spaning domain, and intracellular domain tool There are one or more tyrosine kinase enzymatic domains, and interact with downstream signaling molecules.Vascular endothelial growth factor Sub- receptor (VEGFR) combines its part by its ECD, and ECD is by multiple immunoglobulin like domain (Ig spline structure domain) group Become.Ig spline structure domain utilizes title " D# " to identify.For example, " D1 " refers to an Ig spline structure domain of special receptor ECD.“D1-3” Refer to containing three Ig spline structure domains at least starting most, interleaving and between the domain 1 of particular ligand binding molecule and 2 and 2 and 3 The construct of sequence.

Not binding partner (somatomedin) institute is required for the complete ECD of VEGFR.The ECD of VEGFR-3 has six complete Ig A spline structure domain and cleaved Ig spline structure domain -- the D5 of VEGFR-3 is cracked into two sulfur leaving VEGFR-3 upon translation Bonded subunit.Veikkola, T. et al., Cancer Res.60：203-212(2000).In some embodiments, contain The receptor fragments at least start most three Ig spline structure domains of this family be enough to binding partner.Can in conjunction with VEGF-C and VEGF-D, thus suppressing VEGF-C or VEGF-D activity or being also disclosed in via the soluble recepter of VEGFR-3 signal transduction In WO2000/023565, WO2000/021560, WO2002/060950 and WO2005/087808, disclosures of these documents It is incorporated herein by reference in their entirety.Those through Δ N2 sequence change and optional as herein described other modify can Dissolubility receptor is considered the aspect of the present invention.

Table 1 defines the boundaries in the Ig spline structure domain of human VEGFR-3-3.These borders are critically important, because what these selected Border can be used for forming ligand binding molecules, and therefore can affect the binding property of final construct.

Table 1：The immunoglobulin like domain of human VEGFR-3-3

Complete ECD extends to SEQ ID NO：At 2 about position 775.

The soluble receptor construct that can be used as the ligand binding molecules of VEGF-C or VEGF-D preferably comprises as in table 1 At least one Ig spline structure domain of described VEGFR-3, up to seven.Ligand binding molecules optionally will comprise position and lean on most Sequence before the Ig spline structure domain of N-terminal, optionally will be contained in the sequence of the another side in Ig spline structure domain near C-terminal, and Optionally also will comprise the sequence between Ig spline structure domain.Further contemplate (such as) have one or more amino acid replacements, interpolation or Delete the variant of an amino acid residue.In some embodiments, ligand binding molecules comprise human VEGFR-3-3 containing people The fragment at least starting three Ig spline structure domains most of VEGFR-3.

In some embodiments, ligand binding molecules are the polypeptides of the part containing human VEGFR-3-3 ECD, wherein said Part is attached to one of people VEGF-C and people VEGF-D or two, and comprises at least first, second He of VEGFR-3 ECD The aminoacid sequence of the ECD fragment in the 3rd Ig spline structure domain, wherein VEGFR-3 is to be modified by wild type VEGFR-3, to eliminate open country Second presumption N- of raw type VEGFR-3 connects glycosylation sequences and obtains, and wherein said polypeptide lacks VEGFR-3 Ig sample knot Structure domain 4-7 and preferably any membrane spaning domain and preferably any intracellular domain.

In some embodiments, ligand binding molecules comprise aminoacid sequence and human VEGFR-3-3 polypeptide (SEQ ID NO： 2) or the similar or identical polypeptide of its fragment, condition is that described ligand binding molecules correspond to SEQ ID NO：Listed people in 2 The position of the position 104-106 of VEGFR-3 polypeptide be different from N-X-S or N-X-T, wherein said ligand binding molecules combine one or The somatomedin of multiple groups selected from people VEGF-C and people VEGF-D composition.Described fragment is minimum to be comprised to join with reference to described enough The VEGFR-3 sequence of body, and intact receptor can be comprised.ECD fragment is preferred.Preferred polypeptide is had at least 80% and is joined with it Body binding fragment identical aminoacid sequence.Similarity higher (such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%th, 97%, 98%, 99%, 99.5% or 100%) fragment is highly preferred.Be also contemplated by similarity be 35%, 40%, 45%th, 50%, 55%, 60%, 65%, 70% and 75% fragment.Or, can be by coding and corresponding coding VEGFR-3 The ability of the polypeptide of the complementary sequence hybridization of the nucleotide sequence of the cDNA sequence of receptor defines the similar polypeptide of a class.

Term " homogeneity " refers to that two or more peptide molecules or two or more nucleic acid divide as known in the art Relation between the sequence of son, this is measured by comparative sequences.In the art, " homogeneity " also refers to serial correlation degree, root Can be nucleic acid molecules or peptide sequence according to concrete condition, this is by two or more nucleotide or two or more ammonia Matching between base acid sequence string determines." homogeneity " is to weigh smaller sequence in two or more sequences to align with gap (if any) the identical match percentage ratio between, gap alignment is by the specific mathematical model of computer program (namely " algorithm ") process.The algorithm being suitable for measuring homogeneity percentage of the present invention includes BLASTP and BLASTN, using the most universal and be The default parameterss that people accepts.

Ligand binding molecules can also be described as the SEQ ID NO having by with the ligand-binding fragment of coding VEGFR-3： The aminoacid sequence of 1 fragment at least 80% identical nucleic acid sequence encoding, condition is that described ligand binding molecules correspond to The position of the position 104-106 of coding ligand-binding fragment of VEGFR-3 is different from N-X-S or N-X-T.Higher (the example of similarity As 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) nucleic acid Fragment is highly preferred.Being also contemplated by similarity is 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% and 75% Fragment.For example, it is preferable to ligand binding molecules comprise with reference to people VEGF-C and/or people VEGF-D, and by described herein suitable With SEQ ID NO under degree or high stringency：The nucleotide sequence coded aminoacid sequence of 1 complementary sequence hybridization.

In some embodiments, ligand binding molecules are included containing human VEGFR-3-3 (SEQ ID NO：2) fragment many Peptide, described fragment is selected from group consisting of：SEQ ID NO：2 position 1-226 or 25-226, SEQ ID NO：2 position Put 1-229 or 25-229 and SEQ ID NO：2 position 1-329 or 25-229, condition is the coding ligand binding piece of VEGFR-3 The position 104-106 of section is different from N-X-S or N-X-T.In some embodiments, ligand binding molecules be comprise human VEGFR-3- 3(SEQ ID NO：2) polypeptide of fragment, described fragment is selected from group consisting of：SEQ ID NO：2 position 47- 224、SEQ ID NO：2 position 47-225, SEQ ID NO：2 position 47-226, SEQ ID NO：2 position 47-227, SEQ ID NO：2 position 47-228, SEQ ID NO：2 position 47-229, SEQ ID NO：2 position 47-230, SEQ ID NO：2 position 47-231, SEQ ID NO：2 position 47-232, SEQ ID NO：2 position 47-236, SEQ ID NO：2 position 47-240 and SEQ ID NO：2 position 47-245, condition is the position of the coding ligand-binding fragment of VEGFR-3 Put 104-106 and be different from N-X-S or N-X-T.In some embodiments, ligand binding molecules are to comprise human VEGFR-3-3 (SEQ ID NO：2) polypeptide of fragment, described fragment is selected from group consisting of：SEQ ID NO：2 position 47-314, SEQ ID NO：2 position 47-210 and SEQ ID NO：2 position 47-247, condition is the coding ligand-binding fragment of VEGFR-3 Position 104-106 be different from N-X-S or N-X-T.

Ligand binding molecules can also be described as having and SEQ ID NO：In 3, listed aminoacid sequence is similar or identical Aminoacid sequence.Preferably polypeptide has at least 80% and SEQ ID NO：The similar or identical ammonia of listed aminoacid sequence in 3 Base acid sequence, condition is SEQ ID NO：In 3, the position 80-82 of listed polypeptide is different from N-X-S or N-X-T, wherein part knot Close the group somatomedin that molecule combines one or more and is selected from people VEGF-C and people VEGF-D composition.Similarity higher (such as 85%, 90%th, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) polypeptide is height Preferably.Be also contemplated by similarity be 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% and 75% fragment.Or Person, can be many with the complementary sequence hybridization of the nucleotide sequence of the cDNA sequence of corresponding coding VEGFR-3 receptor by encoding The ability of peptide defines the similar polypeptide of a class.

In some embodiments, ligand binding molecules comprise the NO of ID containing SEQ：The aminoacid of 3 aminoacid 22-290 Sequence.In some embodiments, ligand binding molecules comprise the NO of ID containing SEQ：The aminoacid sequence of 3 aminoacid 23-290 Row.In some embodiments, ligand binding molecules comprise SEQ ID NO：3 aminoacid 22-537 or SEQ ID NO：3 Aminoacid 23-537 or SEQ ID NO：3 amino acid/11-537.

As used herein term " composition domain " refer in ligand binding molecules derived from or be based on receptor protein The domain of the partly interior protein domain in the extracellular of matter.For example, VEGFR-3 (D1-D7) and other tyrosine kinase are subject to Each Ig- domain of body family member (for example, such as VEGFR-1 and VEGFR-2) constitutes composition domain.Group is mentioned herein Become the insertion of functional characteristic, the deletion that domain includes complete Natural wild-type domain and its substantially retains complete domain And/or alternative variations.To it will be readily apparent to those skilled in the art that being, it is possible to obtain said structure domain (for example, Ig- Domain) many variants, they will retain with wild type domains identical functional characteristic.

The growth factor receptorses that ligand binding molecules can be derived include splice variant and Natural allelic modification.Equipotential Genetic mutation is known in the art, and represent alternative form or comprise the replacement of one or more nucleotide, deletion or Add, but be not result in that the nucleotide sequence that any substantial function changes in coded polypeptide.The exemplary allele of VEGFR-3 Variant (such as http in the literature<colon>//www.uniprot.org/uniprot/P35916) reported, and wrap Include the position 149,378,494,527 and 641 in ECD.Standard method can be readily used and generate and such comprise polynucleotide Direct mutagenesises or specificity enzymatic lysis and connection polypeptide.Similarly it is considered to use the peptidomimetic chemical combination retaining binding activity Thing or wherein one or more amino acid residues are by the compound of alpha-non-natural amino acid or amino acid analogue displacement.Preferably, when During using aminoacid replacement, replacement is conservative, that is, aminoacid is similar to by a size and has similar charge property Amino acid replacement.As used herein, term " conservative replaces " represents with another residue substitutions amino being biologically similar to Sour residue.The example of conservative replaces include with a hydrophobic residue for example isoleucine, L-Valine, leucine, alanine, half Cystine, glycine, Phenylalanine, proline, tryptophan, tyrosine, nor-leucine or methionine replace another hydrophobicity Residue, or replace another polar residues with polar residues, such as use arginine for lysine, replace Radix Asparagi with glutamic acid Propylhomoserin, or with glutamin for asparagine etc..The Neutral hydrophilic amino acids that can replace each other include agedoite, paddy Glutamine, serine and threonine.Term " conservative replaces " also includes unsubstituted using substituted amino acid replacement Aminoacid.

Or, conserved amino acid can be as Lehninger, (Biochemistry, the second edition；Worth Publishers, Inc.NY：NY, the 71-77 page (1975)) described in classify, as shown below：

Nonpolar (hydrophobic)

A. aliphatic series：A, L, I, V, P,

B. aromatics：F, W,

C. sulfur-bearing：M,

D. border：G.

Not charged-polarity

A. hydroxyl：S, T, Y,

B. amide：N, Q,

C. sulfydryl：C,

D. border：G.

Positively charged (alkaline)：K、R、H.

Negatively charged (acid)：D、E.

For avoiding doubt, " composition domain " includes the domain of the D1 of corresponding VEGFR-3, wherein SEQ ID No：2 (such as) is mutated N-X-S/T sequence subbase sequence at the 104-106 of position due to replacement.

Wherein ligand binding molecules comprise multiple composition domains (composition domain D1, D2 of such as VEGFR-3 and D3, in embodiment), described composition domain can be connected to each other directly, or can via one or more spacers even Connect.In general, term " spacer " means one or more molecules, such as nucleic acid or aminoacid, or non-peptide moiety, such as poly- second Glycol or disulphide bridgeses, it is inserted between one or more composition domains, forms covalent bond.Spacer sequence can be used There is provided concerned expectation site in inter-module, to simplify operation.May also provide spacer to strengthen the part of host cell The expression of Binding peptide, and then reduce sterically hindered so that assembly or assembly group can obtain its optimal tertiary structure and/or fit Local and its target molecule interacts.For the method in spacer and determination expectation interval area, see, for example, George etc. People (2003) Protein Engineering 15：871-879, is clearly incorporated herein by quoting.Spacer sequence is permissible Including the aminoacid of one or more natural connections to receptor component, or could be for strengthening ligand binding polypeptide expression, specially Concerned expectation site is provided, allow to form domain formed optimal tertiary structure and/or strengthen assembly or assembly group and its The additional sequence of the interaction of target molecule.In one embodiment, spacer include one or more inter-modules one or Multiple peptide sequences, its length is between 1-100 aminoacid, preferably 1-50 aminoacid.In a preferred embodiment, two Spacer between individual composition domain is substantially made up of the aminoacid of receptor component in natural connection to wild-type receptor.If Ligand binding molecules comprise multiple multiple modular domains from same receptor, described domain phase each other in natural receptor D1, D2 and D3 of neighbour, such as VEGFR-3, in one embodiment, described domain is using corresponding natural amino acid even The spacer connecing sequence is connected to each other (for example, D1 connects and connects to D3 to D2 and D2).

In some variations, each ligand binding polypeptide is expressed as fusions, fusion partner albumen such as immune globulin White constant region is connected formation ligand binding molecules with heterologous fusion partner.

Polymer, many polycarboxylic components, fusion partner and connexon

Fusion partner is any heterologous component strengthening ligand binding molecules function.Thus, for example, fusion partner can To increase the dissolubility of ligand binding polypeptide, adjust clearance rate, promote targeting specific cells or organization type, strengthen biological living Property, assist to produce and/or reclaim, strengthen pharmacological propertieses or improve pharmacokineticss (PK) curve.For improving PK curve, this The serum half-life of ligand binding molecules, penetration into tissue can be increased by (such as), lack immunogenicity or stability is real Existing.In preferred embodiments, fusion partner be selected from many polycarboxylic components, serum albumin or can in conjunction with serum albumin point The group that son is formed.

When fusion partner is serum albumin or its fragment, it is selected from following formed group：α -1- microglobulin, AGP-1, orosomucoid O ALPHA1-Acid glycoprotein AGP, α -1- acidoglycoprotein, vitamin D binding protein (DBP), hemopexin, human seralbumin egg (hSA), siderophillin, ferritin, first albumin, hoptoglobin, α-fetoprotein Elityran, α -2-HS- in vain Glycoprotein, β-2- glycoprotein, hyaluronic acid-associated proteins, syntaxin, C1R, C1q a chain, Galectin-3-Mac2 knot Hop protein, Fibrinogen, poly Ig receptor (PIGR), α -2- macroglobulin, Urea transport protein, hoptoglobin, IGFBP, macrophage scavenger receptor, fibronectin, huge albumen, Fc, α -1- chymotrypsin inhibitor, α -1- antitrypsin, Antithrombin III, apolipoproteinss A-1, apolipoproteinss B, beta-2-microglobulin, ceruloplasmin, complement component C3 or C4, CI esterase inhibitor, C reactive protein, cystatin c and PROTEIN C.In a more specific embodiment In, fusion partner is selected from following formed group：α -1- microglobulin, AGP-1, orosomucoid O ALPHA1-Acid glycoprotein AGP, α -1- are acid Glycoprotein, vitamin D binding protein (DBP), hemopexin, human serum albumin (hSA), first albumin and combine pearl egg In vain.When needed, comprise the serum half-life that fusion partner assembly can extend fused polypeptide of the present invention.See, for example, the U.S. Patent the 6,423,512nd, No. 5,876,969, No. 6,593,295 and No. 6,548,653 acquisition serum albumin fusion polypeptides Example, these patents are integrally incorporated herein explicitly by quoting.HSA is distributed widely in body everywhere, particularly intestinal and blood Liquid component, and in maintaining osmolarity and Plasma volumes, there is important function.It is slowly removed in liver, and logical in people Often there is Half-life in vivo (Waldmann et al. (1977) Albumin, the Structure Function and of 14-20 days Uses；Pergamon Press；The 255-275 page).

When fusion partner is can be in conjunction with the molecule of serum albumin, described molecule can be synthesized micromolecule, fat or fat Plastid, nucleic acid, including nucleic acid, such as fit (aptomer), peptide or oligosaccharide.In addition described molecule can be protein, Such as Fc γ R1, Fc γ R2, Fc γ R3, polymerization Ig receptor (PIGR), ScFv and serum albumin is had specific its Its antibody fragment.

When fusion partner is many polycarboxylic components, it is that first ligand binding molecules that can be operably connected are joined with another Another many polycarboxylic components of body binding molecule or another ligand binding molecules with formed higher level structure (for example dimer, three Aggressiveness etc.) naturally occurring or synthetic sequence.Suitably many polycarboxylic components can include leucine zipper, including derived from c-jun or c- The leucine zipper motif of fos；Sequence derived from κ or the constant region of lambda light chain；Composition sequence, such as helix-loop-helix Motif (Muller et al. (1998) FEBS Lett.432：45-49), coil-coil motif etc. or known in the art its Its widely accepted many dimerization domain.In some embodiments, fusion component include from (such as) human IgG, IgM or Domain derived from the immunoglobulin of IgA.

On the one hand, ligand binding molecules described herein are to produce as polymer.Each subunit polymeric comprises to join Body binding molecule such as ligand binding polypeptide or consisting of.These polymers can be homodimer, heterodimer or can Dissolubility multimeric receptor, wherein multimeric receptor by 9 or less subunit, preferably 6 or less subunit, even more preferably 3 or more Few subunit, and most preferably 2 subunit compositions.Preferably, these soluble multimeric receptors are the homologous dimerizations of ligand binding molecules Body.

At least two subunits in polymer are operably connected to each other.Term " being operably connected " shows these subunits It is by covalent and/or non-covalent bond association.These subunits can be covalently attached by any suitable way, such as via crosslinking Reagent or connexon such as polypeptide or peptide connexon.In another embodiment, these subunits connect via non-covalent bond.One In a little modifications, two subunits (such as two ligand binding polypeptides) are directly attached by peptide bond or via " peptide connexon " attachment. The length introducing the peptide connexon between subunit can be to be as short as 1 to 3 amino acid residue (preferably by for example bright ammonia of p1 amino acid Acid, serine, threonine or alanine) or longer, and such as length is 13,15 or 16 amino acid residues.Preferably, peptide connects Son is the peptide with immunologic inertia.Described connexon can be the tripeptides of sequence E-F-M (Glu-Phe-Met), for example, by Glu- 13- amino acid linker sequence (the SEQ of Phe-Gly-Ala-Gly-Leu-Val-Leu-Gly-Gly-Gln-Phe-Met composition ID NO：7) 15- amino acid linker sequence (the SEQ ID NO, being made up of (G4S) 3：8), by GGSGG SGGGG SGGGG S 16- amino acid linker sequence (the SEQ ID NO of composition：9) or human IgG (for example, IgG1, IgG2, IgG3 or IgG4) hinge Sequence.In some variations, two subunits are by disulfide bond or other keys interconnective difference polypeptide chain containing two (such as) Ligand binding polypeptide.

In some embodiments, the form of ligand binding molecules is respectively to contain a ligand binding polypeptide containing at least two The fusion protein of subunit.So, fusion protein can be opened as single using recombination form by directly expressing in host cell Put the nucleic acid molecules of fusion protein described in reading frame codes and produce.

In some variations, ligand binding polypeptide is expressed as fusions, heterologous protein gametophyte such as immune globulin White constant region is connected formation poly ligand binding molecules with heterologous fusion partner.In one embodiment, subunit is operable Ground connects at most polycarboxylic component.Many polycarboxylic components include connecting two or more subunits with being operable to form higher level structure Any naturally occurring or synthetic sequence of (such as dimer, trimer etc.).Many polycarboxylic components can by with subunit " direct " phase interaction With being operably connected or more subunits.Or, many polycarboxylic components of a subunit can with another subunit another is many Polycarboxylic component interacts, with the described subunit that is operably connected.

In one embodiment, described subunit may be operably coupled to provide other amino of the multimerization of described subunit Sour domain (specifically, other structures domain includes providing any functional areas of the dimerization of subunit).Term " operationally connects Connect " show subunit based on VEGFR-3 and other amino acid domain passes through peptide bond and directly associates or via " peptide connexon " (such as Defined herein) associate, and the described subunit based on VEGFR-3 retains ligand binding property.Other amino acid domain are permissible Upstream (N-terminal) or downstream (C-terminal) positioned at VEGFR-3 subunit sequence.Preferably, it (is namely exempted from away from first positioned at downstream Epidemic disease immunoglobulin like domain (Ig-I domain)).So, fusion protein can be passed through in host cell directly with recombination form Express the nucleic acid molecules of encoding said fusion protein and produce.In such embodiment, ligand binding molecules described herein are The polymer of fusion protein, it is contained ligand binding polypeptide and mutually can be made with the many polycarboxylic components being present in another fusion protein In order to form for example dimeric many polycarboxylic components of higher level structure.The fusion protein of these types can be prepared as follows：By inciting somebody to action VEGFR-3 subunit sequence (namely ligand binding polypeptide) may be operably coupled to allow to form dimer, trimer from other Deng Separation of Proteins domain.The example allowing the protein sequence of ligand polypeptide multimerization described herein is included (but not It is limited to) from the domain of following Separation of Proteins, such as immunoglobulin, hCG (WO 97/30161), collagen protein X (WO 04/33486), C4BP (WO 04/20639), Erb albumen (WO 98/02540) or coiled coil peptide (WO 01/00814), this During the disclosure of a little documents is incorporated herein by reference in their entirety.

Many polycarboxylic components (such as) can be selected from the aminoacid sequence in 1 to about 500 aminoacid for (i) length, (ii) bright ammonia Sour slide fastener, (iii) helix loop motif and (iv) coil-coil motif.When many polycarboxylic components comprise length in 1 to about 500 amino During the aminoacid sequence of acid, described sequence can comprise one or more can with comprise there are one or more cysteine residual Corresponding cysteine residues in another fused polypeptide of many polycarboxylic components of base form the cysteine residues of disulfide bond.

In particular aspects, polymer is the dimer of ligand binding polypeptide, and wherein said polypeptide is operably connected To immunoglobulin or immunoglobulin a part as fusion partner, it can also serve as many polycarboxylic components.Term " can be grasped Make ground to connect " show that ligand binding polypeptide and immunoglobulin or one part are directly to associate by peptide bond or via " peptide is even Connect son " (as defined herein) associates, and described ligand binding polypeptide retains ligand binding property.In this embodiment, Ligand binding polypeptide may be operably coupled to whole immunoglobulin or one part, specifically human normal immunoglobulin, very Fc part to more specifically human normal immunoglobulin.Generally, the Fc part of human normal immunoglobulin comprises two constant region knots Structure domain (CH2 and CH3 domain) and hinge region, but lack variable region.(see, for example, U.S. Patent No. 6,018,026 and 5, 750, No. 375, they are incorporated herein by.) immunoglobulin can be selected from arbitrary big class (inclusion of immunoglobulin IgA, IgD, IgE, IgG and IgM) and any subclass or isotype (such as IgG1, IgG2, IgG3 and IgG4；IgA-I and IgA- 2).In one embodiment, Fc part is human IgG 4, and it is stable in the solution and has minimum or does not have complement activation to live Property.In another embodiment, Fc part is human IgG1.Fc partly can pass through mutation, to prevent undesired activity, Complement combines, is bound to Fc receptor etc..Aminoacid sequence derived from immunoglobulin can connect many to ligand binding The C- end of peptide or N- end, are preferably connected to C- end.Such fusion protein can be prepared as follows：With encoding VEGFR-3 Subunit：The DNA transfectional cell of Fc fusion protein, and express dimer in same cell.In one particular embodiment, often Ligand binding polypeptide on individual monomelic subunit all identical (namely dimer is homodimer).Melt for preparing immunoglobulin The method of hop protein is well known in the art, such as Hollenbaugh and Aruffo (" Construction of Immunoglobulin Fusion Proteins ", Current Protocols in Immunology, Suppl.4, the page number 10.19.1-10.19.11,1992) or WO 01/03737, two documents are herein incorporated by reference.

Or, the dimer of ligand binding polypeptide of the present invention can be by by one of which ligand binding polypeptide operationally Connect to the constant region of heavy chain immunoglobulin and another ligand binding multiple medicines be may be operably coupled to light chain immunoglobulin Constant region be prepared.For example, ligand binding polypeptide can may be operably coupled to the CH1- hinge-CH2-CH3 of human IgG1 Region, or identical ligands Binding peptide can may be operably coupled to the C κ region of Ig κ light chain.In one embodiment, Constant heavy is people γ 4, and it is stable in the solution and has minimum or does not have complement activating activity.In another embodiment In, constant heavy is people γ l.Constant heavy can be through mutation, and to prevent undesired activity, such as complement combines, combines To Fc receptor etc..

Equally, if it is desired, fusion protein described herein can include any functional areas promoting purification and producing.Such The instantiation of other aminoacid sequences includes GST sequence or His labelled sequence.In some variations, promote the region of purification It is removed, to be formulated for the compositionss of medicinal usage.

Aminoacid sequence derived from immunoglobulin can connect the C- end or N- end to ligand binding polypeptide, preferably connects It is connected to C- end.Cell with the DNA transfection of encoding immune immunoglobulin light chains fusion protein and heavy chain immunoglobulin fusion protein Heavy chain/light chain heterodimer containing respective ligand binding polypeptide for the expression.When initial synthesis, two kinds of ligand binding polypeptides are favourable Ground comprises natural or heterologous signal peptide, and to promote from cell secretion, but signal sequence is cleaved in secretion.Consider to include signal The modification of arbitrary foregoing embodiments of peptide.The natural signals peptide of human VEGFR-3-3 comprises SEQ ID NO：2 residue 1-24.Literary composition Offer middle teaching many other signal peptide protein.

