CN106414487B - Ligand binding molecules and uses thereof - Google Patents

Abstract

The present invention relates to ligand binding molecules and their use for modulating angiogenesis and/or lymphangiogenesis.

Description

Ligand binding molecules and uses thereof

Technical Field

The present invention relates generally to the modulation of vascular growth, particularly in ophthalmology and oncology.

Sequence listing

The electronic sequence listing forms part of this description.

Background

Vascular Endothelial Growth Factor (VEGF) proteins and their receptors (VEGFR) play an important role in angiogenesis (the development of embryonic vasculature from early differentiated endothelial cells), angiogenesis (the process of forming new blood vessels from existing blood vessels), and lymphangiogenesis (the process of forming new lymphatic vessels). Platelet-derived growth factor (PDGF) proteins and their receptors (PDGFR) are involved in regulating cell proliferation, survival and migration of several cell types.

Dysfunction of the endothelial cell regulatory system is a key feature of cancer and various diseases associated with abnormal angiogenesis, angiogenesis and lymphangiogenesis.

Angiogenesis occurs in embryonic development and the growth, repair and regeneration of normal tissues, the female reproductive cycle, the establishment and maintenance of pregnancy, the repair of wounds and fractures. In addition to angiogenesis occurring in healthy individuals, angiogenic events are involved in a number of pathological processes, especially tumor growth and metastasis, as well as other conditions in which vascular proliferation (especially of the microvascular system) is increased, such as diabetic retinopathy, psoriasis and arthropathy. Inhibition of angiogenesis may be used to prevent or reduce these pathological processes or to slow their progression.

Although therapies involving blockade of VEGF/PDGF signaling through its receptors have shown promise for inhibiting angiogenesis and tumor growth, there remains a need for new or improved compounds and therapies for treating these diseases.

Summary of The Invention

The present invention relates to novel compositions and methods of use thereof for inhibiting aberrant angiogenesis, lymphangiogenesis, or both, as well as inhibiting other effects of vascular endothelial growth factor-C (VEGF-C) and vascular endothelial growth factor-D (VEGF-D), each capable of binding to and stimulating phosphorylation of at least one growth factor receptor tyrosine kinase (i.e., VEGFR-2 or VEGFR-3). Compositions of the invention include ligand binding molecules that bind to one or both of human VEGF-C and human VEGF-D. In some embodiments, the ligand binding molecule comprises a polypeptide, for example, a fragment of the extracellular domain (ECD) of a growth factor receptor tyrosine kinase. The fragment may be different from the wild-type sequence in a manner that does not abrogate growth factor binding, and the fragment is preferably engineered in the manner described herein to improve its properties as a therapeutic agent for administration to a subject/patient in need thereof.

The invention also provides nucleic acids encoding such ligand binding molecules. The nucleic acids may be used to express the polypeptide ligand binding molecules, and in some embodiments, may also be used as therapeutic agents in a biologically active form for achieving in vivo expression of the polypeptide ligand binding molecules.

Administration of a composition comprising a ligand binding molecule described herein (or a polynucleotide encoding it) to a patient in need thereof inhibits growth factor stimulation of the VEGF receptor (e.g., inhibits phosphorylation of the receptor) and thereby inhibits biological responses mediated through the receptor, including but not limited to VEGFR-mediated angiogenesis, lymphangiogenesis, or both.

VEGF-C and VEGF-D bind to and stimulate phosphorylation of at least one VEGF receptor (or receptor heterodimer) selected from VEGFR-2 and VEGFR-3 with high affinity. This expression refers to the well-known properties of growth factors for their cognate receptors and is not intended as a limiting feature of the ligand binding molecules of the invention per se. However, preferred ligand binding molecules of the invention do not simply bind their target growth factor. Preferred ligand binding molecules also inhibit the growth factor to which they bind from stimulating phosphorylation of at least one (and preferably all) of the receptor tyrosine kinases to which the growth factor binds. Stimulation of tyrosine phosphorylation is readily measured using in vitro cellular assays and anti-phosphotyrosine antibodies. Since phosphorylation of receptor tyrosine kinases is an initial step in the signaling cascade, it is convenient to indicate whether a ligand binding molecule is capable of inhibiting growth factor-mediated signal transduction leading to cell migration, cell growth, and other responses. Many other cell-based assays and in vivo assays can be used to confirm the growth factor neutralizing properties of the ligand binding molecules of the invention.

A ligand binding molecule that is "specific" for a particular growth factor is one that specifically recognizes the active form of the growth factor (e.g., the form found to circulate in vivo). Preferably, the ligand binding molecule also specifically binds to other forms of growth factors. For example, VEGF-C (and VEGF-D) is translated into prepro molecules with extensive amino-terminal and carboxy-terminal propeptides that cleave to produce "fully processed" forms of VEGF-C (or VEGF-D), which bind to and stimulate VEGFR-2 and VEGFR-3. Ligand binding molecules specific for VEGF C (or VEGF-D) bind to at least the fully processed form of VEGF-C (or VEGF-D), and preferably also to partially processed and unprocessed forms.

In one aspect, the ligand binding molecule described herein is a purified or isolated ligand binding polypeptide comprising a polypeptide consisting of SEQ ID NO: 2 or position 47-115 of SEQ ID NO: 2, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, with the proviso that the sequence of the polypeptide corresponding to SEQ ID NO: 2 (X represents any amino acid) and N-X-S or N-X-T, wherein said polypeptide binds to at least one ligand polypeptide selected from the group consisting of growth factors of the VEGF or PDGF families, such as human VEGF-A (VEGF), VEGF-B, VEGF-C, VEGF-D, PIGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D. SEQ ID NO: 2 comprises the amino acid sequence of human VEGFR-3, wherein SEQ ID NO: 2 corresponds to a putative signal peptide and SEQ ID NO: 2 corresponds to the putative mature form of the receptor lacking the putative signal peptide. SEQ ID NO: 2 roughly corresponds to or includes the first immunoglobulin-like domain of the ECD of human VEGFR-3 ("D1 for VEGFR-3"). Constructs comprising other Ig-like domains of VEGFR-3 or other receptors attached in a manner that produces ligand binding polypeptides are specifically contemplated, and constructs that bind different ligands are constructed by altering the receptor components used to form the ligand binding polypeptides. In some variations, the ligand-binding polypeptide is based primarily on the extracellular domain of VEGFR-3, and in other embodiments, the ligand-binding polypeptide is a fusion based on fragments of other receptor tyrosine kinases, such as VEGFR-1 and/or VEGFR-2 and/or PDGFR-alpha and/or PDGFR-beta. In embodiments based primarily on VEGFR-3, the at least one ligand is a natural ligand for VEGFR-3, such as a VEGF-C or VEGF-D polypeptide.

In some embodiments, the ligand binding polypeptide comprises a heavy chain variable region comprising at least one of SEQ ID NOs: 2 position 154-210 or SEQ ID NO: 2, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the amino acid sequence defined in position 248-314 of the first amino acid sequence, wherein the N-terminal residue of the second amino acid sequence is linked to the C-terminal residue of the first amino acid sequence, either directly or via a spacer, wherein the polypeptide binds to at least one ligand polypeptide selected from the group consisting of growth factors of the VEGF or PDGF families (such as human VEGF-a (VEGF), VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D). The sequence of amino acids defined by positions of the polypeptide corresponding to positions 154-210 roughly corresponds to or includes the second immunoglobulin-like domain of the ECD of human VEGFR-3 ("D2 of VEGFR-3"). The sequence of amino acids defined by positions of the polypeptide corresponding to positions 248-314 roughly corresponds to or includes the third immunoglobulin-like domain of the ECD of human VEGFR-3 ("D3 of VEGFR-3"). When the second amino acid sequence comprises a sequence of amino acids substantially corresponding to or including D2 of VEGFR-3, it is preferred that the ligand binding polypeptide comprises an amino acid sequence substantially identical to the sequence defined by SEQ ID NO: 2, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the amino acid sequence defined in position 248-314 of the second amino acid sequence, wherein the N-terminal residue of the third amino acid sequence is linked to the C-terminal residue of the second amino acid sequence, either directly or via a spacer, wherein said polypeptide binds to at least one ligand polypeptide selected from the group consisting of growth factors of the VEGF or PDGF families (such as human VEGF-a (VEGF), VEGF-B, VEGF-C, VEGF-D, PlGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D). In other words, in embodiments in which the ligand binding polypeptide comprises an amino acid sequence substantially corresponding to or including D1 and D2 of VEGFR-3, it is preferred that the ligand binding polypeptide further comprises an amino acid sequence substantially corresponding to or including D3 of VEGFR-3.

In embodiments in which the ligand binding polypeptide comprises an amino acid sequence that corresponds generally to two or more component domains of VEGFR-3, the component domains may be linked directly to each other or may be linked via one or more spacers. Preferably, the constitutive domains are linked by one or more spacers. In one embodiment, the spacer comprises one or more peptide sequences located between the component domains and having a length of between 1 and 100 amino acids, preferably between 1 and 50 amino acids. In one embodiment, the spacer between the two component domains consists essentially of the peptide sequence that is naturally linked to the component domains in native VEGFR-3.

In embodiments in which the ligand binding polypeptide comprises an amino acid sequence that substantially corresponds to or includes a contiguous component domain of VEGFR-3 (e.g., D1-D2 or D1-D2-D3), the component domains are linked via one or more spacers comprising one or more peptide sequences located between the component domains and having a length of between 1 and 100 amino acids, preferably between 1 and 50 amino acids. In one embodiment, the spacer between the two constituent domains consists essentially of a peptide sequence corresponding to the peptide sequence linking the corresponding contiguous constituent domains in native VEGFR-3. In some embodiments, the spacer between two consecutive component domains comprises an amino acid sequence that is at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the sequence of amino acids linking the consecutive domains in native VEGFR-3.

In one embodiment, when the ligand binding polypeptide comprises an amino acid sequence substantially corresponding to or including D1 and D2 of VEGFR-3, the component domains D1 and D2 are linked via a spacer amino acid sequence that is linked to a sequence consisting of SEQ ID NO: 2, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity. When the ligand binding polypeptide comprises an amino acid sequence substantially corresponding to or including D1, D2, and D3 of VEGFR-3, the component domains D2 and D3 are linked via a spacer amino acid sequence that is linked to a sequence consisting of SEQ ID NO: 2, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the sequence of amino acids defined in position 211-247.

In some embodiments, the purified or isolated ligand binding polypeptide comprises a polypeptide consisting of SEQ ID NO: 2, or position 47-210 of SEQ ID NO: 2, or position 25-210 of SEQ ID NO: 2, or position 47-314 of SEQ ID NO: 2, or position 25-314 of SEQ ID NO: 2, or positions 47-752 or 47-775 of SEQ ID NO: 2 or 25-775, or an amino acid sequence at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the sequence of an amino acid defined in position 25-752 or 25-775 of said polypeptide, provided that said polypeptide has an amino acid sequence corresponding to SEQ ID NO: 2 at position 104-106 not identical to N-X-S or N-X-T, wherein said polypeptide binds to at least one ligand polypeptide selected from the group consisting of human VEGF-A, VEGF-C, VEGF-C, VEGF-D and PlGF. In one variation, the nucleic acid sequence corresponding to SEQ ID NO: 2 is deleted and replaced with another amino acid (such as glutamine, aspartic acid, glutamic acid, arginine, and lysine). Positions 47-210 include the first two immunoglobulin-like domains of human VEGFR-3ECD, and the VEGFR-3ECD sequence between the first two Ig-like motifs. Positions 47-314 include the first three immunoglobulin-like domains of human VEGFR-3ECD, as well as the VEGFR-3ECD sequence between these Ig-like motifs.

More generally, the ligand binding polypeptides of the invention comprise a polypeptide having an amino acid sequence substantially similar to that shown in SEQ ID NO: 2, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, wherein the amino terminus of the fragment is an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, positions 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 and 50; and wherein the carboxy terminus of said fragment is a sequence selected from SEQ ID NOs: 2 (e.g., positions 110, 111, 112, 113, 114, 115, 116, a.... 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775) provided that the polypeptide has an amino acid sequence corresponding to SEQ ID NO: the positions 104 and 106 of 2 are not the same as N-X-S or N-X-T. For reasons that will be readily apparent from the description herein, the changes allowed are not those that introduce a new glycosylation sequence not found in wild-type VEGFR-3.

In another aspect, the ligand binding molecule described herein is a purified or isolated ligand binding polypeptide comprising a polypeptide consisting of a sequence corresponding to SEQ ID NO: 2, position 47-115 of SEQ ID NO: 2, position 47-210 of SEQ ID NO: 2, position 47-314 of SEQ ID NO: 2 or positions 47-752 or 47-775 of SEQ ID NO: 2 or 25-775, provided that the amino acid sequence of said polypeptide is identical to the sequence of the amino acid sequence of a position-defined amino acid of the polypeptide corresponding to SEQ ID NO: the positions 104 and 106 of 2 are not the same as N-X-S or N-X-T. In one variation, the nucleic acid sequence corresponding to SEQ ID NO: 2 is deleted and replaced with another amino acid (such as glutamine, aspartic acid, glutamic acid, arginine, and lysine).

In another aspect, the ligand binding molecule described herein is a purified or isolated ligand binding polypeptide comprising a polypeptide consisting of SEQ ID NO: 2, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, wherein the amino acid sequence corresponding to SEQ ID NO: 2 is a putative VEGFR-3 glycosylation sequence, and wherein the putative glycosylation sequence is deleted from the amino acid sequence of the ligand binding polypeptide. As used in this context, the term "abrogate" means a change in the primary amino acid sequence in at least one position (by substitution, deletion, or insertion) to disrupt the N-X-T sequence sub-motif.

The invention also includes multimeric ligand binding constructs comprising two or more ligand binding molecules as described herein, the two or more ligand binding molecules 6 being covalently or non-covalently linked to each other, thereby forming a dimeric or multimeric structure. In some variations, the linkage occurs between VEGFR-3-like sequences of the ligand-binding polypeptides; in other variations, the linkage occurs between heterologous polypeptides attached to one or both VEGFR-3-like sequences.

Reference herein to a ligand-binding molecule or ligand-binding polypeptide described herein includes variants thereof as defined above, provided that such ligand-binding polypeptide or molecule (whether monomeric, dimeric or higher order multimer) contains at least an Ig-like motif similar or identical to Ig-like motif 1 of VEGFR-3 (e.g., about 47-115 of SEQ ID NO: 2), provided that the polypeptide has a sequence corresponding to SEQ ID NO: 2 (which represents an N-linked glycosylation sequence in the native VEGFR-3 sequence) is not identical to N-X-S or N-X-T.

In another aspect, described herein is a ligand binding molecule that is an isolated or purified ligand binding polypeptide comprising a first immunoglobulin-like domain of a VEGFR-3 Δ N2 polypeptide. As used herein, the term "VEGFR-3 Δ N2 polypeptide" refers to a polypeptide having at least 95% identity to the sequence of amino acids defining the ECD of human VEGFR-3, provided that the portion of the sequence of the polypeptide corresponding to the second putative glycosylation sequence NDT is mutated such that it no longer conforms to the N-X-S/T SEQUON motif (e.g., due to a substitution at one of the positions). In some embodiments, the purified polypeptide comprises the first two immunoglobulin-like domains of the VEGFR-3 Δ N2 polypeptide, and preferably includes a VEGFR-3 sequence between these domains. In some embodiments, the purified polypeptide comprises the first three immunoglobulin-like domains of the VEGFR-3 Δ N2 polypeptide, and preferably includes VEGFR-3 sequences between these domains.

In yet another aspect, described herein is a ligand binding molecule that is a polypeptide comprising an ECD fragment of human VEGFR-3 fused to a fusion partner, wherein the amino acid sequence of the ECD fragment of VEGFR-3 is modified from wild-type VEGFR-3 to eliminate a second putative N-linked glycosylation sequence molecule of wild-type VEGFR-3, wherein the polypeptide is soluble in human serum and binds human VEGF-C or human VEGF-D; and wherein the fusion partner improves the solubility or serum half-life of the ECD fragment (e.g., compared to the same fragment not fused to the fusion partner). In some embodiments, the fusion partner is a heterologous polypeptide.

In some embodiments, the ligand-binding polypeptide or ligand-binding molecule binds human VEGF-C or human VEGF-D. In some embodiments, the ligand binding polypeptide or ligand binding molecule inhibits binding of VEGF-C or VEGF-D to VEGFR-3 or inhibits stimulation of VEGFR-3 mediated by VEGF-C or VEGF-D in VEGFR-3 expressing cells on the surface. Inhibition of stimulation may be demonstrated, for example, by measuring receptor phosphorylation, or by measuring cell growth in vitro or in vivo, or by measuring changes in blood vessel growth or levels of other tissues in vivo.

The ligand binding molecules preferably have a K of about 1nM or less (e.g., 500pM, 400pM, 300pM, 200pM, 100pM, 50pM, 10pM or less)_dBinds to human VEGF-C. The ligand binding molecule preferably has a K of about 5nM or less (e.g., 2nM, 1nM, 500pM, 400pM, 300pM, 200pM, 100pM, 50pM, 10pM or less)_dBinds to human VEGF-D.

In another aspect, the purified or isolated ligand binding molecule comprises SEQ ID NO: 3, amino acids 22-290 of SEQ ID NO: 3, amino acids 23-290 of SEQ ID NO: 3 or SEQ ID NO: 3, amino acids 22-537. In other variations, the molecule comprises an amino acid sequence that is at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to any of the above sequences, with the proviso that the sequence of the polypeptide corresponding to (aligned with) the VEGFR-3N 2 sequence subsequence is not a glycosylated sequence.

As described herein, ligand binding molecules can be chemically modified (e.g., glycosylated, pegylated, etc.) to impart desired properties while maintaining their specific growth factor binding properties. The Ig-like domains I-III of VEGFR-3 contain five putative N-glycosylation sites (referred to herein as the N1, N2, N3, N4, and N5 sequence subsections of VEGFR-3, respectively). N1 corresponds to SEQ ID NO: 2 amino acids 33-35; n2 corresponds to SEQ ID NO: amino acids 104-106 of 2; n3 corresponds to SEQ ID NO: 2 hydric acid 166-168; n4 corresponds to SEQ ID NO: 2, and N5 corresponds to SEQ ID NO: 2, 299-301. In some embodiments, the ligand binding molecules described herein comprise a modification in the N2 sequence motif of the molecule. For example, in some embodiments, the ligand binding molecule has a sequence corresponding to SEQ ID NO: 2 is deleted and replaced with another amino acid. Conservative substitutions are preferred. In some embodiments, the nucleic acid sequence corresponding to SEQ ID NO: 2 is deleted and replaced with an amino acid selected from the group consisting of glutamine, aspartic acid, glutamic acid, arginine, and lysine. Wherein SEQ ID NO: 2 as described above, the N2 sequence of SEQ ID NO: 2, N1, N3, N4 and N5 are preferably unchanged in amino acid sequence.

As described herein, the ligand binding molecule may be linked to the fusion partner directly or via a linker. The fusion partner may be any heterologous component that enhances the function of the ligand binding molecule. An exemplary peptide fusion partner comprises an immunoglobulin constant domain (Fc) fragment. In some embodiments, the immunoglobulin constant fragment comprises a sequence identical to SEQ ID NO: 3, or amino acid 306-537 has an amino acid sequence that is at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical or has 100% identity.

As described herein, ligand-binding molecules can be chemically modified, for example, to facilitate attachment to fusion partners (such as, e.g., heterologous peptides) or to impart desired properties (such as, e.g., increased serum half-life, increased solubility in aqueous media, and to allow targeting of a particular cell population, e.g., tumor cells or retinal cells).

In some embodiments, the ligand binding molecules described herein optionally comprise at least one PEG moiety attached to the molecule. For example, in some embodiments, about 20-40kDa PEG is attached to the amino terminus of the ligand binding molecule.

In some embodiments, a ligand binding molecule as described herein optionally comprises a linker, such as factor Xa linker sequence PIEGRGGGGG (SEQ ID NO: 4), linking the fusion partner, such as, for example, a heterologous peptide, to the ligand binding polypeptide. In other embodiments, the ligand-binding molecule comprises a polypeptide, wherein the C-terminal amino acid of the ligand-binding polypeptide is directly attached to the N-terminal amino acid of the heterologous peptide fusion partner by a peptide bond. In some embodiments, the ligand-binding polypeptide and the heterologous peptide are attached (directly or via a linker polypeptide) by an amide bond, thereby forming a single polypeptide chain.

In some variations, the ligand binding molecule comprises a signal peptide that directs secretion of the molecule from a cell expressing the molecule.

The nucleic acids (polynucleotides) of the invention include nucleic acids encoding polypeptide ligand binding molecules, which may be used for applications such as gene therapy and recombinant in vitro expression of polypeptide ligand binding molecules. In some embodiments, the nucleic acid is purified or isolated. In some embodiments, the polynucleotide further comprises a promoter sequence operably linked to the nucleotide sequence encoding the polypeptide, wherein the promoter sequence promotes transcription of the sequence encoding the polypeptide in a host cell. The polynucleotide may further comprise a polyadenylation signal sequence. In some variations, the nucleic acid has an encoding nucleotide sequence similar to a nucleic acid encoding wild-type human VEGFR-3. For example, the nucleic acid comprises a nucleotide sequence identical to SEQ ID NO: 1 or a fragment thereof having at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity. For example, in the case of encoding SEQ ID NO: 2 (modified at the N2 sequence subsequence), an exemplary nucleic acid comprises a nucleotide sequence identical to SEQ ID NO: 1 (corresponding to codons 47-314), or at least 80%, or at least 85%, or at least 90%, or at least 92%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identical to the human VEGFR-3 sequence set forth in positions 157 to 961.

Vectors comprising polynucleotides are also an aspect of the invention. Such vectors may comprise an expression control sequence operably linked to a sequence encoding a polypeptide. In some variations, the vector is selected to optimize recombinant expression in vitro in a selected host cell (e.g., a eukaryotic host cell). In some variations, the vector is selected for in vivo delivery. For example, the vector may be selected from the group consisting of a lentiviral vector, an adeno-associated viral vector, an adenoviral vector, a liposomal vector, and combinations thereof. In some embodiments, the vector comprises a replication-defective adenovirus comprising a polynucleotide operably linked to a promoter and flanked by adenovirus polynucleotide sequences.

Host cells comprising polynucleotides, vectors and other nucleic acids and methods of using them for expression and isolation of ligand binding molecules are also aspects of the invention. Eukaryotic host cells, including Chinese Hamster Ovary (CHO) cells and other mammalian cell lines, comprising polynucleotides encoding the ligand binding polypeptides or ligand binding molecules described herein are specifically contemplated. In some variations, the cell line is selected or engineered to introduce human or human-like glycosylation at a glycosylation sequence motif of the polypeptide produced in the cell.

Methods of making the ligand binding polypeptides or molecules described herein are also contemplated. (such methods may also be described as the use of a polynucleotide or cell of the invention.) in one aspect, the method comprises growing a cell that has been transformed or transfected with a polynucleotide or vector described herein under conditions in which the ligand-binding polypeptide or ligand-binding molecule encoded by the polynucleotide is expressed. In some embodiments, the method further comprises purifying or isolating the ligand-binding polypeptide or ligand-binding molecule from the cell or the growth medium of the cell. In some embodiments, the method further comprises attaching one or more polyethylene glycol (PEG) or other moieties to the expressed and purified/isolated polypeptide.

The invention also includes compositions comprising the polypeptides, ligand binding molecules, or nucleic acids encoding them, in combination with a pharmaceutically acceptable diluent, adjuvant, or carrier medium. In some embodiments, the composition is formulated for topical administration to the eye (e.g., an external preparation such as an ointment or eye drops, or a preparation suitable for intravitreal injection). In other embodiments, the composition is formulated for local administration to a tumor or an organ or tissue from which a tumor has been surgically excised, e.g., by intravenous injection or direct injection into the affected tissue, or by application through a device during tumor resection.

The invention also includes methods of inhibiting vascular growth (blood and/or lymphatic vessels) in a therapeutic and prophylactic setting using the materials (polypeptides, molecules and constructs, polynucleotides and vectors, transformed cells, compositions) described herein. The methods of use as described herein may additionally be characterized by the use of various materials for a given indication. Exemplary subjects for treatment include humans and other primates, livestock (e.g., cows, horses, pigs), zoo animals (e.g., felines, canines, pellicles, cervids), and companion animals (e.g., dogs, cats) and rodents.

In some variations, the invention includes a method of inhibiting neovascularization in a subject, comprising administering to the subject an amount of any of the materials or compositions described above effective to inhibit neovascularization in the subject. Exemplary pathogenic neovascular conditions include those of the eye and tumor neovascularization.

In some variations, the invention includes a method of inhibiting retinal neovascularization in a subject, comprising administering to the subject a material or composition as described herein in an amount effective to inhibit retinal neovascularization in the subject. In a related variation, the invention includes a method of treating a subject having an ocular disorder associated with retinal neovascularization, the method comprising administering to the subject a material or composition as described herein and outlined above in an amount effective to inhibit retinal neovascularization in the subject. For example, a composition as described herein is administered topically to the eye of a subject, such as by eye drops or other topical administration, by subconjunctival administration (e.g., injection), by intravitreal injection, or by intravitreal implant.

The compositions are preferably administered in an amount and with a dosing frequency and duration effective to inhibit binding of VEGF-C and/or VEGF-D in the eye of the subject to, or stimulate expression of VEGFR-2 and/or VEGFR-3 in cells of the eye or blood vessels of the eye. This beneficial effect may be measured in terms of a slowing or cessation of the deterioration/progression of the pathological conditions of the eye (such as macular degeneration, diabetic retinopathy, and macular telangiectasia), or an improvement in clinical symptoms. Beneficial effects can also be observed by monitoring blood vessel growth in and around the target tissue.

The methods and uses described herein can be practiced in combination with other therapeutic agents or treatments (e.g., radiation forms), as described in detail herein.

The inventive methods (or uses) described herein can be practiced with one or more ligand binding molecules, or with a combination of at least one ligand binding molecule and another treatment, such as standard of care treatment for treating cancer or for treating the posterior of ocular disorders. In embodiments where the ligand binding molecule is for the treatment of the posterior segment of an ocular disorder, other treatments contemplated include focal laser therapy (or photocoagulation), scattered laser therapy (or pan-retinal photocoagulation), and vitrectomy. In some embodiments, the antibiotic is also administered to the subject receiving treatment.

In embodiments where the ligand binding molecules described herein are used to treat cancer, contemplated standard of care therapies include antisense RNA, RNA interference, bispecific antibodies, other antibody types, and small molecules that target growth factors and/or their receptors, such as chemotherapeutic agents. Cytokines, radiotherapeutic agents, or radiotherapy may also be used in combination with the ligand binding molecules described herein. The chemotherapeutic agent or radiotherapeutic agent may be a member of a class of agents that includes: an antimetabolite; a DNA damaging agent; a cytokine or growth factor; a covalent DNA binding drug; a topoisomerase inhibitor; an anti-mitotic agent; an anti-tumor antibiotic; a differentiating agent; an alkylating agent; a methylating agent; a hormone or hormone antagonist; a nitrogen mustard; a radiosensitizer; and a photosensitizer. Specific examples of these agents are described elsewhere in this application. The combination treatments are preferably synergistic, but they need not be, and additional treatments are also considered aspects of the invention.

In addition to their use in methods, the ligand binding molecules may also be combined with other therapeutic agents or packaged in kits or as unit doses. Neoplastic diseases are not the only diseases that can be treated using ligand binding molecules. The ligand binding molecules may be used as therapeutic agents for any disease associated with abnormal angiogenesis or lymphangiogenesis.

The invention may also be described in the following further embodiments:

a purified or isolated ligand binding polypeptide comprising a polypeptide consisting of SEQ ID NO: 2, provided that the sequence of amino acids defined at positions 47-115 of said polypeptide corresponds to SEQ ID NO: 2 at position 104-106 not identical to N-X-S or N-X-T, wherein said polypeptide binds to at least one ligand polypeptide selected from the group consisting of human VEGF-C, VEGF-D and PlGF.

The purified or isolated ligand binding polypeptide of paragraph [0048], comprising a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, provided that the sequence of the hydrido acid defined at positions 47-210 of said polypeptide has a hydrido sequence of at least 95% identity, with the proviso that the amino acid sequence of said polypeptide corresponds to SEQ ID NO: the positions 104 and 106 of 2 are not the same as N-X-S or N-X-T.

The purified or isolated ligand binding polypeptide of paragraph [0048], comprising a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, provided that the sequence of the hydrido acid defined at positions 47-314 of said polypeptide has a hydrido sequence of at least 95% identity, with the proviso that the amino acid sequence of said polypeptide corresponds to SEQ ID NO: the positions 104 and 106 of 2 are not the same as N-X-S or N-X-T.

The purified or isolated ligand binding polypeptide of paragraph [0048], comprising a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, provided that the sequence of the hydrido acid defined at positions 47-752 of said polypeptide has a hydrido sequence of at least 95% identity, with the proviso that the amino acid sequence of said polypeptide corresponds to SEQ ID NO: the positions 104 and 106 of 2 are not the same as N-X-S or N-X-T.

A purified or isolated ligand binding polypeptide according to any of paragraphs [0048] to [0051], which retains a sequence corresponding to SEQ ID NO: 2, position 33-35 of SEQ ID NO: 2, position 166-168 of SEQ ID NO: 2 and position 251 of SEQ ID NO: 2, four N-glycosylation sequence subsites at position 299-301.

The purified or isolated ligand binding polypeptide of paragraph [0052], which is glycosylated at the four N-glycosylation sequence subsites.

A purified or isolated ligand-binding polypeptide according to any of paragraphs [0048] to [0053], which is a soluble polypeptide.

A purified or isolated ligand binding polypeptide according to any of paragraphs [0048] to [0054], comprising a heavy chain variable region sequence encoded by SEQ ID NO: 2, position 47-115 of SEQ ID NO: 2, position 47-210 of SEQ ID NO: 2 or position 47-314 of SEQ ID NO: 2, provided that the polypeptide has an amino acid sequence which is identical to the sequence of the amino acid defined in positions 47-752 of SEQ ID NO: the positions 104 and 106 of 2 are not the same as N-X-S or N-X-T.

A purified or isolated ligand binding polypeptide according to any of paragraphs [0048] to [0055], which binds to human VEGF-C or human VEGF-D.

The purified or isolated ligand binding polypeptide of paragraph [0056], which inhibits binding of VEGF-C or VEGF-D to VEGFR-3 or inhibits stimulation of VEGFR-3 mediated by VEGF-C or VEGF-D in cells expressing VEGFR-3 on their surface.

A purified or isolated ligand binding polypeptide according to any of paragraphs [0048] to [0057], which binds human VEGF-C with a Kd of 1nM or less.

A purified or isolated ligand binding polypeptide according to any of paragraphs [0048] to [0057], which binds human VEGF-D with a Kd of 5nM or less.

The purified or isolated ligand binding polypeptide of any of paragraphs [0048] to [0059], wherein the polypeptide has an amino acid sequence corresponding to SEQ ID NO: 2 is deleted or replaced with another amino acid.

The purified or isolated ligand binding polypeptide of paragraph [0055], wherein the amino acid sequence set forth in SEQ ID NO: 2 is deleted or replaced with another amino acid selected from the group consisting of glutamine, aspartic acid, glutamic acid, arginine, and lysine.

The purified or isolated ligand polypeptide of any of paragraphs [0048] to [0056], wherein the polypeptide comprises the amino acid sequence of SEQ ID NO: 3, amino acids 23-290.

A purified or isolated ligand binding polypeptide according to any of paragraphs [0048] to [0062], further comprising a signal peptide.

A purified or isolated ligand binding polypeptide according to any of paragraphs [0048] to [0063], further comprising at least one polyethylene glycol moiety attached to the polypeptide.

The purified or isolated ligand binding polypeptide of paragraph [0064], comprising polyethylene glycol of about 20-40kDa attached to the amino terminus of the polypeptide.

A ligand binding molecule comprising a ligand binding polypeptide according to any of paragraphs [0048] to [0065] linked to a heterologous peptide.

The ligand binding molecule of paragraph [0066], wherein the heterologous peptide comprises an immunoglobulin constant domain fragment.

A ligand binding molecule according to paragraph [0066], wherein the immunoglobulin constant domain fragment is an IgG constant domain fragment.

The ligand binding molecule of paragraph [0067], wherein the immunoglobulin constant fragment comprises the amino acid sequence of SEQ ID NO: amino acid 306- "537" of 3.

The ligand binding molecule of paragraph 19 wherein the ligand binding molecule comprises SEQ ID NO: 3, amino acids 22-537.

The ligand-binding molecule of any of paragraphs [0066] to [0070], optionally comprising a linker linking the heterologous peptide to the ligand-binding polypeptide.

The ligand binding molecule of any of paragraphs [0066] to [0070], comprising a polypeptide wherein the C-terminal amino acid of the ligand binding polypeptide is directly attached to the N-terminal amino acid of the heterologous peptide by a peptide bond.

A ligand binding molecule according to any one of paragraphs [0066] to [0072], further comprising a signal peptide that directs secretion of the molecule from a cell in which the molecule is expressed.

A ligand binding molecule according to paragraph [0066], wherein the molecule comprises the amino acid sequence set forth in SEQ ID NO: 3, or a pharmaceutically acceptable salt thereof.

The ligand binding molecule according to any one of paragraphs [0066] to [0070], wherein the ligand binding polypeptide and the heterologous peptide are linked by an amide bond to form a single polypeptide chain.

A ligand-binding polypeptide according to any of paragraphs [0048] to [0065] or a ligand-binding molecule according to any of paragraphs 19 to 28, further comprising a detectable label.

A conjugate comprising a ligand-binding polypeptide according to any one of paragraphs 1 to 18 or a ligand-binding molecule according to any one of paragraphs [0066] to [0075] and a chemotherapeutic agent.

An isolated polynucleotide comprising an encoding nucleotide sequence encoding a ligand binding polypeptide according to any of paragraphs 1 to 18 or a ligand binding molecule according to any of paragraphs [0066] to [0075 ].

The polynucleotide of paragraph [0078], further comprising a promoter sequence operably linked to the encoding nucleotide sequence to facilitate transcription of the encoding nucleotide sequence in a host cell.

A vector comprising the polynucleotide of paragraph [0078] or paragraph [0079 ].

The vector of paragraph [0080], further comprising an expression control sequence operably linked to the encoding nucleotide sequence.

The vector of paragraph [0080], wherein the vector is selected from the group consisting of a lentiviral vector, an adeno-associated viral vector, an adenoviral vector, a liposomal vector, and combinations thereof.

The vector of paragraph [0080], wherein the vector comprises a replication-defective adenovirus comprising a polynucleotide operably linked to a promoter and flanked by adenovirus polynucleotide sequences.

An isolated cell or cell line transformed or transfected with a polynucleotide according to paragraphs [0078] or [0079] or a vector according to paragraphs [0080] to [0083 ].

The isolated cell or cell line of paragraph [0084], which is a eukaryotic cell.

The isolated cell or cell line of paragraph [0084], which is a human cell.

The isolated cell or cell line of paragraph [0084], which is a Chinese Hamster Ovary (CHO) cell.

A method of making a ligand-binding polypeptide comprising growing a cell according to any one of paragraphs [0084] to [0087] under conditions in which the ligand-binding polypeptide or ligand-binding molecule encoded by the polynucleotide is expressed.

The method of paragraph [0088], further comprising purifying or isolating the ligand binding polypeptide or ligand binding molecule from the cell or the growth medium of the cell.

A composition comprising a purified ligand-binding polypeptide or ligand-binding molecule according to any of paragraphs [0048] to [0076] and a pharmaceutically acceptable diluent, adjuvant, excipient or carrier.

A composition comprising a polynucleotide or vector according to any one of paragraphs [0078] to [0083] and a pharmaceutically acceptable diluent, adjuvant, excipient or carrier.

The composition of paragraph [0090] or paragraph [0091], which is formulated for topical administration.

The composition of paragraph [0092], which is in the form of a solid, paste, ointment, gel, liquid, aerosol, spray, polymer, film, emulsion or suspension.

The composition of paragraph [0090] or paragraph [0091], which is formulated for intravitreal administration.

A method of inhibiting neovascularization in a subject, the method comprising administering to the subject a composition according to any of paragraphs [0090] to [0094] in an amount effective to inhibit neovascularization in the subject.

A method of inhibiting retinal neovascularization in a subject, comprising administering to the subject a composition according to any of paragraphs [0090] to [0094] in an amount effective to inhibit retinal neovascularization in the subject.

A method of treating a subject having an ocular disorder associated with retinal neovascularization, the method comprising administering to the subject a composition according to any of paragraphs [0090] to [0095] in an amount effective to inhibit retinal neovascularization in the subject.

Use of a composition according to any of paragraphs [0090] to [0094] for inhibiting neovascularization, such as retinal neovascularization or tumor neovascularization, in a subject in need thereof.