In another particular aspects of the present invention, polymeric ligand binding polypeptide connects via non-covalent bond.Subunit Non-covalent bonding can be by without interference with its biological activity (namely it combines the ability of people VEGF-C and/or VEGF-D) Any suitable way is realized.In particular aspects, these polymers are the dimers of ligand binding polypeptide, one of part Binding peptide may be operably coupled to the first compound, and another or identical ligands Binding peptide may be operably coupled to second Compound, it will noncovalently be bonded to described first compound.The example of such compound is biotin and avidin 9 In vain.The dimer of ligand binding polypeptide can be by may be operably coupled to biotin and will be another by a VEGFR-3 subunit Individual ligand binding polypeptide may be operably coupled to avidin and is prepared.From there through biotin and avidin Noncovalent interaction formed receptor.Other examples include the subunit of heterodimer proteohormone.In these embodiment party In case, it is fused to encoding heterologous protein dimer hormone (such as hCG) by encoding a kind of DNA construct of ligand binding protein Subunit DNA construct, and by encode another ligand binding polypeptide DNA construct be fused to encoding heterologous dimer protein The DNA of another subunit (as disclosed in US 6,193,972) of matter hormone (such as hCG).These DNA construct are identical thin Coexpression in born of the same parents, thus lead to express ligand binding molecules, because each coexpression sequence comprises corresponding hormone subunit, with table Form heterodimer when reaching.Aminoacid sequence derived from heterodimer proteohormone can connect many to ligand binding The C- end of peptide or N- end, are preferably connected to C- end.When initial synthesis, two kinds of subunits advantageously comprise natural or Heterologous signal Peptide, to promote from cell secretion, but signal sequence is cleaved in secretion.

In some embodiments, ligand binding molecules may be operably coupled to non-VEGFR-3 source property combining unit, also It is free from the combining unit of the composition domain derived from VEGFR-3.Such chimeric ligand binding molecule can (such as) include Heterologous combining unit based on other tyrosine kinase receptors.In one embodiment, such heterologous combining unit is attached to At least one is selected from following ligand polypeptide：VEGF-A (VEGF), VEGF-B, PlGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D.In a preferred embodiment, such heterologous combining unit is attached at least VEGF-A (VEGF).

In one embodiment, such heterologous combining unit is included derived from VEGFR-1 or VEGFR-2 or two kinds Composition domain.The heterologous combination being applied in combination with the ligand binding molecules of the chimeric ligand binding molecule form of the present invention The example of unit includes the VEGF- described in (such as) WO 2000/75319, WO 2005/000895 and WO 2006/088650 Trap molecule.Preferably heterologous combining unit includes the Ig- domain 2 (R1D2) of VEGFR-1 and the Ig- domain 3 of VEGFR-2 (R2D3), optionally it is fused to the Fc part of immunoglobulin.In one embodiment it is contemplated to a kind of chimeric molecule, its Comprise connection to the ligand binding polypeptide of the present invention of the Fc part of immunoglobulin, it may be operably coupled to be fused to immune ball The R1D2R2D3 combining unit of the Fc part of albumen.Two kinds of combining units are operationally connected by the disulfide bond between two Fc parts Connect.

Connexon

Although the Ig spline structure domain of human VEGFR-3-3 can directly be attached to each other (via peptide bond, disulfide bond or other types of Covalent bond) or it is attached to the Ig spline structure domain of other receptors, ligand binding molecules described herein optionally additionally comprise one (one Individual or multiple) by two or more different combining units (for example, VEGFR-3 ECD fragment and another VEGFR-3 ECD fragments Or the even copy of oneself) connexon that connects together.Combining unit can also be connected and takes to other described herein by connexon Dai Ji.In one embodiment, connexon includes heterologous polypeptide.For example, in some embodiments, connexon includes connecting Combining unit can be expressed as single ligand binding molecules with forming the peptide of single continuous peptide, described single continuous peptide.Connect Son can be through selecting, so that it is difficult induced hypersensitivity reaction.Can also be connected with reference to single using polysaccharide or other parts Unit, to form ligand binding molecules.

Each ligand binding molecules can use more than a connexon.Connexon can be through selecting, to join various Obtain best conformation (space) degree of freedom between body combining unit, allow that they interact if necessary, such as to form dimer, Or allow that they are interacted with part.Connexon can be linear so that continuous combining unit is to be connected in series, or Person's connexon can serve as the support of various combining unit attachments, such as side chain connexon.Connexon can also have multiple Chain, for example, such as Tam, J.Immunol.Methods 196：Disclosed in 17 (1996).Combining unit can be attached to each other, Or via N- Amino End Group, C- end carboxyl, side chain, chemical modification group, side chain or it is otherwise attached to connect submounts.

Connexon peptide can be designed with the sequence allowing that there is desired characteristic.For example, using glycyl residue Allow that there is relatively large conformational freedom, and proline will tend to the opposite effect.Peptide connexon can pass through and select, It is made to have specific two grades and tertiary structure, for example, α spiral, β-pleated sheet or β bucket.Can also be produced using quarternary structure with The connexon that two basic change unit is connected together by non-covalent fashion.For example, with hydrophobic surface, protein domain is fused to respectively Combining unit can allow the interaction via between two intermolecular hydrophobic interactions to be connected to two basic change unit Together.In some embodiments, connexon can provide polar interaction.For example, it is possible to respectively using proto-oncogene egg The leucine zipper motif of white Myc and Max.Luscher and Larsson, Ongogene 18：2955-2966(1999).? In some embodiments, connexon allows to form salt bridge or disulfide bond.Connexon can include alpha-non-natural amino acid and generally It is not incorporated in the natural amino acid in polypeptide.In some embodiments, connexon includes metal or other ion is combined with thus The different residues of multiple peptides between formed co-ordination complex.

Consider the linear peptides connexon of at least one hydrogen-based acid residue.In some embodiments, connexon has and exceedes 10,000 residues.In some embodiments, connexon has 1-10, and 000 residue, 1-1000 residue, 1-100 are individual residual Base, 1-50 residue or 1-10 residue.In some embodiments, linear peptides connexon comprises there is relative inertness side chain Residue.Peptide connexon amino acid residue need not connect via α-carboxyl and α-hydrogen-based completely or at all need not via α-carboxyl and α- Hydrogen-based connects.It is, peptide can connect via the side-chain radical of various residues.

Connexon can affect whether the polypeptide that it is merged dimerization or dimerization can form another polypeptide each other.Even Connect son and play several functions.The natural receptor monomer being limited by the substantially two dimensional surface of cell membrane enjoys relatively high local concentration With the utilizability of co-receptor (combining unit), thus increase find gametophyte probability.Increase the company of monomer valid density Connect son and may assist in free receptor in the solution lacking such advantage.

In some embodiments, ligand binding molecules can contain more than a kind of connexon.Suitable connexon also may be used To comprise above-mentioned chemical modification.

Ligand binding molecules described herein can comprise other n terminal amino acid residues, preferably methionine.In fact, According to expression system and condition, polypeptide can be expressed in the recombinant host cell have initial methionine.Then, this is other Aminoacid can be retained in final recombiant protein, or by exopeptidase (such as Methionine Aminopeptidase), according to document Disclosed in method remove (Van Valkenburgh HA and Kahn RA, Methods Enzymol. (2002) 344：186- 93；Ben-Bassat A, Bioprocess Technol. (1991) 12：147-59).

Substituent group and other chemical modification

Ligand binding molecules described herein are chemically modified optionally past various substituent groups.Such modification is preferably real The specificity of somatomedin binding affinity or ligand binding molecules will not be reduced on matter.On the contrary, chemical modification gives as herein Described other desired characteristics.Chemical modification can show as multiple multi-forms, such as heterologous peptides, polysaccharide, lipid, radioactivity Isotope, non-standard amino acid residue and nucleic acid, metal-chelator and various toxin.

Receptor fragments (or " combining unit " or " composition domain ") as herein described and ligand binding molecules optionally melt It is bonded to heterologous fusion partner such as heterologous polypeptide, to give various properties, the such as dissolubility of increase, regulation clearance rate, target To specific cells or organization type.In some embodiments, receptor fragments are connected the Fc to IgG or other immunoglobulin Domain.In some embodiments, receptor fragments are fused to alkali phosphatase (AP).Construct for manufacturing Fc or AP The method of body sees in WO 02/060950.(for example, partly declined with having special properties by merging ligand binding polypeptide or molecule Phase, bioavailability, interaction gametophyte) protein domain, these properties can be given to ligand binding molecules (for example, molecule is distributed or the particular organisms half-life with having particular organization through through engineering approaches).In some embodiments, part Binding molecule includes co-receptor and VEGFR fragment.

VEGR-3 piece can be affected for the specific fusion partner (for example, heterologous polypeptide) in particular ligand binding molecule Section whether by dimerization, itself so ligand binding can be affected.

For substituent group, the Fc area of such as human IgG, between fusions can directly be fused to ligand binding molecules or pass through Slotting sequence merges.For example, human IgG hinge, CH2 and CH3 can merge in the N-terminal of ligand binding molecules or C-terminal, to be attached Fc Area.Gained Fc- fusion constructs can pass through protein A affinity column (Pierce, Rockford, Ill.) purification.It is fused to Fc area Peptide and protein can represent the Half-life in vivo substantially greater than not merging homologue.It is fused to Fc area and allow fused polypeptide Dimerization/multimerization.Fc area can be natural Fc area, or can obtain advantageous characteristic through modification, for example, therapeutic quality, follow Ring time, minimizing are assembled.

For example, polypeptide can by glycosylation, amidatioon, carboxylation or phosphorylation or by produce acid-addition salts, amide, Ester (particularly C-terminal ester) and N- acyl derivative are modified.The Ig spline structure domain I-III of VEGFR-3 comprises 5 presumption N- sugar Base site (is referred to as N1, N2, N3, N4 and N5 sequence or the region of VEGFR-3) herein.N1 corresponds to SEQ ID NO： 2 aminoacid 33-35；N2 corresponds to SEQ ID NO：2 amino acid/11 04-106；N3 corresponds to SEQ ID NO：2 hydrogen-based acid 166-168；N4 corresponds to SEQ ID NO：2 hydrogen-based acid 251-253, and N5 corresponds to SEQ ID NO：2 aminoacid 299- 301.In some embodiments, ligand binding molecules described herein comprise the modification in the N2 region of described molecule.For example, one In a little embodiments, in ligand binding molecules, correspond to SEQ ID NO：The aminoacid of 2 position 104 is deleted and replaces with another A kind of hydrogen-based acid.Conservative replaces are preferred.In some embodiments, corresponding to SEQ ID NO：The ammonia of 2 position 104 Base acid is deleted and replaces with the amino of the group selected from L-Glutamine, aspartic acid, glutamic acid, arginine and lysine composition Acid.In other modifications, position 106 is substituted to eliminate N2 sequence.SEQ ID NO wherein：2 N2 sequence is as above Described when being modified, SEQ ID NO：2 N1, N3, N4 and N5 sequence is not preferably modified.

Protein can also by with other parts formed covalently or non-covalently complex carry out modifying produce peptide derive Thing.Covalent bond complex can be by connecting functional group or connection to the side chain of the aminoacid of polypeptide by chemical part In the preparation of N- or C- end.

Polypeptide can be conjugated to reporter group, including but not limited to radioactive label, fluorescent labeling, (for example, catalytic amount Heat or fluorescence reaction) enzyme, substrate, solid matrix or carrier (for example, biotin or avidin).The example of analog It is described in WO 98/28621 and Olofsson et al., Proc.Nat ' l.Acad.Sci.USA, 95：11709-11714(1998)、 U.S. Patent No. No. 5,512,545 and No. 5,474,982；U.S. Patent Application No. No. 20020164687 and No. 20020164710 In.

Cysteinyl residue most commonly with halogenated acetic acids ester (and corresponding amine), such as monoxone, chloroacetamide reaction obtain Carboxymethyl or carboxylic amine methyl-derivatives.Cysteinyl residue also by with bromine trifluoroacetone, α-bromo- β (5- imidazole radicals) propanoic acid, chlorine Acetyl phosphate ester, N- alkyl maleimide, 3- nitro -2- disulfide, methyl 2- disulfide, to chlorine hydrargyrum Benzoic acid, 2- chloromercuri -4- nitrophenol, adjacent chlorine (orchloro) -7- nitro benzo -2- oxa- -1, the reaction of 3- diazole is derivative Change.

Histidyl residues by reacting derivatization with pyrocarbonic acid diethyl ester under pH 5.5-7.0 because this reagent is to group Aminoacyl side chain has relative specificity.It is also possible to use PBPB；This reaction preferably under pH 6.0 Carry out in 0.1M sodium dimethylarsonate.

Lysyl and amino-terminal residue and succinic anhydrides or carboxylic acid anhydride reactant.With these reagent derivatizations, there is reverse and rely ammonia The effect of the electric charge of acyl residue.Other is suitable for making the reagent containing alpha-amino residue derivatization to include imino-ester, such as methyl Pyridine imine methyl ester；Pyridoxal 5-phosphate；2-methyl-3-hydroxy-4-formyl-5-hydroxymethylpyridine.；Hydroboration chlorine；Trinitro-benzene-sulfonic acid；O- methyl-isourea；2,4 pentanediones；With Carry out the transaminase of catalytic reaction with glyoxalic acid.

Arginyl residues are modified by being reacted with one or more conventional reagent, wherein have phenylglyoxal, 2,3- fourth Diketone, 1,2- cyclohexanedione and 1,2,3-indantrione monohydrate.The derivatization of arginine residues requires to be reacted in the basic conditions, because guanidine official Group can have high pK.Additionally, these reagent can be reacted with the group of lysine and arginine epsilon-amino group.

The concrete modification of tyrosinyl residues itself made widely studied, of particular concern be by with aromatic series weight Spectrum label is introduced tyrosinyl residues by nitrogen salt compound or tetranitromethane reaction.Most generally, respectively using N- acetyl group Imidazoles and tetranitromethane are forming O- acetyl tyrosyl material and 3- nitro-derivative.Make tyrosyl using 125I or 131I Residue iodate, prepares for the labelled protein in radioimmunoassay.

Carboxyl side group (aspartyl or glutamyl) by with carbodiimide (R1) (such as 1- cyclohexyl -3- (2- Quinoline base-(4- ethyl) carbodiimide or 1- ethyl -3 (4 azonias 4,4- dimethyl amyl group) carbodiimide) reaction selected Sex modification.Additionally, aspartyl and glutamyl residue are converted into asparaginyl- and glutamy by reacting with ammonium ion Amine acyl residue.

Performed the derivatization with bi-functional reagents and can be used for making ligand binding molecules crosslinked with water insoluble carrier substrate.Such Derivatization may also provide by the adjacent combination element in ligand binding molecules or to combine element connection heterologous peptides (example As Fc fragment) connexon.Conventional cross-linking agent include double (diazoacetyl the base) -2- vinylbenzene of (such as) 1,1-, penta 2 Aldehyde, N-hydroxy-succinamide ester (ester for example, being formed with 4- azido salicylic acid), homotype bifunctional imido esters (are included Two butanimide base esters, such as 3,3 '-two sulfur are double (succinyl phosphorons amino propyl acid ester)) and bifunctional maleimides are (such as Double-N- dimaleoyl imino -1,8- octane).Derivatization reagent such as 3- [(p- azido phenyl) two sulfur] malonamic acid (propioimidate) what methyl ester obtained being formed in the presence of light crosslinking can photoactivation intermedium.Or, using reactivity Water-insoluble substrate such as cyanogen bromide-activated carbohydrate and U.S. Patent No. 3,969,287；No. 3,691,016；4,195, No. 128；No. 4,247,642；No. 4,229,537；With the reactive bottom described in No. 4,330,440 (being incorporated herein by) Thing carries out protein to be fixed.

Usually deamidization obtains corresponding glutamyl and aspartyl for glutaminyl and asparaginyl Residue.Or, these residues desamido- under mildly acidic conditions.Any form of these residues all falls in the scope of the invention Interior.

Other modify include proline and lysine the phosphorylation of the hydroxyl of hydroxylating, seryl or threonyl residues, Alpha-amino (T.E.Creighton, the Proteins of methylating of lysine, arginine and histidine side chains：Structure And Molecule Properties, W.H.Freeman＆Co., San Francisco, page number 79-86,1983), N-terminal amine The amidatioon of acetylation and in some cases C-terminal carboxyl.This analog derivative is the peptide composition through chemical modification, wherein Ligand binding molecules polypeptide connects to polymer.Selected polymer be typically water miscible so that its attached protein not Can precipitate in aqueous environments, such as physiological environment.Selected polymer generally goes through modification and single has reactive group, such as For acylated active ester or for alkylating aldehyde so that controlling the degree of polymerization when can provide in the methods of the invention.Polymerization Thing can have any molecular weight, and can be side chain or unbranched type.Including the model in ligand binding molecules polypeptide polymer In enclosing is the mixture of polymer.Preferably, for the therapeutic use of final preparation, polymer will be pharmaceutically acceptable 's.

Polymer each can have any molecular weight, and can be side chain or unbranched type.Polymer generally each has (term " about " refers in water soluble polymeric agents, and some molecules will mean molecule quantity between about 2kDa to about 100kDa More heavier than described molecular weight, gentlier).The mean molecule quantity of each polymer between about 5kDa and about 50kDa, more preferably Ground between about 12kDa to about 40kDa, and most preferably between about 20kDa to about 35kDa.

Suitable water-soluble polymer or its mixture include but is not limited to N- connect or O- connect carbohydrate, Sugar, phosphate ester, carbohydrate；Sugar；Phosphate ester；Polyethylene Glycol (PEG) (include PEG to be used for making protein derived form, Including list-(C1-C10) alkoxyl-or aryloxy group-Polyethylene Glycol)；Mono methoxy-Polyethylene Glycol；Dextran is (such as, for example The low-molecular-weight dextran of about 6kD), cellulose；Cellulose；Other polymer based on carbohydrate, poly- (N- ethylene Ketopyrrolidine) Polyethylene Glycol, propropylene glycol homopolymers, poly(propylene oxide)/ethylene oxide copolymer, polyoxyethylated polyols (example As glycerol) and polyvinyl alcohol.Present invention also contemplates that can be used for preparing the polymeric bi-functional linker's molecule of covalent attachment.

In general, chemical derivatization can be in any bar being suitable for and making protein and activated polymer molecule react Carry out under part.Method for preparing the chemical derivative of polypeptide is typically included step (a) makes polypeptide divide with living polymer Sub (reactive ester of such as polymer molecule or aldehyde derivatives) are in ligand binding molecules so as to becoming to be attached one or more polymerizations React under conditions of thing molecule, and (b) obtains product.Optimum reaction condition will be true based on known parameters and results needed Fixed.For example, polymer molecule：The ratio of protein is bigger, and the amount of the polymer molecule of attachment is bigger.In an embodiment In, ligand binding molecules polypeptide derivative can have single polymer molecule part in aminoterminal.(see, for example, United States Patent (USP) No. 5,234,784).

It is Polyethylene Glycol (PEG) with particularly preferred water-soluble polymer in this article.As used herein, poly- second two Alcohol is intended to any PEG form that may be used to other oroteins derivatization, such as singly-(C1-C10) alkoxyl-or virtue Epoxide-Polyethylene Glycol.PEG is straight or branched neutrality polyethers, can be obtained with numerous molecular weight, and can be dissolved in water and most Number organic solvent.When being present in water, PEG effectively can be excluded other poly- by its high dynamic chain mobility and hydrophilic nmature Compound or peptide, produce water hull or hydration ball therefore when being attached to other oroteins or polymer surfaces.PEG is nontoxic, no immunity Originality, and ratified for internal consumption by Food and Drug Admistraton.

When being conjugated to PEG, protein or enzyme represent the clear of biological activity, nonantigenic and decline when applying in animal Except rate.F.M.Veronese et al., Preparation and Properties of Monomethoxypoly (ethylene Glycol)-modified Enzymes for Therapeutic Applications, in J.M.Harris compile, Poly (Ethylene Glycol) Chemistry--Biotechnical and Biomedical Applications, 127-36, 1992, it is herein incorporated by reference.These phenomenons are caused due to the exclusion property that PEG prevents immune system identification.Additionally, PEG is widely used in and reduces protein adsorption and improve in the surface modification program of blood compatibility.S.W.Kim et al., Ann.N.Y.Acad.Sci.516：116-30 1987；Jacobs et al., Artif.Organs 12：500-501,1988；Park Et al., J.Poly.Sci, Part A 29：1725-31,1991, they are both incorporated herein by reference.Hydrophobic polymer table Face (such as polyurethane and polystyrene) can be modified by being grafted PEG (MW 3,400), and is used as non-cause thrombogenic surface. Surface nature (contact angle) can be more consistent with hydrophilic surface, because PEG has hydration effect.Importantly, it is permissible Greatly reduce protein (albumin and other plasma protein) to absorb, this is by the high chain mobility of PEG, hydration ball and albumen row Except property causes.

After measured, PEG (MW3,400) is the optimum size in the mobile research in surface, Park et al., J.Biomed.Mat.Res.26：739-45,1992, and PEG (MW 5,000) is most beneficial for reduction proteantigen. (F.M.Veronese et al., In J.M.Harris et al., Poly (Ethylene Glycol) Chemistry- Biotechnical and Biomedical Applications, 127-36.)

Method for preparing Pegylation ligand binding molecules is typically included step (a) and makes polypeptide and Polyethylene Glycol (reactive ester of such as PEG or aldehyde derivatives) are anti-under conditions of one or more PEG group so as to becoming to be attached in ligand molecular Should, and (b) acquisition product.In general, the optimum reaction condition of acylation reaction will be based on known parameters and results needed Determine.For example, PEG：The ratio of protein is bigger, and the percentage ratio of poly- PEGylated product is bigger.In some embodiments, Ligand binding molecules will have single peg moiety at N- end.Referring to U.S. Patent No. 8,234,784, described patent is passed through to draw With being incorporated herein.In some embodiments, ligand binding molecules as herein described optionally comprise to be attached to this molecule At least one peg moiety.For example, in some embodiments, the PEG of about 20-40kDa is attached at the amino of ligand binding molecules End.

Derivatization ligand binding molecules disclosed herein can have other activity, the biological activity strengthening or weakening, Or other characteristic, the half-life such as increasing or decreasing, this right and wrong derivatization molecule is compared.

The polynucleotide of coding ligand binding molecules and expression system

The present invention not only comprises ligand binding molecules described herein, combining unit and polypeptide, and comprises to encode such point Son nucleic acid, comprise the carrier of this quasi-molecule and the host cell of thin examples of such carriers.Using any described molecule, unit, polypeptide, The method of nucleic acid, carrier and host cell is all considered as the aspect of the present invention.

Exemplary human VEGFR-3-3 coded sequence is listed in SEQ ID NO：In 1, and SEQ ID NO：1 fragment (N2 sequence Place is modified) it is considered the coded sequence of ligand binding polypeptide described herein.(for example, it is contemplated that coding VEGFR-3 ECD's is complete Portion or the fragment of a part.) due to the degenerate due to knowing, many equal coded sequences are compiled for any polypeptide For code sequence can, and all such equivalents are considered the aspect of the present invention.

Additionally, as considering the aminoacid sequence modification of VEGFR-3 wild type ECD as above it is also contemplated that nucleic acid sequence Row modification.Nucleotide sequence modification can be characterized as with respect to SEQ ID NO：1 homogeneity percentage is (for example, at least 80,85, 90th, 92,93,94,95,96,97,98 or 99% homogeneity).

Nucleotide sequence modification can also be by the capability representation with the complementary sequence hybridization of optimized encoding sequence.Nucleic acid divides Attached bag include those be included in as herein defined appropriateness or high stringency under with SEQ ID NO：Listed nucleic acid molecules in 1 Or coded polypeptide (described polypeptide comprises SEQ ID NO：Listed receptor tyrosine kinase aminoacid sequence in 2 and 3) molecule or The nucleotides sequence that the ECD coded sequence of nucleic acid fragment as described herein or the nucleic acid fragment encoding polypeptide as described herein hybridizes The molecule of row.

Term " high stringency " refers to design the DNA hybridization allowing sequence highly complementary, and exclude notable not Those conditions of the DNA hybridization joined.Hybridization stringency is mainly dense by temperature, ionic strength and denaturant (such as Methanamide) Degree determines.The example of " high stringency " of hybridization and cleaning is 0.015M sodium chloride, 65-68 DEG C of 0.0015M sodium citrate Or 0.015M sodium chloride, 0.0015M sodium citrate and 42 DEG C of 50% Methanamide.Referring to Sambrook, Fritsch＆Maniatis, Molecular Cloning：A Laboratory Manual, second edition, Cold Spring Harbor Laboratory, (Cold Spring Harbor, N.Y.1989)；With Anderson et al., Nucleic Acid Hybridization：a Practical approach, the 4th chapter, IRL Press Limited (Oxford, England) .Limited, Oxford, England.In order to reduce non-specificity and/or background hybridization, in hybridization and cleaning buffer solution, other reagent can be included.Example For 0.1% bovine serum albumin, 0.1% Polyvinylpyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium lauryl sulphate (NaDodSO₄Or SDS), ficoll, Deng Hate (Denhardt ' s) solution, salmon sperm dna through sonication (or another non- Complementary DNA) and dextran sulfate but it is also possible to using other suitable agent.Having no substantial effect on the strict of hybridization conditions In the case of degree, can be with the concentration of these additives and type.Hybrid experiment is generally carried out under pH 6.8-7.4, however, Under exemplary ion strength condition, hybridization rate is almost unrelated with pH.Referring to Anderson et al., Nucleic Acid Hybridization：A Practical Approach, the 4th chapter, IRL Press Limited (Oxford, England).