The method or use according to any of paragraphs [0096] to [0098], wherein the composition is administered topically to the eye of the subject.

The method or use of paragraph [0099], wherein the composition is administered by intravitreal injection.

The method or use of paragraph [0099], wherein the composition is administered by topical application.

The method or use of any of paragraphs [0096] to [00101], wherein the composition is administered in an amount effective to inhibit binding of VEGF-C and/or VEGF-D in the eye of the subject to or stimulate VEGFR-2 and/or VEGFR-3 expression in cells of the eye or blood vessels of the eye.

The method or use of paragraphs [0097] or [0098], wherein the ocular disorder is selected from the group consisting of macular degeneration, diabetic retinopathy and macular telangiectasia.

The method or use of any of paragraphs [0096] to [00103], further comprising administering an antibiotic to the subject.

The method of paragraph [00104], wherein the antibiotic is selected from the group consisting of: amikacin, gentamicin, kanamycin, neomycin, netilmicin, streptomycin, tobramycin, teicoplanin, vancomycin, azithromycin, clarithromycin, dirithromycin, erythromycin, roxithromycin, oleandomycin, amoxicillin, ampicillin, azlocillin, carbenicillin, cloxacillin, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, penicillin, piperacillin, ticarcillin, bacitracin, colistin, polymyxin B, ciprofloxacin, enoxacin, gatifloxacin, levofloxacin, lomefloxacin, moxifloxacin, norfloxacin, ofloxacin, trovafloxacin, mafenide, sulfacetamide, sulfamethoxazole, sulfasalazine, sulfisoxazole, trimethoprim, sulfamethoxazole, demeclocycline, doxycycline, minocycline, and doxycycline, Oxytetracycline, and tetracycline.

The method or use of paragraphs [0095] or [0098], wherein the subject has been diagnosed with a tumor, and wherein the composition is administered in an amount effective to inhibit neovascularization in the tumor.

The method or use of paragraph [00106], wherein the composition is administered locally to the tumor or to an organ or tissue from which a tumor has been surgically excised.

The method or use of paragraph [00106], wherein the composition is administered in an amount effective to inhibit VEGF-C and/or VEGF-D in the tumor of the subject from binding to or stimulating VEGFR-2 and/or VEGFR-3 expression in the tumor cells.

The summary of the invention is not intended to be limiting or comprehensive and other embodiments are described in the drawings and detailed description, including examples. All such embodiments are aspects of the present invention. Moreover, various details applicable to multiple embodiments may not be repeated for each embodiment for the sake of brevity. Variations reflecting combinations and rearrangements of the embodiments described herein are intended as aspects of the invention. In addition to the foregoing, the present invention includes as other aspects all embodiments of the invention that are narrower in any way than the scope of the variations explicitly mentioned above. For example, for aspects described as genus or range, each subgenus, subrange, or species is specifically contemplated as an embodiment of the invention.

Brief Description of Drawings

FIG. 1A shows the PK profiles of VGX-300 and VGX-301- Δ N2 produced by transient CHO expression. FIG. 1B shows the PK profiles of VGX-300 and VGX-301- Δ N2 resulting from transient HEK expression.

FIG. 2 shows that both VGX-300 and VGX-301- Δ N2 specifically bind to both VEGF-C and VEGF-D.

FIG. 3 shows that VGX-300 blocks the binding and crosslinking of a) VEGFR-2 and b) VEGFR-3 to VEGF-C and VEGF-D.

FIG. 4 shows that VGX-300 and VGX-300-N2 block the binding and crosslinking of VEGFR-3 to a) VEGF-C and b) VEGF-D in a cell-based Ba/F3 assay. Data points represent mean. + -. SD for n.gtoreq.2.

Figure 5 shows the pharmacokinetics and ocular biodistribution of rabbits following intravitreal administration.

Detailed Description

The present invention is based, in part, on the demonstration that fragments of the ECD of human VEGFR-3, which have one or modifications in the N-glycan region of the ECD, are capable of binding to and neutralizing human VEGF-C and human VEGF-D in vitro, and are also capable of inhibiting vascular development in an animal model of age-related macular degeneration.

Growth factor receptor tyrosine kinases generally comprise three main domains: an extracellular domain (ECD), a transmembrane domain, and an intracellular domain. The ECD binds a ligand, the transmembrane domain anchors the receptor to the cell membrane, and the intracellular domain has one or more tyrosine kinase enzymatic domains and interacts with downstream signaling molecules. Vascular Endothelial Growth Factor Receptor (VEGFR) binds its ligand via its ECD, which is composed of multiple immunoglobulin-like domains (Ig-like domains). The Ig like domains are identified by the name "D #". For example, "D1" refers to the first Ig-like domain of the ECD of a particular receptor. "D1-3" refers to a construct containing at least the first three Ig-like domains, and intervening sequences between domains 1 and 2 and 3 of a particular ligand binding molecule.

The intact ECD of VEGFR is not required for binding to a ligand (growth factor). The ECD of VEGFR-3 has six intact Ig-like domains and one cleaved Ig-like domain- -D5 of VEGFR-3 is cleaved post-translationally into disulfide-linked subunits that leave VEGFR-3. Veikkola, t. et al, Cancer res.60: 203-212(2000). In some embodiments, a receptor fragment containing at least the first three Ig-like domains of this family is sufficient to bind a ligand. Soluble receptors capable of binding to VEGF-C and VEGF-D, thereby inhibiting VEGF-C or VEGF-D activity or signaling via VEGFR-3, are also disclosed in WO2000/023565, WO2000/021560, WO2002/060950 and WO2005/087808, the disclosures of which are incorporated herein by reference in their entirety. Those soluble receptors modified by a change in the Δ N2 sequence motif and optionally other modifications described herein are contemplated as aspects of the invention.

Table 1 defines the approximate boundaries of the Ig-like domains of human VEGFR-3. These boundaries are important because these selected boundaries can be used to form ligand binding molecules and thus can affect the binding properties of the final construct.

Table 1: immunoglobulin-like domains of human VEGFR-3

The intact ECD extends to SEQ ID NO: 2 at approximately position 775.

Soluble receptor constructs useful as ligand binding molecules for VEGF-C or VEGF-D preferably comprise at least one Ig-like domain of VEGFR-3, as described in Table 1, up to seven. The ligand binding molecule will optionally comprise sequences preceding the Ig-like domain positioned closest to the N-terminus, will optionally comprise sequences on the other side of the Ig-like domain closest to the C-terminus, and will optionally further comprise sequences between Ig-like domains. Also contemplated are variants having, for example, one or more amino acid substitutions, additions or deletions of an amino acid residue. In some embodiments, the ligand binding molecule comprises a fragment of human VEGFR-3 that contains at least the first three Ig-like domains of human VEGFR-3.

In some embodiments, the ligand binding molecule is a polypeptide comprising a portion of a human VEGFR-3 ECD, wherein the portion binds to one or both of human VEGF-C and human VEGF-D and comprises at least a first, second, and third Ig-like domain of VEGFR-3 ECD, wherein the amino acid sequence of the ECD fragment of VEGFR-3 is modified by wild-type VEGFR-3 to eliminate a second putative N-linked glycosylation sequence seed of wild-type VEGFR-3, and wherein the polypeptide lacks VEGFR-3 Ig-like domains 4-7 and preferably any transmembrane domain and preferably any intracellular domain.

In some embodiments, the ligand binding molecule comprises a polypeptide having an amino acid sequence similar to or identical to a human VEGFR-3 polypeptide (SEQ ID NO: 2) or fragment thereof, provided that the ligand binding molecule corresponds to SEQ ID NO: 2 at position 104-106 different from N-X-S or N-X-T, wherein the ligand binding molecule binds one or more growth factors selected from the group consisting of human VEGF-C and human VEGF-D. The fragment minimally contains the VEGFR-3 sequence sufficient to bind the ligand, and may contain the entire receptor. ECD fragments are preferred. Preferably the polypeptide has an amino acid sequence at least 80% identical to its ligand binding fragment. Fragments with higher similarity (e.g., 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%) are highly preferred. Fragments with degrees of similarity of 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% and 75% are also contemplated. Alternatively, a similar class of polypeptides may be defined by the ability to encode a polypeptide that hybridizes to the complement of a nucleotide sequence corresponding to a cDNA sequence encoding a VEGFR-3 receptor.

The term "identity" as known in the art refers to the relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by comparing the sequences. In the art, "identity" also refers to the degree of sequence relatedness, which as the case may be, a nucleic acid molecule or polypeptide sequence, as determined by the match between two or more nucleotides or two or more stretches of amino acid sequences. "identity" is a measure of the percentage of identical matches between the smaller of two or more sequences and gap alignments (if any) that are processed through a particular mathematical model (i.e., an "algorithm") of a computer program. Algorithms suitable for determining percent identity in the present invention include BLASTP and BLASTN, using the most common and accepted default parameters.

The ligand binding molecules can also be described as having a sequence encoded by SEQ ID NO: 1, provided that the ligand binding molecule corresponds to a position 104-106 of VEGFR-3 encoding the ligand binding fragment other than N-X-S or N-X-T. Nucleic acid fragments with higher degrees of similarity (e.g., 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%) are highly preferred. Fragments with degrees of similarity of 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% and 75% are also contemplated. For example, preferred ligand binding molecules comprise a peptide that binds human VEGF-C and/or human VEGF-D and is encoded by a sequence that hybridizes under the mild or high stringency conditions described herein to SEQ ID NO: 1, and a nucleotide sequence that hybridizes to the complement of 1.

In some embodiments, the ligand binding molecule comprises a polypeptide comprising a fragment of human VEGFR-3(SEQ ID NO: 2) selected from the group consisting of: SEQ ID NO: 2, position 1-226 or 25-226 of SEQ ID NO: 2 and positions 1-229 or 25-229 of SEQ ID NO: 2, provided that positions 104-106 of the ligand binding fragment encoding VEGFR-3 are different from N-X-S or N-X-T. In some embodiments, the ligand binding molecule is a polypeptide comprising a fragment of human VEGFR-3(SEQ ID NO: 2) selected from the group consisting of: SEQ ID NO: 2, position 47-224 of SEQ ID NO: 2, position 47-225 of SEQ ID NO: 2, position 47-226 of SEQ ID NO: 2, positions 47-227 of SEQ ID NO: 2, position 47-228 of SEQ ID NO: 2, position 47-229 of SEQ ID NO: 2, position 47-230 of SEQ ID NO: 2, position 47-231 of SEQ ID NO: 2, position 47-232 of SEQ ID NO: 2, position 47-236 of SEQ ID NO: 2 and position 47-240 of SEQ ID NO: 2, provided that position 104-106 of the ligand binding fragment encoding VEGFR-3 is different from N-X-S or N-X-T. In some embodiments, the ligand binding molecule is a polypeptide comprising a fragment of human VEGFR-3(SEQ ID NO: 2) selected from the group consisting of: SEQ ID NO: 2, position 47-314 of SEQ ID NO: 2 and positions 47-210 of SEQ ID NO: 2, provided that position 104-106 of the ligand binding fragment encoding VEGFR-3 is different from N-X-S or N-X-T.

Ligand binding molecules can also be described as having a sequence that is identical to SEQ ID NO: 3, or an amino acid sequence similar or identical to the amino acid sequence listed in seq id no. Preferred polypeptides have at least 80% identity to SEQ ID NO: 3, provided that the amino acid sequence set forth in SEQ ID NO: 3 from position 80-82 of the listed polypeptides differ from N-X-S or N-X-T wherein the ligand binding molecule binds to one or more growth factors selected from the group consisting of human VEGF-C and human VEGF-D. Polypeptides with higher degrees of similarity (e.g., 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) are highly preferred. Fragments with degrees of similarity of 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% and 75% are also contemplated. Alternatively, a similar class of polypeptides may be defined by the ability to encode a polypeptide that hybridizes to the complement of a nucleotide sequence corresponding to a cDNA sequence encoding a VEGFR-3 receptor.

In some embodiments, the ligand binding molecule comprises a polypeptide comprising SEQ ID NO: 3 amino acid sequence of amino acids 22-290. In some embodiments, the ligand binding molecule comprises a polypeptide comprising SEQ ID NO: 3, amino acid sequence of amino acids 23-290. In some embodiments, the ligand binding molecule comprises SEQ ID NO: 3, or amino acids 22-537 of SEQ ID NO: 3 or amino acids 23-537 of SEQ ID NO: 3, amino acids 1-537.

The term "component domain" as used herein refers to a domain within a ligand binding molecule that is derived from or based on a protein domain within the extracellular portion of a receptor protein. For example, the individual Ig-domains of VEGFR-3(D1-D7) and other tyrosine kinase receptor family members (e.g., such as VEGFR-1 and VEGFR-2) constitute the component domains. Reference herein to component domains includes the entirely native wild-type domain and insertion, deletion and/or substitution variants thereof which substantially retain the functional properties of the entire domain. It will be apparent to those skilled in the art that many variants of the above-described domains (e.g., Ig-domains) can be obtained that will retain the same functional properties as the wild-type domain.

Growth factor receptors from which ligand binding molecules may be derived include splice variants and natural allelic variants. Allelic variants are well known in the art and represent alternative forms or nucleic acid sequences comprising substitutions, deletions or additions of one or more nucleotides, which do not result in any substantial functional alteration of the encoded polypeptide. Exemplary allelic variants of VEGFR-3 have been reported in the literature (e.g., http < colon >// www.uniprot.org/uniport/P35916) and include positions 149, 378, 494, 527, and 641 within the ECD. Such polypeptides comprising site-directed mutagenesis, or specific enzymatic cleavage and ligation of polynucleotides can be readily generated using standard methods. Similarly, the use of peptidomimetic compounds or compounds in which one or more amino acid residues are replaced with a non-natural amino acid or amino acid analog that retain binding activity is contemplated. Preferably, when amino acid substitutions are used, the substitutions are conservative, i.e., the amino acid is replaced with an amino acid of similar size and having similar charge properties. As used herein, the term "conservative substitution" refers to the replacement of an amino acid residue with another, biologically similar residue. Examples of conservative substitutions include the substitution of one hydrophobic residue, such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine, or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, and the like. Neutral hydrophilic amino acids that may be substituted for each other include asparagine, glutamine, serine, and threonine. The term "conservative substitution" also includes the replacement of an unsubstituted amino acid with a substituted amino acid.

Alternatively, conserved amino acids can be classified as described in Lehninger, (Biochemistry, second edition; Worth Publishers, Inc. NY: NY, pages 71-77 (1975)), as follows:

nonpolar (hydrophobic)

A. Aliphatic: a, L, I, V, P,

B. aromatic: the ratio of F to W,

C. sulfur-containing: m is the sum of the total number of the M,

D. boundary: G.

uncharged-polarity

A. Hydroxyl group: the ratio of S, T, Y,

B. amide: the contents of N, Q,

C. mercapto group: c, performing a chemical reaction on the mixture to obtain a reaction product,

D. boundary: G.

positively charged (basic): K. r, H are provided.

Negative charge (acidic): D. and E.

For the avoidance of doubt, a "component domain" includes the domain corresponding to D1 of VEGFR-3, wherein SEQ ID No: the N-X-S/T sequence sub-motif at position 104-106 of 2 has been mutated, for example, by substitution.

In embodiments where the ligand binding molecule comprises multiple component domains (e.g., component domains D1, D2, and D3 of VEGFR-3), the component domains may be directly linked to each other, or may be linked via one or more spacers. In general, the term "spacer" means one or more molecules, e.g., nucleic acids or amino acids, or a non-peptide moiety, such as polyethylene glycol or a disulfide bridge, which can be inserted between one or more component domains to form a covalent bond. Spacer sequences can be used to provide desired sites of interest between modules to simplify handling. Spacers may also be provided to enhance expression of the ligand binding polypeptide by the host cell, thereby reducing steric hindrance, so that the module or group of modules can achieve its optimal tertiary structure and/or properly interact with its target molecule. For spacers and methods of determining the desired spacer see, for example, George et al (2003) Protein Engineering 15: 871-. The spacer sequence may comprise one or more amino acids naturally linked to the receptor component, or may be an added sequence used to enhance ligand binding polypeptide expression, deliberately provide a desired site of interest, allow the constituent domains to form an optimal tertiary structure and/or enhance the interaction of the component or group of components with its target molecule. In one embodiment, the spacer comprises one or more peptide sequences between one or more modules, which are between 1 and 100 amino acids in length, preferably between 1 and 50 amino acids in length. In a preferred embodiment, the spacer between the two constitutive domains consists essentially of the amino acids naturally linked to the receptor component in the wild-type receptor. If the ligand binding molecule comprises multiple component domains from the same receptor, which domains are adjacent to each other in the native receptor, such as, for example, D1, D2, and D3 of VEGFR-3, in one embodiment, the domains are linked to each other with a spacer that corresponds to the native amino acid linking sequence (e.g., D1 is linked to D2 and D2 is linked to D3).

In some variations, each ligand-binding polypeptide is expressed as a fusion, and a fusion partner protein, such as an immunoglobulin constant region, is linked to a heterologous fusion partner to form a ligand-binding molecule.

Multimers, multimeric assemblies, fusion partners and linkers

The fusion partner is any heterologous component that enhances the function of the ligand-binding molecule. Thus, for example, the fusion partner can increase the solubility of the ligand-binding polypeptide, modulate clearance, facilitate targeting to a particular cell or tissue type, enhance biological activity, aid in production and/or recovery, enhance pharmacological properties, or improve Pharmacokinetic (PK) profiles. In terms of improving the PK profile, this can be achieved, for example, by increasing serum half-life, tissue penetration, lack of immunogenicity, or stability of the ligand binding molecule. In a preferred embodiment, the fusion partner is selected from the group consisting of a multimerizing component, a serum protein or a molecule capable of binding to a serum protein.