The factor of impact DNA double spiral stability includes base composition, length and base-pair mismatch degree.Hybridization conditions are permissible Adjusted by those skilled in the art to adapt to these variables, and allow the DNA of different serial correlations to form crossbred.Completely The melting temperature of the DNA double spiral of coupling can be estimated by below equation：

Tm (DEG C)=81.5+16.6 (log [Na+])+0.41 (%G+C) -600/N-0.72 (Methanamide %)

Wherein N is formed double-helical length, and [Na+] is the molar concentration of sodium ion in hybridization or cleaning solution, %G + C is (guanine+cytosine) base in crossbred.For the crossbred of imperfect coupling, every mispairing 1%, melting temperature drops Low about 1 DEG C.

Term " appropriate stringent condition " is to refer to formation base-pair mismatch degree may go out higher than " under high stringency " The condition of existing DNA double spiral.Typical " appropriate stringent condition " be 0.015M sodium chloride, 50-65 DEG C of 0.0015M sodium citrate or 0.015M sodium chloride, 0.0015M sodium citrate and 37-50 DEG C of 20% Methanamide.For example, 50 DEG C, in 0.015M sodium ion In " appropriateness strict " condition about 21% mispairing occurs by allowing.

At most about the oligonucleotide probe of 20nt is in 1M NaCl^*In the good estimated value of melting temperature be to be given below：

Tm=2 DEG C/A-T base pair+4 DEG C/G-C base pair

^*Na ion concentration in 6x sodium citrate salt (SSC) is 1M.Referring to Suggs et al., Developmental Biology Using Purified Genes, page 683, in Brown and Fox (volume) (1981).

The height stringent wash condition of oligonucleotide is generally in the low 0- of the Tm in 6x SSC, 0.1%SDS than oligonucleotide At a temperature of 5 DEG C.

The difference of nucleotide sequence can lead to aminoacid sequence with respect to SEQ ID NO：2 or SEQ ID NO：3 amino Conservative and/or non-conservative modification in acid sequence.The invention still further relates to corresponding any of the above-described DNA sequence or under strict conditions with Separation and/or purification DNA that it hybridizes.

Encode all or part of nucleic acid molecules (all ligand binding molecules as described herein or the combination of polypeptide of the present invention Unit) can manufacture in every way, including but not limited to chemosynthesis, cDNA or genomic library screening, expression library The PCR amplification of screening and/or cDNA or genomic DNA.Can be used for separating these methods of such DNA and other method by example As Sambrook et al., " Molecular Cloning：A Laboratory Manual, " Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), Ausubel et al. compile, " Current Protocols In Molecular Biology, " Current Protocols Press (1994) and Berger and Kimmel, " Methods In Enzymology：Guide To Molecular Cloning Techniques, " volume 152, Academic Press, Inc., San Diego, Calif. (1987) illustrate.Preferred nucleic acid sequence is mammalian cell, all As people, rat and mice.

The chemosynthesis of nucleic acid molecules can be completed using method well known in the art, and such as those are by Engels et al., Angew.Chem.Intl.Ed., 28：The method that 716-734 (1989) illustrates.The phosphoric acid that these methods synthesize particularly including nucleic acid Three esters, phosphoramidite and H- phosphonate.The nucleic acid that length is greater than about 100 nucleotide can synthesize as some fragments, often At most about 100 nucleotide of the length of individual fragment.Then as mentioned below described fragment can be linked together, be subject to being formed The total length nucleic acid of concern.Method for optimizing is to carry out polymer support synthesis using standard phosphoramidite chemistry.

Term " carrier " refers to amplified nucleic acid molecule, duplication and/or expression vector, and it generally originates from or is in plasmid or virus DNA or RNA system form, wherein plasmid or viral DNA or RNA are in selected host cell (such as antibacterial, yeast, plant, no ridge Vertebrate and/or mammalian host cell) in function.Carrier can be kept separate from host cell gene group DNA, or Person can be integrated with genomic DNA wholly or in part.Carrier will comprise all necessary elements, so that thin in any compatible host Function in born of the same parents.This class component is shown below.

After separating the nucleic acid of coded polypeptide or its fragment, preferably it is inserted in amplification and/or expression vector, to increase The copy number of gene and/or in the Suitable host cells in target organism and/or transformed cell expression coded polypeptide (with Express described polypeptide in vivo).Many commercially available carriers are all suitable but it is also possible to use " customization " carrier.Carrier Through selecting function (namely replicate and/or express) in particular host cell or host tissue.Polypeptide or its fragment Can expand in protokaryon and/or eukaryotic host cell/express, for example bacto yeast, insecticide (rhabdovirus system), plant and the food in one's mouth Newborn zooblast.Whether the selection of host cell will want glycosylation based in part on polypeptide or its fragment.If it is, yeast, Insecticide or mammalian host cell are preferred；If glycosylation site is present on aminoacid sequence, then yeast and the food in one's mouth Newborn zooblast will make polypeptide glycosylation.

The carrier being commonly used in any host cell all will comprise 5 ' flanking sequences and other regulating element, such as increase Hadron, promoter, origin of replication element, transcription terminator element, the complete intron sequence containing donor and acceptor splicing sites, letter Number peptide sequence, Ribosome binding site element, polyadenylation sequence, many for the insertion coding nucleic acid of polypeptide to be expressed Joint (polylinker) area and selected marker element.Optionally, carrier can comprise " label " sequence, that is, is located at coding The oligonucleotide sequence at 5 ' or 3 ' ends of the coded sequence of many His (such as six His) or another immunogenicity sequence.This labelling With protein expression, and will can serve as the affinity labeling from host cell purified polypeptide.Optionally, subsequently described labelling can To be removed from purified polypeptide by various modes (such as using selected peptidase).

Carrier/expression construct can optionally comprise such as elements below：5 ' flanking sequences, origin of replication, transcription are eventually Only sequence, selected marker sequence, ribosome binding site, signal sequence and one or more intron sequences.5 ' flanking sequences can To be homology (namely be derived from and host cell identical species and/or bacterial strain), heterologous (to be namely derived from different from place The species of chief cell or bacterial strain), heterozygosis (namely from more than one source 5 ' flanking sequences combination), synthesis, Or it can be natural 5 ' flanking sequences.Therefore, the source of 5 ' flanking sequences can be any unicellular prokaryotic or eucaryon life Object, any vertebratess or invertebrate organism or any plant, precondition is 5 ' flanking sequences in host cell In mechanism function and can by its activation.

Transcription terminator element is usually located at 3 ' ends of polypeptid coding sequence, and purpose is to terminate the transcription of polypeptide.Generally, Transcription terminator element in prokaryotic cell is the fragment rich in G-C after poly T-sequence.This class component can from library clone, As carrier a part commercially, and can be easily synthesized.

Selectable marker gene coding host cell is survived and protein necessary to growing in selective medium.Typical case Selectable marker gene encodes such protein：A () gives prokaryotic host cell to antibiotic or other toxin (such as ammonia ratio west Woods, tetracycline or kanamycin) resistance, (b) supplies the auxotrophy of described cell；Or (c) provide cannot be from compound criteria The critical nutrients that base obtains.

Sugared body binding member (commonly referred to (give birth to for Shine-Dalgarno sequence (prokaryote) or Kozak sequence by eucaryon Thing)) it is necessary to mRNA translation initiation.Described element is usually located at 3 ' ends of promoter and the code sequence of polypeptide to be synthesized 5 ' ends of row.Shine-Dalgarno sequence can change, but typically poly purine (namely there is high A-G content).? Identified many Shine-Dalgarno sequences, wherein every kind of can utilize said method to synthesize easily.

The element that above-mentioned all elements and other can be used in the present invention is all known to technical staff, and is described in (for example) Sambrook et al., " Molecular Cloning：A Laboratory Manual, " Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Berger et al. compile, " Guide To Molecular Cloning Techniques, " Academic Press, Inc., San Diego, Calif. (1987] in.

With regard to the present invention those wherein for the secreted embodiment of recombinant polypeptide, it preferably includes signal sequence, with From its cell direct secretion of synthesis.Generally, the polynucleotide of coded signal sequence are located at 5 ' ends of coding region.Identified permitted Multi signal sequence, and the signal sequence of one function in target cell or species of any of which can be with transgenic one Rise and use.

In many cases, genetic transcription increased because of there are one or more introns on carrier.Intron is permissible It is natural, particularly when total length or fragment that transgenic is genomic dna sequence.Intron can with transgenic and/or The transgene mammal homology or heterologous that described gene will insert.Intron is very heavy with respect to the position of promoter and transgenic Will, because intron must effectively be transcribed.The optimum position of intron is the 3 ' ends in transcriptional start site, and in poly A 5 ' ends of transcription terminator.For cDNA transgenic, intron be located at the side of transgene coding sequence or opposite side ( It is exactly 5 ' ends or 3 ' ends).Any including of any source (including any virus, protokaryon and eucaryon (plant or animal) organism) Son may be used to express polypeptide, and precondition is that it is compatible with the host cell that it is inserted.Also include synthesis herein to include Son.Optionally, an intron can be used more than in carrier.

It is those and antibacterial, insecticide and the compatible load of mammalian host cell for recombinant expressed exemplary carrier Body.Examples of such carriers is particularly including pCRII (Invitrogen Company, San Diego, Calif.), pBSII (Stratagene Company, La Jolla, Calif.) and pETL (BlueBacII；Invitrogen).

In carrier construction and by after in the appropriate site of nucleic acid insertion vector, complete carrier can be inserted suitable host Expanded in cell and/or expression of polypeptides.The inclusion being usually used：Eukaryotic cell, such as Gram-negative or gram sun Property mattress, that is, escherichia coli, bacillus, streptomyces, Saccharomyces, Salmonella mattress belong to etc. any bacterial strain；Protokaryon is thin Born of the same parents, such as CHO (Chinese hamster ovary) cell；People's kidney 293 cell；COS-7 cell；Insect cell, such as Sf4, Sf5, Sf9 and Sf21 and High 5 (all being from Invitrogen Company, San Diego, Calif.)；Plant cell and each primary yeast Cell, such as Saccharomyces and pichia.Suitably have from any organism (such as antibacterial, yeast, funguses, unifacial leaf Plant and dicotyledon, plant cell and animal) any conversion or transfectional cell or cell line.

Carrier is inserted (also referred to as " converting " or " transfection ") and selectes the such as following method that can utilize in host cell Complete：Calcium chloride, electroporation, microinjection, lipofection or DEAE- glucosan method.Institute's choosing method will partly depend on and will make Host cell species.These methods and other appropriate method are known to technical staff, and are shown in such as Sambrook Et al., ibid.

Host cell containing carrier (namely convert or transfect) can be using the standard medium training known to technical staff Support.Described culture medium generally will comprise cell growth and all nutrients necessary to survival.It is suitable for culture Bacillus coli cells Culture medium be such as Luria Broth (LB) and/or TerrificBroth (TB).It is suitable for the culture medium of culture eukaryotic cell RPMI 1640, MEM, DMEM, all of which can be supplemented with serum required for the specific cells of culture and/or growth because Son.The suitable culture medium of insect cultures is to be supplemented with yeast extract, lactalbumin hydrolysate and/or tire Sanguis Bovis seu Bubali as needed Clear Ge Lasishi (Grace ' s) culture medium.

Generally, the antibiotic of the selective growth that may be only used for transformed cell or other compound are added as supplement Add to culture medium.Selected marker element present on the plasmid that compound to be used will be converted by host cell determines.Example As when selecting identification element to have kalamycin resistance, adding to the compound of culture medium will be kanamycin.

The amount of the polypeptide producing in host cell can be using standard method assessment known in the art.Such method includes The analysis of (but not limited to) western-blot, SDS- polyacrylamide gel electrophoresis, native gel electrophoresises, HPLC separate, immunity is heavy Form sediment and/or binding analysis.

If polypeptide is designed from host cell secretes, most polypeptide would be possible to find in cell culture medium. If however, polypeptide is not from host cell secretes, it will be present in Cytoplasm (for eucaryon, Gram-positive mattress and insecticide place For chief cell) and pericentral siphon (for Gram-negative mattress host cell) in.

For intracellular polypeptides, the mechanicalness of host cell or permeability are destroyed first, and Cytoplasmic inclusions are released Put to buffer solution.Then go out polypeptide from this solution separating.

In order to long-term, recombinant polypeptide is produced with high yield, it is preferred for stablizing expression.For example, stably express concerned polypeptide Cell line can be using expression vector conversion, described expression vector can comprise virus origin of replication and/or endogenous expression Selectable marker gene on element and same vehicle or different carriers.After introducing carrier, cell can be made in enrichment medium Middle growth 1-2 days, is then transferred to Selective agar medium.The purpose of selected marker is to confer to select resistance, and its presence is allowed into The cell growth of sequence and recovery that work(expression introduces.The resistance clone of stable transformed cells can be using suitable cell type Tissue culture technique is bred.Then the cell line being substantially rich in such cell can be separated, stable cell lines are provided.

The particularly preferred method producing recombinant polypeptide of the present invention with high yield is passed through to use in DHFR- defect Chinese hamster ovary celI Dihydrofolate reductase (DHFR) expands, and by using the methotrexate that concentration is continuously cumulative, such as US 4, described in 889,803. Gained polypeptide can be glycoforms.

Various technology purified polypeptide from solution can be utilized.If the polypeptide having synthesized contains in its carboxyl or aminoterminal There are labelling hexahistine or other small peptides, then described polypeptide substantially can pass through parent by making solution in one step process Carry out purification with post, wherein base for post is verified described labelling or directly have high-affinity (namely specific recognition to described polypeptide The monoclonal antibody of described polypeptide).For example, polyhistidyl with big affinity and specifically binds to nickel, the therefore affinity column of nickel (such as Qiagen nickel post) can be used for purification His labeling polypeptide.(see, for example, Ausubel et al. to compile, " Current Protocols In Molecular Biology, " 10.11.8 part, John Wiley＆Sons, New York (1993)).

Part allows ligand binding molecules to carry out affinity purification the strong affinity of its receptor, and ligand binding molecules use Affinity substrate containing complementary binding partner.Affinity chromatography can be adopted, for example, (for example, be joined using natural binding partner Body, when by during to its affinity purification ligand binding molecules) or the antibody that generated using standardization program (for example, with suitable Polypeptide makes mice, rabbit or other animal immune).Polypeptide of the present invention can be used for generating this antibody-like.When being combined with target ligand When molecule shares epi-position, can be using the antibody of known antibodies or known growth factor receptorses.

In addition it is possible to use the purifying procedure known to other.This class package include (but not limited to) ion exchange chromatography, Molecular sieve chromatography, HPLC, native gel electrophoresis joint gel elution and formula isoelectrofocusing (" Isoprime " machine/skill Art, Hoefer Scientific).In some cases, two or more in these technology can combine to increase pure Degree.Preferably purification process includes polyhistidine tag and ion exchange chromatography joint formula isoelectrofocusing.

Polypeptide, pericentral siphon or the cytoplasmic content (bag finding in the Cytoplasm of the periplasmic space of antibacterial or eukaryotic cell Include inclusion body (antibacterial), if treated polypeptide defines such complex) can utilize known to the skilled person any Standard technique is extracted from host cell.For example, it is possible to make host thin by French crusher, homogenizing and/or supersound process Cellular lysate, to discharge the content of pericentral siphon.Then can be to homogenate centrifugation.

If polypeptide defines inclusion body in pericentral siphon, then described inclusion body generally can be bound to intercellular membrane and/ Or adventitia, and therefore mainly will find in granular materialss after centrifugation.Then granular materialss can with chaotropic agent (such as guanidine or Urea) process, to discharge inclusion body, so that it is ruptured and dissolve.Then, the polypeptide of dissolving can be heavy by gel electrophoresiss, immunity The methods such as shallow lake are analyzed.If it is intended to isolated polypeptide, it is possible to use standard method completes to separate, such as those below and [Marston et al., Meth.Enz., 182：264-275 (1990) .] shown in method.

Gene therapy

In some embodiments, the polynucleotide of the present invention comprise the extra sequence for promoting gene therapy further Row.In one embodiment, using encode ligand binding molecules as herein described " naked " transgenic (i.e. not used for promotion The transgenic of the virus of transfection, liposome or other carrier) carry out gene therapy.

Carrier can be used for " gene therapy " therapeutic scheme, wherein by many nucleoside of coding ligand binding polypeptide or molecule Acid is introduced in the form of leading to the cell in experimenter to express the ligand binding molecules of the present invention in vivo to be needed to suppress new hemopoietic In the experimenter that pipe is formed.It is described in United States Patent (USP) to disclose No. 2002/0151680 (they all pass through to draw with WO 01/62942 With being expressly incorporated herein) in gene therapy aspect be also herein applicable.

Using any suitable carrier, the polynucleotide encoding ligand binding molecules as herein described can be introduced host In.Have been described in the exemplary carrier in document and include Replication defective retroviral vector, including but not limited to sick slowly Poisonous carrier (Kim et al., J.Virol., 72 (1)：811-816,1998；Kingsman and Johnson, Scrip Magazine, October, 1998, the 43-46 page)；Adeno-associated viruses (AAV) carrier (U.S. Patent No. 5,474,9351；No. 5,139,941； No. 5,622,856；No. 5,658,776；No. 5,773,289；No. 5,789,390；No. 5,834,441；No. 5,863,541；5, No. 851,521；No. 5,252,479；Gnatenko et al., J.Invest.Med., 45：87-98,1997)；Adenoviruss (AV) carry Body (U.S. Patent No. 5,792,453；No. 5,824,544；No. 5,707,618；No. 5,693,509；No. 5,670,488；5, No. 585,362；Quantin et al., Proc.Natl.Acad.Sci.USA, 89：2581-2584,1992；Stratford Perricadet et al., J.Clin.Invest., 90：626-630,1992；With Rosenfeld et al., Cell, 68：143- 155,1992)；Adenoviruss adeno-associated viruses chimera (U.S. Patent No. 5,856,152) or vaccinia viruss or herpesviruss (U.S. Patent No. 5,879,934；No. 5,849,571；No. 5,830,727；No. 5,661,033；No. 5,328,688)；Lipid The gene transfer (BRL) of body mediation；(U.S. Patent No. 5,631, comprises Sendai virus (Sendai to liposome vectors by No. 237 Virus) the liposome of albumen)；And combinations thereof.All above-mentioned documents are all incorporated herein by reference in their entirety.

Expected other Non-viral delivery mechanisms include but is not limited to：Calcium phosphate precipitation (Graham and Van Der Eb, Virology, 52：456-467,1973；Chen and Okayama, Mol.Cell Biol., 7：2745-2752,1987；Rippe Et al., Mol.Cell Biol., 10：689-695,1990), DEAE- glucosan method (Gopal, Mol.Cell Biol., 5： 1188-1190,1985), electroporation (Tur-Kaspa et al., Mol.Cell Biol., 6：716-718,1986；Potter etc. People, Proc.Nat.Acad.Sci.USA, 81：7161-7165,1984), direct microinjection (Harland and Weintraub, J.Cell Biol., 101：1094-1099,1985.), carry DNA liposome (Nicolau and Sene, Biochim.Biophys.Acta, 721：185-190,1982；Fraley et al., Proc.Natl.Acad.Sci.USA, 76： 3348-3352,1979；Felgner, Sci Am.276 (6)：102-6,1997；Felgner, Hum Gene Ther.7 (15)： 1791-3,1996), cell sonication (Fechheimer et al., Proc.Natl.Acad.Sci.USA, 84：8463-8467, 1987), use the micro- bullet of high speed gene bombardment (Yang et al., Proc.Natl.Acad.Sci USA, 87：9568-9572, 1990) and receptor-mediated transfection (Wu and Wu, J.Biol.Chem., 262：4429-4432,1987；Wu and Wu, Biochemistry, 27：887-892,1988；Wu and Wu, Adv.Drug Delivery Rev., 12：159-167,1993).

Expression construct (or ligand binding molecules actually described herein) can be embedded in liposome.Liposome It is imitated vesicle structure, be characterized as Lipid bilayer membranes and inner aqueous medium.Multilamellar liposome has multiple has aqueous medium to separate Lipid layer.When being suspended in phospholipid in excess aqueous solution, they just spontaneously form.Fat component experiences self and resets, and is then formed Enclosed construction, and by water and dissolving solute be embedded between lipid bilayer (Ghosh and Bachhawat,：Liver diseases, Targeted diagnosis and therapy using specific receptors and ligands, Wu G, Wu C Compile, New York：Marcel Dekker, the 87-104 page, 1991).By DNA add to cationic-liposome lead to topology from Liposome is converted to optical birefringence liquid crystal and concentrates ball (Radler et al., Science, 275 (5301)：810-4,1997).This A little DNA- ester complexes are the potential non-virus carriers for gene therapy and delivery.

The liposome-mediated in vitro delivery of nucleic acids of foreign DNA and expression have been achieved with successfully.Present invention further contemplates that being related to " fat The various business methods of matter transfection " technology.In certain embodiments of the invention, liposome can be with haemagglutinating viruses (HVJ) Compound.It has been proved that this contributes to and cell membrane fusion, and promote the more strong DNA of liposome enter cell (Kaneda et al., Science, 243：375-378,1989).In other embodiments, liposome can be with core nonhistone chromosomal protein (HMG-1) compound or used together (Kato et al., J.Biol.Chem., 266：3361-3364,1991).Other real Apply in scheme, liposome can be combined or used together with HVJ and HMG-1.Since such expression vector is successfully used In nucleic acid in vitro and internal transfer and expression, then they are applied to the present invention.

Another embodiment that the present invention is used for that naked DNA expression construct is transferred in cell may relate to particle and bangs Hit.This method depends on accelerating to the microgranule of coating DNA allows they to be pierced through cell membrane and enters cell without killing Ability (Klein et al., Nature, 327 of their two-forty dead：70-73,1987).Have been developed for several for Accelerate the device of compact particle.A kind of such device relies on electrion to produce electric current, and it provides power (Yang etc. then People, Proc.Natl.Acad.Sci USA, 87：9568-9572,1990).The microgranule being used is by bioinert material (such as Tungsten or gold bead grain) composition.

In the embodiment using viral vector, preferred polynucleotide also include suitable promoter as above and Polyadenylic acid sequence.In addition it will be apparent that, in these embodiments, polynucleotide also include vector polynucleotides Sequence (for example, adenoviruss polynucleotide) may be operably coupled to the sequence of the coded polypeptide of the present invention.

The therapeutic use of ligand binding molecules

Ligand binding polypeptide and molecule described herein and encode their polynucleotide and carrier can be used for suppression and passes through The cell processes of endothelial cell growth factor (ECGF) mediation, endothelial cell growth factor (ECGF) passes through VEGFR-2 or VEGFR-3 inducing signal transduction, and refers to Show the prevention of the disease (for example, various eye disorders and cancer) related to abnormal vascular generation and/or lymphatic vessel generation or control Treat, abnormal vascular generates and/or lymphatic vessel generation is by such somatomedin, the effect of these receptors to be stimulated.Ligand binding Polypeptide and molecule described herein and encode their polynucleotide and carrier has therapeutic use, can be used for treating or prevent logical Cross and remove, suppress or reduce VEGF-C and/or VEGF-D improvement, any disease of the disease of improvement, suppression or prevention.By suppression The non-exhaustive list making or reducing the concrete disease that VEGF-C and/or VEGF-D (and particularly at least VEGF-C) improves includes： Be characterized as the clinical disease of vascular endothelial cell hyperplasia, vascular permeability, edema or inflammation, such as with damage, apoplexy or The related cerebral edema of tumor；The edema related to inflammatory conditions, such as psoriasiss or arthritis, including rheumatoid joint Scorching；Asthma；To related general edema of burning；To tumor, inflammation or the related ascites of wound and hydrothorax；Chronic airway is scorching Disease；Capillary vessel leak syndrome；Sepsis；Increase related nephropathy to protein leak；And oculopathy, such as age related Degeneration of macula and diabetic retinopathy.

For simplicity's sake although describing many methods below for the compositionss comprising ligand binding molecules, but it should reason Solution it is considered to any construct described herein (ligand binding polypeptide, molecule and encode their construct and polynucleotide, Dimer and other polymer etc.) present invention.

Exemplary treatment purposes be a kind of suppress experimenter in need in new vesselses formed method, it include to This experimenter applies consumption and can effectively suppress what the new vesselses in experimenter were formed to comprise ligand binding molecules as herein described Compositionss.In some embodiments, new vesselses form and include choroid or retinal neovascularazation.Real at some Apply in scheme, new vesselses form the tumor angiogenesis being to be present in malignant cancer and other tumor.

In yet another aspect, this document describes a kind of prevention or treatment form the side of relevant eye disorders with new vesselses Method, it includes comprising ligand binding molecules as herein described to experimenter's administration of needs prevention or the described eye disorders for the treatment of Compositionss.

In yet another aspect, this document describes a kind of prevention or treatment lead to retinal edema eye disorders method, It includes to needs prevention or treats the experimenter of described eye disorders or disease and apply and comprise ligand binding as herein described and divide The compositionss of son.

The example of treatable eye disorders includes choroidal neovascularization formation, diabetic macular edema, age Macular degeneration related, proliferative diabetic retinopathy, the retinal vein occlusion and corneal neovascularization/transplanting Repel.Preferably, the amount of the ligand binding molecules being adopted suppresses VEGF-C and/or VEGF-D ligand binding to arrive effectively The thorn to VEGFR-3 (and preferably other VEGFR-2) for the VEGFR-3 (and preferably other VEGFR-2) or VEGF-C and/or VEGF-D Swash effect.

In one embodiment, eye disorders are age-related macular degeneration.The reality of age-related macular degeneration Example is non-neovascular (also referred to as " dryness ") degeneration of macula and neovascular (also referred to as " moist ") degeneration of macula. In a preferred embodiment, eye disorders are wet age related macular degenerations.Treatment or prevention Wet Age are related Property degeneration of macula also include treat or prevent choroidal neovascularization formed or retinal pigment epithelium detachment.

In one embodiment, eye disorders are polypoidal choroidal vasculopathy in Chinese patients.Polypoidal choroidal vasculopathy in Chinese patients Feature be the interior choroidal artery network from blood vessel focus, it is finally that aneurysmal is raised or outwardly (Ciardella et al. (2004) Surv Ophthalmol.49：25-37).

In one embodiment, eye disorders are to form related condition of illness to choroidal neovascularization.New with choroid The example that angiogenic forms the condition of illness of correlation includes degeneration, inflammatory, traumatic or idiopathic condition of illness.Treatment or prevention and venation The degenerative disorders that film new vesselses form correlation also include treating or prevent heredo disease.Heredo disease The example of disease includes vitelliform macular dystrophy, fundus flavimaculatus and papilla of optic nerve drusen.Newborn with choroid The example of the related degeneration condition of illness of vascularization includes myopic degeneration or angioid streak.Treatment or prevention are new with choroid Angiogenic formed correlation inflammatory disease also include treating or prevent ocular tissue kytoplasm bacterium disease syndrome, Multifocal choroiditis, Crawl row choroiditises, toxoplasmosiss, toxocariasis, rubella, Vogt Koyanagi-Harada syndrome (Vogt-Koyanagi- Harada syndrome), behcet's syndrome (Behcet syndrome) or sympathetic ophthalmia.Treatment or prevention and choroid The traumatic disease that new vesselses form correlation also includes treating or prevent to coagulate the choroidal rupture causing or wound by strong light Sexually transmitted disease (STD) shape.

In one embodiment, eye disorders are hypertensive retinopathies.

In one embodiment, eye disorders are diabetic retinopathy.Diabetic retinopathy is permissible It is non-proliferative or proliferative diabetic retinopathy.The example of non-proliferative diabetic retinopathy includes macula lutea Edema and macular ischemia.

In one embodiment, eye disorders are that sickle cell retinopathy becomes.

In one embodiment, eye disorders are to form related condition of illness to peripheral retina new vesselses.With periphery The example of the related condition of illness of retinal neovascularazation include ischemic angiopathy, may with the inflammatory diseasess of ischemia, Bloch-Siemens syndrome, retinitis pigmentosa, retinoschisis or chronic retinal depart from.

The example of ischemic angiopathy includes proliferative diabetic retinopathy, branch retinal vein occlusion remaining, regards Nethike embrane bifurcated artery obstruction, carotid-cavernous fistula, sickle cell hemoglobinopathies, non-sickle cell hemoglobinopathies, IRVAN Syndrome (being characterized as the retinal vasculitis disease of idiopathic retinal vasculitis, aneurysm and neuroretinitis), regard Nethike embrane thromboembolism, retinopathy of prematurity, familial exudative vitreoretinopathy, high viscous syndrome, aortic arch Syndrome or eales disease (Eales disease).The example of sickle cell hemoglobinopathies includes SS hemoglobinopathy and SC Hemoglobinopathy.The example of non-sickle cell hemoglobinopathies includes AC hemoglobinopathy and AS hemoglobinopathy.High viscous is comprehensive The example closing disease includes leukemia, Waldenstrom's macroglobulinemia (Waldenstrom macroglobulinemia), multiple bone Myeloma, erythrocytosiss or myeloproliferative disorder.

Treatment or prevention also may include treating with the inflammatory diseasess of ischemia or prevent regard related to systemic disease The scorching retinal vasculitis related to infectious agent of retinal vasculature, uveitis or birdshot retinopathy (birdshot retinopathy).The example of systemic disease includes systemic lupus erythematosus (sle), behcets disease, inflammatory bowel Disease, sarcoidosises, multiple sclerosis, Wei Genashi granulomatosis (Wegener ' s granulomatosis) and nodositas are moved more Arteries and veins is scorching.The example of infectious agent include bacterial pathogens (its be syphilis, tuberculosis, Lyme disease (Lyme disease) or Cat scratch disease pathogenic former), viral (such as herpesviruss) or parasite (such as Toxocara canis (Toxocara canis) or bow Shape worm (Toxoplasma gondii)).Uveitic example includes orbiculus ciliarises inflammation or uveitis Fox is comprehensive Disease.

In one embodiment, eye disorders are retinopathy of prematurity.Retinopathy of prematurity likely cause Misgrowth (Pollan C (2009) Neonatal Netw.28 in the vascular bed medium vessels of the retina supporting growth：93- 101).

In one embodiment, eye disorders venous occlusive disease.The example of venous occlusive disease includes view Film branch retinal vein occlusion and central retinal vein occlusion.Branch retinal vein occlusion remaining can be for discharging following of retina blood The blocking of loop section.This blocking can lead to the build pressure in blood capillary, and this may lead to bleeding and also result in body fluid And the seepage of other blood constitutent.

In one embodiment, eye disorders are arteriosclerosis obliteranss.The example of arteriosclerosis obliteranss includes regarding Nethike embrane bifurcated artery obstruction, central retinal artery occlusion or eyes ischemic syndrome.Arterial branch when supply to retina One of occur block when it may occur however that Branch Retinal Artery block (BRAO).

In one embodiment, eye disorders are central serous chorioretinopathy (CSC).In a reality Apply in scheme, CSC is characterised by the leakage of body fluids in central macula lutea.

In one embodiment, eye disorders are cystoid macular edema (CME).In one embodiment, CME impact Central retina or macula lutea.In another embodiment, CME occurs after cataract operation.

In one embodiment, eye disorders are retinal telangiectasias.In one embodiment, retina Telangiectatic expansion being characterised by retinal vessel and the formation of complications and Multiple aneurysms.Idiopathic JXT, The granular aneurysm of Lay Bai Shi foxtail millet (Leber ' s miliary aneurysm) and coats disease (Coats ' disease) are three species The retinal telangiectasia of type.

In one embodiment, eye disorders are huge aneurysms.

In one embodiment, eye disorders are retinal angiomatosiies.In one embodiment, work as ocular vascular When forming angiomatosises, there are retinal angiomatosiies.

In one embodiment, eye disorders are radiation inducible retinopathy (RIRP).In an embodiment In, RIRP can show the symptom of such as macular edema and non-proliferative and proliferative retinopathy.

In one embodiment, eye disorders are rubeosis of iris.In another embodiment, rubeosis of iris leads to newly The formation of angiogenic glaucoma.In another embodiment, rubeosis of iris is by diabetic retinopathy, retina Central retinal vein occlusion, eyes ischemic syndrome or chronic retinal disengaging cause.

In one embodiment, eye disorders are tumors.The example of tumor includes eyelid tumor, conjunctival tumor, venation Film tumor, Iris neoplasms, optic nerve tumors, Retinal neoplasms, wellability intraocular tumour or orbital tumor.The example of eyelid tumor Including basal cell carcinoma, squamous cell carcinoma, sebaceous gland carcinoma, malignant melanoma, capillary hemangioma, hidrocystoma, nevuss or seborrhea Property keratosiss.The example of conjunctival tumor includes conjunctiva Kaposi sarcoma (conjunctival Kaposi ' s sarcoma), squama Tumor, eyeball surface dermoid cyst, conjunctiva lymphoma, melanoma, pinguecula or pterygium in shape cell carcinoma, conjunctival epithelium. The example of choroidal tumor includes choroid nevuss, choroidal hemangioma, choroidal metastasis tumor, choroidal osteoma, choroid black Plain tumor, corpus ciliare melanoma or Ota nevuss.It is black that the example of Iris neoplasms includes leading portion tunica uvea metastatic tumor, iris cyst, iris Chromatophoroma, iris melanoma or iris pearl cyst.The example of optic nerve tumors includes optic nerve melanocyte Tumor, vagina nervi optici meningioma, impact optic nerve melanoma of choroid or with metastatic tumor around the nipple of optic neuropathy. The example of Retinal neoplasms includes retinal pigment epithelium (RPE) hypertrophy, RPE adenoma, RPE cancer, retinoblastoma, RPE Hamartoma or Feng Xi Perdipine hemangioma (von Hippel angioma).It is thin that the example of wellability intraocular tumour includes chronic lymphatic Born of the same parents' property leukemia, wellability choroidopathy or Intraocular lymphoma.The example of orbital tumor includes Adenoid cystic caroinoma of Lacrimal gland, eye socket Cavernous hemangioma, eye socket lymphangioma, mucocele of orbit, pseudotumor of orbit, rhabdomyosarcoma of orbit, child's hemangioma near the eyes Or atherosclerotic type pseudotumor of orbit.

In yet another aspect, the present invention describes a kind of method treating ocular injury, and it is included to experimenter in need The ligand binding molecules as herein described of local application effective dose, thus mitigating or improving ocular injury.Preferably, described ocular injury It is corneal injury or conjunctival damage and the described Therapeutic Method minimizing angiogenesis related to ocular injury and inflammation.In some enforcements In scheme, methods described can be used for treating acute and subacute corneal injury or conjunctival damage.Acute corneal injury can be Treated in after appearance 24 hours, and include being damaged by the cornea piercing through object, foreign body or chemistry injures or burn causes Wound or conjunctival damage.Subacute damage can be treated in most two weeks after injury and can include above-mentioned damage with And spreading venereal diseasess because.In some embodiments, ocular injury is by wound such as surgical injury, chemical burn, corneal transplantation, biography Metachromia or inflammatory diseasess cause.

Treatment length will change according to damage, but the treatment persistent period can be short, for example most one month, and can To include the observation period of 3-6 month, can provide during this period and treat again.Administration can also include the second reagent, such as immunity One or more of inhibitor, such as corticosteroid, dexamethasone or cyclosporin A.Local application is included for example to apply The eye drops being added on eyes apply ligand binding molecules, or subconjunctival injection is in eyes.

In yet another aspect, this document describes a kind of method curing ocular injury, it is included to experimenter office in need Portion applies the ligand binding molecules as herein described of effective dose, so that ocular injury healing.

In yet another aspect, this document describes a kind of method reducing or mitigating angiogenesis relevant with ocular injury, its Including the ligand binding molecules as herein described to experimenter's local application effective dose in need, thus reducing or mitigating and eye Damage relevant angiogenesis.

In yet another aspect, this document describes a kind of method reducing or mitigating the inflammation relevant with ocular injury, it includes To the ligand binding molecules as herein described of experimenter's local application effective dose in need, thus reducing or mitigating and ocular injury Relevant inflammation.

In yet another aspect, this document describes a kind of ligand binding molecules applying the present invention are treating and ocular injury or sense It is infected with the angiogenesis of pass and/or the method for inflammation, it includes the eye drop by comprising ligand binding molecules as herein described Carry out local application, or carry out applying under conjunctiva by injection or transplanting.

In yet another aspect, this document describes a kind of prolongation carries out the survival of corneal graft after corneal transplantation in patients The method of phase, methods described is the medicine group containing ligand binding molecules as herein described by applying effective dose to this patient Compound (angiogenesis in suppression patient's cornea and/or lymphatic vessel generation whereby).

Dose response research allows accurately to measure the usage amount of suitable ligand binding molecules.Effective dose can for example pass through Measurement polypeptide (for example, is used for the binding affinity of target receptor, acceptor quantity, expected dilution volume present on target cell The weight in patients of internal embodiment and blood volume) and polypeptide clearance rate estimating.For example, relevant known VEGF-C antibody Dosage existing document also can be ligand binding molecules as herein described dosage provide instruct.Description A Baixi A kind of document of the dosage of general (Regeneron) (part trap based on VEGFR-1/VEGFR-2) can be used for as this The dosage of the treatment molecule described in literary composition provides and instructs.

In some embodiments, when being applied by intravitreal injection, ligand binding molecules are with every eye about 2mg To about 4mg's (or every eye about 1mg to about 3mg or about 1mg to about 4mg or about 3mg to about 4mg or about 1mg to about 2mg) Concentration is applied.In some embodiments, with every eye about 1mg or about 2mg or about 3mg or about 4mg or about 5mg or about The concentration of 6mg applies ligand binding molecules.In some embodiments, ligand binding molecules are any concentration enumerated above Be present in 10 μ l, 15 μ l, 20 μ l, 25 μ l, 30 μ l, 35 μ l, 40 μ l, 45 μ l, 50 μ l, 60 μ l, 70 μ l, 80 μ l, 90 μ l, 95 μ l or In the volume of 100 μ l.In some embodiments, ligand binding molecules are to be applied with the concentration of about 2-4mg/50 μ l.

Ligand binding molecules as herein described can be only used as prophylactic treatment and be applied to have prevented development and new hemopoietic Pipe forms the new life in the experimenter of risk of ocular disease (for example, diabetic retinopathy, degeneration of macula) of correlation Vascularization, or it is administered to experimenter with the ocular disease eye to suppress experimenter in need as therapeutic treatment New vesselses in eyeball are formed.

The experimenter having the risk of development diabetic retinopathy or degeneration of macula includes：Age exceedes quinquagenary Experimenter；Experimenter with rheumatoid arthritiss；Patient with diabetes；With the experimenter that thyroid is abnormal；Suffer from There is the experimenter of asthma；With cataractous experimenter；Experimenter with glaucoma；Experimenter with lupus；With height The experimenter of blood pressure and the experimenter with retina shedding.Other risk factor include sudden and violent under heredity, diet, smoking and sunlight Dew.

In some embodiments, this document describes a kind of for experimenter in need select therapeutic scheme method, its One or more symptom including the eye disorders related to retinal neovascularazation of examination experimenter and being subject to for this Examination person opens the prescription applying the compositionss comprising ligand binding molecules as herein described.In another embodiment, herein Describe a kind of method with the experimenter of eye disorders related to retinal neovascularazation for treatment, it includes differentiating There is the experimenter of one or more symptom of described eye disorders and apply, to experimenter, the group comprising ligand binding molecules Compound.The related symptoms of the eye disorders relevant with retinal neovascularazation include but is not limited to：Blurred vision and vision Slow forfeiture in time, the subparticle drift of ophthalmic, the shade of vision zone or loss, metamorphopsia and nyctalopia.

In some embodiments, method described herein further includes to open or (administration) is used for treating xerophthalmia Nursing standard scheme.In the context of approach described herein, " nursing standard " refers to generally accepted by clinician For being diagnosed as with a kind for the treatment of of the specific types of patients of disease.For example for diabetic retinopathy and macula lutea For degeneration, one aspect of the present invention is to be divided using the ligand binding as herein described with suppression retinal neovascularazation The conjoint therapy of son is improving nursing standard therapy.The exemplary care standard of diabetic retinopathy and degeneration of macula is controlled Treatment includes but is not limited to：Eyelid hygiene, topical antibiotic (including but not limited to erythromycin or bar mattress peptide ointment), oral tetracycline Class (tetracycline, doxycycline (doxycycline) or minocycline (minocycline)), anti-inflammatory compound (include but not Be limited to cyclosporin), corticosteroid, laser photocoagulation and optical dynamic therapy.

Also contemplate treatment with the mammalian subject of eye disorders related to retinal neovascularazation Method, this mammalian subject has hypoergia, methods described bag to the nursing standard scheme for treating eye disorders Include and ligand binding molecules are applied to this experimenter with the amount of this disease of effectively treatment.

Mammalian subject is preferably people experimenter.It is also contemplated that the method for the present invention is in other mammals tested Person, is especially often used as model to prove mammal (for example, primate, pig, dog or the rabbit of the curative effect in people Animal) in practice.

Combined therapy and other activating agent

The combined therapy of the present invention and preventative embodiment include product and method.Can with one as herein described or The exemplary compounds that multiple ligand binding molecules are administered in combination include but is not limited to the compound providing in table 2 below.

Ligand binding molecules can be administered in combination with one or more other reactive compound or therapy, is subject to including second Body capture molecule, cytotoxic agent, surgical operation, pipe guide and radiation.Exemplary combination product includes two or more Kind of reagent, they be formulated into single compositionss or be packaged together as such as unit dose packaging using separate compositionss or Test kit.Exemplary combined method includes opening administration prescription, or applies simultaneously or in the lump or with the staggered time (i.e. sequentially) Use two or more reagent.

As used herein, term " cytotoxic agent " refers to suppress or stop cell function and/or leads to cell to break Bad material.This term is intended to include radiosiotope (for example, I¹³¹、I¹²⁵、Y⁹⁰And Re¹⁸⁶), chemotherapeutant and toxin Enzyme activity toxin or its fragment as antibacterial, funguses, plant or animal origin.

" chemotherapeutant " is useful chemical compound in treatment of cancer.The example of chemotherapeutant includes：Alkanisation Agent, such as thio-tepa (thiotepa) and cyclophosphamideAlkyl sulfonates, such as busulfan (busulfan) a, improsulfan (improsulfan) and piposulfan (piposulfan)；Aziridines (aziridines), Such as benzodepa (benzodopa), carboquone (carboquone), U.S. amine TEPA (meturedopa) and urethimine (uredopa)；Ethylenimine class (ethylenimine) and methylamelamines (methylamelamine), including pregnancy honey Amine (altretamine), triethylenemelamine, triethylenephosphoramide, triethylene thiophosphoramide and tri methylol melamine (trimethyloIomelamine)；Chlormethine (nitrogen mustard), such as chlorambucil, chlornaphazine (chlornaphazine), cholophosphamide (cholophosphamide), estramustine (estranustine), different ring phosphinylidyne Amine, chlormethine (mechlorethamine), mustron (mechlorethamine oxide hydrochloride), American and French Logical sequence (melphalan), novoembichin (novembichin), phenesterin (phenesterine), prednimustine (prednimustine), trofosfamide (trofosfamide), uracil mustard (uracil mustard)；Nitrosoureas (nitrosourea), such as carmustine (carmustine), chlorozotocin (chlorozotocin), fotemustine (fotemustine), lomustine (lomustine), nimustine (nimustine), Ranimustine (ranimustine)； Antibioticses, such as aklavine (aclacinomysin), D actinomycin D (actinomycin), anthramycin (authramycin), azaserine (azaserine), bleomycin (bleomycin), actinomycin C (cactinomycin), Calicheamicin (calicheamicin), OK a karaoke club are than star (carabicin), carminomycin (carminomycin), cardinophyllin (carzinophilin), chromomycin (chromomycin), dactinomycin, daunorubicin, Detorubicin (detorubicin), 6- phenodiazine -5- oxn-l-norieucin, doxorubicin (doxorubicin), epirubicin (epirubicin), esorubicin (esorubicin), idarubicin (idarubicin), marcellomycin (marcellomycin), mitomycin, mycophenolic acid (mycophenolic acid), nogalamycin (nogalamycin), Fructus Canarii albi Mycin (olivomycin), peplomycin (peplomycin), porfiromycin (potfiromycin), puromycin (puromycin), triferricdoxorubicin (quelamycin), rodorubicin (rodorubicin), streptonigrin (streptonigrin), streptozocin (streptozocin), tubercidin (tubercidin), ubenimex (ubenimex), zinostatin (zinostatin), zorubicin (zorubicin)；Antimetabolic species, such as methotrexate and 5-fluorouracil (5-FU)；Folacin, such as 9,10-dimethylpteroylglutamic acid (denopterin), methotrexate, Pteropterin (pteropterin), trimetrexate (trimetrexate)；Purine analogue, such as fludarabine (fludarabine), 6- Thin base purine (6-mercaptopurine), ITG (thiamiprine), thioguanine (thioguanine)；Miazines Like thing, such as ancitabine (ancitabine), azacitidine (azacitidine), 6- azauridine (6-azauridine), card Not fluorine (carmofur), cytosine arabinoside, di-deoxyuridine (dideoxyuridine), Doxifluridine (doxifluridine), Enocitabine (enocitabine), floxuridine (floxuridine)；Androgens, such as calusterone (calusterone), Dromostanolone propionate (dromostanolone propionate), epitiostanol (epitiostanol), mepitiostane (mepitiostane), testolactone (testolactone)；Anti- adrenal gland's class, such as aminoglutethimide (aminoglutethimide), mitotane (mitotane), trilostane (trilostane)；Folic acid supplement, such as sub- leaf Sour (leucovorin)；Aceglatone (aceglatone)；；Aldophosphamideglycoside (aldophosphamide glycoside)；Amino-laevulic acid (aminolevulinic acid)；Peace a word used for translation is fixed；bestrabucil；Bisantrene (bisantrene)；Edatrexate (edatraxate)；Defosfamide (defofamine)；Demecolcine (demecolcine)； Diaziquone (diaziquone)；Eflornithine (elfornithine)；Elliptinium acetate (elliptinium acetate)；According to Tuo Gelu (etoglucid)；Ganite (Fujisawa).；Hydroxyurea；Lentinan (lentinan)；Lonidamine (lonidamine)；Meter Tuo Guanidine hydrazone (mitoguazone)；Mitoxantrone；Mopidamol (mopidamol)；Nitrazine；Pentostatin；Benzene carrys out beautiful spy (phenamet)；Pirarubicin (pirarubicin)；Podophyllinic acid；2- ethylhydrazide；Procarbazine；Razoxane (razoxaue)；Sizofiran (sizofiran)；Spirogermanium (spirogermanium)；Sour (tenuazonicacid) for slave's assistant； Triaziquone (triaziquone)；2,2 ', 2 "-RA3；Urethane (urethan)；Vindesine；Dacarbazine；Sweet Dew alcohol chlormethine；Mitobronitol；Mitolactol (mitolactol)；Pipobroman (pipobroman)；Jia Tuoyin (gacytosine)；Galactoside (arabinoside) (" Ara-C ")；Cyclophosphamide；Thio-tepa；Taxanes, such as Ramulus et folium taxi cuspidatae Alcohol (Bristol-Myers Squibb Oncology, Princeton, N.J.) and docetaxel (Aventis Antony, France)；Chlorambucil (chlorambucil)；Gemcitabine (gemcitabine)；6- thioguanine；Purinethol；Methotrexate；Platinum analogs, such as cisplatin and carboplatin；Vinblastine；Platinum； Etoposide (VP-16)；Ifosfamide；Ametycin；Mitoxantrone；Vincristine；Vinorelbine；Navelbine；Promise Peace support (novantrone)；Teniposide (teniposide)；Daunorubicin；Aminopterin；Xeloda (xeloda)；Ibandronic acid Salt (ibandronate)；CPT-11；Topoisomerase enzyme inhibitor RFS 2000；α-difluorometylornithine (DMFO)；Tretinoin； Ai Sipeila mycin (esperamicin)；Capecitabine (capecitabine)；And pharmaceutically can the connecing of any above material Salt, acid or the derivant being subject to.The antihormone agent of the effect to tumor for regulation or inhibitory hormone is also included in this definition, Such as：Anti-estrogenses, including such as tamoxifen (tamoxifen), raloxifene (raloxifene), suppress aromatase 4 (5)-imidazoles, 4-hydroxytamoxifen, trioxifene (trioxifene), that sweet smell (keoxifene) Lip river former times, LY 117018, Onapristone (onapristone) and toremifene (Fareston)；And anti-androgenses, such as Drogenil (flutamide), nilutamide (nilutamide), bicalutamide (bicalutamide), leuprorelin (leuprolide) With goserelin (goserelin)；And the pharmaceutically acceptable salt of any of above material, acid or derivant.

" growth inhibitor " refers to suppress the growth of cell (especially cancerous cell) in vitro or in vivo as used herein Compound or compositionss.The example of growth inhibitor includes blocking the examination of cell cycle progression (stage in addition to the S phase) Agent, the reagent that such as induction G 1 stops and the M phase stops.Typical M phase blocker include Changchun flower drugs (vincristine and Vinblastine),And Topoisomerase II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide And bleomycin.Those stop the reagent of G 1 from can also further resulting in the S phase to stop, such as DNA alkylating agent, such as tamoxifen Sweet smell, prednisone, dacarbazine, chlormethine, cisplatin, methotrexate, 5-fluorouracil and cytosine arabinoside (ara-C).

VEGF-A (VEGF) inhibitor product

In some embodiments, method described herein optionally includes applying therapeutically active agent to suppress VEGF-A to tie Close one or more receptor, particularly VEGFR-2.VEGF-A inhibitor product can be with one or more as herein described Ligand binding molecules are administered in combination.In some embodiments, VEGF-A inhibitor product and ligand binding molecules are with single group Solvate form common use.In other embodiments, VEGF-A inhibitor product is to tie with part as single compositionss Close molecule separate administration.

In one embodiment, VEGF-A inhibitor product is selected from ranibizumab, bevacizumab, VEGF Trap, KH902 Vegf receptor-Fc fusion protein, 2C3 antibody, ORA102, piperazine Jia Tani (pegaptanib), shellfish cut down western Buddhist nun, SIRNA-027, front Hu Su (decursin), decursinol (decursinol), picropodophyllin (picropodophyllin), Myrrha sterone (guggulsterone), PLG101, eicosanoid LXA4, PTK787, pazopanib, Axitinib (axitinib), CDDO-Me, CDDO-Imm, shikonin, beta-hydroxy isovaleryl shikonin, EYE001, Ganglioside GM3, DC101 antibody, Mab25 antibody, Mab73 antibody, 4A5 antibody, 4E10 antibody, 5F12 antibody, VA01 antibody, BL2 antibody, VEGF associated protein, SFLT01, sFLT02, peptide B3, the medicine of TG100801, Sorafenib (sorafenib) or G6-31 antibody or any of above material Acceptable salt on.