When the fusion partner is a serum protein or a fragment thereof, it is selected from the group consisting of: alpha-1-microglobulin, AGP-1, orosomucoid, alpha-1-acid glycoprotein, vitamin D Binding Protein (DBP), hemopexin, human serum albumin (hSA), transferrin, ferritin, alphaalbumin, haptoglobin, alpha-fetoprotein thyroglobulin, alpha-2-HS-glycoprotein, beta-2-glycoprotein, hyaluronic acid-binding protein, syntaxin, C1R, C1q a chain, galectin 3-Mac2 binding protein, fibrinogen, poly Ig receptor (PIGR), alpha-2-macroglobulin, urea transporter, haptoglobin, IGFBP, macrophage ablating receptor, fibronectin, megalin, Fc, alpha-1-antichymotrypsin, alpha-1-antitrypsin, Antithrombin III, apolipoprotein A-1, apolipoprotein B, beta-2-microglobulin, ceruloplasmin, complement component C3 or C4, a CI esterase inhibitor, C-reactive protein, cystatin C and protein C. In a more specific embodiment, the fusion partner is selected from the group consisting of: alpha-1-microglobulin, AGP-1, serum mucoid, alpha-1-acid glycoprotein, vitamin D Binding Protein (DBP), blood binding protein, human serum albumin (hSA), alpha-albumin and haptoglobin. Inclusion of a fusion partner module can extend the serum half-life of the fusion polypeptide of the invention, when desired. See, e.g., U.S. Pat. nos. 6,423,512, 5,876,969, 6,593,295, and 6,548,653, which are expressly incorporated herein by reference in their entirety for examples of serum albumin fusion polypeptides. hSA is widely distributed throughout the body, particularly in the intestinal and blood components, and plays an important role in maintaining osmolarity and plasma volume. It is slowly cleared in the liver and typically has an in vivo half-life of 14-20 days in humans (Waldmann et al (1977) Albumin, Structure Function and Uses; Pergamon Press; pp. 255-275).

When the fusion partner is a molecule capable of binding to a serum protein, the molecule may be a synthetic small molecule, a lipid or liposome, a nucleic acid, including synthetic nucleic acids such as aptamers (aptamers), peptides or oligosaccharides. The molecules may additionally be proteins such as, for example, Fc γ R1, Fc γ R2, Fc γ R3, polymeric Ig receptors (PIGR), ScFv and other antibody fragments specific for serum proteins.

When the fusion partner is a multimeric component, it is a natural or synthetic sequence capable of operably linking the first ligand-binding molecule to another ligand-binding molecule or another multimeric component of another ligand-binding molecule to form a higher order structure (e.g., a dimer, trimer, etc.). Suitable multimeric components may include leucine zippers, including leucine zipper domains derived from c-jun or c-fos; sequences derived from the constant region of a kappa or lambda light chain; sequences are synthesized such as helix-loop-helix motifs (Muller et al (1998) FEBS Lett.432: 45-49), coil-coil motifs, and the like, or other widely accepted multimerizing domains known in the art. In some embodiments, the fusion module comprises an immunoglobulin-derived domain from, for example, human IgG, IgM, or IgA.

In one aspect, the ligand binding molecules described herein are produced as multimers. Each subunit of the multimer comprises or consists of a ligand-binding molecule, such as a ligand-binding polypeptide. These multimers may be homodimers, heterodimers, or soluble multimeric receptors, wherein the multimeric receptor consists of 9 or fewer subunits, preferably 6 or fewer subunits, even more preferably 3 or fewer subunits, and most preferably 2 subunits. Preferably, these soluble multimeric receptors are homodimers of ligand binding molecules.

At least two subunits in the multimer are operably linked to each other. The term "operably linked" indicates that the subunits are associated by covalent and/or non-covalent bonds. These subunits may be covalently linked by any suitable means, such as via a crosslinking agent or linker, such as a polypeptide or peptide linker. In another embodiment, the subunits are linked via a non-covalent linkage. In some variations, two subunits (e.g., two ligand-binding polypeptides) are attached directly by a peptide bond or via a "peptide linker". The length of the peptide linker introduced between the subunits may be as short as 1 to 3 amino acid residues (preferably consisting of small amino acids such as leucine, serine, threonine or alanine) or longer, for example 13, 15 or 16 amino acid residues in length. Preferably, the peptide linker is an immunologically inert peptide. The linker may be a tripeptide of the sequence E-F-M (Glu-Phe-Met), for example a 13-amino acid linker sequence consisting of Glu-Phe-Gly-Ala-Gly-Leu-Val-Leu-Gly-Gly-Gln-Phe-Met (SEQ ID NO: 7), a 15-amino acid linker sequence consisting of (G4S)3 (SEQ ID NO: 8), a 16-amino acid linker sequence consisting of GGSGG SGGGG SGGGG S (SEQ ID NO: 9) or a hinge region of human IgG (e.g., IgG1, IgG2, IgG3 or IgG 4). In some variations, the two subunits are ligand-binding polypeptides comprising two different polypeptide chains interconnected, for example, by disulfide bonds or other bonds.

In some embodiments, the ligand-binding molecule is in the form of a fusion protein comprising at least two subunits, each comprising a ligand-binding polypeptide. In this way, a fusion protein can be produced recombinantly by direct expression in a host cell of a nucleic acid molecule encoding the fusion protein as a single open reading frame.

In some variations, the ligand-binding polypeptide is expressed as a fusion and a heterologous protein fusion partner, such as an immunoglobulin constant region, is linked to a heterologous fusion partner to form a multimeric ligand-binding molecule. In one embodiment, the subunit is operably linked to a multimerizing component. Multimeric components include any natural or synthetic sequence capable of operably linking two or more subunits to form a higher order structure (e.g., a dimer, trimer, etc.). A multimeric assembly may be operably linked to or more subunits by "direct" interaction with the subunits. Alternatively, the multimeric component of one subunit may interact with another multimeric component of another subunit to operably link the subunits.

In one embodiment, the subunit is operably linked to other amino acid domains that provide multimerization of the subunit (in particular, the other domains include any functional region that provides dimerization of the subunit). The term "operably linked" indicates that the VEGFR-3 based subunits and other amino acid domains associate either directly by peptide bonds or via a "peptide linker" (as defined herein), and that the VEGFR-3 based subunits retain ligand binding properties. Other amino acid domains may be located upstream (N-terminal) or downstream (C-terminal) of the VEGFR-3 subunit sequence. Preferably, it is located downstream (i.e., away from the first immunoglobulin-like domain (Ig-I domain)). In this way, the fusion protein can be produced recombinantly by directly expressing the nucleic acid molecule encoding the fusion protein in a host cell. In such embodiments, the ligand binding molecules described herein are multimers of fusion proteins comprising a ligand binding polypeptide and a multimer module capable of interacting with a multimer module present in another fusion protein to form a higher order structure, such as a dimer. These types of fusion proteins can be prepared as follows: by operably linking the VEGFR-3 subunit sequences (i.e., ligand binding polypeptides) to domains isolated from other proteins that allow formation of dimers, trimers, etc. Examples of protein sequences that allow multimerization of the ligand polypeptides described herein include, but are not limited to, domains isolated from proteins such as immunoglobulins, hCG (WO 97/30161), collagen X (WO 04/33486), C4BP (WO 04/20639), Erb protein (WO 98/02540), or coiled coil peptide (WO 01/00814), the disclosures of which are incorporated herein by reference in their entirety.

The multimerization component can be, for example, selected from the group consisting of (i) an amino acid sequence between 1 to about 500 amino acids in length, (ii) a leucine zipper, (iii) a helical loop motif, and (iv) a coil-coil motif. When the multimerization module comprises an amino acid sequence of 1 to about 500 amino acids in length, the sequence may comprise one or more cysteine residues capable of forming a disulfide bond with a corresponding cysteine residue on another fusion polypeptide comprising a multimerization module having one or more cysteine residues.

In a particular aspect, the multimer is a dimer of a ligand-binding polypeptide, wherein the polypeptide is operably linked to an immunoglobulin or a portion of an immunoglobulin as a fusion partner, which can also serve as a multimerization component. The term "operably linked" indicates that the ligand-binding polypeptide and the immunoglobulin or a portion thereof are associated either directly by a peptide bond or via a "peptide linker" (as defined herein) and that the ligand-binding polypeptide retains ligand-binding properties. In this embodiment, the ligand binding polypeptide is operably linked to the entire immunoglobulin or a portion thereof, particularly a human immunoglobulin, even more particularly the Fc portion of a human immunoglobulin. Typically, the Fc portion of a human immunoglobulin comprises two constant region domains (CH2 and CH3 domains) and a hinge region, but lacks a variable region. (see, e.g., U.S. Pat. Nos. 6,018,026 and 5,750,375, which are incorporated herein by reference.) the immunoglobulin may be selected from any of the major classes of immunoglobulins (including IgA, IgD, IgE, IgG, and IgM) and any of the subclasses or isotypes (e.g., IgG1, IgG2, IgG3, and IgG 4; IgA-I and IgA-2). In one embodiment, the Fc portion is of human IgG4, which is stable in solution and has little or no complement activation activity. In another embodiment, the Fc portion is of human IgG 1. The Fc portion may be mutated to prevent unwanted activities such as complement fixation, binding to Fc receptors, and the like. The amino acid sequence derived from the immunoglobulin may be linked to the C-terminus or N-terminus of the ligand binding polypeptide, preferably to the C-terminus. Such fusion proteins can be prepared by: with the encoding VEGFR-3 subunit: the DNA of the Fc fusion protein transfects the cells and expresses the dimer in the same cells. In a particular embodiment, the ligand binding polypeptides on each monomeric subunit are identical (i.e., the dimer is a homodimer). Methods for preparing Immunoglobulin Fusion Proteins are well known in the art, such as Hollenbaugh and Aruffo ("Construction of Immunoglobulin Fusion Proteins", Current Protocols in Immunology, Suppl.4, pages 10.19.1-10.19.11, 1992) or WO 01/03737, both of which are incorporated herein by reference.

Alternatively, a dimer of ligand-binding polypeptides of the invention may be prepared by operably linking one of the ligand-binding polypeptides to the constant region of an immunoglobulin heavy chain and another ligand-binding polypeptide to the constant region of an immunoglobulin light chain. For example, a ligand binding polypeptide may be operably linked to the CH 1-hinge-CH 2-CH3 region of human IgG1, or the same ligand binding polypeptide may be operably linked to the ck region of an Ig kappa light chain. In one embodiment, the constant heavy chain is human γ 4, which is stable in solution and has little or no complement activation activity. In another embodiment, the constant heavy chain is human γ l. The constant heavy chain may be mutated to prevent unwanted activities such as complement fixation, binding to Fc receptors, and the like.

Likewise, the fusion proteins described herein can include any functional region that facilitates purification and production, if desired. Specific examples of such other amino acid sequences include a GST sequence or a His tag sequence. In some variations, the areas that facilitate purification are removed to formulate a composition for pharmaceutical use.

The amino acid sequence derived from the immunoglobulin may be linked to the C-terminus or N-terminus of the ligand binding polypeptide, preferably to the C-terminus. Cells transfected with DNA encoding an immunoglobulin light chain fusion protein and an immunoglobulin heavy chain fusion protein express heavy/light chain heterodimers comprising the respective ligand binding polypeptides. When initially synthesized, both ligand binding polypeptides advantageously comprise a native or heterologous signal peptide to facilitate secretion from the cell, but the signal sequence is cleaved upon secretion. Variations of any of the foregoing embodiments including a signal peptide are contemplated. The native signal peptide of human VEGFR-3 comprises SEQ ID NO: 2, residues 1-24. Many other signal peptide proteins are taught in the literature.

In another particular aspect of the invention, the ligand binding polypeptides of the multimer are linked via a non-covalent bond. Non-covalent bonding of the subunits may be achieved by any suitable means that does not interfere with their biological activity (i.e., their ability to bind human VEGF-C and/or VEGF-D). In a particular aspect, the multimers are dimers of ligand-binding polypeptides, wherein one ligand-binding polypeptide is operably linked to a first compound and another or the same ligand-binding polypeptide is operably linked to a second compound that will non-covalently bond to the first compound. Examples of such compounds are biotin and avidin. Dimers of ligand-binding polypeptides may be prepared by operably linking one VEGFR-3 subunit to biotin and another ligand-binding polypeptide to avidin. Whereby the receptor is formed by the non-covalent interaction of biotin with avidin. Other examples include subunits of heterodimeric protein hormones. In these embodiments, a DNA construct encoding one ligand-binding protein is fused to a DNA construct encoding a subunit of a heterodimeric protein hormone (such as hCG), and a DNA construct encoding another ligand-binding polypeptide is fused to DNA encoding another subunit of a heterodimeric protein hormone (such as hCG) (as disclosed in US 6,193,972). These DNA constructs are co-expressed in the same cell, resulting in the expression of the ligand binding molecule, since each co-expression sequence comprises the corresponding hormone subunit to form a heterodimer upon expression. The amino acid sequence derived from the heterodimeric protein hormone may be linked to the C-terminus or N-terminus of the ligand-binding polypeptide, preferably to the C-terminus. When initially synthesized, both subunits advantageously comprise a native or heterologous signal peptide to facilitate secretion from the cell, but the signal sequence is cleaved upon secretion.

In some embodiments, the ligand binding molecule is operably linked to a binding unit that is not VEGFR-3 derived, i.e., does not contain a component domain derived from VEGFR-3. Such chimeric ligand binding molecules may, for example, comprise heterologous binding units based on other tyrosine kinase receptors. In one embodiment, such heterologous binding units bind to at least one ligand polypeptide selected from the group consisting of: VEGF-A (VEGF), VEGF-B, PlGF, PDGF-A, PDGF-B, PDGF-C and PDGF-D. In a preferred embodiment, such heterologous binding units bind to at least VEGF-a (VEGF).

In one embodiment, such heterologous binding units comprise a constitutive domain derived from VEGFR-1 or VEGFR-2 or both. Examples of heterologous binding units that may be used in combination with the ligand binding molecules in the form of chimeric ligand binding molecules of the invention include, for example, the VEGF-trap molecules described in WO 2000/75319, WO 2005/000895 and WO 2006/088650. Preferred heterologous binding units include Ig-domain 2 of VEGFR-1 (R1D2) and Ig-domain 3 of VEGFR-2 (R2D3), optionally fused to the Fc portion of an immunoglobulin. In one embodiment, a chimeric molecule is contemplated comprising a ligand binding polypeptide of the invention linked to an Fc portion of an immunoglobulin operably linked to a R1D2R2D3 binding unit fused to the Fc portion of the immunoglobulin. The two binding units are operably linked by a disulfide bond between the two Fc moieties.

Connector

While the Ig-like domains of human VEGFR-3 may be attached directly to each other (via peptide bonds, disulfide bonds, or other types of covalent bonds) or to Ig-like domains of other receptors, the ligand binding molecules described herein optionally additionally comprise a linker(s) that links two or more different binding units (e.g., a VEGFR-3 ECD fragment to another VEGFR-3 ECD fragment or even a copy of itself) together. Linkers may also link the binding unit to other substituents described herein. In one embodiment, the linker comprises a heterologous polypeptide. For example, in some embodiments, the linker comprises a peptide linking the binding units to form a single contiguous peptide that can be expressed as a single ligand binding molecule. The linker may be selected such that it does not readily induce an allergic reaction. Polysaccharides or other moieties may also be used to link the binding units to form ligand binding molecules.

More than one linker may be used per ligand binding molecule. The linkers may be selected to obtain optimal conformational (spatial) freedom between the various ligand binding units, to allow their interaction if necessary, for example to form dimers, or to allow their interaction with ligands. The linker may be linear such that consecutive binding units are connected in series, or the linker may serve as a scaffold to which various binding units are attached, e.g., a branched linker. Linkers can also have multiple branches, e.g., as described by Tam, j.immunol.methods 196: 17 (1996). The binding units may be attached to each other or to the linker scaffold via an N-terminal amino group, C-terminal carboxyl group, side chain, chemical modifying group, side chain or other means.

Linker peptides can be designed to have sequences that allow for desirable properties. For example, the use of glycyl residues allows for relatively large conformational freedom, whereas proline will tend to have the opposite effect. The peptide linker may be selected such that it has a specific secondary and tertiary structure, e.g., alpha helix, beta sheet, or beta barrel. The quaternary structure can also be used to create linkers that link two binding units together in a non-covalent manner. For example, fusing a protein domain to each binding unit with a hydrophobic face may allow two binding units to be linked together via an interaction between the hydrophobic interactions between the two molecules. In some embodiments, the linker may provide a polar interaction. For example, the leucine zipper domains of the proto-oncogene proteins Myc and Max, respectively, may be used. Luscher and Larsson, oncogene 18: 2955-2966(1999). In some embodiments, the linker allows for the formation of a salt bridge or disulfide bond. Linkers can include unnatural amino acids as well as natural amino acids that are not normally incorporated into a polypeptide. In some embodiments, the linker comprises a coordination complex formed between a metal or other ion and different residues of the plurality of peptides bound thereby.

Consider a linear peptide linker of at least one amino acid residue. In some embodiments, the linker has more than 10,000 residues. In some embodiments, the linker has 1-10,000 residues, 1-1000 residues, 1-100 residues, 1-50 residues, or 1-10 residues. In some embodiments, the linear peptide linker comprises a residue having a relatively inert side chain. The peptide linker amino acid residues need not be linked completely via the alpha-carboxy and alpha-hydro groups or via the alpha-carboxy and alpha-hydro groups at all. That is, the peptides may be linked via side chain groups of various residues.

A linker may influence whether the polypeptides to which it is fused are capable of dimerizing or dimerizing with each other to form another polypeptide. The linker serves multiple functions. Native receptor monomers, which are constrained by the roughly two-dimensional plane of the cell membrane, share relatively high local concentrations and the availability of co-receptors (binding units), thereby increasing the likelihood of finding a partner. Increasing the effective concentration of the monomer of the linker may help with free receptor in solutions lacking such advantages.

In some embodiments, the ligand binding molecule may comprise more than one linker. Suitable linkers may also comprise the chemical modifications described above.

The ligand binding molecules described herein may comprise other N-terminal amino acid residues, preferably methionine. Indeed, depending on the expression system and conditions, the polypeptide may be expressed in a recombinant host cell with an initial methionine. This other amino acid can then be retained in the final recombinant protein or removed by means of an exopeptidase such as methionine aminopeptidase according to Methods disclosed in the literature (Van Valkenburgh HA and Kahn RA, Methods Enzymol. (2002) 344: 186-93; Ben-Bassat A, Bioprocess Technol. (1991) 12: 147-59).

Substituents and other chemical modifications

The ligand binding molecules described herein are optionally chemically modified with various substituents. Such modifications preferably do not substantially reduce the growth factor binding affinity or the specificity of the ligand binding molecule. Rather, the chemical modification imparts other desirable characteristics as described herein. Chemical modifications can take many different forms, such as heterologous peptides, polysaccharides, lipids, radioisotopes, non-standard amino acid residues and nucleic acids, metal chelators, and various toxins.