The cDNA of human VEGFR-3-2 ECD and aminoacid sequence are listed on SEQ ID NO respectively：5 and SEQ ID NO：In 6. " VEGF-A inhibitor product " can be specifically to work to interact (for example by resistance to reduce VEGF-A/VEGFR-2 Disconnected VEGF-A be attached to VEGFR-2 or by reduce VEGFR-2 expression) any molecule.As used herein, term " VEGF-A " refers to that induction of vascular generates or the VEGF of angiogenesis and the various hypotypes of inclusion VEGF, They are (to include VEGF by such as VEGF-A gene₁₂₁、VEGF₁₆₅And VEGF₁₈₉) alternative splicing and produce.Term " VEGF " can be used to gene or the nucleic acid referring to " VEGF " polypeptide or encoding " VEGF ".

Term " VEGF-A inhibitor product " refers to reduce partially or completely or suppress the activity of VEGF-A or generation Reagent.VEGF-A inhibitor product can directly or indirectly reduce or suppress specific VEGF-A such as VEGF₁₆₅Activity or product Raw.Additionally, " VEGF-A inhibitor product " includes acting on VEGF-A part or its homoreceptor to reduce or to suppress VEGF-A The reagent of associated receptor signal.The example of " VEGF-A inhibitor product " includes the antisense molecule of targeting VEGF-A nucleic acid, ribose Enzyme or RNAi；VEGF-A is fit；VEGF-A antibody；VEGF-A is stoped to combine the soluble VEGF-receptor bait of its homoreceptor； The antisense molecule of targeting homology VEGF-A receptor (VEGFR-1 and/or VEGFR-2) nucleic acid, ribozyme or RNAi；VEGFR-1 and VEGFR-2 is fit or VEGFR-1 and VEGFR-2 antibody；And VEGFR-1 and/or VEGFR-2 tyrosine kinase inhibitor.

VEGF-A inhibitor can be polypeptide (the SEQ ID comprising the sVEGFR-2 ECD fragment with reference to VEGF NO：6 aminoacid 20-764)；Soluble VEGFR -1 ECD fragment, the soluble ligand trap such as Ah based on VEGFR-1/R2 Espumisan general (Regeneron)；VEGFR-2 antisense polynucleotides or short interfering rna (siRNA)；Anti-VEGFR-2 antibody；Comprise to press down The VEGFR-2 inhibitor polypeptide of the Fab of the anti-VEGFR-2 antibody of the combination between VEGFR-2 and VEGF processed；Suppression Combination between VEGFR-2 and VEGF-A processed fit.In some variations, comprise to merge based on the part trap of VEGFR-2 Albumen, it comprises the sVEGFR-2 polypeptide fragment merging with constant region for immunoglobulin fragment (Fc).In some embodiment party In case, VEGFR-2 polypeptide fragment is fused to alkali phosphatase (AP).Method for forming Fc or AP fusion constructs sees WO In 02/060950, the disclosure of which is incorporated herein by reference in their entirety.

Have been described with many VEGF-A antibody, see, for example, U.S. Patent No. 8,349,322；No. 8,236,312；8, No. 216,571；No. 8,101,177；No. 8092,797；No. 8,088,375；No. 8,034,905；No. 5,730,977；6,342, No. 219, No. 6,524,583, No. 6,451,764, No. 6,448,077, No. 6,416,758, No. 6,342,221 and PCT Publication WO 96/30046, WO 97/44453 and WO 98/45331, the content of these documents is passed through to quote to be integrally incorporated.Exemplary VEGF-A antibody includes bevacizumabAnd ranibizumabIn some embodiments, originally One or more ligand binding molecules described in literary composition are administered in combination with bevacizumab.In some embodiments, as herein described One or more ligand binding molecules are administered in combination with ranibizumab.

In some embodiments, VEGF-A inhibitor is EYE001 (being previously referred to as NX1838), and it is adorned Pegylation is fit, combines main soluble human vegf isotype (referring to U.S. Patent No. (ginseng with high specific affinity See U.S. Patent No. 6,011,020；No. 6,051,698；With No. 6,147,204).Described fit with similar to for VEGF's The mode of high-affinity antibody with reference to VEGF and makes it inactivate.Another kind of useful VEGF is fit to be non-PEGylated forms EYE001.

In a preferred embodiment, one or more ligand binding molecules as herein described and VEGF Trap(Holash et al., Proc.Natl.Acad.Sci.USA, 99 are administered in combination：11393-11398,2002, it is public Open content to be incorporated herein by reference in their entirety).

Have been described with many VEGFR-2 antibody, see, for example, U.S. Patent No. 6,334,339 and United States Patent (USP) is open (all of which is integrally incorporated this by quoting for No. 2002/0064528, No. 2005/0214860 and No. 2005/0234225 Literary composition).Antibody can be used for adjusting VEGFR-2/VEGF interaction, and this is due to can easily produce with relative specificity Antibody and due to by antibody be applied to people treatment technology sustained improvement.Therefore, the present invention is expected uses to VEGFR-2 There is specific antibody (for example, monoclonal and polyclonal antibody, single-chain antibody, chimeric antibody, bi-functional/bispecific Antibody, humanized antibody, human antibody and complementary determining region (CDR) grafted antibodies, including containing specific recognition polypeptide of the present invention CDR sequence compound).Human antibody can also be using various technology (mattress body display library is bitten in inclusion) as known in the art [Hoogenboom and Winter, J.Mol.Biol., 227：381(1991)；Marks et al., J.Mol.Biol., 222：581 (1991)] producing.The technology of Cole et al. and Boerner et al. can be used for preparing human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R.Liss, the 77th page (1985) and Boerner etc. People, J.Immunol., 147 (1)：86 95(1991)].It is likewise possible to turn base by introducing human immunoglobulin gene's seat To prepare human antibody because in animal (mice that for example, wherein endogenous immunoglobulin genes have partially or completely inactivated). It was observed that human antibody produces after attack, its in all respects, including gene rearrangement, assembling and antibody repertoire, all with people Finding is very similar.This method is described in such as U.S. Patent No. 5,545,807；No. 5,545,806；No. 5,569,825； No. 5,625,126；No. 5,633,425；In 5,661, No. 016, and following scientific publications：Marks et al., Bio/ Technology 10,779 783 (1992)；Lonberg et al., Nature 368 856 859 (1994)；Morrison, Nature 368,812-13 (1994)；Fishwild et al., Nature Biotechnology 14,845-51 (1996)； Neuberger, Nature Biotechnology 14,826 (1996)；Lonberg and Huszar, I ntern.Rev.Immunol.13：65-93(1995).

PDGF inhibitor product

In some embodiments, method described herein optionally includes applying therapeutically active agent to suppress PDGF to combine To one or more receptor.PDGF inhibitor product can be combined with one or more ligand binding molecules as herein described and apply With.In some embodiments, PDGF inhibitor product and ligand binding molecules are with single composition forms common use.At it In its embodiment, PDGF inhibitor product is as single compositionss and ligand binding molecules separate administration.

Term " PDGF " refers to adjust the platelet-derived growth factor of cell growth or division.As used herein, Term " PDGF " includes the various hypotypes of PDGF, including PDGF-B, PDGF-A, PDGF-C, PDGF-D, its variant form and its two Dimer form, including PDGF-AA, PDGF-AB, PDGF-BB, PDGF-CC and PDGF-DD.Platelet-derived growth factor includes A The homodimer of chain (PDGF-A) and B chain (PDGF-B) or heterodimer, they are via being attached to two related receptor cheese ammonia Acid kinase platelet-derived growth factor cell surface receptor (that is, PDGFR) PDGFR- α and PDGFR- β and this two receptors Dimerization play its effect.In addition it has been identified that being directed to two kinds of extra protease activated parts of PDGFR complex PDGF-C and PDGF-D (Li et al., (2000) Nat.Cell.Biol.2：302-9；Bergsten et al., (2001) Nat.Cell.Biol.3：512-6；With Uutele et al., (2001) Circulation 103：2242-47).Due to PDGFR's Different ligand binding specificity is it is known that PDGFR- α/α combines PDGF-AA, PDGF-BB, PDGF-AB and PDGF-CC； PDGFR- β/β combines PDGF-BB and PDGF-DD；And PDGFR- α/β combines PDGF-AB, PDGF-BB, PDGF-CC and PDGF-DD (Betsholtz et al., (2001) BioEssays 23：494-507).As used herein, term " PDGF " also refers to pass through The combination of the PDGFR in responsive cell type synthesizes that of the somatomedin classification occurring with mitosiss with activation inducing DNA A little members.PDGF can affect for example：Committed cell migration (chemotaxiss) and cell activation；Phospholipase activating；Increased phospholipid Acyl inositol changes and prostaglandin metabolism；The stimulation to collagen and collagen enzymatic synthesiss for the responsive cell；Metabolic activity in cells includes base Matter synthesis, the change that cytokine produces and lipoprotein absorbs；Proliferative induction reaction indirectly in the cell lacking pdgf receptor； And potent vasoconstrictor activity.Term " PDGF " can be used to refer to " PDGF " polypeptide, the gene of coding " PDGF " or core Acid or its dimeric forms.

Term " PDGF inhibitor product " refers to reduce or suppress the activity of PDGF or the reagent of generation partially or completely. PDGF inhibitor product can directly or indirectly reduce or suppress activity or the generation of specific PDGF such as PDGF-B.Additionally, " PDGF inhibitor product " includes acting on PDGF part or its homoreceptor to reduce or to suppress PDGF associated receptor signal Reagent.The example of " PDGF inhibitor product " includes antisense molecule, ribozyme or the RNAi of targeting PDGF nucleic acid；PDGF is fit, The PDGF antibody of PDGF itself or its receptor, or stop PDGF from being attached to the solubility pdgf receptor bait of its homoreceptor；Target To the antisense molecule of homology pdgf receptor (PDGFR) nucleic acid, ribozyme or RNAi；The PDGFR being attached to homology PDGFR receptor fits Body or PDGFR antibody；And PDGFR tyrosine kinase inhibitor.

In one embodiment, PDGF inhibitor product is selected from：As US 2012/0100136, (entire contents are passed through Be incorporated herein by reference) described in and definition formula A, B, the compound of C, D or E, p183 antibody, CDP860, IMC-3G3, 162.62 antibody, 163.31 antibody, 169.14 antibody, 169.31 antibody, α R1 antibody, 2A1E2 antibody, M4TS.11 antibody, M4TS.22 antibody, Hyb 120.1.2.1.2 antibody, Hyb 121.6.1.1.1 antibody, Hyb 127.5.7.3.1 antibody, Hyb 127.8.2.2.2 antibody, Hyb 1.6.1 antibody, Hyb 1.11.1 antibody, Hyb 1.17.1 antibody, Hyb 1.18.1 antibody, Hyb 1.19.1 antibody, Hyb 1.23.1 antibody, Hyb 1.24 antibody, Hyb 1.25 antibody, Hyb 1.29 antibody, Hyb 1.33 Antibody, Hyb 1.38 antibody, Hyb 1.39 antibody, Hyb 1.40 antibody, Hyb 1.45 antibody, Hyb 1.46 antibody, Hyb 1.48 antibody, Hyb 1.49 antibody, Hyb 1.51 antibody, Hyb 6.4.1 antibody, F3 antibody, humanization F3 antibody, C1 antibody, Humanization C1 antibody, 6.4 antibody, anti-mPDGF-C anti-goat IgG antibody, C3.1 antibody, PDGFR-B1 monoclonal antibody, PDGFR- B2 monoclonal antibody, 6D11 monoclonal antibody, Sis 1 monoclonal antibody, PR7212 monoclonal antibody, PR292 monoclonal antibody, HYB 9610 monoclonal antibody, HYB 9611 monoclonal antibody, HYB 9612 monoclonal antibody or HYB 9613 monoclonal antibody Or the pharmaceutically acceptable salt of any of above material.

In a preferred embodiment, one or more ligand binding molecules as herein described are (all with PDGFR- β antibody The antibody for eye indication as developed by Regeneron Inc.) or anti-PDGF fit (such as by Ophthotech Inc. the E10030 for eye indication developing) it is administered in combination.

Also contemplate the antibody fragment of such as VEGF-A and PGDF inhibitor product, including Fab, Fab ', F (ab ') 2, Fv, scFv.For describe the present invention antibody when, term " being specific to " represent antibody of the present invention variable region specially identify and tie Close concerned polypeptide (that is, can by the measured difference of binding affinity by concerned polypeptide and identical family its Its known peptide is distinguished, although there may be the sequence identity of local, homology or similarity between family member).Should This is appreciated that, specific antibody can also be with other oroteins (for example, staphylococcus aureuses (S.aureus) a-protein Or the other antibody in elisa technique) interact, by with the variable region of described antibody outside and particularly molecule constant region In sequence interaction.Screening analysis for measuring the binding specificity of antibody of the present invention is well known in the art And to implement in the usual way.With regard to comprehensive discussion of this alanysis, referring to Harlow et al. (editor), Antibodies A Laboratory Manual；Cold Spring Harbor Laboratory；Cold Spring Harbor, NY (1988), 6th chapter.The antibody of the present invention can be prepared using any method that is well known in the art and implementing in the usual way.

In another embodiment, method described herein optionally include to experimenter apply antisense (for example, with VEGFR-2 antisense) nucleic acid molecules.The antisense nucleic acid molecule of specified protein (for example, VEGFR-2) can be used for pressing down in treatment System encodes the translation of the mRNA of this protein (for example, VEGFR-2), and wherein therapeutic goal includes wishing to eliminate described protein Exist or lower its level.VEGFR-2 antisense RNA for example can wherein VEGFR-2 as pathogenic Radix Scrophulariae and disease (for example Inflammatory diseasess) treatment in be used as VEGFR-2 antagonist.

Antisensenucleic acidses comprise " just " complementary nucleic acid (for example, the coding strand with doublestranded cDNA molecule with coded protein Complementary or complementary with mRNA sequence) nucleotide sequence.(see, for example, SEQ ID NO：1 VEGFR-3 cDNA sequence).With It is described in Lima et al. (J Biol Chem in the method designing and optimizing antisense nucleotide；272：626-38.1997) and Kurreck et al. (Nucleic Acids Res.；30：1911-8.2002).In particular aspects, there is provided antisense nucleic acid molecule, It comprises with least about 10,25,50,100,250 or 500 nucleotide or whole protein (such as VEGFR-2) coding strand or The only complementary sequence of one part.Also contemplate fragment, congener, derivant and the class of coded protein (such as VEGFR-2) Nucleic acid molecules or the antisensenucleic acidses with protein (VEGFR-2) nucleic acid array complementation like thing.

In one embodiment, antisense nucleic acid molecule and the nucleotide sequence of coded protein such as such as VEGFR-2 " coding region " antisense of coding strand.Term " coding region " refers to the password comprising to be translated into amino acid residue of nucleotide sequence The region of son.In another embodiment, the antisense nucleic acid molecule and coded protein such as nucleotide sequence of such as VEGFR-2 Coding strand " concession area " antisense.Term " concession area " refers to 5 ' and 3 ' sequences positioned at coding region flank, and they are not turned It is translated into aminoacid (that is, also referred to as 5 ' and 3 ' non-translation area).

The antisensenucleic acidses of the present invention can be according to Watson-Crick (Watson and Crick) or Hoogsteen base Pairing ruleses are designed.Antisense nucleic acid molecule can be complementary with the whole coding region of protein mRNA, but is more preferably and egg The oligonucleotide of the only a part antisense of the coding region of white matter mRNA or noncoding region.The length of antisense oligonucleotide can be example Such as from about 5,10,15,20,25,30,35,40,45 or 50 nucleotide.The antisensenucleic acidses of the present invention can using chemosynthesis or Enzymatic coupled reaction, is built using program as known in the art.For example, antisensenucleic acidses (for example, antisense oligonucleotide) can To utilize chemical method, synthesizing, described modification is intended to increase for nucleotide using naturally occurring nucleotide or through different modifying The biological stability of bonus point or improve the duplex being formed between antisense and sense nucleic acid physical stability (for example, it is possible to The nucleotide being replaced using phosphorothioate derivative and acridine).

The example that can be used for producing the modification nucleotide of antisensenucleic acidses includes：5-fluorouracil, 5-bromouracil, 5- Chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5- (carboxyl hydroxymethyl) uracil, 5- carboxylic first Base amino methyl -2- thio uridine, 5- carboxymethylamino methyluracil, dihydrouracil, β-D- galactosyl pigtail glycosides, flesh Glycosides, N6- isopentenyl gland purine, 1- methyl guanine, M1I, 2,2- dimethylguanine, 2- methyladenine, 2- Methyl guanine, 3- methylcystein, 5-methylcytosine, N6- adenine, 7- methyl guanine, 5- Methylaminomethyl urine Pyrimidine, 5- Methoxyamino methyl -2- thiouracil, β-D-MANNOSE base pigtail glycosides, 5 '-methoxyl group carboxymethyl uracil, 5- first Epoxide uracil, 2- methyl mercapto-N6- isopentenyl gland purine, uracil -5- fluoroacetic acid (v), bosom fourth glycosides (wybutoxosine), pseudouracil, pigtail glycosides, the thio cytosine of 2-, 5-methyl-2-thiouracil, 2- thiouracil, 4- sulphur urine Pyrimidine, methyl uracil, uracil -5- fluoroacetic acid methyl ester, uracil -5- fluoroacetic acid (v), 5-methyl-2-thiouracil, 3- (3- amino -3-N-2- carboxylic propyl group) uracil, (acp3) w and 2,6- diaminopurine.Or, antisensenucleic acidses can use will Nucleic acid is produced with biological mode to expression vector therein with antisense orientation sub-clone.

Antisense nucleic acid molecule is generally administered to experimenter or generates in the original location, so that they and coded protein (example As VEGFR-2) cell mRNA and/or genomic DNA hybridization or combination, thus suppress protein expression (for example pass through suppression System transcription and/or translation).Hybridization can be complementary by forming the common nucleotides stablizing duplex, or is for example being attached to In the case of the antisense nucleic acid molecule of DNA duplex, interacted by the specificity in double-stranded major groove.

In another embodiment, protein RNA be used for double-stranded RNA (dsRNA) (Fire et al., Nature 391：806-811.1998) or short interfering rna (siRNA) sequence (Yu et al., Proc Natl Acad Sci U S A.99：6047-52,2002) induction RNA interference (RNAi)." RNAi " is the homology dependency degraded of the complementary mRNA of dsRNA induction Process.In one embodiment, the nucleic acid molecules of the present invention are by the complementary base with " just " ribonucleic acid of the present invention Basigamy to hybridizing, thus forming double-stranded RNA.Provide corresponding at least about 20,25,50,100,250 or 500 nucleoside Acid or whole protein (such as VEGFR-2) coding strand or only part thereof of dsRNA antisense and sense nucleic acid molecule.Another In individual embodiment, the length of siRNA is 30 nucleotide or less, and more preferably 21 to 23 nucleotide have characteristic 2 to 3 nucleotide 3 ' outstanding ends, it is produced by the ribonuclease III cleavage from longer dsRNA.See, for example, Tuschl T.(Nat Biotechnol.20：446-48.2002).The preparation of RNAi compound and use are described in United States Patent (USP) Disclose in No. 2004/0023390, the disclosure of which is incorporated herein by reference in their entirety.

The Intracellular transcription of small RNA molecular can be by being cloned into usual coding small nuclear rna (snRNA) by siRNA template To realize in rna plymerase iii (Pol III) transcriptional units of U6 or people RNAse P RNA H1.Two methods can be used To express siRNA：In one embodiment, it is made up of justice and the antisense strand of siRNA double-strand single promoter transcription (Lee et al., Nat.Biotechnol.20,500-505.2002)；In another embodiment, siRNA is expressed as stem ring Hairpin RNA structure, it produces siRNA (Brummelkamp et al., Science 296 after processing in the cell：550- 553.2002) (being incorporated herein by).

DsRNA/siRNA applies most often through making justice anneal with antisense RNA chain before being delivered to organism in vitro. In the embodiment of a replacement, RNAi can by apply the justice of the present invention in the same solution and antisensenucleic acidses Lai Carry out and need not anneal before administration, and even can be included in different vehicles by applying within the extremely close time period In described nucleic acid apply and carry out.Also contemplate the fragment of coded protein (as such as VEGFR-2), congener, derivant and The nucleic acid molecules of analog or the antisensenucleic acidses with mVEGFR-2 nucleic acid array complementation.

Fit is for disturbing receptor and its cognate ligand (as such as VEGFR-2 and VEGF-A and PDGFR and PGDF) Interaction the method based on nucleic acid for the another kind.Fit is to have been based on it to combine the ability of other molecules from hangar The DNA selecting or RNA molecule.Select the suitable of bind nucleic acid, protein, small-sized organic compound and even whole organism Body.For differentiating and preparing that fit method and composition is well known by persons skilled in the art and to be described in the such as U.S. special Profit the 5th, 840,867 and U.S. Patent No. 5, in 582, No. 981, described patent is integrally incorporated herein each via quoting.

Latest developments in combination scientific domain have identified has high-affinity and specific to given target Short polymer sequence.For example, SELEX technology is used to the DNA differentiating to have with the binding property of mammalian antibody competition And RNA aptamer, field of immunology has produced the antibody or antibody fragment with separating and combining to countless compounds, and bites mattress body exhibition Show the new peptide sequence being used to find there is very favorable binding property.Based on the success of these molecular evolution techniques, Be sure of to produce the molecule being attached to any target molecule.Loopback configuration generally participates in providing required combination attribute, such as following The same in situation：Generally fit using the hairpin loop being produced by the short region not having complementary base pair, using annular hypervariable region The natural derivative antibody of combination configuration with using compared with biting mattress body display library result with linear peptides, improved results are shown Cyclic peptide newly bite mattress body display library.Therefore, there is ample evidence showing that, can have been produced by the molecular evolution technique of combination Life and identification high-affinity part.For the present invention, it is possible to use molecular evolution technique is joined to as herein described to separate Body has specific ligand binding molecules.Be intended to understand more with regard to fit information, referring generally to Gold, L., Singer, B., He, Y.Y., Brody.E., " Aptamers As Therapeutic And Diagnostic Agents, " J.Biotechnol.74：5-13(2000).U.S. Patent No. 6,699,843 can be seen for producing fit correlation technique In number, described patent is passed through to quote to be integrally incorporated.

In some embodiments, fit can produce in the following manner：Preparation nucleic acid library；Make described nucleic acid library Contact with somatomedin, wherein screen the nucleic acid to this somatomedin with more high binding affinity (with respect to other libraries core Acid) and expand to produce the mixture of nucleic acid, its enrichment has higher affinity and special to being attached to described somatomedin The nucleic acid of property.Described process can be repeated and make selected nucleic acid mutation and again screen, thus differentiate that somatomedin is fit.

In another modification, VEGF-A inhibitor product comprises the soluble E CD fragment of VEGFR-1, and it combines VEGF And suppress VEGF to be attached to VEGFR-2.In SEQ ID NO：10 and SEQ ID NO：CDNA and the ammonia of VEGFR-1 is listed in 11 Base acid sequence.The exemplary ECD fragment of VEGFR-1 is described in United States Patent (USP) and discloses No. 2006/0030000 and international monopoly public affairs Open in WO 2005/087808, the disclosure of described document is incorporated herein by reference in their entirety.

Antiinflammatory

In another embodiment, method described herein optionally includes applying one or more antiinflammatory to experimenter Agent.In some embodiments, antiinflammatory and ligand binding molecules are with single composition forms common use.In other embodiment party In case, antiinflammatory is as single compositionss and ligand binding molecules separate administration.It is expressly contemplated that include ligand binding dividing The combination of son, VEGF-A inhibitor product and antiinflammatory.As used herein, term " antiinflammatory " generally refer to reduce tested Inflammation in person or any reagent of swelling.Although listing many exemplary antiinflammatories herein, it should be understood that there may be Not expressly listed herein, but it is covered by the other suitable antiinflammatory in the present invention.

In a modification, antiinflammatory is nonsteroid anti-inflammatory drugses (NSAID).Exemplary NSAID includes but is not limited to：Ah A department woods, Sulfasalazine^TM、Asacol^TM、Dipendtum^TM、Pentasa^TM、Anaprox^TM、Anaprox DS^TM(Nabumetone Raw sodium)；Ansaid^TM(Flurbiprofen)；Arthrotec^TM(diclofenac sodium+misoprostol)；Cataflam^TM/ Voltaren^TM(diclofenac potassium)；Clinoril^TM(sulindac)；Daypro^TM(oxaprozin)；Disalcid^TM(salicyl salicylate (salsalate) Ester)；Dolobid^TM(diflunisal)；EC Naprosyn^TM(naproxen sodium)；Feldene^TM(Piroxicam)；Indocin^TM、 Indocin SR^TM(indomethacin)；Lodine^TM、Lodine XL^TM(Etodolac)；Motrin^TM(ibuprofen)； Naprelan^TM(naproxen)；Naprosyn^TM(naproxen)；Orudis^TM(ketoprofen)；Oruvail^TM(ketoprofen)； Relafen^TM(nabumetone)；Tolectin^TM(tolmetin sodium)；Trilisate^TM(Choline magnesium trisalicylate)；Cox-1 suppresses Agent；Cox-2 inhibitor such as Vioxx^TM(rofecoxib)；Arcoxia^tm(Etoricoxib), Celebrex^TM(Celecoxib)； Mobic^TM(Meloxicam)；Bextra^TM(valdecoxib), Dynastat^TMPara examines former times sodium；Prexige^TM(lumiracoxib) and Nabumetone (nambumetone).Other suitable NSAID are including but not limited to following：5-aminosalicylic acid (5-ASA, U.S. salad Piperazine, sharp salad piperazine), -acetamidohexanoic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine (amixetrine), anitrazafen (anitrazafen), antrafenine (antrafenine), bendazac (bendazac), benzyl Dalai's propylhomoserin (bendazac lysinate), benzydamine (benzydamine), beprozin, broperamole (broperamole), Bucolome (bucolome), bufezolac (bufezolac), ciproquazone (ciproquazone), cloximate (cloximate), dazidamine (dazidamine), deboxamet (deboxamet), Tommy fixed (detomidine), fragrant Pyrrole amine (difenpiramide), difenpyramide, Burmannia coelestis D. Don. Lamine (difisalamine), ditazole (ditazol), according to not Method ancestor (Emorfazone), fanetizole methanesulfonates (fanetizole mesylate), fenflumizole (fenflumizole), fluorine Kui ammonia phenyl ester (flctafenine), flumizole (flumizole), fluorine Buddhist nun's star (flunixin), Fluproquazone (fluproquazone), fopirtoline (fopirtoline), fosfosal (fosfosal), Guaimesal (guaimesal), guaiazolene, isonixirn, hydrochloric acid Li Feitaming (lefetamine HCl), leflunomide (leflunomide), lofemizole (lofemizole), lotifazole (lotifazole), lysine chlorine Buddhist nun star (lysin Clonixinate), meseclazone (meseclazone), nabumetone (nabumetone), nictindole (nictindole), Nimesulide (Nimesulide), orgotein (orgotein), orpanoxin (orpanoxin), Ao Shapulong (oxaceprolm), oxapadol (oxapadol), paranyline (paranyline), perisoxal (perisoxal), Fructus Citri Limoniae Sour perisoxal, pifoxime (pifoxime), naproxen piperazine acid (Piproxen), pirazolac (pirazolac), the non-Buddhist nun of pyrrole Ketone (pirfenidone), proquazone (proquazone), proxazole (proxazole), thielavin B, tiflamizole (tiflamizole), timegadine (timegadine), Tolectin (tolectin), tolpadol (tolpadol), bent Pu Ta meter (tryptamid) those and by such as following company's numbering named：480156S, AA861, AD1590, AFP802, AFP860、AI77B、AP504、AU8001、BPPC、BW540C、CHINOIN 127、CN100、EB382、EL508、F1044、FK- 506、GV3658、ITF182、KCNTEI6090、KME4、LA2851、MR714、MR897、MY309、ONO3144、PR823、 PV102、PV108、R830、RS2131、SCR152、SH440、SIR133、SPAS510、SQ27239、ST281、SY6001、 TA60, TAI-901 (4- benzoyl -1- indane formic acid), TVX2706, U60257, UR2301 and WY41770.

In another modification, antiinflammatory comprises to suppress the compound of the interaction of inflammatory cytokine and its receptor.Can The example of the cytokine inhibitor being applied in combination with the specific-binding agent with the present invention includes the antagonist of such as TGF- α (as antibody) (for example, Rui meter Kai De (Remicade)), and (such as anti-for the antagonist of the interleukin being related to inflammation Body).Such interleukin description in this article and preferably includes, but is not limited to IL-1, IL-2, IL-3, IL-4, IL-5, IL- 6th, IL-8, IL-9, IL-12, IL-13, IL-17 and IL-18.Referring to Feghali et al., Frontiers in Biosci., 2： 12-26(1997).

In another modification, antiinflammatory is corticosteroid.Exemplary corticosteroid includes but is not limited to：Oxalic acid Diflorasone (difloroasone diacetate), clobetasol propionate, halobetasol propionate, betamethasone, dipropionic acid times he Meter Song, budesonide (budesonide), cortisone (cortisone), dexamethasone, Fluocinonide (fluocinonide), halcinonide (halcinonide), dechlorination dexamethasone (desoximethasone), omcilon, third Sour fluticasone (fluticasone propionate), fluocinonide, flurandrenolide (flurandrenolide), furancarboxylic acid Mometasone (mometasone furoate), betamethasone (betamethosone), fluticasone propionate, fluocinonide, two The other beclomethasone of propanoic acid (aclometasome dipropionate), methylprednisolone, prednisolone, prednisone, omcilon, Nai De and hydrocortisone.

In another modification, antiinflammatory is cyclosporin.

Antibiotic

In another embodiment, method described herein optionally further includes to experimenter's administration of antibiotics. In some embodiments, antibiotic and ligand binding molecules are with single composition forms common use.In other embodiments In, antibiotic is as single compositionss and ligand binding molecules separate administration.Exemplary antibiotic includes but is not limited to：Four Ring element, ammonia very glucosides, penicillin, cephalosporin, sulfonamide, Protophenicol (Proto)., erythromycin, vancomycin, woods can be mould Element, clindamycin, nystatin, Amphotericin B, amantadine, idoxuridine, para-aminosalicylic acid, isoniazid (isoniazid), Rifampicin (rifampin), actinomycin D, mithramycin, daunorubicin, amycin, bleomycin, vinblastine, vincristine, Procarbazine and Imidazole carboxamide.

Tyrosine kinase inhibitor

In another embodiment, method described herein optionally further include apply suppression VEGFR-2 and/or The tyrosine kinase inhibitor of VEGFR-3 activity.

Include but is not limited to for the exemplary tyrosine kinase inhibitor in method described herein：AEE788 (TKI, VEGFR-2, EGFR：Novartis)；ZD6474 (TKI, VEGFR-1, -2, -3, EGFR：ZD6474：AstraZeneca)； AZD2171 (TKI, VEGFR-1, -2：AstraZeneca)；SU 11248 (TKI, VEGFR-1, -2, PDGFR：Sutent： Pfizer)；AG13925 (TKI, VEGFR-1, -2：Pfizer)；AG013736 (TKI, VEGFR-1, -2：Pfizer)；CEP- 7055 (TKI, VEGFR-1, -2, -3：Cephalon)；CP-547,632 (TKI, VEGFR-1, -2：Pfizer)；GW7S6024 (TKL VEGFR-1, -2, -3：GlaxoSmithKline)；GW786034 (TKI, VEGFR-1, -2, -3： GlaxoSmithKline)；Sorafenib (TKI, Bay 43-9006, VEGFR-1, -2, PDGFR：Bayer/Onyx)；SU4312 (TKI, VEGFR-2, PDGFR：Pfizer)；AMG706 (TKI, VEGFR-1, -2, -3：Amgen)；XL647 (TKI, EGFR, HER2, VEGFR, ErbB4：Exelixis)；XL999 (TKl, FGFR, VEGFR, PDGFR, Fll-3：Exelixis)；PKC412 (TKI, KIT, PDGFR, PKC, FLT3, VEGFR-2：Novartis)；AEE788 (TKI, EGFR, VEGFR2, VEGFR-1： Novartis)；OSI-030 (TKI, c-kil, VEGFR：OSI Pharmaceuticals)；OS1-817 (TKI c-kit, VEGFR：OSI Pharmaceuticals)；DMPQ (TKI, ERGF, PDGFR, ErbB2.p56.pkA, pkC)；MLN518 (TKI, Flt3, PDGFR, c-KIT (T53518：Millennium Pharmaceuticals)；Lestaurinib (TKI, FLT3, CEP- 701, Cephalon)；ZD 1839 (TKI, EGFR：Gefitinib, IRESSA：AstraZcneca)；OSI-774 (TKI, EGFR： Erlotinib：Tarceva：OSI Pharmaceuticals)；Lapatinib (TKI, ErbB-2, EGFR, and GD-2016：Tyke Rich：GlaxoSmithKline).

In some embodiments, method described herein further includes to apply the cheese of suppression angiogenesis to experimenter Histidine kinase inhibitor.Exemplary angiogenesis inhibitor tyrosine kinase inhibitor and its target are provided in table 2 below.

In embodiment, the ligand binding molecules of the present invention and PDGF inhibitor product and VEGF-A inhibitor product mix Apply.For example, ligand binding molecules (such as comprise SEQ ID NO：The ligand binding molecules of 3 aminoacid sequence) can be with (i) VEGF Trap(ii) PDGFR antibody (such as by Regeneron Inc. develop for eye indication Antibody) or the fit (E10030 for eye indication such as being developed by Ophthotech Inc. of PDGF (Fovista^TM)) be administered in combination.

The administration of combined therapy

The combined therapy being combined with one or more other activating agents as herein described can be joined by applying to contain to experimenter The single compositionss of body binding molecule and one or more other activating agents described or pharmaceutical preparation, or by applying to experimenter simultaneously Realized with two kinds of (or more kinds of) different components or preparation, one of which compositionss comprise ligand binding molecules, and another kind of Compositionss comprise another kind of activating agent.

Or, adopt ligand binding molecules described herein combined therapy can with the range of several minutes to several weeks it Interval is prior to or subsequent to second pharmaceutical treatment.Second medicament and ligand binding molecules are the embodiments of separate administration wherein In, typically will ensure that effective period of time will not expire so that described medicament and ligand binding molecules will between each delivery Favourable combined effect can be played.In such cases it is contemplated that two kinds of forms will be applied, each other in about 12-24 hour, more Preferably each other in about 6-12 hour, most preferably, time delay only about 12 hours.However, in some cases, may Need the time period of notable extended treatment, wherein experience several days between corresponding administration (2,3,4,5,6 or 7 days) extremely several weeks (1,2,3,4,5,6,7 or 8 weeks).It is expressly contemplated that the repetitive therapy using one or two reagent.

Preparation and pharmaceutically acceptable supporting agent

Present invention also offers comprising the pharmaceutical composition of the ligand binding molecules of the present invention.Such composition comprises to treat One or more ligand binding molecules of effective dose and pharmaceutically acceptable carrier.In one embodiment, such combination Thing comprises one or more ligand binding molecules and optional one or more other activating agent (in the case of combined therapy). In one embodiment, such composition comprises one or more ligand binding molecules and optional one or more other is lived Property agent, described activating agent be selected from PDGF inhibitor product and VEGF-A inhibitor product.In another embodiment, apply bag Compositionss of one or more ligand binding molecules containing the present invention and comprise PDGF inhibitor product or VEGF-A inhibitor and produce Another kind of compositionss of product.

Term " pharmaceutically acceptable " means the regulator's approval by federal or state government, or in American Pharmacopeia (U.S.Pharmacopeia) or other generally acknowledge list in pharmacopeia for animal and specifically for people's.Term " carries Agent " refers to diluent, adjuvant, excipient or the vehicle using it to apply therapeutic agent.Such pharmaceutical carriers can be aseptic Liquid, such as water and oil, including those oil of oil, animal, plant or synthesis source, such as Oleum Arachidis hypogaeae semen, soybean oil, mineral Oil, Oleum sesami etc..Suitable drug excipient includes starch, glucose, Lactose, sucrose, gelatin, Fructus Hordei Germinatus, rice, flour, white Chalk, silica gel, sodium stearate, glyceryl monostearate, Talcum, sodium chloride, skimmed milk powder, glycerol, propylene, ethylene glycol, water, ethanol Deng.If necessary, compositionss can also contain a small amount of wetting agent or emulsifying agent or pH buffer.

The form that described compositionss can be taken has solution, suspension, emulsion, tablet, pill, capsule, powder, granule Agent, gel (inclusion hydrogel), paste, ointment, cream, delivery apparatus, extended release preparation, suppository, injection, implant, Spray, drop, aerosol etc..Comprising ligand binding molecules, one or more extra activating agent or combination thing can (see, for example, Remington to be prepared according to conventional pharmaceutical practice：The Science and Practice of Pharmacy (the 20th edition), edits A.R.Gennaro, 2000, Lippincott Williams＆Wilkins, Philadelphia, Pa. such as Encyclopedia of Pharmaceutical Technology, editor J.Swarbrick and J.C.Boylan, 1988-2002, Marcel Dekker, New York).E.W.Martin exists " Remington ' s The example of suitable pharmaceutical carrier is described in Pharmaceutical Sciences ".

The administration of compositionss can be carried out by any suitable means, and these modes produce effectively treatment or prevention is specific The ligand binding molecules of disease or disease and/or the amount of other activating agent.Each ligand binding molecules for example can with suitable Carrier mass mixes, and is generally existed with the amount accounting for 1-95 weight % of composition total weight.Compositionss can be suitable for eye With, oral, parenteral (for example, intravenouss, intramuscular, subcutaneous), rectum, percutaneous, per nasal or suck the dosage form applied and to provide.? In one embodiment, described compositionss are the form being applied to direct injection to eyes.

The ligand binding molecules of the present invention, and if present in combined therapy, one or more other activating agent is permissible It is configured to neutrality or salt form.Pharmaceutically acceptable salt includes those salt with the hydrogen-based formation that dissociates, such as derived from salt The salt of acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid etc.；And with free carboxy formed those salt, for example derived from sodium, potassium, ammonium, The salt of calcium, hydrated ferric oxide., 2-aminopropane., triethylamine, 2- ethylaminoethanol, histidine, procaine (procaine) etc..

The ligand binding molecules of the present invention and other activating agent can have the enough functional groups of alkalescence, and it can be with many Any one reaction in mineral acid and organic acid forms pharmaceutically acceptable salt.As known in the art, pharmaceutically Acceptable acid-addition salts are to be formed by pharmaceutically acceptable acid.It is pharmaceutically acceptable that such salt includes enumerating in following Salt：Journal of Pharmaceutical Science, 66,2-19 (1977) and The Handbook of Pharmaceutical Salts；Properties, Selection, and Use.P.H.Stahl and C.G.Wermuth (compiles Volume), Verlag, Zurich (Switzerland) 2002, these document heres are passed through to quote to be integrally incorporated.

Pharmaceutically acceptable salt includes sulfate, citrate, acetate, oxalates, chloride, bromide, iodate Thing, nitrate, disulfate, phosphate, acid phosphate, isonicotinic acid salt, lactate, salicylate, acid citrate, wine Stone hydrochlorate, oleate, tannate, pantothenate, biatrate, Ascorbate, succinate, maleate, gentisate, Fumarate, gluconate, glucuronate, saccharate, formates, benzoate, glutamate, Glu, mesylate, ethyl sulfonic acid Salt, benzene sulfonate, tosilate, camsilate, embonate, phenylacetate, trifluoroacetate, acrylates, Chloro benzoate, dinitro-benzoate, hydroxy benzoate, methoxybenzoic acid salt, ar-Toluic acid salt, adjacent acetoxyl group Benzoate, naphthalene -2- benzoate, isobutyrate, benzenebutanoic acid salt, alpha-hydroxybutyric acid salt, butine-Isosorbide-5-Nitrae-dicarboxylate, hexin - Isosorbide-5-Nitrae-dicarboxylate, caprate, caprylate, cinnamate, glycollate, enanthate, hippurate, malate, hydroxyl horse Come hydrochlorate, malonate, mandelate, mesylate, nicotinate, phthalate, terephthalate, propiolate, Propionate, phenpropionate, sebacate, suberate, brosylate, closilate, ethyl sulfonate, 2- ethoxy Sulfonate, metilsulfate, naphthalene -1- sulfonate, naphthalene-2-sulfonic acid salt, naphthalene -1,5- sulfonate, xylenesulfonate and tartaric acid Salt.

Term " pharmaceutically acceptable salt " also refer to the ligand binding molecules with acidic functionality such as carboxylic acid functional and Other activating agents and the salt of alkali.Suitable alkali includes but is not limited to：The hydroxide of alkali metal such as sodium, potassium and lithium；Alkaline-earth metal Hydroxide as calcium and magnesium；The hydroxide of other metals such as aluminum and zinc；Ammonia and organic amine, such as unsubstituted or by hydroxyl Single-, two- or trialkylamine, the dicyclohexylamine replacing；Tri-butylamine；Pyridine；N- methyl, N- ethylamine；Diethylamine；Three second Amine；Single-, double-or three-(2-OH- low-grade alkylamine), such as singly-, double-or three-(2- ethoxy) amine, 2- hydroxy-tert-butylamine or Trihydroxymethylaminomethane, N ' N- bis--low alkyl group-N (hydroxy lower alkyl)-amine, such as N, N- dimethyl-N-(2- hydroxyl second Base) amine or three-(2- ethoxy) amine；N- methyl-D-glucosamine；And aminoacid such as arginine, lysine etc..Term " pharmacy Upper acceptable salt " also includes the hydrate of the compounds of this invention.

At a useful aspect, described compositionss are parenteral administrations (for example, by intramuscular, intraperitoneal, vein In interior, ophthalmic, glass body, after eyeball, under conjunctiva, in eyestrings membrane vesicle or subcutaneous injection or implantation) or systemic administration.For the intestines and stomach Outer or systemic administration preparation includes sterile aqueous or non-aqueous solution, suspension or emulsion.Various aqueous carriers can be used, For example, water, buffered water, saline and analog.The example of other suitable vehicles includes polypropylene glycol, Polyethylene Glycol, plant Oil, gelatin, hydrogel, hydrogenated naphthalene and injectable organic ester such as ethyl oleate.Such preparation can also contain auxiliary substance, such as Preservative, wetting agent, buffer agent, emulsifying agent and/or dispersant.Biocompatible biodegradable lactide polymer, third Lactide/glycolide copolymer or Pluronic F68 can be used for controlling the release of active component.

Or, described compositionss can be applied by being administered orally.Being intended to compositions for oral can be according to this area Known any method for manufacturing pharmaceutical composition to be prepared with solid or liquid form.

Include capsule, tablet, pill, powder and granule for Orally administered solid dosage formss.Generally, these medicines Preparation comprises the active component mixing with nontoxic pharmaceutically acceptable excipient.These include such as inert diluent, all As Calcium Carbonate, sodium carbonate, Lactose, sucrose, glucose, Mannitol, cellulose, starch, calcium phosphate, sodium phosphate, Kaolin etc..Also Can be using binding agent, buffer agent and/or lubricant (for example, magnesium stearate).In addition tablet and pill can be prepared into and have Enteric coating.It is more suitable to provide that described compositionss can optionally comprise sweeting agent, flavoring agent, coloring agent, aromatic and preservative The preparation of mouth.

Solid dosage formss can be used for treating eye disorders.Can be used for ophthalmically acceptable compositionss to include comprising one or more part The tablet of the mixture of binding molecule and pharmaceutically acceptable excipient.These excipient can be for example inert diluent or Filler (for example, sucrose and Sorbitol), lubricant, fluidizer and antitack agent (for example, magnesium stearate, zinc stearate, Hard Fat Acid, Silicon stone, hydrogenated vegetable oil or Talcum).

The compositionss of the present invention can be by intravitreal injection in eyes and by under conjunctiva and in eyestrings membrane vesicle Injection carries out ophthalmic administration.Other route of administration include after sclera, eyeball, intraperitoneal, intramuscular and intravenouss.Or, permissible Apply compositionss using drug delivery device or intraocular implant.

Pharmaceutically acceptable emulsion, solution, suspension, syrup can be included for Orally administered liquid dosage form Agent and Perle.These forms can comprise inert diluent commonly used in the art, such as water or oil medium, and also Adjuvant, such as wetting agent, emulsifying agent and suspending agent can be included.

In some cases, described compositionss can be with local application, for example, by patch or by being directly applied to easily Suffer from neovascular disease or the region such as epidermis or eyes that are affected by, or pass through ionotherapy.

In the case of the combined therapy of the present invention, ligand binding molecules and one or more other activating agent can mix In tablet or other vehicle, or can be allocated.In one embodiment, ligand binding molecules are comprised in the interior of tablet Portion, and a kind of other activating agent is externally-located, so that the major part of described other activating agent is in contained ligand binding molecules Discharge before release.

In one embodiment, comprise the combination of ligand binding molecules (and optional one or more other activating agent) Thing can comprise one or more pharmaceutically acceptable excipient.In one embodiment, such excipient include but not It is limited to buffer agent, nonionic surfactant, preservative, penetrating agent, hydrogen-based acid, saccharide and pH adjusting agent.Suitable buffer agent Including but not limited to sodium dihydrogen phosphate, disodium hydrogen phosphate and sodium acetate.Suitable nonionic surfactant includes but is not limited to Polyoxyethylene sorbitan fatty acid ester such as polysorbate20 and polysorbate80.Suitable preservative includes but does not limit In benzylalcohol.Suitable penetrating agent includes but is not limited to sodium chloride, Mannitol and Sorbitol.Suitable saccharide includes but is not limited to α, α-trehalose dehydrate.Suitable aminoacid includes but is not limited to glycine and histidine.Suitable pH adjusting agent include but not It is limited to hydrochloric acid, acetic acid and sodium hydroxide.In one embodiment, one or more pH adjusting agent is effectively to provide about 3 Amount to about 8, about 4 to about 7, about 5 to about 6, about 6 to about 7 or the pH of about 7 to about 7.5 exists.In one embodiment, wrap Compositionss containing ligand binding molecules do not comprise preservative.In another embodiment, comprise the combination of ligand binding molecules Thing does not comprise anti-bacterial agent.In another embodiment, the compositionss comprising ligand binding molecules do not comprise to press down mattress agent.

In one embodiment, comprise the combination of ligand binding molecules (and optional one or more other activating agent) Thing is the aqueous solution form being suitable to inject.In one embodiment, compositionss comprise ligand binding molecules, buffer agent, pH tune Section agent and water for injection.In another embodiment, compositionss comprise ligand binding molecules, sodium dihydrogen phosphate, phosphoric acid hydrogen two Sodium, sodium chloride, hydrochloric acid and sodium hydroxide.In another embodiment, compositionss comprise ligand binding molecules, phosphate (example As sodium dihydrogen phosphate), trehalose, sodium chloride and polysorbate.

The waterborne compositions that can be used for putting into practice the inventive method in ocular environment have compatible pH on ophthalmology and ooze Thoroughly spend.One or more ophthalmology's above acceptable pH adjusting agent and/or buffer agent can be included in the present compositions, Including acid such as acetic acid, boric acid, citric acid, lactic acid, phosphoric acid and hydrochloric acid；Alkali for example sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, Sodium acetate and sodium lactate；With buffer such as citrate/dextrose, sodium bicarbonate and ammonium chloride.Such acid, alkali and buffer It is to be included so that the pH of compositionss is maintained required amount in the upper acceptable scope of ophthalmology.Permissible in the composition Including one or more ophthalmology's above acceptable salt, their amount be enough to make the permeability of compositionss be on ophthalmology and can connect In the range of being subject to.Such salt includes those and has sodium, potassium or ammonium cation and chloride ion, citrate, Vitamin C acid group, boric acid Root, phosphate radical, bicarbonate radical, the salt of sulfate radical, thiosulfate anion or bisulfite anion.

In some embodiments, the compositionss comprising the ligand binding molecules of the present invention are formulated for being delivered to be subject to The eyes of examination person.Suitably ophthalmically acceptable carrier is that well known by persons skilled in the art and all such routine carriers may be used to this In invention.It is impregnated in the exemplary compounds to facilitate and speed up topical composition dermal delivery to ocular tissue or appendages tissue Including but not limited to：Alcohol (ethanol, propanol and nonyl alcohol), fatty alcohol (lauryl alcohol), fatty acid (valeric acid, caproic acid and capric acid), fat Acid esters (isopropyl myristate and n-caproic acid isopropyl ester), Arrcostab (ethyl acetate and butyl acetate), polyhydric alcohol (propylene glycol, Propanedione and hexanetriol), sulfoxide (dimethyl sulfoxide and decyl methyl sulfoxide), amide (carbamide, dimethyl acetylamide and ketopyrrolidine Derivant), surfactant (sodium lauryl sulfate, cetyl trimethylammonium bromide, poloxamer (polaxamers), Spans, tweens, bile saltss and lecithin), terpenes ((R)-4-isopropenyl-1-methyl-1-cyclohexene, α-terpinol, 1,8- eucalyptole and menthone) and alkanone (normal heptane and n -nonane).Additionally, the compositionss of local application comprise surface adhesion molecule regulator, including but not limited to calcium glues Protein antagonist, selection protein antagonist and integrin antagonists.Therefore, specific carrier can take aseptic ophthalmically acceptable soft Cream, cream, gel, solution or dispersion.Also include release polymer such as " Ocusert " polymer, " Hydron " to gather Compound etc. is as suitably ophthalmically acceptable carrier.

Exemplary ophthalmically acceptable viscosity intensifier can include used in this preparation：Sodium carboxymethyl cellulose；Methyl cellulose Element；Hydroxypropyl cellulose；Hydroxypropyl methyl cellulose；Hydroxyethyl cellulose；Liquid Macrogol；PEG400；Polyethylene Alcohol；And polyvidone.

Some natural prodcuts, such as aluminium-magnesium silicate (veegum), alginate, xanthan gum, gelatin, arabic gum and Radix astragali Glue is it is also possible to be used for increasing the viscosity of ophthalmic solution.

Tonicity is important, because hypotonic eye drop leads to the edema of cornea, and hypertonic eye drop leads to the change of cornea Shape.Preferably tonicity is about 300mOsM.Described tonicity can be described in by well known by persons skilled in the art Remington：Method in The Science and Practice of Pharmacy is realizing.

Can also use stabilizer, all such as (e.g.) chelating agen, such as EDTA.Antioxidant can also be used, for example, sub- Sodium bisulfate, sodium thiosulfite, 8-hydroxyquinoline or ascorbic acid.The aseptic of aqueous formulation is generally by by conventional ophthalmically acceptable Preservative (for example, methaform, benzalkonium chloride, cetylpyridinium chloride, phenyl mercuric salt, thimerosal etc.) is maintaining, and institute The usage amount stating preservative is nontoxic and changes generally between about 0.001 weight % to about 0.1 weight % of aqueous solution. Conventional preservatives for ointment include methyl parahydroxybenzoate and propyl p-hydroxybenzoate.Typical ointment base includes White petrolatum and mineral oil or liquid petrolatum.However, preserved aqueous carrier is preferred.Solution can with suitable dosage form for example Eye drop is delivered in eyes manually, or the suitable microdroplet by the medicine of the commonly provided dosing or sprayer unit are passed Send.The example of suitably ophthalmically acceptable carrier includes generally isotonic aseptic aqueous solution, and it contains and (that is, is less than by weight on a small quantity About 5%) hydroxypropyl methyl cellulose, polyvinyl alcohol, carboxymethyl cellulose, hydroxyethyl cellulose, glycerol and EDTA.Described molten Liquid be preferably kept at generally under neutral pH and with appropriate conventional buffers such as phosphate, borate, acetate, tris Isotonic.