The receptor fragments (or "binding units" or "component domains") and ligand binding molecules described herein are optionally fused to heterologous fusion partners such as heterologous polypeptides to confer various properties, e.g., increased solubility, modulated clearance, targeting to specific cell or tissue types. In some embodiments, the receptor fragment is linked to the Fc domain of an IgG or other immunoglobulin. In some embodiments, the receptor fragment is fused to Alkaline Phosphatase (AP). Methods for making Fc or AP fusion constructs are found in WO 02/060950. These properties can be imparted to a ligand-binding molecule (e.g., a molecule engineered to have a particular tissue distribution or a particular biological half-life) by fusing the ligand-binding polypeptide or molecule to a protein domain having particular properties (e.g., half-life, bioavailability, interaction partner). In some embodiments, the ligand binding molecule comprises a co-receptor and a VEGFR fragment.

The particular fusion partner (e.g., heterologous polypeptide) used in a particular ligand binding molecule can affect whether the VEGR-3 fragment will dimerize, which in turn can affect ligand binding.

For substituents, such as the Fc region of human IgG, the fusion can be fused directly to the ligand binding molecule or through an intervening sequence. For example, human IgG hinges, CH2, and CH3 may be fused at the N-or C-terminus of the ligand binding molecule to attach the Fc region. The resulting Fc-fusion construct can be purified by protein a affinity column (Pierce, Rockford, il.). Peptides and proteins fused to the Fc region may exhibit in vivo half-lives that are substantially greater than the unfused counterpart. Fusion to the Fc region allows the fusion polypeptide to dimerize/multimerize. The Fc region may be a native Fc region, or may be modified to provide advantageous properties, e.g., therapeutic quality, circulation time, reduced aggregation.

For example, polypeptides may be modified by glycosylation, amidation, carboxylation or phosphorylation, or by the production of acid addition salts, amides, esters (particularly C-terminal esters) and N-acyl derivatives. The Ig-like domains I-III of VEGFR-3 contain 5 putative N-glycosylation sites (referred to herein as the N1, N2, N3, N4, and N5 sequence subsections or regions, respectively, of VEGFR-3). N1 corresponds to SEQ ID NO: 2 amino acids 33-35; n2 corresponds to SEQ ID NO: amino acids 104-106 of 2; n3 corresponds to SEQ ID NO: 2 hydric acid 166-168; n4 corresponds to SEQ ID NO: 2, and N5 corresponds to SEQ ID NO: 2, 299-301. In some embodiments, the ligand binding molecules described herein comprise a modification of the N2 region of the molecule. For example, in some embodiments, the ligand binding molecule has a sequence corresponding to SEQ ID NO: 2 is deleted and replaced with another amino acid. Conservative substitutions are preferred. In some embodiments, the nucleic acid sequence corresponding to SEQ ID NO: 2 is deleted and replaced with an amino acid selected from the group consisting of glutamine, aspartic acid, glutamic acid, arginine, and lysine. In other variations, position 106 is substituted to eliminate the N2 sequence. Wherein SEQ ID NO: 2 is modified as described above, the amino acid sequence of SEQ ID NO: 2, N1, N3, N4 and N5 sequences are preferably unmodified.

Proteins may also be modified by forming covalent or non-covalent complexes with other moieties to produce peptide derivatives. Covalently bound complexes can be prepared by attaching chemical moieties to functional groups on the side chains of amino acids of polypeptides or to the N-or C-terminus.

The polypeptide may be conjugated to a reporter group including, but not limited to, a radiolabel, a fluorescent label, an enzyme (e.g., that catalyzes a calorimetric or fluorescent reaction), a substrate, a solid matrix, or a carrier (e.g., biotin or avidin). Examples of analogues are described in WO 98/28621 and Olofsson et al, proc.nat' l.acad.sci.usa, 95: 11709, 11714(1998), U.S. Pat. Nos. 5,512,545 and 5,474,982; U.S. patent application nos. 20020164687 and 20020164710.

The cysteinyl residue is most commonly reacted with a haloacetate (and corresponding amine), such as chloroacetic acid, chloroacetamide, to give a carboxymethyl or carboxyamidomethyl derivative. The cysteinyl residue is also derivatized by reaction with bromotrifluoroacetone, α -bromo- β (5-imidazolyl) propionic acid, chloroacetyl phosphate, N-alkylmaleimide, 3-nitro-2-pyridine disulfide, methyl 2-pyridine disulfide, p-chloromercuribenzoic acid, 2-chloromercuriyl-4-nitrophenol, o-chloro (orchloro) -7-nitrobenz-2-oxa-1, 3-diazole.

Histidyl residues are derivatized by reaction with diethylpyrocarbonate at pH 5.5-7.0 because this agent has relative specificity for histidyl side chains. P-bromobenzoylmethyl bromide may also be used; this reaction is preferably carried out in 0.1M sodium cacodylate at pH 6.0.

The lysyl and amino terminal residues are reacted with succinic anhydride or carboxylic acid anhydride. Derivatization with these agents has the effect of reversing the charge of the lysyl residue. Other suitable reagents for derivatizing the α -amino group-containing residue include imidoesters, such as methyl picoliniminate; pyridoxal phosphate; pyridoxal; boron chlorine hydride; trinitrobenzenesulfonic acid; o-methylisourea; 2, 4 pentanedione; and a transaminase which reacts catalytically with glyoxylate.

Arginyl residues are modified by reaction with one or more conventional reagents, among which are phenylglyoxal, 2, 3-butanedione, 1, 2-cyclohexanedione, and ninhydrin. Derivatization of arginine residues requires that the reaction be carried out under alkaline conditions, since the guanidine functional group has a high pK. In addition, these reagents can react with the groups of lysine and arginine epsilon-amino groups.

The specific modification of tyrosyl residues has been extensively studied per se, and it is of particular interest to introduce a spectroscopic tag into tyrosyl residues by reaction with aromatic diazonium compounds or tetranitromethane. Most commonly, N-acetylimidazole and tetranitromethane are used to form O-acetyltyrosyl species and 3-nitro derivatives, respectively. A labeled protein for use in radioimmunoassay was prepared by iodination of tyrosyl residues with 125I or 131I.

Pendant carboxyl groups (aspartyl or glutamyl) are selectively modified by reaction with carbodiimides (R1), such as 1-cyclohexyl-3- (2-morpholinyl- (4-ethyl) carbodiimide or 1-ethyl-3 (4 nitrogen cation 4, 4-dimethylpentyl) carbodiimide.

Derivatization with bifunctional reagents can be used to crosslink the ligand binding molecules with a water-insoluble support matrix. Such derivatizations may also provide linkers that can link adjacent binding elements or binding elements in the ligand-binding molecule to a heterologous peptide (e.g., an Fc fragment). Commonly used crosslinking agents include, for example, 1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters (e.g., esters formed with 4-azidosalicylic acid), homobifunctional imidoesters (including disuccinimidyl esters such as 3, 3' -dithiobis (succinimidyl propionate)), and bifunctional maleimides such as bis-N-maleimido-1, 8-octane. Derivatizing agents such as methyl 3- [ (p-azidophenyl) dithio ] malonamic acid (propioimidate) give photoactivatable intermediates capable of forming crosslinks in the presence of light. Alternatively, reactive water-insoluble substrates such as cyanogen bromide activated carbohydrates are used and U.S. patent No. 3,969,287; 3,691,016 No. C; 4,195,128 No. C; 4,247,642 No. C; 4,229,537 No. C; and 4,330,440 (incorporated herein by reference) for protein immobilization.

Glutaminyl and asparaginyl residues are often deamidated to give the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Any form of these residues falls within the scope of the present invention.

Other modifications include hydroxylation of proline and lysine, phosphorylation of the hydroxyl groups of seryl or threonyl residues, methylation of the alpha-amino groups of the lysine, arginine and histidine side chains (T.E. Creighton, Proteins: Structure and molecular Properties, W.H. Freeman & Co., San Francisco, pages 79-86, 1983), acetylation of the N-terminal amine and, in some cases, amidation of the C-terminal carboxyl group. Such derivatives are chemically modified polypeptide compositions in which the ligand binding molecule polypeptide is linked to a polymer. The polymer selected is typically water soluble such that the protein to which it is attached does not precipitate in an aqueous environment, such as a physiological environment. The selected polymer is typically modified to have a single reactive group, such as an active ester for acylation or an aldehyde for alkylation, so that the degree of polymerization can be controlled when provided in the process of the present invention. The polymer may have any molecular weight and may be branched or unbranched. Included within the scope of the ligand binding molecule polypeptide polymers are mixtures of polymers. Preferably, the polymer will be pharmaceutically acceptable for therapeutic use in the final formulation.

Each of the polymers may have any molecular weight and may be branched or unbranched. The polymers typically each have an average molecular weight of between about 2kDa and about 100kDa (the term "about" means that some molecules will be heavier and lighter than the molecular weight in a water-soluble polymer formulation). The average molecular weight of each polymer is between about 5kDa and about 50kDa, more preferably between about 12kDa and about 40kDa, and most preferably between about 20kDa and about 35 kDa.

Suitable water-soluble polymers or mixtures thereof include, but are not limited to, N-linked or O-linked carbohydrates, sugars, phosphates, carbohydrates; a sugar; a phosphate ester; polyethylene glycol (PEG) (including forms of PEG used to derivatize proteins, including mono- (C1-C10) alkoxy-or aryloxy-polyethylene glycols); monomethoxy-polyethylene glycol; dextran (such as, for example, low molecular weight dextran of about 6 kD), cellulose; cellulose; other carbohydrate-based polymers, poly- (N-vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide/ethylene oxide copolymers, polyoxyethylated polyols (e.g., glycerol), and polyvinyl alcohol. The invention also encompasses bifunctional cross-linking molecules that can be used to prepare covalently attached multimers.

In general, chemical derivatization may be carried out under any conditions suitable for reacting a protein with an activated polymer molecule. A method for preparing a chemical derivative of a polypeptide will generally comprise the steps of (a) reacting the polypeptide with an active polymer molecule, such as a reactive ester or aldehyde derivative of the polymer molecule, under conditions whereby the ligand binding molecule becomes attached to one or more polymer molecules, and (b) obtaining a reaction product. Optimal reaction conditions will be determined based on known parameters and the desired results. For example, the polymer molecule: the greater the proportion of protein, the greater the amount of attached polymer molecules. In one embodiment, the ligand binding molecule polypeptide derivative may have a single polymeric molecule moiety at the amino terminus. (see, e.g., U.S. patent No. 5,234,784).

A particularly preferred water-soluble polymer for use herein is polyethylene glycol (PEG). As used herein, polyethylene glycol is intended to encompass any PEG form that can be used to derivatize other proteins, such as mono- (C1-C10) alkoxy-or aryloxy-polyethylene glycol. PEG is a linear or branched neutral polyether, available in a wide range of molecular weights, and is soluble in water and most organic solvents. When present in water, PEG can effectively exclude other polymers or peptides through its high dynamic chain mobility and hydrophilic properties, thus creating a water shell or hydrated sphere when attached to other proteins or polymer surfaces. PEG is non-toxic, non-immunogenic, and approved by the food and drug administration for internal consumption.

When conjugated to PEG, the proteins or enzymes exhibit bioactivity, non-antigenicity, and reduced clearance when administered in animals. M.M. Veronese et al, Preparation and Properties of monomer Enzymes for Therapeutic Applications, in J.M.Harris eds, Poly (ethylene glycol) Chemistry- -Biotechnical and Biomedical Applications, 127-36, 1992, incorporated herein by reference. These phenomena are due to the excluding nature of PEG to prevent recognition by the immune system. In addition, PEG is widely used in surface modification procedures to reduce protein absorption and improve blood compatibility. S.w.kim et al, ann.n.y.acad.sci.516: 116, 301987; jacobs et al, artif. 500-; park et al, j.poly.sci, Part a 29: 1725-31, 1991, all of which are incorporated herein by reference. Hydrophobic polymer surfaces, such as polyurethane and polystyrene, can be modified by grafting PEG (MW 3,400) and used as non-thrombogenic surfaces. The surface properties (contact angle) may be more consistent with a hydrophilic surface because PEG has a hydration effect. More importantly, protein (albumin and other plasma proteins) absorption can be greatly reduced, which is caused by the high chain mobility, hydrated globules and protein exclusion properties of PEG.

PEG (MW3,400) was determined to be the optimal size in surface mobility studies, Park et al, j.biomed.mat.res.26: 739-45, 1992, while PEG (MW 5,000) is most beneficial in reducing protein antigenicity. (F.M.Veronese et al, In J.M.Harris et al, Poly (ethylene glycol) Chemistry-Biotechnical and Biomedical Applications, 127-36.)

A method for preparing a pegylated ligand-binding molecule will generally comprise the steps of (a) reacting a polypeptide with polyethylene glycol (such as a reactive ester or aldehyde derivative of PEG) under conditions whereby the ligand molecule becomes attached to one or more PEG groups, and (b) obtaining a reaction product. In general, the optimal reaction conditions for the acylation reaction will be determined based on known parameters and the desired result. For example, PEG: the greater the proportion of protein, the greater the percentage of polyglycolyzed product. In some embodiments, the ligand binding molecule will have a single PEG moiety at the N-terminus. See U.S. patent No. 8,234,784, which is incorporated herein by reference. In some embodiments, the ligand binding molecules described herein optionally comprise at least one PEG moiety attached to the molecule. For example, in some embodiments, about 20-40kDa PEG is attached at the amino terminus of the ligand binding molecule.

The derivatized ligand binding molecules disclosed herein may have other activities, enhanced or diminished biological activities, or other properties, such as increased or decreased half-life, as compared to non-derivatized molecules.

Polynucleotides encoding ligand binding molecules and expression systems

The invention encompasses not only the ligand binding molecules, binding units and polypeptides described herein, but also nucleic acids encoding such molecules, vectors comprising such molecules and host cells that are thin films of such vectors. Methods of using any of the described molecules, units, polypeptides, nucleic acids, vectors and host cells are all considered aspects of the invention.

Exemplary human VEGFR-3 coding sequences are set forth in SEQ ID NO: 1, and SEQ ID NO: 1 (modified at the N2 sequence subsequence) is contemplated as a coding sequence for a ligand binding polypeptide described herein. (e.g., fragments encoding all or a portion of the VEGFR-3 ECD are contemplated.) because of the well-known degeneracy of the genetic code, many equivalent coding sequences are possible for any polypeptide coding sequence, and all such equivalents are contemplated as aspects of the present invention.

In addition, as with the amino acid sequence variants of the VEGFR-3 wild-type ECD described above, nucleic acid sequence variants are also contemplated. Nucleic acid sequence variants can be characterized as being modified relative to SEQ ID NO: 1 (e.g., at least 80, 85, 90, 92, 93, 94, 95, 96, 97, 98, or 99% identity).

Nucleotide sequence variants can also be characterized by the ability to hybridize to the complement of a preferred coding sequence. Nucleic acid molecules include those comprising a nucleotide sequence that hybridizes under moderately or highly stringent conditions as defined herein to SEQ ID NO: 1 or a molecule encoding a polypeptide comprising the receptor tyrosine kinase amino acid sequences set forth in SEQ ID NOs 2 and 3, or a nucleic acid fragment as described herein, or a molecule encoding a nucleotide sequence that hybridizes to the ECD-encoding sequence of a nucleic acid fragment of a polypeptide as described herein.

The term "highly stringent conditions" refers to those conditions designed to allow hybridization of DNA strands whose sequences are highly complementary, and to exclude hybridization of DNA that is significantly mismatched. The stringency of hybridization is mainly determined by temperature and ionic strengthAnd the concentration of denaturants such as formamide. Examples of "highly stringent conditions" for hybridization and washing are 0.015M sodium chloride, 0.0015M sodium citrate 65-68 ℃ or 0.015M sodium chloride, 0.0015M sodium citrate and 50% formamide 42 ℃. See Sambrook, Fritsch&Maniatis, Molecular Cloning: a Laboratory Manual, 2 nd edition, Cold Spring Harbor Laboratory, (Cold Spring Harbor, N.Y. 1989); and Anderson et al, Nucleic Acid Hybridization: a Practical proproach, chapter 4, IRL Press Limited (Oxford, England). Other reagents may be included in the hybridization and wash buffers to reduce non-specific and/or background hybridization. Examples are 0.1% bovine serum albumin, 0.1% polyvinylpyrrolidone, 0.1% sodium pyrophosphate, 0.1% sodium dodecyl sulfate (NaDodSO) ₄Or SDS), polysucrose, Denhardt's solution, sonicated salmon sperm DNA (or another non-complementary DNA), and dextran sulfate, although other suitable reagents may also be used. The concentration and type of these additives may be used without substantially affecting the stringency of the hybridization conditions. Hybridization experiments are usually performed at pH 6.8-7.4, however, under typical ionic strength conditions, the rate of hybridization is nearly independent of pH. See Anderson et al, Nucleic Acid Hybridization: a Practical Approach, chapter 4, IRL Press Limited (Oxford, England).

Factors that affect the stability of a DNA duplex include base composition, length, and the degree of base pair mismatch. Hybridization conditions can be adjusted by those skilled in the art to accommodate these variables and allow the formation of hybrids of DNA of different sequence relatedness. The melting temperature of perfectly matched DNA duplexes can be estimated by the following equation:

tm (. degree. C.). cndot.81.5 +16.6(log [ Na + ]) +0.41 (% G + C) -600/N-0.72 (formamide%)

Where N is the length of the duplex formed, [ Na + ] is the molar concentration of sodium ions in the hybridization or wash solution,% G + C is the (guanine + cytosine) base in the hybrid. For imperfectly matched hybrids, the melting temperature decreases by about 1 ℃ per 1% mismatch.

The term "moderately stringent conditions" refers to conditions that are capable of forming a DNA duplex with a higher degree of base pair mismatch than would occur under "highly stringent conditions". Typical "moderately stringent conditions" are 0.015M sodium chloride, 0.0015M sodium citrate 50-65 ℃ or 0.015M sodium chloride, 0.0015M sodium citrate and 20% formamide 37-50 ℃. For example, "moderately stringent" conditions in 0.015M sodium ion at 50 ℃ will allow for the occurrence of about 21% mismatches.

Up to about 20nt of oligonucleotide probe in 1M NaCl^＊A good estimate of the melting temperature in (a) is given as follows:

tm is 2 ℃/A-T base pair +4 ℃/G-C base pair

^＊The sodium ion concentration in 6x citric acid Sodium Salt (SSC) was 1M. See, Suggs et al, development Biology Using Purified Genes, page 683, Brown and Fox (eds.) (1981).

Highly stringent washing conditions for oligonucleotides are typically at a temperature 0-5 ℃ below the Tm of the oligonucleotide in 6 XSSC, 0.1% SDS.

The difference in nucleic acid sequence may result in an amino acid sequence that is different relative to SEQ ID NO: 2 or SEQ ID NO: 3, conservative and/or non-conservative modifications occur in the amino acid sequence. The invention also relates to an isolated and/or purified DNA corresponding to any of the DNA sequences described above or which hybridizes thereto under stringent conditions.