In some embodiments, penetration enhancers are added in ophthalmically acceptable supporting agent.

Will the amount of effective ligand binding molecules can pass through to mark according to this specification for its expected therapeutic use Quasi- clinical technology is determining.Furthermore it is possible to assist in optimal dose scope optionally with analyzed in vitro.With carrier materials Mixing can be according to the mammal treated and specific application pattern to produce the amount of the ligand binding molecules of single dose Change.

The dosage of ligand binding molecules can depend on several factors, severity including condition of illness (no matter this condition of illness be by It is treated or prevent) and the age of individual to be treated, body weight and health status.In addition, the medicine with regard to particular patient Thing genomics (impacts of pharmacokineticss, pharmacodynamicss or effect overview to therapeutic agent for the genotype) information may affect to make Use dosage.Additionally, definite individual dose slightly can adjust according to many factors, described factor includes applied specific group Close treatment, time of application, route of administration, preparation nature, discharge rate, (that for example, is treated is concrete for the disease specific treated Eye disorders), the anatomical position of the severity of disease and neovascular disease.It is expected that some changes of dosage.

Generally, when by Orally administered to mammal when, the dosage of the ligand binding molecules of the present invention is usually 0.001mg/kg/ days to 100mg/kg/ days, 0.01mg/kg/ days to 50mg/kg/ days or 0.1mg/kg/ days to 10mg/kg/ days. Generally, when by Orally administered giving people, the dosage of the antagonist of the present invention is usually 0.001mg/ days to 300mg/ days, 1mg/ It was to 200mg/ days or 5mg/ days to 50mg/ days.The dosage of up to 200mg/ days is possibly necessary.

For apply the antagonist of the present invention by parenteral injection, dosage is usually 0.1mg/ days to 250mg/ My god, 1mg/ days to 20mg/ days or 3mg/ days to 5mg/ days.Can inject daily four times.

Generally, when oral or parenteral administration, the dosage for the ligand binding molecules of the present invention is usually 0.1mg/ It was to 1500mg/ days or 0.5mg/ days to 10mg/ days or 0.5mg/ days to 5mg/ days.Up to 3000mg/ days can be applied Dosage.

When being given people with ophthalmically acceptable mode (for example passing through in glass body) administration, the ligand binding molecules that every eye is applied every time Dosage generally in 0.003mg, 0.03mg, 0.03mg, 0.1mg or 0.5mg to 5.0mg, 4mg, 3mg, 2mg or 1mg, or In the range of 0.5mg to 1.0mg.The dosage of ligand binding molecules is generally in following scope：Every eye applies 0.003mg every time Apply 0.03mg to 4.0mg every time to 5.0mg or every eye or every eye applies 0.1mg to 4.0mg every time or every eye is every Secondary administration 0.03mg to 3.0mg or every eye applies 0.1mg to 3.0mg every time or every eye applies 0.1mg extremely every time 1.0mg or every eye apply 0.5mg to 4.0mg every time or every eye applies 0.5mg to 3.0mg every time, every eye is applied every time Apply 1.0mg to 4.0mg every time with 0.5mg to 2.0mg or every eye or every eye applies 1.0mg to 3.0mg or every every time Eye applies 1.0mg to 2.0mg every time.In some embodiments, about 1mg or about 2mg or about is applied every time with every eye The concentration of 3mg or about 4mg or about 5mg or about 6mg applies ligand binding molecules.In some embodiments, ligand binding is divided Son be any concentration enumerated above be present in 10 μ l, 15 μ l, 20 μ l, 25 μ l, 30 μ l, 35 μ l, 40 μ l, 45 μ l, 50 μ l, 60 In μ l, 70 μ l, 80 μ l, the volume of 90 μ l, 95 μ l or 100 μ l.In some embodiments, ligand binding molecules are with about 2- The concentration of 4mg/50 μ l is applying.The every eye that may range from of dose volume applies 0.01mL to 0.2mL or every eye administration 0.03mL to 0.15mL or every eye apply 0.05mL to 0.10mL.

In some embodiments, when being applied by intravitreal injection, ligand binding molecules are with every eye about 2mg To about 4mg's (or every eye about 1mg to about 3mg or about 1mg to about 4mg or about 3mg to about 4mg or about 1mg to about 2mg) Concentration is applied.In some embodiments, with every eye about 1mg or about 2mg or about 3mg or about 4mg or about 5mg or about The concentration of 6mg applies ligand binding molecules.In some embodiments, ligand binding molecules are any concentration enumerated above Be present in 10 μ l, 15 μ l, 20 μ l, 25 μ l, 30 μ l, 35 μ l, 40 μ l, 45 μ l, 50 μ l, 60 μ l, 70 μ l, 80 μ l, 90 μ l, 95 μ l or In the volume of 100 μ l.In some embodiments, ligand binding molecules are to be applied with the concentration of about 2-4mg/50 μ l.

Generally it is adaptable to intravenouss applied dose scope is typically about 50-5000 micrograms of active compound/every kilogram of body Weight.The dosage range being applied to intranasal administration is typically about 0.01pg/kg body weight to 1mg/kg body weight.Can by from external or The dose-effect curve extrapolation effective dose of animal model test system.

For systemic administration, initially can estimate treatment effective dose from analyzed in vitro.For example, it is possible to be formulated in dynamic The dosage of the circulation composition scope including the IC50 measuring such as in cell culture is reached in thing model.This information can be used In more accurately measuring useful dosage in people.Can also be using technology well known in the art from intra-body data such as animal mould Predose estimated by type.Those of ordinary skill in the art can easily optimize the administration to people based on animal data.

To there is provided the compound plasma levels enough to maintaining treatment effect individually to adjust dosage and time interval.In office In the case of portion's administration or selectivity picked-up, effective local concentration of compound can be unrelated with plasma concentration.Art technology Personnel are possible in the case of without excessively experiment optimize therapeutically effective local dose.

The amount of application of compound certainly will depend upon treated experimenter, the body weight of experimenter, painful severity, applies Judgement with mode and prescribing doctor.Treatment can be intermittent heavy when symptom can detect or even when they are undetectable Multiple.Described treatment can be provided separately or combine offer with other medicines.

The administration of ligand binding molecules and other reagent (when being present in combined therapy) can independently be daily one To four times or monthly one to four time or annual one to six time or every two years, 3 years, 4 years or twice-a-decade.The persistent period applied Can be one day or one month, two months, three months, six months, 1 year, 2 years, 3 years, and be possibly even the one of patient Raw.In one embodiment, monthly carry out applied once, continue three months.Chronic long will be needed to apply in many cases With.Described dosage can be applied as single dose or be divided into multiple dose.In general, required dosage should be with the time of setting Interval is long-time to apply, and typically at least reaches several weeks or several months, it is also possible to when needing the longer administration of several months or several years or more long Between.

Except treating the disease having existed, can be prevented with preventative applying said compositions or slow down these diseases Outbreak.In prophylactic use, compositionss can be administered to and be susceptible to suffer from particular condition such as eye disorders or be in addition in its risk Under patient.

Route of administration

Compositionss containing ligand binding molecules as herein described can be administered to patient in several ways, and this part takes Certainly in the medical history of the type of reagent to be administered and patient, risk factor and symptom.It is applied to the administration way of the inventive method Footpath includes systemic administration and local application.As used herein, term " systemic administration " means to lead to pharmaceutical composition to deliver Method of application to the substantially all body of patient.The exemplary approach of systemic administration include but is not limited to intravenous injection and Orally administered.As used herein, term " local application " means to lead to significantly more pharmaceutical composition to be delivered to eye Eyeball (or tumor or other target tissue) and about, rather than the administration in the region away from eyes (or tumor or other target tissue) Mode.

Can be used for the whole body in the inventive method and topical routes of administration includes but is not limited to：Gavage；Intravenous injection；Abdominal cavity Injection；Intramuscular injection；Subcutaneous injection；Transdermal diffusion and electrophoresis；External eye drop and ointment；Near the eyes and intraocular injection, including knot Inject under film；Extend release delivery device, including the prolongation release device of implant region；And ophthalmic and implant near the eyes, bag Include can biological corrosion and the implant based on bank.

Therefore, in one aspect, new with retina by implementing treatment to experimenter's local application ligand binding molecules The method that angiogenic forms relevant eye disorders.For example, in some embodiments, comprise the medicine group of ligand binding molecules Compound is applied topically, or is applied by local injection (for example, being injected by ophthalmic (for example in glass body)), or from ophthalmic Near the eyes implant as can biological corrosion or based on bank implant release.Described compositionss are preferably tested with effective suppression VEGF-C and/or VEGF-D in person's eyes is attached to or stimulates the VEGFR- of expression in the cell of eyes or the blood vessel of eyes 2 and/or VEGFR-3 amount is applying.

In the case of combined therapy, the administration of ligand binding molecules and other reagent can be continuous in time or Simultaneously.When continuous administration, the administration of each can be by identical or different approach.In one embodiment, Other reagent (for example, VEGF-A or PDGF inhibitor product) be apply ligand binding molecules after 90 days, 30 days, 10 days, 5 My god, 24 hours, 1 hour, 30 minutes, 10 minutes, apply in 5 minutes or in one minute.When other reagent are in ligand binding molecules When applying, ligand binding molecules are within a certain period of time with a certain amount of administration before, so that other reagent and ligand binding are divided Son total amount can effectively treatment or prevention target indication, such as eye disorders.When ligand binding molecules are before other reagent During administration, other reagent are within a certain period of time with a certain amount of administration, so that the total amount of other reagent and ligand binding molecules Can effectively treatment or prevention target indication, such as eye disorders.

Pharmaceutical composition according to the present invention can be formulated and generally discharge immediately after application or adopt controlled-release is released Put preparation any predetermined amount of time after application and discharge ligand binding molecules and optional other reagent in combined therapy.Example As pharmaceutical composition can be provided with sustained release form.Using immediately or sustained-release composition depends on being treated The property of condition of illness.If condition of illness is made up of acute disease, treatment can be carried out using releasing pattern immediately and be more than long-term release Compositionss.For some preventative or long-term treatment, sustained-release composition can also be suitable.

It is useful for applying ligand binding molecules or ligand binding molecules and one or more other medicaments with control release preparation , ligand binding molecules wherein alone or in combination have (i) narrow therapeutic index and (for example, produce harmful side effect or toxicity is anti- Difference very little between the plasma concentration answered and the plasma concentration producing therapeutic effect；Generally, therapeutic index TI is defined as half cause Dead dosage (LD50) and the ratio of median effective dose (ED50)))；(ii) narrow absorbing window in the gastrointestinal tract；Or (iii) short life The thing half-life, therefore in one day, need frequent medication, so that plasma concentration is maintained treatment level.

Many strategies can be executed and exceed its degraded or metabolism to obtain control release, the rate of release of wherein active component Speed.For example, it is possible to by properly selecting preparation parameter and composition, including for example suitable control release compositionss and bag Clothing, obtains control release.Example include single unit or many unitary tablet or capsule composition, oil solution, suspension, emulsion, Microcapsule, microsphere, nano-particle, patch and liposome.It is ability for preparing such lasting or control release preparation method Known in domain.

Ligand binding molecules and other reagent (if present) can also be delivered using drug delivery device such as implant. As used herein, term " implant " refers to after the implantation not from any material of the notable migration of insertion site.Implant Can be biodegradable, not biodegradable or be made up of biodegradable and non-biodegradable material.No Biodegradable implant can include the bank that can refill when necessary.Can be used for the implant bag in the inventive method Include such as patch, granule, thin slice, speckle, microcapsule etc., and can have any shape compatible with the insertion site selected And size, described insertion site can be (but are not limited to) back room, anterior chamber, on choroid or under conjunctiva.It should be understood that can Implant for the present invention generally discharges the eyes of the pharmaceutical composition of implantation to patient for a long time with effective dose.

It is well known in the art for being applied to the various ocular implants of eye release and alleviating prolongation delivery formulations, such as example U.S. Patent No. 5,869, No. 079 and 5, described in 443, No. 505, described disclosure is passed through to quote to be integrally incorporated Herein.Ocular drug delivery device can be inserted into the within the chamber of eyes, such as anterior chamber or back room, or can be implanted to Gong In film or on sclera, venation intermembrane space or the avascular area domain outside vitreous body.In one embodiment, implant can be determined Position on the domain of avascular area, on such as sclera, to allow ligand binding molecules and any other reagent to diffuse to institute through sclera Need therapentic part, the such as macula lutea of ophthalmic space and eyes.Additionally, the position through sclera diffusion can be formed close to new vesselses Position, such as close to the position of macula lutea.Suitable drug delivery device is described in such as U.S. Publication the 2008/0286334th Number；No. 2008/0145406；No. 2007/0184089；No. 2006/0233860；No. 2005/0244500；2005/0244471 Number；With No. 2005/0244462, and U.S. Patent No. 6,808,719 and 5,322, No. 691, the content of each document is passed through Quote and be integrally incorporated herein.

In other embodiments, via liposome, ligand binding molecules as herein described are applied to eyes.Another In individual embodiment, ligand binding molecules are included in continuous release device or selectivity release device, such as film, such as but not It is limited in Ocusert^TMThose adopting in System (Alza Corp., Palo Alto, Calif.).As another enforcement Scheme, ligand binding molecules are included in the contact lenss being positioned on eyes, are carried or be attached with it by it.Real at another Apply in scheme, ligand binding molecules are included in the swab being applied in eye surface or sponge.Another of the present invention is real The scheme of applying is related to the ligand binding molecules being included in the liquid spray being applied in eye surface.

In one embodiment, described implant comprises the part knot being dispersed in biodegradable polymer substrate Close molecule and optional other reagent (if present).Described substrate can comprise PLGA (PLGA), Ester end-sealed type polymer, acid blocked type polymer or its mixture.In another embodiment, described implant comprises part Binding molecule and optional other reagent (if present), surfactant and lipophilic compound.Lipophilic compound is permissible Existed with the amount of about 80-99 weight % of implant.Suitable lipophilic compound includes but is not limited to：Palmitostearate acid is sweet Grease, diglycol stearate, propylene glycol monostearate, glyceryl monostearate, Masine 35-1, single Oleic acid are sweet Grease, monopalmitin, glyceryl monolaurate, GLYCERYL DILAURATE, single myristin, two myristic acids Glyceride, monopalmitin, glycerol-1,3-dipalmitate, glyceryl monostearate, distearin, single oleic Ester, glyceryl dioleate, Masine 35-1, dilinoleic acid glyceride, single flower give birth to acid glyceride, two Semen arachidis hypogaeae acid glycerides, Single behenic acid glyceride, two behenic acid glyceride and its mixture.In another embodiment, described implant comprises to house Ligand binding molecules in hollow bushing and optional other reagent (if present).Described ligand binding molecules and optional Other reagent (if present) are through the following steps that be delivered to eyes：Insert the cannula in eyes, implant is released from sleeve pipe It is put in eyes, from eyes, then remove sleeve pipe.The example of this delivery apparatus is described in U.S. Publication the 2005/th In No. 0244462, document here is passed through to quote to be integrally incorporated.

In one embodiment, implant is adapted for ligand binding molecules and optional other reagent (if present) The flexible eye insertion apparatus being sustained release in eyes with controlling.In one embodiment, described device include in rod or The elongate body of the polymeric material of form of tubes, it contains ligand binding molecules and optional other reagent (if present), its In extend radially outward at least two grappling outthrust from this main body.Described device can have at least length of 8mm, and its Diameter including the main part of described outthrust is less than 1.9mm.Sustained release mechanism can for example be by spreading or logical Cross infiltration or biological corrosion.Insertion apparatus can be inserted in upper fornix or the lower fornix of eyes, so that by means of fornix solution Cut open the motion independent of eyes for the structure.Outthrust can have variously-shaped, such as, rib, screw thread, scrobicula or projection, The conical section of truncate or winding braiding section.In another embodiment, the polymeric material of described main body is chosen as in liquid The material expanding in environment.It is therefore possible to use having the device of less original dimension.Insertion apparatus can be such size And construction, after it makes on being inserted in fornix or lower fornix, this device is still outside the visual field, to make for a long time It is aware of in the original location and not by receiver with retaining well in the phase.This device can retain 7 in upper fornix or lower fornix To 14 days or more long.The example of this device is described in U.S. Patent No. 5,322,691, and described patent here is passed through to quote It is integrally incorporated.

In yet another aspect, a kind of method that suppression has been diagnosed as being formed with the new vesselses in the experimenter of tumor It is by implementing to this experimenter's local application ligand binding molecules.For example, in some embodiments, comprise ligand binding The organ or tissue that the pharmaceutical composition of molecule is applied topically to tumor or has passed through surgical operation therefrom tumor resection.Here In class embodiment, the amount that compositionss are preferably formed with the new vesselses in effective suppression tumor is applied.

In the case that ligand binding molecules are nucleic acid molecules wherein, the administration comprising the pharmaceutical composition of nucleic acid molecules can To be carried out using one of many methods known in field of gene.Such method include but is not limited to slow viruss conversion, The conversion of adenovirus transfected, cytomegaloviruses, microinjection and electroporation.

Examination flask and unit dose

The invention still further relates to comprising the test kit of one or more pharmaceutical composition and operation instructions.Ligand binding molecules Can pack together with another ligand binding molecules as herein described or other therapeutic agent or be formulated in such as test kit or bag In dress or unit dose, to allow common use；Both components can be prepared (that is, mixing) or together with single dosage Prepare (that is, not mixing) in different compositionss.Every kind of compositionss in test kit may be embodied in container.Real at some Apply in scheme, two kinds of components of test kit/unit dose with for two kinds of compounds are administered to people experimenter to treat herein The description of one of described disease and disease is packaged together.

Test kit can comprise container.This container can be used for separation component, and include for example separate bottle or separate Foilpac.Different compositionss can also be included in single undivided container when necessary.Test kit can also comprise The administration of component is instructed.When different components is applied with different dosage forms, when being applied with different dosage levels, or when needs Carry out indivedual antagonisies titration when, test kit is particularly advantageous.

All publications and patents here mentioned by herein is passed through to quote to be integrally incorporated, as each single publication Or patent by clearly be individually appointed as being incorporated by reference into the same.In case of conflict, herein to include The application of any definition is defined.

Embodiment

The ECD fragment of embodiment 1-VEGFR albumen.

Tested and be effectively combined target ligands (such as VEGF-C and/or VEGF-D and/or VEGF-A) to characterize The fragment of VEGFR-3 and/or VEGFR-2 and/or VEGFR-1 and variant and fusions.Referring to International Patent Publication WO No. 2005/087808, WO 2005/000895, WO 2006/088650, WO 2006/099154, WO 2004/ No. 106378, WO 2005/123104 and U.S. Patent No. 7,855,178, all of which is integrally incorporated this by quoting Literary composition.These researchs show：The ECD of these receptors can be truncated, and the domain from not isoacceptor can be recombinated, thus Form ligand binding molecules.

The generation of embodiment 2-VGX-301- Δ N2 ligand binding molecules

As Makinen et al., Nat.Med., 7：199-205, preparation described in 2001 comprises the Ig spline structure of VEGFR-3 The ligand binding molecules (being referred to herein as " VGX-300 ") of domain I-III, the disclosure of described document is by quoting entirety simultaneously Enter herein.

The key feature of VGX-300 molecule is that it contains 12 glycosylation sites；2x6 potential N- connects glycosylation position Point, 1 on upper 5 of each receptor fragments (VEGFR-3 Ig spline structure domain I, II and III) and each Fc area γ chain.Not with regard to O- connects glycosylated evidence.

Glycosylation characteristic can affect PK, but the impact to PK for the Fc polysaccharide minimum (Jones et al., Glycobiology, 17 (5), 2007, the 529-540 page).In short, asialo-glycoprotein receptor is incorporated therein lacks two or more salivas The compound N- of acid connects glycan structures, and galactose (Gal) residue of wherein bottom becomes terminal carbohydrates.In addition, mannose (Man) Receptor recognition high Man N- connects polysaccharide and terminal N-Acetyl Glucosamine (tGlcNAc) residue.Both receptors can The tachymetabolism leading to protein is removed.

In order to differentiate important glycosylation site for its lytic activity, sequentially delete in the N- connection site of five presumptions Each.Using five primer pairs, single mutation is introduced in VGX-300 coding region, connect polysaccharide (N- to destroy five N- Each of) Q total connection.

The primer pair being used is as follows：

N1 justice：5’GACCCCCCCGACCTTGCAGATCACGGAGGAGTCACAC 3’(SEQ ID NO：12)

N1 antisense：5’GTGTGACTCCTCCGTGATCTGCAAGGTCGGGGGGGTC 3’(SEQ ID NO：13)

N2 justice：5’CTGCACGAGGTACATGCCCAGGACACAGGCAGCTACGTC 3’(SEQ ID NO：14)

N2 antisense：5’GACGTAGCTGCCTGTGTCCTGGGCATGTACCTCGTGCAG 3’(SEQ ID NO：15)

N3 justice：5’GTCCATCCCCGGCCTCCAAGTCACGCTGCGCTCGC 3’(SEQ ID NO：16)

N3 antisense：5’GCGAGCGCAGCGTGACTTGGAGGCCGGGGATGGAC 3’(SEQ ID NO：17)

N4 justice：5’GGGAGAAGCTGGTCCTCCAGTGCACCGTGTGGGCTGA 3’(SEQ ID NO：18)

N4 antisense：5’TCAGCCCACACGGTGCACTGGAGGACCAGCTTCTCCC 3’(SEQ ID NO：19)

N5 justice：5’AGCATCCTGACCATCCACCAGGTCAGCCAGCACGACCT 3’(SEQ ID NO：20)

N5 antisense：5’AGGTCGTGCTGGCTGACCTGGTGGATGGTCAGGATGCT 3’(SEQ ID NO：21)

Determine the presence of mutation by sequencing, then by plasmid vector transient transfection in 293T cell (HEK).By west Square Northern blot analysis culture samples.Then feasible construct can enter the 293F cell (HEK) adapting to of short duration suspension, and leads to Cross ProSepA chromatography and gel-filtration purified supernatant, with biological by Enzyme Linked Immunoadsorbent Assay (ELISA) and BaF/3 Analysis is tested, further to measure yield and activity.Table 3 below summarizes expression data and the activity of each gained mutant.

Table 3.

Table 3 shows that only N2 mutant (being referred to herein as " VGX-301- Δ N2 ") is with respect to parent molecule (that is, VGX- 300) favourable expression and activity characteristic are shown.By transient expression produce in CHO and HEK cell VGX-301- Δ N2 and VGX-300 parent, and check the pharmacokineticss (PK) of each molecule as follows.Sprague-Dawley rat is tested at each In with each compound 2,3 or 5 be randomly assigned in arbitrary group.Rat in every group accepts to apply via intravenouss with 1mg/ The single dose VGX-300 of the dose concentration bolus of kg or VGX-301- Δ N2.After the -1st day (before administration) and administration altogether 12 time points (5 minutes to 14 days from after initial treatment), are punctured by lateral tail vein and collect interim blood sample.From every Individual blood sample is prepared blood serum sample and is carried out testing using quantitative VEGF-C part-capture ELISA and determine each compound Circulation composition.Then the result that these are analyzed is used for calculating pharmacokinetic parameter.VGX-300 and VGX-301- Δ N2's PK data is provided in table 4 below.

Table 4.

The PK curve providing in Fig. 1 and the as shown by data from table 4：With the VGX-300 producing in identical expression system Compare, VGX-301- Δ N2 can have Beneficial Effect to PK.

Embodiment 3-VGX-301- Δ N2 combines VEGF-C and VEGF-D

In order to measure the binding specificity to VEGF-C and VEGF-D for the VGX-300 and VGX-301- Δ N2, VEGF-C or VEGF-D (2 μ g/mL) is pre-deposited to elisa plate and as capture antigen.VGX-300 or VGX-301- by increasing concentration Δ N2 (0 to 10 μ g/mL) is applied on plate and utilizes rabbit anti-human igg-horseradish peroxidase conjugate, is joined using tetramethyl Aniline substrate reagent box detect.Result shows, VGX-300 and VGX-301- Δ N2 is incorporated into both VEGF-C and VEGF-D. Referring to Fig. 2.Unexpectedly, VGX-301- Δ N2 all represents, to two kinds of parts, the combination being better than VGX-300.

Embodiment 4-VGX-300 and VGX-301- Δ N2 binding affinity

The surface plasmon resonance (SPR) point carrying out by using ProteOn XPR36 biosensor (Bio-Rad) The combination of analysis VEGF-C and VEGF-D and VGX-300 or VGX-301- Δ N2.By VGX-300 or VGX-301- Δ N2 capture solid It is scheduled on the Protein G’ on GLM sensor chip, and measure the affinity to VEGF-C or VEGF-D for this molecule.Affinity is real The result tested is provided in table 5 below.

Table 5.

It is presented on the as shown by data in upper table 5：VGX-300 with VGX-301- Δ N2 sample is tied with almost identical affinity Close people VEGF-C and VEGF-D, it is strong that two of which molecule all shows that the combination to VEGF-C compares VEGF-D.

The combination of embodiment 5-VGX-301- Δ N2 blocking VEGF R-3 and VEGF-C and VEGF-D and crosslinking

Have been developed over analysis based on cell and evaluate VEGF family ligand binding and crosslinked VEGFR-2 and VEGFR-3 Ability.These bioanalysiss are already used to study the neutralization activity of VGX-300 and VGX-301- Δ N2.Bioanalysiss cell System is made up of mice IL-3 dependency pro-B cell line Ba/F3, and this cell line is made up of the ECD of VEGFR-2 or VEGFR-3 Chimerical receptor stable transfection, this Chimerical receptor is melted with the cross-film of mice erythropoietin receptor and extracellular domain inframe Close (as described in the embodiment 5 of WO 2005/087808, disclosure of the documents is incorporated herein by reference in their entirety).? In the case of lacking IL-3, these cells only can in conjunction with and cross-linked phase answer VEGFR ECD somatomedin in the presence of Can survival and propagation.