Nucleic acid molecules encoding all or a portion of a polypeptide of the invention, such as the ligand binding molecules or binding units described herein, can be made in a variety of ways, including, but not limited to, chemical synthesis, cDNA or genomic library screening, expression library screening, and/or PCR amplification of cDNA or genomic DNA. These and other methods that can be used to isolate such DNA are described, for example, by Sambrook et al, "Molecular Cloning: a Laboratory Manual, "Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), authored by Ausubel et al," Current Protocols In Molecular Biology, "Current Protocols Press (1994) and Berger and Kimmel," Methods In Enzymology: guide To Molecular Cloning Techniques, "Vol. 152, Academic Press, Inc., San Diego, Calif. (1987). Preferably the nucleic acid sequence is a mammalian sequence, such as human, rat and mouse.

Chemical synthesis of nucleic acid molecules can be accomplished using methods well known in the art, such as those described by Engels et al, angelw.chem.intl.ed., 28: 716-734 (1989). These include in particular the phosphotriester, phosphoramidite and H-phosphonate methods of nucleic acid synthesis. Nucleic acids greater than about 100 nucleotides in length can be synthesized as several fragments, each of which is up to about 100 nucleotides in length. The fragments can then be ligated together as described below to form the full-length nucleic acid of interest. The preferred method is polymer support synthesis using standard phosphoramidite chemistry.

The term "vector" refers to a nucleic acid molecule amplification, replication and/or expression vector, typically derived from or in the form of a plasmid or viral DNA or RNA system, wherein the plasmid or viral DNA or RNA functions in a selected host cell, such as a bacterial, yeast, plant, invertebrate and/or mammalian host cell. The vector may remain independent of the host cell genomic DNA, or may be fully or partially integrated with the genomic DNA. The vector will contain all the necessary elements to function in any compatible host cell. Such elements are shown below.

When the nucleic acid encoding the polypeptide or fragment thereof is isolated, it is preferably inserted into an amplification and/or expression vector to increase the copy number of the gene and/or to express the encoded polypeptide in a suitable host cell and/or transformed cell in the target organism (to express the polypeptide in vivo). Many commercially available vectors are suitable, but "custom" vectors may also be used. The vector is selected to function (i.e., to replicate and/or express) in a particular host cell or host tissue. The polypeptides or fragments thereof may be amplified/expressed in prokaryotic and/or eukaryotic host cells, such as yeast, insect (baculovirus systems), plant and mammalian cells. The choice of host cell will depend, at least in part, on whether the polypeptide or fragment thereof is to be glycosylated. If so, yeast, insect or mammalian host cells are preferred; if glycosylation sites are present in the amino acid sequence, yeast and mammalian cells will glycosylate the polypeptide.

In general, the vector used in any host cell will contain 5' flanking sequences as well as other regulatory elements such as enhancers, promoters, origin of replication elements, transcription termination elements, complete intron sequences containing donor and acceptor splice sites, signal peptide sequences, ribosome binding site elements, polyadenylation sequences, polylinker regions for inserting nucleic acid encoding the polypeptide to be expressed, and selectable marker elements. Optionally, the vector may comprise a "tag" sequence, i.e. an oligonucleotide sequence located 5 'or 3' to the coding sequence encoding a polyhis (such as a hexahis) or another immunogenic sequence. This tag will accompany the protein expression and may serve as an affinity tag for purification of the polypeptide from the host cell. Optionally, the tag can then be removed from the purified polypeptide by various means, such as using a selected peptidase.

The vector/expression construct may optionally comprise elements such as: a 5' flanking sequence, an origin of replication, a transcription termination sequence, a selectable marker sequence, a ribosome binding site, a signal sequence, and one or more intron sequences. The 5 ' flanking sequence may be homologous (i.e., from the same species and/or strain as the host cell), heterologous (i.e., from a species or strain different from the host cell), hybrid (i.e., a combination of 5 ' flanking sequences from more than one source), synthetic, or it may be a native 5 ' flanking sequence. Thus, the source of the 5 'flanking sequence may be any unicellular prokaryotic or eukaryotic organism, any vertebrate or invertebrate organism or any plant, provided that the 5' flanking sequence functions in and can be activated by the host cell machinery.

Transcription termination elements are typically located 3' to the polypeptide coding sequence and are intended to terminate transcription of the polypeptide. Typically, the transcription termination element in prokaryotic cells is a G-C rich fragment following a poly-T sequence. Such elements can be cloned from libraries, purchased commercially as part of a vector, and can be readily synthesized.

The selectable marker gene encodes a protein necessary for the survival and growth of the host cell in selective media. Typical selectable marker genes encode proteins that: (a) conferring resistance to antibiotics or other toxins (such as ampicillin, tetracycline or kanamycin) to prokaryotic host cells, (b) complementing the auxotrophy of said cells; or (c) provide key nutrients not available from complex media.

Carbohydrate binding elements, commonly referred to as Shine-Dalgarno sequences (prokaryotes) or Kozak sequences (eukaryotes), are necessary for the initiation of translation of mRNA. Such elements are typically located 3 'to the promoter and 5' to the coding sequence for the polypeptide to be synthesized. The Shine-Dalgarno sequence can vary, but is typically polypurine (i.e., has a high A-G content). A number of Shine-Dalgarno sequences have been identified, each of which can be readily synthesized using the methods described above.

All of the above elements, as well as others that may be used in the present invention, are well known to the skilled artisan and are described, for example, in Sambrook et al, "Molecular Cloning: a Laboratory Manual, "Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and Berger et al, in" Guide To Molecular Cloning Techniques, "Academic Press, Inc., San Diego, Calif. (1987).

For those embodiments of the invention in which the recombinant polypeptide is secreted, it is preferred to include a signal sequence for direct secretion from the cell in which it is synthesized. Typically, the polynucleotide encoding the signal sequence is located 5' of the coding region. Many signal sequences have been identified and any one of them that functions in the target cell or species can be used with the transgene.

In many cases, gene transcription is increased by the presence of one or more introns on the vector. Introns may be native, particularly when the transgene is a full length or fragment of a genomic DNA sequence. The intron may be homologous or heterologous to the transgene and/or the transgenic mammal into which the gene is to be inserted. The location of the intron relative to the promoter and transgene is important because the intron must be transcribed efficiently. Preferred positions for the intron are 3 'to the transcription start site and 5' to the poly-A transcription termination sequence. For cDNA transgenes, introns are located on one or the other side (i.e., the 5 'or 3' end) of the transgene coding sequence. Any intron from any source, including any viral, prokaryotic, and eukaryotic (plant or animal) organism, may be used to express the polypeptide, provided that it is compatible with the host cell into which it is inserted. Synthetic introns are also included herein. Optionally, more than one intron can be used in the vector.

Exemplary vectors for recombinant expression are those compatible with bacterial, insect and mammalian host cells. Such vectors include, inter alia, pCRII (Invitrogen Company, San Diego, Calif.), pBSII (Stratagene Company, La Jolla, Calif.), and pETL (BlueBacII; Invitrogen).

After the vector is constructed and the nucleic acid inserted into the appropriate site of the vector, the entire vector may be inserted into an appropriate host cell for amplification and/or polypeptide expression. Commonly used include: eukaryotic cells, such as gram-negative or gram-positive bacteria, i.e. any strain of escherichia coli, bacillus, streptomyces, saccharomyces, salmonella, etc.; prokaryotic cells such as CHO (chinese hamster ovary) cells; human kidney 293 cells; COS-7 cells; insect cells such as Sf4, Sf5, Sf9 and Sf21 and High 5 (all from Invitrogen Company, San Diego, Calif.); plant cells and various yeast cells, such as Saccharomyces and Pichia. Suitable are any transformed or transfected cells or cell lines derived from any organism, such as bacteria, yeast, fungi, monocotyledonous and dicotyledonous plants, plant cells and animals.

Insertion (also referred to as "transformation" or "transfection") of the vector into a selected host cell can be accomplished using methods such as: calcium chloride, electroporation, microinjection, lipofection, or DEAE-dextran method. The method selected will depend in part on the type of host cell to be used. These and other suitable methods are well known to the skilled artisan and are shown, for example, in Sambrook et al, supra.

Host cells containing the vector (i.e., transformed or transfected) can be cultured using standard media well known to the skilled artisan. The medium will typically contain all the nutrients necessary for cell growth and survival. Suitable media for culturing E.coli cells are, for example, Luria Broth (LB) and/or TerrificBroth (TB). Suitable media for culturing eukaryotic cells are RPMI 1640, MEM, DMEM, all of which can be supplemented with serum and/or growth factors required for the particular cells being cultured. Suitable media for insect cultures are gras' media supplemented with yeast extract, lactalbumin hydrolysate and/or foetal calf serum as required.

Typically, antibiotics or other compounds that can only be used for selective growth of transformed cells are added to the culture medium as supplements. The compound to be used will be determined by the selectable marker element present on the plasmid transformed by the host cell. For example, when the selectable marker element is kanamycin resistant, the compound added to the medium will be kanamycin.

The amount of polypeptide produced in the host cell can be assessed using standard methods known in the art. Such methods include, but are not limited to, western blot analysis, SDS-polyacrylamide gel electrophoresis, non-denaturing gel electrophoresis, HPLC separation, immunoprecipitation, and/or binding analysis.

If the polypeptide is designed to be secreted from the host cell, it is likely that a large proportion of the polypeptide will be found in the cell culture medium. However, if the polypeptide is not secreted from the host cell, it will be present in the cytoplasm (for eukaryotic, gram-positive and insect host cells) and periplasm (for gram-negative host cells).

In the case of intracellular polypeptides, the mechanical or osmotic properties of the host cell are first disrupted, releasing the cytoplasmic contents into a buffered solution. The polypeptide is then isolated from this solution.

For producing recombinant polypeptides with high yield over a long period of time, stable expression is preferred. For example, a cell line stably expressing a polypeptide of interest can be transformed with an expression vector, which can comprise a viral origin of replication and/or endogenous expression elements and a selectable marker gene on the same vector or a different vector. After introduction of the vector, the cells may be grown in enrichment medium for 1-2 days and then transferred to selection medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows for growth and recovery of cells that successfully express the introduced sequence. Resistant clones of stably transformed cells may be propagated using tissue culture techniques appropriate to the cell type. Cell lines substantially enriched in such cells can then be isolated, providing stable cell lines.

A particularly preferred method for producing the recombinant polypeptides of the invention in high yield is by amplification using dihydrofolate reductase (DHFR) in DHFR-deficient CHO cells, by using methotrexate at successively increasing concentrations, as described in U.S. Pat. No. 4,889,803. The resulting polypeptide may be in a glycosylated form.

The polypeptide may be purified from solution using a variety of techniques. If the polypeptide which has been synthesized contains a tag hexa-histidine or other small peptide at its carboxy or amino terminus, the polypeptide can be purified essentially in a one-step process by passing the solution through an affinity column, where the column matrix has a high affinity for the tag or directly for the polypeptide (i.e., a monoclonal antibody which specifically recognizes the polypeptide). For example, polyhistidine binds to nickel with great affinity and specificity, and thus a nickel affinity column (such as a Qiagen nickel column) can be used to purify His-tagged polypeptides. (see, e.g., Ausubel et al, eds. "Current Protocols In Molecular Biology," section 10.11.8, John Wiley & Sons, New York (1993)).

The strong affinity of the ligand for its receptor allows affinity purification of the ligand binding molecule, and the ligand binding molecule uses an affinity matrix containing complementary binding partners. Affinity chromatography can be employed, for example, using a natural binding partner (e.g., a ligand when the ligand-binding molecule is purified by affinity thereto) or an antibody generated using standard procedures (e.g., immunization of a mouse, rabbit, or other animal with a suitable polypeptide). The polypeptides of the invention may be used to generate such antibodies. When the epitope is shared with the target ligand binding molecule, a known antibody or an antibody to a known growth factor receptor may be used.

In addition, other well known purification procedures may be used. Such procedures include, but are not limited to, ion exchange chromatography, molecular sieve chromatography, HPLC, native gel electrophoresis in combination with gel elution, and preparative isoelectric focusing ("Isoprime" machine/technique, Hoefer Scientific). In some cases, two or more of these techniques may be combined to increase purity. Preferred purification methods include polyhistidine labeling in conjunction with ion exchange chromatography for preparative isoelectric focusing.

The polypeptides found in the periplasmic space of bacteria or in the cytoplasm of eukaryotic cells, the contents of the periplasm or cytoplasm, including inclusion bodies (bacteria) if the treated polypeptides form such complexes, can be extracted from the host cell using any standard technique known to the skilled person. For example, the host cells can be lysed by French press, homogenization, and/or sonication to release the periplasmic contents. The homogenate may then be centrifuged.

If the polypeptide forms inclusion bodies in the periplasm, the inclusion bodies can typically bind to the inner and/or outer membrane of the cell and will therefore be found primarily in the particulate material after centrifugation. The particulate material may then be treated with a chaotropic agent (such as guanidine or urea) to release the inclusion bodies, rupture them and dissolve them. The solubilized polypeptide can then be analyzed by gel electrophoresis, immunoprecipitation, or the like. If it is desired to isolate the polypeptide, isolation can be accomplished using standard procedures, such as those described below and [ Marston et al, meth.enz., 182: 264, 275(1990).

Gene therapy

In some embodiments, the polynucleotides of the invention further comprise additional sequences for facilitating gene therapy. In one embodiment, gene therapy is performed using a "naked" transgene (i.e., a transgene without a virus, liposome, or other vector used to facilitate transfection) encoding the ligand binding molecules described herein.

The vectors may also be used in "gene therapy" treatment regimens in which a polynucleotide encoding a ligand-binding polypeptide or molecule is introduced into a subject in need of inhibition of neovascularization in a form that causes cells in the subject to express the ligand-binding molecule of the invention in vivo. The gene therapy aspects described in U.S. patent publication No. 2002/0151680 and WO 01/62942, both of which are incorporated herein by reference, are also applicable herein.

Any suitable vector may be used to introduce a polynucleotide encoding a ligand binding molecule described herein into a host. Exemplary vectors that have been described in the literature include replication-defective retroviral vectors, including but not limited to lentiviral vectors (Kim et al, J.Virol., 72 (1): 811-816, 1998; Kingsman and Johnson, script Magazine, 10 months, 1998, pages 43-46); adeno-associated virus (AAV) vectors (U.S. Pat. Nos. 5,474,9351; 5,139,941; 5,622,856; 5,658,776; 5,773,289; 5,789,390; 5,834,441; 5,863,541; 5,851,521; 5,252,479; Gnatenko et al, J.Invest.Med., 45: 87-98, 1997); adenovirus (AV) vectors (U.S. Pat. Nos. 5,792,453; 5,824,544; 5,707,618; 5,693,509; 5,670,488; 5,585,362; Quantin et al, Proc. Natl. Acad. Sci. USA, 89: 2581-; adeno-associated virus chimeras (U.S. Pat. No. 5,856,152) or vaccinia or herpes viruses (U.S. Pat. Nos. 5,879,934; 5,849,571; 5,830,727; 5,661,033; 5,328,688); liposome-mediated gene transfer (BRL); liposome carriers (U.S. Pat. No. 5,631,237, liposomes containing Sendai virus protein); and combinations thereof. All of the above documents are incorporated herein by reference in their entirety.

Other non-viral delivery mechanisms contemplated include, but are not limited to: calcium phosphate precipitation (Graham and Van Der Eb, Virology, 52: 456-467, 1973; Chen and Okayama, mol.Cell biol., 7: 2745-2752, 1987; Rippe et al, mol.Cell biol., 10: 689-695, 1990), DEAE-dextran method (Gopal, mol.Cell biol., 5: 1188-1190, 1985), electroporation (Tur-Kaspa et al, mol.Cell biol., 6: 716-718, 1986; Potter et al, Proc. Nat.Acad.Sci.USA, 81: 7161-7165, 1984), direct microinjection (Harland and Weintraub, J.Cell., 1094, 101: Sci.1985, the USA 81: 7161-7165, 1984), Liposome treatment (Fegna-8452, Natl et al, Nature, USA, 1986, USA, Nature, 1985-3383-92, 1985, Nature, Fegna-8476, Fegna-52, Nature, USA, 1985, Fegna, Nature, USA, 2000-33185, USA, 2000-35, Nature, 2000-35, Nature, 2000, Na 2-2000, Na 2, Na-2000, Na 2, Na-K, Na 2, Na-K, Na 2, K, gene bombardment using high-speed microprojectiles (Yang et al, Proc. Natl. Acad. Sci USA, 87: 9568-9572, 1990) and receptor-mediated transfection (Wu and Wu, J.biol. chem., 262: 4429-4432, 1987; Wu and Wu, Biochemistry, 27: 887-892, 1988; Wu and Wu, adv. drug Delivery Rev., 12: 159-167, 1993).

The expression construct (or indeed the ligand binding molecule described herein) may be embedded in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by an aqueous medium. When phospholipids are suspended in an excess of aqueous solution, they form spontaneously. The lipid component undergoes self-rearrangement, then forms a closed structure, and entraps water and dissolved solutes between lipid bilayers (Ghosh and Bachhawat, in: Liver diseases, targeted diagnostics and therapy using specific receptors and ligands, Wu G, Wu C eds., New York: Marcel Dekker, pp. 87-104, 1991). Addition of DNA to cationic liposomes results in a topological transition from liposomes to optically birefringent liquid crystal condensed spheres (Radler et al, Science, 275 (5301): 810-4, 1997). These DNA-ester complexes are potential non-viral vectors for gene therapy and delivery.

Liposome-mediated nucleic acid delivery and expression of exogenous DNA in vitro has been successful. The present invention also contemplates various commercial methods involving "lipofection" techniques. In certain embodiments of the invention, the liposomes may be complexed with Hemagglutinating Virus (HVJ). This has been shown to facilitate fusion with cell membranes and promote the entry of more robust DNA from liposomes into cells (Kaneda et al, Science, 243: 375-378, 1989). In other embodiments, the liposomes can be complexed with or used in conjunction with nuclear non-histone chromosomal protein (HMG-1) (Kato et al, J.biol.chem., 266: 3361-3364, 1991). In other embodiments, liposomes can be complexed with or used in conjunction with HVJ and HMG-1. Since such expression vectors have been successfully used for the transfer and expression of nucleic acids in vitro and in vivo, they are suitable for use in the present invention.

Another embodiment of the invention for transferring naked DNA expression constructs into cells may involve particle bombardment. This method relies on the ability to accelerate DNA-coated microparticles to a high rate that allows them to pierce the cell membrane and enter the cell without killing them (Klein et al, Nature, 327: 70-73, 1987). Several devices have been developed for accelerating small particles. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, Proc. Natl. Acad. Sci USA, 87: 9568-. The microparticles used consist of biologically inert substances such as tungsten or gold beads.

In embodiments employing viral vectors, preferred polynucleotides further include a suitable promoter and polyadenylation sequence as described above. In addition, it will be apparent that in these embodiments, the polynucleotides also include vector polynucleotide sequences (e.g., adenoviral polynucleotides) operably linked to the sequences encoding polypeptides of the invention.

Therapeutic uses of ligand binding molecules

The ligand binding polypeptides and molecules described herein, as well as polynucleotides and vectors encoding them, are useful for inhibiting cellular processes mediated by endothelial growth factors that induce signal transduction through VEGFR-2 or VEGFR-3 and are indicative of the prevention or treatment of disorders associated with aberrant angiogenesis and/or lymphangiogenesis (e.g., various ocular disorders and cancers) stimulated by the action of such growth factors on these receptors. The ligand binding polypeptides and molecules described herein, as well as the polynucleotides and vectors encoding them, have therapeutic uses for treating or preventing any disease for which a condition is improved, ameliorated, inhibited or prevented by removal, inhibition or reduction of VEGF-C and/or VEGF-D. A non-exhaustive list of specific disorders ameliorated by inhibiting or reducing VEGF-C and/or VEGF-D (and especially at least VEGF-C) includes: clinical conditions characterized by vascular endothelial cell hyperproliferation, vascular permeability, edema, or inflammation, such as cerebral edema associated with injury, stroke, or tumor; edema associated with inflammatory conditions, such as psoriasis or arthritis, including rheumatoid arthritis; asthma; general edema associated with burns; ascites and pleural effusions associated with tumors, inflammation or trauma; chronic airway inflammation; capillary leak syndrome; sepsis; renal disease associated with increased protein leakage; and ocular diseases such as age-related macular degeneration and diabetic retinopathy.

For simplicity, while many of the methods are described below for compositions comprising ligand binding molecules, it is to be understood that the invention is contemplated with any of the constructs (ligand binding polypeptides, molecules, and constructs and polynucleotides encoding them, dimers and other multimers, etc.) described herein.

An exemplary therapeutic use is a method of inhibiting neovascularization in a subject in need thereof, comprising administering to the subject an amount of a composition comprising a ligand binding molecule described herein effective to inhibit neovascularization in the subject. In some embodiments, neovascularization comprises choroidal or retinal neovascularization. In some embodiments, the neovascularization is tumor neovascularization that occurs in malignant cancers and other tumors.

In another aspect, described herein is a method of preventing or treating an ocular disorder associated with neovascularization, comprising administering to a subject in need of prevention or treatment of the ocular disorder a composition comprising a ligand binding molecule described herein.

In another aspect, described herein is a method of preventing or treating an ocular disorder that results in retinal edema, comprising administering to a subject in need of prevention or treatment of the ocular disorder or disease a composition comprising a ligand binding molecule described herein.

Examples of ocular disorders that may be treated include choroidal neovascularization, diabetic macular edema, age-related macular degeneration, proliferative diabetic retinopathy, retinal vein occlusion, and corneal neovascularization/graft rejection. Preferably, the amount of ligand binding molecule employed is effective to inhibit the binding of VEGF-C and/or VEGF-D ligands to VEGFR-3 (and preferably additionally VEGFR-2) or the stimulatory effect of VEGF-C and/or VEGF-D on VEGFR-3 (and preferably additionally VEGFR-2).

In one embodiment, the ocular disorder is age-related macular degeneration. Examples of age-related macular degeneration are the non-neovascular (also referred to as "dry") and neovascular (also referred to as "wet") forms of macular degeneration. In a preferred embodiment, the ocular disorder is wet age-related macular degeneration. Treating or preventing wet age-related macular degeneration also includes treating or preventing choroidal neovascularization or pigment epithelial detachment.

In one embodiment, the ocular disorder is polypoid choroidal vasculopathy. Polypoidal choroidal vasculopathy is characterized by lesions from the intravascular, inner choroidal vascular network of blood vessels that eventually appear as aneurysmal bumps or outward protrusions (Ciardella et al (2004) Surv ophthalmol.49: 25-37).

In one embodiment, the ocular disorder is a condition associated with choroidal neovascularization. Examples of conditions associated with choroidal neovascularization include degenerative, inflammatory, traumatic, or idiopathic conditions. Treating or preventing a degenerative disorder associated with choroidal neovascularization also includes treating or preventing a genetic degenerative disorder. Examples of genetic degenerative disorders include vitelliform macular dystrophy, macular disease of the fundus, and optic nerve head drusen. Examples of degenerative conditions associated with choroidal neovascularization include myopic degeneration or angioid streaks. Treating or preventing inflammatory conditions associated with choroidal neovascularization also includes treating or preventing ocular histocytopathic syndrome, multifocal choroiditis, creeping choroiditis, toxoplasmosis, toxocariasis, bowardia, rubella, voguett-salix Harada syndrome (Vogt-Koyanagi-Harada syndrome), Behcet syndrome (Behcet syndrome), or sympathetic ophthalmia. Treating or preventing a traumatic disorder associated with choroidal neovascularization also includes treating or preventing choroidal rupture or traumatic condition caused by intense photocoagulation.

In one embodiment, the ocular disorder is hypertensive retinopathy.

In one embodiment, the ocular disorder is diabetic retinopathy. The diabetic retinopathy may be non-proliferative or proliferative diabetic retinopathy. Examples of non-proliferative diabetic retinopathy include macular edema and macular ischemia.

In one embodiment, the ocular disorder is sickle cell retinopathy.

In one embodiment, the ocular disorder is a condition associated with peripheral retinal neovascularization. Examples of pathologies associated with peripheral retinal neovascularization include ischemic vascular disease, inflammatory diseases that may be accompanied by ischemia, pigment incontinence, retinitis pigmentosa, retinoschisis, or chronic retinal detachment.

Examples of ischemic vascular diseases include proliferative diabetic retinopathy, retinal branch vein occlusion, retinal branch artery occlusion, carotid cavernous fistula, sickle cell hemoglobinopathy, non-sickle cell hemoglobinopathy, IRVAN syndrome (a retinal vasculitic condition characterized by idiopathic retinal vasculitis, aneurysm, and neuroretinitis), retinal embolism, retinopathy of prematurity, familial exudative vitreoretinopathy, hyperviscosity syndrome, aortic arch syndrome, or early disease (eae disease). Examples of sickle cell hemoglobinopathies include SS hemoglobinopathies and SC hemoglobinopathies. Examples of non-sickle cell hemoglobinopathies include AC hemoglobinopathies and AS hemoglobinopathies. Examples of hyperviscosity syndromes include leukemia, Waldenstrom macroglobulinemia, multiple myeloma, polycythemia or myeloproliferative disorders.

Treating or preventing inflammatory diseases that may be accompanied by ischemia also includes treating or preventing retinal vasculitis associated with systemic disease, retinal vasculitis associated with infectious pathogens, uveitis, or birdshot retinitis. Examples of systemic diseases include systemic lupus erythematosus, Behcet's disease, inflammatory bowel disease, sarcoidosis, multiple sclerosis, Wegener's granulomatosis, and polyarteritis nodosa. Examples of infectious pathogens include bacterial pathogens, which are causative agents of syphilis, tuberculosis, Lyme disease (Lyme disease) or cat scratch disease, viruses such as herpes viruses, or parasites such as Toxocara canis (Toxocara canis) or Toxoplasma gondii (Toxoplasma gondii). Examples of uveitis include pars plana inflammation or uveitis fox syndrome.

In one embodiment, the ocular disorder is retinopathy of prematurity. Retinopathy of prematurity may result from abnormal growth of blood vessels in the vascular bed supporting the developing retina (Pollan C (2009) Neonatal Net.28: 93-101).

In one embodiment, the ocular disorder is a venous occlusive disease. Examples of vein occlusive disease include retinal branch vein occlusion and central retinal vein occlusion. Retinal branch vein occlusion may be an obstruction of the portion of the circulation that drains retinal blood. This blockage can lead to built up pressure in the capillaries, which can lead to bleeding and also to leakage of body fluids and other blood components.

In one embodiment, the ocular disorder is an arterial occlusive disease. Examples of arterial occlusive disease include retinal branch artery occlusion, central retinal artery occlusion, or ocular ischemic syndrome. Retinal branch arterial occlusion (BRAO) may occur when an occlusion occurs in one of the arterial branches feeding the retina.

In one embodiment, the ocular disorder is Central Serous Chorioretinopathy (CSC). In one embodiment, the CSC is characterized by fluid leakage in the central macula.

In one embodiment, the ocular disorder is Cystoid Macular Edema (CME). In one embodiment, CME affects the central retina or macula. In another embodiment, CME occurs after cataract surgery.

In one embodiment, the ocular disorder is retinal telangiectasia. In one embodiment, retinal telangiectasia is characterized by dilation and tortuosity of retinal blood vessels and the formation of multiple aneurysms. Idiopathic JXT, Leber's millet granular aneurysm (Leber's milliary aneurysm) and korts ' disease are three types of retinal capillary dilation.

In one embodiment, the ocular disorder is a giant aneurysm.

In one embodiment, the ocular disorder is retinal angiomatosis. In one embodiment, retinal angiomatosis occurs when blood vessels of the eye form a multiple hemangioma.

In one embodiment, the ocular disorder is Radiation Induced Retinopathy (RIRP). In one embodiment, the RIRP may exhibit symptoms such as macular edema and non-proliferative and proliferative retinopathies.

In one embodiment, the ocular disorder is rubeosis iridis. In another embodiment, rubeosis iridis results in the formation of neovascular glaucoma. In another embodiment, the rubeosis iridis is caused by diabetic retinopathy, central retinal vein occlusion, ocular ischemic syndrome, or chronic retinal detachment.

In one embodiment, the ocular disorder is a tumor. Examples of tumors include eyelid tumors, conjunctival tumors, choroidal tumors, iris tumors, optic nerve tumors, retinal tumors, invasive intraocular tumors, or orbital tumors. Examples of eyelid tumors include basal cell carcinoma, squamous cell carcinoma, sebaceous gland carcinoma, malignant melanoma, capillary hemangioma, sweat gland cystic tumor, nevi or seborrheic keratosis. Examples of conjunctival tumors include conjunctival Kaposi's sarcoma, squamous cell carcinoma, conjunctival intraepithelial tumors, epibulbar epidermoid cysts, conjunctival lymphoma, melanoma, palpebral fissure, or pterygium. Examples of choroidal tumors include choroidal nevi, choroidal hemangioma, choroidal metastasis, choroidal osteoma, choroidal melanoma, ciliary body melanoma, or Ota nevi. Examples of iris tumors include anterior uveal metastases, iris cysts, iris melanoma, or iris pearl cysts. Examples of the optic nerve tumor include optic nerve melanoma, optic nerve sheath meningioma, choroidal melanoma affecting the optic nerve, or peripapillary metastasis accompanied by optic neuropathy. Examples of retinal tumors include Retinal Pigment Epithelium (RPE) hyperplasia, RPE adenoma, RPE carcinoma, retinoblastoma, RPE hamartoma, or von Hippel angioma (von Hippel angioma). Examples of infiltrating intraocular tumors include chronic lymphocytic leukemia, infiltrating choroidopathy, or intraocular lymphoma. Examples of orbital tumors include lacrimal adenoid cystic carcinoma, orbital cavernous hemangioma, orbital lymphangioma, orbital mucus cyst, orbital pseudotumor, orbital rhabdomyosarcoma, periorbital hemangioma in children, or sclerosing orbital pseudotumor.

In another aspect, the invention features a method of treating ocular injury comprising topically administering to a subject in need thereof an effective amount of a ligand binding molecule described herein, thereby reducing or ameliorating ocular injury. Preferably, the ocular injury is corneal injury or conjunctival injury and the method of treatment reduces angiogenesis and inflammation associated with ocular injury. In some embodiments, the methods can be used to treat acute and subacute corneal or conjunctival injuries. Acute corneal injury can be treated within 24 hours of the occurrence and includes corneal or conjunctival injury caused by a penetrating object, foreign body, or chemical or burn injury. Subacute lesions can be treated up to two weeks after the lesion and can include the lesions described above as well as infectious etiologies. In some embodiments, the ocular injury is caused by trauma, such as surgical injury, chemical burn, corneal transplantation, infectious or inflammatory disease.

The length of treatment will vary depending on the lesion, but the duration of treatment may be short, for example up to one month, and may include an observation period of 3-6 months during which re-treatment may be provided. Administration may also include a second agent, such as an immunosuppressive agent, e.g., one or more of a corticosteroid, dexamethasone, or cyclosporin a. Topical administration includes, for example, administration of the ligand binding molecule in the form of eye drops that are applied to the eye, or subconjunctival injection into the eye.

In another aspect, described herein is a method of healing an ocular injury comprising topically administering to a subject in need thereof an effective amount of a ligand binding molecule described herein, thereby causing the ocular injury to heal.

In another aspect, described herein is a method of reducing or mitigating angiogenesis associated with ocular injury, comprising topically administering to a subject in need thereof an effective amount of a ligand binding molecule described herein, thereby reducing or mitigating angiogenesis associated with ocular injury.

In another aspect, described herein is a method of reducing or alleviating inflammation associated with ocular injury, comprising topically administering to a subject in need thereof an effective amount of a ligand binding molecule described herein, thereby reducing or alleviating inflammation associated with ocular injury.

In another aspect, described herein is a method of administering a ligand-binding molecule of the invention to treat angiogenesis and/or inflammation associated with ocular injury or infection, comprising topical administration via eye drops comprising a ligand-binding molecule described herein, or subconjunctival administration via injection or transplantation.

In another aspect, described herein is a method of prolonging the survival of a corneal graft after a corneal transplant in a patient by administering to the patient an effective amount of a pharmaceutical composition comprising a ligand binding molecule described herein (thereby inhibiting angiogenesis and/or lymphangiogenesis in the cornea of the patient).

Dose response studies allow for accurate determination of the amount of appropriate ligand binding molecule used. An effective amount can be estimated, for example, by measuring the binding affinity of the polypeptide for the target receptor, the number of receptors present on the target cells, the expected dilution volume (e.g., the patient's body weight and blood volume for in vivo embodiments), and the clearance of the polypeptide. For example, prior literature on the dosage of administration of known VEGF-C antibodies can also provide guidance for the dosage of ligand binding molecules described herein. Literature describing the dosing of aflibercept (Regeneron), a VEGFR-1/VEGFR-2 based ligand trap, may also be used to provide guidance for dosing of therapeutic molecules as described herein.

In some embodiments, when administered by intravitreal injection, the ligand binding molecule is administered at a concentration of about 2mg to about 4mg per eye (or about 1mg to about 3mg, or about 1mg to about 4mg, or about 3mg to about 4mg, or about 1mg to about 2mg per eye). In some embodiments, the ligand binding molecule is administered at a concentration of about 1mg, or about 2mg, or about 3mg, or about 4mg, or about 5mg, or about 6mg per eye. In some embodiments, the ligand binding molecule is present in a volume of 10. mu.l, 15. mu.l, 20. mu.l, 25. mu.l, 30. mu.l, 35. mu.l, 40. mu.l, 45. mu.l, 50. mu.l, 60. mu.l, 70. mu.l, 80. mu.l, 90. mu.l, 95. mu.l or 100. mu.l at any of the concentrations listed above. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4mg/50 μ l.

The ligand binding molecules described herein can be administered as a prophylactic treatment alone to prevent neovascularization in a subject at risk of developing an ocular disease associated with neovascularization (e.g., diabetic retinopathy, macular degeneration), or as a therapeutic treatment to a subject having an ocular disease to inhibit neovascularization in the eye of a subject in need thereof.

Subjects at risk of developing diabetic retinopathy or macular degeneration include: subjects over fifty years of age; a subject suffering from rheumatoid arthritis; patients with diabetes; a subject having a thyroid abnormality; a subject suffering from asthma; a subject with cataract; a subject suffering from glaucoma; a subject suffering from lupus; subjects with hypertension and subjects with retinal detachment. Other risk factors include genetics, diet, smoking, and sun exposure.

In some embodiments, described herein is a method of selecting a treatment regimen for a subject in need thereof, comprising screening the subject for one or more symptoms of an ocular disorder associated with retinal neovascularization and prescribing the subject for administration of a composition comprising a ligand binding molecule described herein. In another embodiment, described herein is a method of treating a subject having an ocular disorder associated with retinal neovascularization, comprising identifying a subject having one or more symptoms of the ocular disorder and administering to the subject a composition comprising a ligand binding molecule. Symptoms associated with ocular disorders associated with retinal neovascularization include, but are not limited to: blurred vision and slow loss of vision over time, fine particle drift in the eye, shadowing or loss of vision areas, metamorphosis and nyctalopia.

In some embodiments, the methods described herein further comprise the development or (administration) of standard of care regimens for the treatment of dry eye. In the context of the methods described herein, "standard of care" refers to treatment generally accepted by clinicians for a particular type of patient diagnosed as having a disease. For example, in the case of diabetic retinopathy and macular degeneration, one aspect of the present invention is the use of combination therapy with ligand binding molecules described herein that inhibit retinal neovascularization to improve standard of care therapy. Exemplary standard of care treatments for diabetic retinopathy and macular degeneration include, but are not limited to: eyelid hygiene, topical antibiotics (including but not limited to erythromycin or bacitracin ointments), oral tetracyclines (tetracycline, doxycycline or minocycline), anti-inflammatory compounds (including but not limited to cyclosporine), corticosteroids, laser photocoagulation, and photodynamic therapy.

Also contemplated is a method of treating a mammalian subject having an ocular disorder associated with retinal neovascularization that is hyporesponsive to a standard of care regimen for treating the ocular disorder, comprising administering to the subject a ligand binding molecule in an amount effective to treat the disorder.

The mammalian subject is preferably a human subject. It is further contemplated that the methods of the invention are practiced in other mammalian subjects, particularly mammals (e.g., primates, swine, canine, or rabbit animals) that are commonly used as models to demonstrate efficacy in humans.

Combination therapy and other active agents

The combination therapeutic and prophylactic embodiments of the invention include products and methods. Exemplary compounds that can be administered in combination with one or more ligand binding molecules described herein include, but are not limited to, the compounds provided in table 2 below.