Briefly, in the culture medium being supplemented with VEGF-C or VEGF-D, in VGX-300 or VGX- of increasing concentration In the presence of 301- Δ N2 (0-100 μ g/mL), by the Ba/F3 cell transfecting through VEGFR-2 or VEGFR-3, (10,000 thin Born of the same parents/hole；96 orifice plates) cultivate 48 hours at 37 DEG C.Using WST 1 reagent measuring cell proliferation；Trained at 37 DEG C using WST-1 Foster cell 4 hours and at 450 nm measurement absorbance (n=3；The standard error of error bars=average, SEM).

Result shows：Activity with VEGF-C and VEGF-D in VGX-300, such as in VEGFR-2 and VEGFR-3 Ba/F3 life In thing analysis, the dose response suppression of VEGF-C and VEGF-D is shown.VGX-300 is equal in VEGFR-2 and VEGFR-3 analysis It is strong that display compares VEGF-D to the neutralization effect of VEGF-C.Referring to Fig. 3 and Fig. 4.

The analysis shows of VGX-301- Δ N2：This molecule is also capable of the combination of blocking VEGF-C and VEGF-D and VEGFR-3. The neutralization activity of VGX-301-N2 is slightly better than VGX-300.Referring to Fig. 4.Table 6 shows in VEGFR-3 Ba/F3 bioanalysiss The combination (IC50) of VGX-300 and VGX-301- Δ N2 and VEGF-C and VEGF-D.

Table 6

The embodiment 6-VGX-300 and VGX-301 Δ N2 eye after intravitreal administration is distributed and pharmacokineticss

Carry out this research to probe into VGX-300, VGX-301- Δ N2 and VEGF Trap (EYLEA) to Chinchilla Rabbit single Eye distribution after intravitreal administration and pharmacokineticss.

Research design is made up of 3 groups, each group 8 doe of distribution.Via bolus in 50 μ L glass bodies to eyes, right Animal applies 500 μ g radiolabeled VGX-300, VGX-301- Δ N2 or VEGF Trap.

1,12,24,72,168,366,504 and 672 hours upon administration, implement peaceful and comfortable to the animal that each is organized Extremely.In each time point collect blood (being processed into serum) and selected ocular tissue, and measure radioactivity by radiometric analysiss Concentration.Collected ocular tissue include aqueous humor, choroid, cornea, I-CB (ICB), lens, optic nerve, retina, Retinal pigment epithelium (RPE), sclera, trabecular reticulum and vitreous humor.Fig. 5 shows in different tissues and serum during monitoring Mean radio concentration.

Trial target [¹²⁵I]VGX-300、[¹²⁵I] VEGF Trap (EYLEA) and [¹²⁵I] VGX-301- Δ N2 is well-tolerated , stable in vitreous humor, and persistently it is exposed to the ocular tissue of back segment and leading portion.Although [¹²⁵I] VGX-300 and [¹²⁵I] serum after intravitreal administration for the VGX-301- Δ N2 expose variant, but [¹²⁵I] VGX-300 and [¹²⁵I]VGX- 301- Δ N2 only has a small amount of systemic exposure compared to VEGF Trap (EYLEA), and this is likely due to absorb via choroid Flow out caused removing with by aqueous humor.Observe in here research [¹²⁵I] VGX-300 and [¹²⁵I] VGX-301- Δ N2 PK is similar with bio distribution for two kinds of compounds, and with [¹²⁵I] PK of VEGF Trap (EYLEA) and bio distribution Quite.

Embodiment 7- retinopathy of prematurity model

Following examples are exemplary analysis it is therefore an objective to be suppressed using ROP model evaluation VGX-300 and VGX-301- Δ N2 The ability of retinal neovascularazation outbreak.In this model, the mice in the 7th day puerperal (P7) is exposed to hyperoxia (75% oxygen) 5 days (to P12).After exposing hyperoxia, P12 mice is made to return to normal oxygen, intravitreal injection applies people's isotype controls Antibody VGX-300, VGX-301- Δ N2, Eylea (VEGF-Trap), VGX-300+Eylea or VGX-301- Δ N2+Eylea. Then all mices are housed in 5 days under the conditions of normal oxygen, then put to death in P17, extract and be fixed on 10% formalin/PBS In.Dye the blood vessel in quantitative analysis each group using H＆E and/or IHC.

Embodiment 8- argon laser induction new vesselses form (CNV)

In this age-related macular degeneration (AMD) model, at the 0th day, Bruch is induced by argon laser (Bruch ' s) film rupture induction CNV (every mice is burnt 3 times).Research 10 mice groups, by intravitreal injection weekly ( 0th day and the 7th day) people's Isotype control antibodies, VGX-301- Δ N2, VGX-300, Eylea (VEGF-Trap), VGX-301- Δ N2+Eylea or VGX-300+Eylea is treated.At the 14th day, put to death animal, and prepare choroid flat board slide glass, be used in combination ICAM-2 dyes, by fluorescence microscope angiogenesiss.

Expected, VGX-301- Δ N2 will significantly inhibit the choroid in angiogenesiss AMD mouse model as single medicament Angiogenesiss, this can be withThe effect being represented is compared.

The inhibition to the growth and metastasis of tumours that VEGF-C mediates for the embodiment 9- ligand binding molecules

For proving that ligand binding molecules described herein suppress the ability of tumour growth and/or transfer, can using any can The tumor model accepting.The animal that exemplary model includes tending to developing various cancers, injection are derived from identical or different species Tumor or tumor cell or tumor cell line, including optionally inverted with recombinate ground one or more somatomedin of overexpression The cell of (such as VEGF-C or VEGF-D).For providing the vivo tumor model that multiple somatomedin wherein can be detected, can To make tumor cell line convert with exogenous DNA, to lead to express multiple somatomedin.

Ligand binding molecules described herein can (such as) with protein form, be transfused by i.v. or pass through implantable miniature Pump is directly applied, or using nucleic acid as the part administration of gene therapy approach.Experimenter preferably passes through sex, body Weight, age and medical history packet, to help make the difference between experimenter minimum.

Effect is weighed by the reduction of tumor size (volume) and weight.Can also check and tumor size, diffusion (are turned Move) and tumor quantity effect property.For example, the purposes of specific cells label can be used for illustrating with respect to lymphatic vessel generation Effect to angiogenesis is it is contemplated that VEGF-A binding constructs have bigger effect to the former, and expected VEGF-C combines and builds Body has bigger effect to the latter.Animal is considered as entirety to draw the change of time-to-live and weight.Check tumor and mark The evidence of this angiogenesis, lymphatic vessel generation and/or necrosis.

SCID mice can serve as obtaining being subject to of the ability of ligand binding molecules suppression described herein or prevention tumour growth Examination person.Ligand binding molecules for treatment generally go through selection so that it is bound to by the somatomedin of tumor cells expression Part, especially with respect to the non-neoplastic cell in experimenter by tumor cell overexpression somatomedin.In SCID mould In type, tumor cell (for example, MCF-7 cell) can be given birth in promoter or other offer with the virus of coding particular growth factor Transfect under the control of the expression control sequenc of the overexpression of the long factor, as described in WO 02/060950.Or, can adopt Other cell lines, such as HT-1080, such as described in U.S. Patent No. 6,375,929.Can be with wanting the growth of overexpression Factor ligand transfection tumor cell, or the swollen of one or more concerned somatomedin parts of overexpression can be selected Oncocyte system.The cell that one group of experimenter's implantation transfects through simulation, i.e. the carrier through lacking somatomedin part insert turns Dye.

Before the tumor of above-mentioned cell is implanted, simultaneously or after, process experimenter with particular ligand binding molecule.Have many Plant the mode of different administration ligand binding molecules.Can be using internal and/or ex vivo gene therapy.For example, it is possible to encoding The adenoviruss of ligand binding molecules or other vector-transfected cell, and implant the tumor cell expressing described somatomedin, with joining The cell of body binding molecule transfection can transfect (or somatomedin described in overexpression) with those with described somatomedin Cell identical.In some embodiments, the adenoviruss of internal (such as intravenouss) injection coding ligand binding molecules.One In a little embodiments, ligand binding molecules itself (for example, in protein form) are applied systemically or topically, such as using miniature Pump.When testing effect of particular combination construct, it is typically employed to a few comparison.For example, be based on carrier treatment and Speech, using the carrier with sky insert or LacZ, or insert can be containing can be in conjunction with VEGF-C or VEGF-D The ligand binding molecules of the complete ECD of VEGFR-3, this comparison can utilize more than an ECD construct if necessary and (for example, use In with reference to multiple parts, if using the binding constructs with multiple ligands binding affinity).

A. exemplary process

Prepare plasmid expression vector, transfectional cell and test cell

By coding VEGF-C or VEGF-D or a combination thereof cDNA be introduced in pEBS7 plasmid (Peterson and Legerski, Gene, 107：279-84,1991.).This identical carrier can be used for expressing ligand binding molecules.

With plasmid DNA, by the MCF-7S1 sub-clone of electroporation transfection people's MCF-7 breast cancer cell line, and select to stablize thin Born of the same parents group, and cultivate (Egeblad and Jaattela, Int.J.Cancer, 86 as discussed previously：617-25,2000).Cell is being mended It is filled with 100 μ Ci/ml [35S]-methionine and the no methionine of [35S]-cysteine and the MEM (Gibco) of cysteine Carry out metabolic marker in (Redivue Pro-Mix, Amersham Pharmacia Biotech).Labeled somatomedin profit With the antibody of anti-expressed somatomedin, from conditioned medium, immunoprecipitation goes out.Using Protein A sepharose (Amersham Pharmacia Biotech) make immune complex and combine complex precipitate, the 0.5%BSA in PBS, 0.02% Clean twice in Tween 20, and clean once in PBS, and analyze under SDS-PAGE under the reducing conditions.

Experimenter prepares and processes

In quadruplicate cell (20,000/ hole) is inoculated in 24- hole, after 1,4,6 or 8 days, pancreas on parallel-plate Albumen enzymology.New culture medium was provided after 4 and 6 days.Tumor is generated for analysis, is collected by trypsin acting and closely converge Culture, cleaning twice, will be 10 in PBS⁷Individual cell is inoculated in second (axillary vein) mammary gland of ovariectomized SCID mice Fat pad in, described mice carries 60 days sustained release pellet, described pill beta estradiol (Innovative containing 0.72mg 17 Research of America).Ovary excision and implantation pill are to carry out for 4-8 days before inoculated tumour cell.

The cDNA clone of coding binding constructs is in pAdBgllI plasmid, and produces adenoviruss as discussed previously (Laitinen et al., Hum.Gene Ther., 9：1481-6,1998).With 10⁹Pfu/ mice is by ligand binding molecules or LacZ Comparison (Laitinen et al., Hum.Gene Ther., 9：1481-6,1998) in SCID mice, 3 is little for adenoviruss intravenous injection When after inoculate tumor cell.

Analysis therapeutic efficiency

Length of tumor and width are measured twice a week in blind mode, and gross tumor volume is calculated as length x width x depth X0.5 it is assumed that tumor is semiellipsoid, and depth identical with width (Benz et al., Breast Cancer Res.Treat., 24：85-95,1993).

Tumor resection, is fixed on 24 hours in 4% paraformaldehyde (pH 7.0), and is embedded in paraffin.With resisting (such as) PECAM-1 (Pharmingen), VEGFR-1, VEGFR-2, VEGFR-3 (Kubo et al., Blood, 96：546-553,2000) or PCNA (Zymed Laboratories), PDGFR- α, the monoclonal antibody of PDGFR- β or anti-LYVE-1 (Banerji et al., J Cell Biol, 144：789-801,1999), VEGF-C (Joukov et al., EMBO J., 16：3898-911,1997), basis Laminin，LN (Partanen et al., Cancer, 86 of open scheme：2406-12,1999) or any one somatomedin is many Clonal antibody carries out immunostaining to section (7 μm).(amplified by the region of three vessel density highests (blood vessel focus) in section 60x) measure the number average of PECAM-1 positive vessels.All histologic analysis are all to be carried out using blinding tumor sample.

Injection adenovirus construct and/or protein therapeutic, after three weeks, make every group of four mouse anesthesias, open veutro skin Skin, and several microlitres are injected in tumor in her Wen (Evau ' s) indigo plant dyestuff (Sigma) of 3% in PBS.Then visually release The dyestuff of tumor.

Blood and blood protein can also be imaged and be monitored, the instruction health of experimenter and tumor vascular system Length.

Embodiment 10- is in experimenter using the effect to tumour progression for the combined therapy of ligand binding molecules and chemotherapeutics

Carry out this research, to test the work(combining with other anti-cancer therapies using ligand binding molecules described herein Effect.Such therapy includes chemotherapy for cancer target, X-ray therapy, antisense therapy, RNA interference and monoclonal antibody. Combined effect can be plus sum in its anticancer effect, but is preferably collaborative, for example, the prevention of cancer, suppress, disappear and Eliminate, extend the life-span and/or reduce side effect.

Experimenter is grouped, one group accepts chemotherapeutics, one group accepts ligand binding molecules, and one group accepts chemotherapeutics and joins Body molecule, frequency is with conventional regular intervals of time, for example daily, weekly or monthly.In people's research, experimenter's generally property passed through Not, body weight, age and medical history packet, to help make the difference between experimenter minimum.It is desirable that experimenter is diagnosed with phase The cancer of same type.In people or non-human subject, can be by measuring tumor size, transfer, body weight increase/mitigation, tumor Blood vessel chemical combination white blood cell count follows the tracks of progress.

Periodically carry out tumor biopsy before starting a treatment and afterwards.For example, biopsy is to control Carry out before treatment, be spaced one week, be then spaced apart one month, hereafter or when any possible (for example, in tumor resection) Carry out.Check cell marker and general cell and the tissue morphology of living tissue specimen, to assess the effectiveness for the treatment of.In addition Or in alternatives, imaging technique can be adopted.

For non-human animal's research, can be using other placebo.The zooscopy carrying out according to NIH guide is also There is provided insertion selectivity excess generation one or more by ligand binding molecules targeting somatomedin relatively uniform cancerous cell Colony and the advantage of tumor.

Claims (62)

1. a kind of purification or detached ligand binding polypeptide, it comprises and by SEQ ID NO：The ammonia that 2 position 47-115 limits The sequence of base acid has the aminoacid sequence of at least 95% homogeneity, and condition is described polypeptide corresponding to SEQ ID NO：2 The position of position 104-106 is not identical with N-X-S or N-X-T,

Wherein said polypeptide is attached at least one ligand polypeptide selected from people VEGF-C, VEGF-D and PlGF.

2. purification according to claim 1 or detached ligand binding polypeptide, it comprises and by SEQ ID NO：2 position The sequence of the aminoacid that 47-210 limits has the aminoacid sequence of at least 95% homogeneity, and condition is corresponding to of described polypeptide SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T.

3. purification according to claim 1 or detached ligand binding polypeptide, it comprises and by SEQ ID NO：2 position The sequence of the aminoacid that 47-314 limits has the aminoacid sequence of at least 95% homogeneity, and condition is corresponding to of described polypeptide SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T.

4. purification according to claim 1 or detached ligand binding polypeptide, it comprises and by SEQ ID NO：2 position The sequence of the aminoacid that 47-752 limits has the aminoacid sequence of at least 95% homogeneity, and condition is corresponding to of described polypeptide SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T.

5. purification according to any one of claim 1 to 4 or detached ligand binding polypeptide, it retains corresponding to SEQ ID NO：2 position 33-35, SEQ ID NO：2 position 166-168, SEQ ID NO：2 position 251-253 and SEQ ID NO：The sub- site of four N- glycosylation sequences of 2 position 299-301.

6. purification according to claim 5 or detached ligand binding polypeptide, it is in described four N- glycosylation sequences Site is glycosylated.

7. purification according to any one of claim 1 to 6 or detached ligand binding polypeptide, it is soluble polypeptide.

8. purification according to any one of claim 1 to 7 or detached ligand binding polypeptide, it comprises and by SEQ ID NO：2 position 47-115, SEQ ID NO：2 position 47-210, SEQ ID NO：2 position 47-314 or SEQ ID NO：2 Position 47-752 limit aminoacid sequence identical aminoacid sequence, condition is described polypeptide corresponding to SEQ ID NO：The position of 2 position 104-106 is not identical with N-X-S or N-X-T.

9. purification according to any one of claim 1 to 8 or detached ligand binding polypeptide, its combine people VEGF-C or People VEGF-D.

10. purification according to claim 9 or detached ligand binding polypeptide, it is on its surface to express VEGFR-3 Cell in suppression VEGF-C or VEGF-D be attached to the VEGFR-3 or suppression VEGFR-3 by VEGF-C or VEGF-D mediation Stimulate.

11. purification according to any one of claim 1 to 10 or detached ligand binding polypeptide, it is with 1nM or less K_dIn conjunction with people VEGF-C.

12. purification according to any one of claim 1 to 10 or detached ligand binding polypeptide, it is with 5nM or less K_dIn conjunction with people VEGF-D.

13. purification according to any one of claim 1 to 12 or detached ligand binding polypeptide, in wherein said polypeptide Corresponding to SEQ ID NO：The aminoacid of 2 position 104 is deleted or substituted with another kind of aminoacid.

14. purification according to claim 8 or detached ligand binding polypeptide, wherein in SEQ ID NO：2 position 104 The aminoacid at place is deleted or substituted with the group selected from L-Glutamine, aspartic acid, glutamic acid, arginine and lysine composition Another kind of aminoacid.

15. purification according to any one of claim 1 to 9 or detached ligand polypeptide, wherein said polypeptide comprises SEQ ID NO：3 aminoacid 23-290.

16. purification according to any one of claim 1 to 15 or detached ligand binding polypeptide, it comprises letter further Number peptide.

17. purification according to any one of claim 1 to 16 or detached ligand binding polypeptide, it comprises attached further It is connected at least one polyalkylene glycol moiety of described polypeptide.

18. purification according to claim 17 or detached ligand binding polypeptide, it comprises to be attached to the ammonia of described polypeptide The Polyethylene Glycol of the about 20-40kDa of base end.

A kind of 19. ligand binding molecules, it comprises to connect to heterologouss peptide according to any one of claim 1 to 18 Ligand binding polypeptide.

20. ligand binding molecules according to claim 19, wherein said heterologouss peptide comprises the constant knot of immunoglobulin Structure domain fragment.

21. ligand binding molecules according to claim 19, wherein said immunoglobulin constant domains fragment is IgG Constant domain fragment.

22. ligand binding molecules according to claim 20, wherein said immunoglobulin constant fragment comprises SEQ ID NO：3 aminoacid 306-537.

23. ligand binding molecules according to claim 19, wherein said ligand binding molecules comprise SEQ ID NO：3 Aminoacid 23-537.

24. ligand binding molecules according to any one of claim 19 to 23, it optionally comprises described heterologouss Peptide connects to the connexon of described ligand binding polypeptide.

25. ligand binding molecules according to any one of claim 19 to 23, it is many that it comprises wherein said ligand binding The C-terminal aminoacid of peptide is directly attached to the polypeptide of the N-terminal aminoacid of described heterologouss peptide by peptide bond.

26. ligand binding molecules according to any one of claim 19 to 25, it comprises to instruct described molecule further Signal peptide from the cell secretion expressing described molecule.

27. ligand binding molecules according to claim 19, wherein said molecule is included in SEQ ID NO：List in 3 Aminoacid sequence.

28. ligand binding molecules according to any one of claim 19 to 23, wherein said ligand binding polypeptide and institute State heterologouss peptide and formation Single polypeptide chain is connected by amide bond.

29. ligand binding polypeptides according to any one of claim 1 to 18 or according to arbitrary in claim 19 to 28 Ligand binding molecules described in, it comprises detectable label further.

A kind of 30. conjugates, it comprises ligand binding polypeptide according to any one of claim 1 to 18 or according to right Require the ligand binding molecules any one of 19 to 28 and chemotherapeutant.

A kind of 31. detached polynucleotide, the ligand binding that it comprises to encode according to any one of claim 1 to 18 is many Peptide or the coding nucleotide sequence of the ligand binding molecules according to any one of claim 19 to 28.

32. polynucleotide according to claim 31, it comprises to may be operably coupled to described coding nucleotide further The promoter sequence of sequence, to promote transcription in host cell for the described coding nucleotide sequence.

A kind of 33. carriers, it comprises the polynucleotide described in claim 31 or claim 32.

34. carriers according to claim 33, it comprises to may be operably coupled to described coding nucleotide sequence further Expression control sequenc.

35. carriers according to claim 33, wherein said carrier be selected from slow virus carrier, gland relevant viral vector, The group of adenovirus vector, liposome vectors and combinations thereof composition.

36. carriers according to claim 33, wherein said carrier comprises replication-defective adenoviral, described adenoviruss bag Containing may be operably coupled to promoter and both sides have the polynucleotide of adenoviruss polynucleotide sequence.

A kind of 37. detached cells or cell line, it is by the polynucleotide according to claim 31 or 32 or according to right Require the carrier conversion described in 33 to 36 or transfect.

38. detached cells according to claim 37 or cell line, it is eukaryotic cell.

39. detached cells according to claim 37 or cell line, it is people's cell.

40. detached cells according to claim 37 or cell line, it is Chinese hamster ovary (CHO) cell.

A kind of 41. methods preparing ligand binding polypeptide, it is included therein expression and joins described in described polynucleotide encoding The cell according to any one of claim 37 to 40 is grown under conditions of body Binding peptide or ligand binding molecules.

42. methods according to claim 41, it further includes the growth medium from described cell or described cell Purification or the described ligand binding polypeptide of separation or ligand binding molecules.

A kind of 43. compositionss, its ligand binding polypeptide comprising the purification according to any one of claim 1 to 29 or join Body binding molecule and pharmaceutically acceptable diluent, adjuvant, excipient or supporting agent.

A kind of 44. compositionss, it comprises polynucleotide or carrier and pharmacy according to any one of claim 31 to 36 Upper acceptable diluent, adjuvant, excipient or supporting agent.

45. compositionss according to claim 43 or claim 44, it is formulated for local application.

46. compositionss according to claim 45, its be solid, paste, ointment, gel, liquid, aerosol, spray, Polymer, thin film, emulsion or suspension formation.

47. compositionss according to claim 43 or claim 44, it is formulated for intravitreal administration.

The method that new vesselses in a kind of 48. suppression experimenters are formed, methods described includes suppressing described experimenter with effective In the amount that formed of new vesselses apply compositionss according to any one of claim 43 to 47 to described experimenter.

Choroid in a kind of 49. suppression experimenters or the method for retinal neovascularazation, methods described is included with effective The amount suppressing the retinal neovascularazation in described experimenter is applied according in claim 43 to 47 to described experimenter Compositionss described in any one.

A kind of method with the experimenter of eye disorders relevant with retinal neovascularazation for 50. treatments, methods described Will according to right including being applied to described experimenter with effective amount suppressing the retinal neovascularazation in described experimenter Seek the compositionss any one of 43 to 48.

A kind of 51. compositionss according to any one of claim 43 to 47 are used for suppressing new in experimenter in need Angiogenic is formed as the purposes of retinal neovascularazation, choroidal neovascularization formation or tumor angiogenesis.

52. methods according to any one of claim 49 to 51 or purposes, wherein said compositionss are locally applied to The eyes of described experimenter.

53. methods according to claim 52 or purposes, wherein pass through intravitreal injection applying said compositions.

54. methods according to claim 52 or purposes, wherein pass through intravitreal implant applying said compositions.

55. methods according to claim 52 or purposes, wherein by local application come applying said compositions.

56. methods according to any one of claim 49 to 55 or purposes, wherein said compositionss are to be suppressed with effective VEGF-C and/or VEGF-D in the eyes of described experimenter is attached to or stimulates table in the cell of eyes or the blood vessel of eyes The amount of VEGFR-2 and/or VEGFR-3 reaching is applying.

57. methods according to claim 50 or 51 or purposes, wherein said eye disorders are selected from degeneration of macula, glycosuria Characteristic of disease retinopathy and the group of macula lutea telangiectasis composition.

58. methods according to any one of claim 49 to 57 or purposes, it further includes to apply to described experimenter Use antibiotic.

59. methods according to claim 58, wherein said antibiotic is selected from following formed group：Amikacin, Gentamycin, kanamycin, neomycin, netilmicin, streptomycin, tobramycin, teicoplanin, vancomycin, Azithromycin, Clarithromycin, clarithromycin, dirithromycin, erythromycin, Roxithromycin, triacetyloleandomycin, amoxicillin, ampicillin, Ah XiLin is pricked in Lip river XiLin, Carbenicillin, chlorine, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, penicillin, piperazine draw west Woods, ticarcillin, bacitracin, colistin, polymyxin B, Ciprofloxacin, enoxacin, Gatifloxacin, Levofloxacin, Lip river U.S. sand star, Moxifloxacin, norfloxacin, Ofloxacin, trovafloxacin, mafenide, sulfacetamide, sulfamethizole, willow nitrogen Sulfapyridine, ganda, trimethoprim, sulfamethoxazole, demeclocycline, doxycycline, minocycline, soil Mycin and tetracycline.

60. methods according to claim 48 or 51 or purposes, wherein said experimenter is diagnosed as with tumor, and The amount that wherein said compositionss are formed with effective new vesselses suppressing in described tumor to be applied.

61. methods according to claim 60 or purposes, wherein said compositionss are locally applied to described tumor or Organ or tissue by surgical operation therefrom tumor resection.

62. methods according to claim 60 or purposes, wherein said compositionss are to suppress described experimenter with effective VEGF-C and/or VEGF-D in tumor is attached to or stimulates VEGFR-2 and/or VEGFR-3 of expression in tumor cell Measure and to apply.