The ligand binding molecule may be administered in combination with one or more other active compounds or therapies, including secondary receptor capture molecules, cytotoxic agents, surgery, catheter devices, and radiation. Exemplary combination products include two or more agents formulated as a single composition or packaged together in separate compositions as, for example, a unit dose package or kit. Exemplary combination methods include prescribing for administration, or administering two or more agents simultaneously or concurrently or at staggered times (i.e., sequentially).

As used herein, the term "cytotoxic agent" refers to a substance that inhibits or prevents cellular function and/or causes cellular destruction. The term is intended to include radioisotopes (e.g., I) ¹³¹、I¹²⁵、Y⁹⁰And Re¹⁸⁶) Chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof.

A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include: alkylating agents, such as thiotepa and cyclophosphamide

Alkyl sulfonates such as busulfan, improsulfan, and piposulfan; aziridines (aziridines)) Such as benzotepa (benzodopa), carboquone (carboquone), mepiquat (meturedpa) and uredepa (uredpa); ethyleneimine and methylmelamine including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylolmelamine; nitrogen mustards (nitrogen mustards), such as chlorambucil, chlorambucil (chlorenaphazine), cholorophosphamide (cholorophosphamide), estramustine (estramustine), ifosfamide, mechlorethamine (mechlorethamine), mechlorethamine hydrochloride (mechlorethamine oxide hydrochloride), melphalan (melphalan), neomustard (novembechin), benzene mustards (pherenesterone), prednimustine (prednimustine), triamcinolone (trofosfamide), uracil mustard (uracil mustard); nitrosoureas such as carmustine (carmustine), chlorouretocin (chlorozotocin), fotemustine (fotemustine), lomustine (lomustine), nimustine (nimustine), ramustine (ranimustine); antibiotics such as aclacinomycin (aclacinomycin), actinomycin (actinomycin), anthranomycin (aurramycin), azaserine (azaserine), bleomycin (bleomycin), actinomycin C (cactinomycin), calicheamicin (calicheamicin), karanjin (caraubicin), carminomycin (carminomycin), carcinomycin (carcinomycin), chromomycin (chromomycin), dactinomycin, daunorubicin, ditoreubicin (detoubicin), 6-diaza-5-oxo-L-norleucine, doxorubicin (doxorubicin), epirubicin (epirubicin), esorubicin (esorubicin), idarubicin (idarubicin), sisomicin (cellomycetin), mitomycin, mycophenolic acid (mycophenolic acid), garomycin (oxyprolicin), streptomycin (streptomycin), streptomycin (flavomycin), pleomycin (flavomycin), doxorubicin (flavomycin (lipomycin), doxorubicin (flavomycin), doxorubicin (lipomycin), doxorubicin (lipomycin), doxorubicin (lipomycin), doxorubicin (lipomycin), doxorubicin (lipomycin), doxorubicin (lipomycin), doxorubicin (lipomycin), doxorubicin (lipomycin (beta-L, Streptozocin (streptozocin), tubercidin (tubicidin), ubenimex (ubenimex), azinostatin (zinostatin), zorubicin (zorubicin); antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues, such as denopterin, methotrexate (iv) pteropterin (pteropterin), trimetrexate (trimetrexate); purine analogs such as fludarabine (fludarabine), 6-mercaptopurine (6-mercaptopurine), thiamiprine (thiamiprine), thioguanine (thioguanine); pyrimidine analogs such as ancitabine (ancitabine), azacitidine (azacitidine), 6-azauridine (6-azauridine), carmofur (carmofur), cytarabine, dideoxyuridine (dideoxyuridine), doxifluridine (doxifluridine), enocitabine (enocitabine), floxuridine (floxuridine); androgens such as carotinone (calusterone), dromostanolone propionate, epitioandrostanol (epitiostanol), mepiquitane (mepiquitane), testolactone (testolactone); anti-adrenal agents such as aminoglutethimide (aminoglutethimide), mitotane (mitotane), trilostane (trilostane); folic acid replenishers such as leucovorin (leucovorin); acetoglucurolactone (acegultone); (ii) a (ii) an aldophosphamide glycoside; aminolevulinic acid (aminolevulinic acid); azadine; bestrabuucil; bisantrene; edatrexate (edatraxate); desphosphamide (defofamine); dimecorsine (demecolcine); diazaquinone (diaziqutone); isoflurine (elfornithine); ammonium etitanium acetate; etoglut (etoglucid); gallium nitrate; a hydroxyurea; lentinan (lentinan); lonidamine (lonidamine); mitoguazone (mitoguzone); mitoxantrone; mopidamol (mopidamol); a nitrazine; pentostatin; phenamet (phenamett); pirarubicin (pirarubicin); pedicellonic acid; 2-ethyl hydrazide; (ii) procarbazine;

Razoxaue (razoxaue); sizofuran (sizofiran); germanium spiroamines (spirogyranium); tenuzonacic acid (tenuazonicacid); triimine quinone (triaziquone); 2, 2' -trichlorotriethylamine; urethane (urethan); vindesine; dacarbazine; mannitol mustard; dibromomannitol; dibromodulcitol (mitolactol); pipobromane (pipobroman); gatorine (gamytosine); arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxanes, e.g. paclitaxel (A)

Bristol-Myers Squibb Oncology, Princeton, N.J.) and docetaxel (

Aventis antonyx, France); chlorambucil (chlorambucil); gemcitabine (gemcitabine); 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; nuantro (novantrone); teniposide (teniposide); daunorubicin; aminopterin; (xiloda); ibandronate (ibandronate); CPT-11; topoisomerase inhibitor RFS 2000; difluoromethyl ornithine (DMFO); retinoic acid; esperamicin (esperamicin); capecitabine (capecitabine); and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included in this definition are anti-hormonal agents used to modulate or inhibit the effects of hormones on tumors, such as: antiestrogens including, for example, tamoxifen (tamoxifen), raloxifene (raloxifene), aromatase inhibiting 4(5) -imidazole, 4-hydroxytamoxifene, trioxifene (trioxifene), naloxifene (keoxifene), LY 117018, onapristone (onapristone), and toremifene (Fareston); and antiandrogens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the foregoing.

"growth inhibitory agent" as used herein refers to a compound or composition that inhibits the growth of cells, particularly cancer cells, in vitro or in vivo. Examples of growth inhibitory agents include agents that block cell cycle progression (at a stage other than S phase), such as agents that induce G1 arrest and M phase arrest. Typical phase M blockers include the vinca drugs (vincristine and vinblastine),

And topoisomerase II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. Those agents that block G1 may also further cause a cessation of S phase, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and cytarabine (ara-C).

VEGF-A (VEGF) inhibitor products

In some embodiments, the methods described herein optionally include administering a therapeutically active agent to inhibit VEGF-a binding to one or more of its receptors, particularly VEGFR-2. The VEGF-a inhibitor product may be administered in combination with one or more ligand binding molecules described herein. In some embodiments, the VEGF-a inhibitor product and the ligand binding molecule are co-administered in a single composition. In other embodiments, the VEGF-a inhibitor product is administered as a separate composition from the ligand binding molecule.

In one embodiment, the VEGF-a inhibitor product is selected from ranibizumab, bevacizumab, aflibercept, KH902 VEGF receptor-Fc fusion protein, 2C3 antibody, ORA102, pegaptanib (pegaptanib), bevacinib, SIRNA-027, decursin (decursin), decursinol (decursinol), picropodophyllin (picrophyllin), guggulsterone (guggulsterone), lxplg 101, eicosanoid a4, PTK787, pazopanib, axitinib (axitinib), CDDO-Me, CDDO-Imm, alkannin, β -hydroxyisovalerylshikonin, eya 001, ganglioside GM 5, DC101 antibody, Mab25 antibody, Mab73 antibody, 4A5 antibody, 4E10 antibody, 5F 4 antibody, 01 antibody, egel 801, flt 4624 antibody, flb 31, flb 4631 antibody, flb 31, flb-t-related antibody, flb-t fusion protein, or a pharmaceutically acceptable salt of any of the foregoing.

The cDNA and amino acid sequences of human VEGFR-2 ECD are set forth in SEQ ID NO: 5 and SEQ ID NO: 6 in (A). A "VEGF-A inhibitor product" may be any molecule that specifically acts to reduce the VEGF-A/VEGFR-2 interaction (e.g., by blocking VEGF-A binding to VEGFR-2 or by reducing VEGFR-2 expression). As used herein, the term "VEGF-A" refers to the induction of blood vessels Vascular endothelial growth factors and including various subtypes of VEGF, which are produced or produced during angiogenesis, by, for example, the VEGF-A gene (including VEGF)₁₂₁、VEGF₁₆₅And VEGF₁₈₉) By alternative splicing. The term "VEGF" may be used to refer to a "VEGF" polypeptide or a gene or nucleic acid encoding "VEGF".

The term "VEGF-A inhibitor product" refers to an agent that partially or completely reduces or inhibits the activity or production of VEGF-A. The VEGF-A inhibitor product may directly or indirectly reduce or inhibit a particular VEGF-A, such as VEGF₁₆₅Activity or production of (c). In addition, a "VEGF-A inhibitor product" includes agents that act on VEGF-A ligands or their cognate receptors to reduce or inhibit VEGF-A related receptor signaling. Examples of "VEGF-A inhibitor products" include antisense molecules, ribozymes, or RNAi targeting VEGF-A nucleic acids; a VEGF-A aptamer; a VEGF-A antibody; a soluble VEGF receptor decoy that prevents VEGF-a from binding to its cognate receptor; an antisense molecule, ribozyme or RNAi targeting a homologous VEGF-A receptor (VEGFR-1 and/or VEGFR-2) nucleic acid; VEGFR-1 and VEGFR-2 aptamers or VEGFR-1 and VEGFR-2 antibodies; and VEGFR-1 and/or VEGFR-2 tyrosine kinase inhibitors.

The VEGF-A inhibitor can be a polypeptide comprising a soluble VEGFR-2 ECD fragment that binds VEGF (amino acids 20-764 of SEQ ID NO: 6); soluble VEGFR-1 ECD fragments, VEGFR-1/R2-based soluble ligand traps such as Aberemopen (Regeneron); VEGFR-2 antisense polynucleotides or short interfering RNAs (siRNAs); anti-VEGFR-2 antibodies; a VEGFR-2 inhibitor polypeptide comprising an antigen binding fragment of an anti-VEGFR-2 antibody that inhibits binding between VEGFR-2 and VEGF; aptamers that inhibit the binding between VEGFR-2 and VEGF-A. In some variations, the VEGFR-2 based ligand trap comprises a fusion protein comprising a soluble VEGFR-2 polypeptide fragment fused to an immunoglobulin constant region fragment (Fc). In some embodiments, the VEGFR-2 polypeptide fragment is fused to Alkaline Phosphatase (AP). Methods for forming Fc or AP fusion constructs are found in WO 02/060950, the disclosure of which is incorporated herein by reference in its entirety.

A number of VEGF-a antibodies have been described, see, e.g., U.S. patent No. 8,349,322; 8,236,312 No. C; 8,216,571 No. C(ii) a 8,101,177 No. C; 8092,797 No. C; 8,088,375 No. C; 8,034,905 No. C; 5,730,977 No. C; 6,342,219, 6,524,583, 6,451,764, 6,448,077, 6,416,758, 6,342,221 and PCT publications WO 96/30046, WO 97/44453 and WO 98/45331, the contents of which are incorporated by reference in their entirety. Exemplary VEGF-A antibodies include bevacizumab

And ranibizumab

In some embodiments, one or more ligand binding molecules described herein are administered in combination with bevacizumab. In some embodiments, one or more ligand binding molecules described herein are administered in combination with ranibizumab.

In some embodiments, the VEGF-A inhibitor is EYE001 (previously referred to as NX1838), which is a modified pegylated aptamer that binds with high specific affinity to the predominant soluble human VEGF isoform (see U.S. Pat. Nos. (6,011,020; 6,051,698; and 6,147,204).

In a preferred embodiment, one or more of the ligand binding molecules described herein is conjugated to aflibercept

Combined administration (Holash et al, Proc. Natl. Acad. Sci. USA, 99: 11393-.

A number of VEGFR-2 antibodies have been described, see, e.g., U.S. patent No. 6,334,339 and U.S. patent publication nos. 2002/0064528, 2005/0214860 and 2005/0234225 (all of which are incorporated herein by reference in their entirety). Antibodies can be used to modulate VEGFR-2/VEGF interactions due to the ease with which antibodies of relative specificity can be produced and due to the continuing improvement in the technology of applying antibodies to human therapy. Thus, the present invention contemplates the use of antibodies specific for VEGFR-2 (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, bifunctional/bispecific antibodies, humanized antibodies, human antibodies, and Complementarity Determining Region (CDR) grafted antibodies, including compounds containing CDR sequences that specifically recognize a polypeptide of the present invention). Human antibodies can also be produced using various techniques known in the art (including phage display libraries) [ Hoogenboom and Winter, j.mol.biol., 227: 381 (1991); marks et al, j.mol.biol., 222: 581(1991) ]. Cole et al and Boerner et al techniques can also be used to prepare human Monoclonal Antibodies (Cole et al, Monoclonal Antibodies and Cancer Therapy, Alan R.Liss, p.77 (1985) and Boerner et al, J.Immunol., 147 (1): 8695 (1991); similarly, human Antibodies can be prepared by introducing the human immunoglobulin locus into transgenic animals (e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated.) following challenge human antibody production is observed, which in all respects, including gene rearrangement, assembly and antibody repertoire, is very similar to that seen in humans. this method is described, for example, in U.S. Pat. Nos. 5,545,807, 5,812,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016; and in the following publications: Marks et al, biology/Technology, 1992, No. 10,859, Natherd 9777368; Fisherd et al, (36569; 1994,8813; Fisherd.),889, nature Biotechnology 14, 845-51 (1996); neuberger, Nature Biotechnology 14, 826 (1996); lonberg and huskzar, intern. rev. immunol.13: 65-93(1995).

PDGF inhibitor products

In some embodiments, the methods described herein optionally include administering a therapeutically active agent to inhibit PDGF binding to one or more of its receptors. The PDGF inhibitor product may be administered in combination with one or more of the ligand binding molecules described herein. In some embodiments, the PDGF inhibitor product and the ligand binding molecule are co-administered in a single composition. In other embodiments, the PDGF inhibitor product is administered as a separate composition and separately from the ligand binding molecule.

The term "PDGF" refers to platelet-derived growth factors that regulate cell growth or division. As used herein, the term "PDGF" includes the various subtypes of PDGF, including PDGF-B, PDGF-A, PDGF-C, PDGF-D, its variant forms, and its dimeric forms, including PDGF-AA, PDGF-AB, PDGF-BB, PDGF-CC, and PDGF-DD. Platelet-derived growth factors include homodimers or heterodimers of the a chain (PDGF-a) and the B chain (PDGF-B), which exert their effects via binding to and dimerization of the two related receptor tyrosine kinases, platelet-derived growth factor cell surface receptors (i.e., PDGFR) PDGFR- α and PDGFR- β. In addition, two additional protease activating ligands for the PDGFR complex, PDGF-C and PDGF-D, have been identified (Li et al, (2000) nat. cell. biol.2: 302-9; Bergsten et al, (2001) nat. cell. biol.3: 512-6; and Uutele et al, (2001) Circulation 103: 2242-47). Due to the different ligand binding specificities of PDGFR, it is known that PDGFR- α/α binds PDGF-AA, PDGF-BB, PDGF-AB and PDGF-CC; PDGFR-beta/beta binds PDGF-BB and PDGF-DD; whereas PDGFR- α/β binds PDGF-AB, PDGF-BB, PDGF-CC, and PDGF-DD (Betsholtz et al, (2001) BioEssays 23: 494-507). As used herein, the term "PDGF" also refers to those members of the class of growth factors that induce DNA synthesis and mitogenesis by responding to binding and activation of PDGFR on cell types. PDGF can affect, for example: directed cell migration (chemotaxis) and cell activation; activating phosphatidase; increased phosphatidylinositol conversion and prostaglandin metabolism; in response to stimulation of collagen and collagenase synthesis by cells; cellular metabolic activities include alterations in matrix synthesis, cytokine production, and lipoprotein uptake; (ii) indirectly inducing a proliferative response in a cell lacking a PDGF receptor; and potent vasoconstrictor activity. The term "PDGF" may be used to refer to a "PDGF" polypeptide, a gene or nucleic acid encoding "PDGF", or dimeric forms thereof.

The term "PDGF inhibitor product" refers to an agent that partially or completely reduces or inhibits the activity or production of PDGF. The PDGF inhibitor product may directly or indirectly reduce or inhibit the activity or production of a particular PDGF such as PDGF-B. In addition, a "PDGF inhibitor product" includes agents that act on PDGF ligands or their cognate receptors to reduce or inhibit PDGF-related receptor signaling. Examples of "PDGF inhibitor products" include antisense molecules, ribozymes, or RNAi that target PDGF nucleic acids; a PDGF aptamer, a PDGF antibody to PDGF itself or its receptor, or a soluble PDGF receptor decoy that prevents PDGF binding to its cognate receptor; an antisense molecule, ribozyme or RNAi targeting a homologous PDGF receptor (PDGFR) nucleic acid; PDGFR aptamers or PDGFR antibodies that bind to homologous PDGFR receptors; and PDGFR tyrosine kinase inhibitors.

In one embodiment, the PDGF inhibitor product is selected from the group consisting of: a compound of formula A, B, C, D or E, a p183 antibody, a CDP860, IMC-3G3, 162.62 antibody, 163.31 antibody, 169.14 antibody, 169.31 antibody, α R1 antibody, 2A1E2 antibody, mlts.11 antibody, mlts.22 antibody, Hyb 120.1.2.1.2 antibody, Hyb 121.6.1.1.1 antibody, Hyb 127.5.7.3.1 antibody, Hyb 127.8.2.2.2 antibody, Hyb 1.6.1 antibody, Hyb 1.11.1 antibody, Hyb 1.17.1 antibody, Hyb 1.18.1 antibody, Hyb 1.19.1 antibody, Hyb 1.23.1 antibody, Hyb 1.24 antibody, Hyb 1.25 antibody, Hyb 1.29 antibody, Hyb 1.33 antibody, Hyb 1.38 antibody, Hyb 1.39 antibody, Hyb 1.40 antibody, Hyb 1.45 antibody, Hyb 1.46 antibody, Hyb 1.48 antibody, Hyb 1.3548 antibody, Hyb 1.6.6.7 antibody, Hyb 366.6 antibody, Hyb 364 antibody, Hyb 366.366 antibody, Hyb 366.6 antibody, Hyb 364 antibody, Hyb 366.6.7 antibody, Hyb 366.6.6.7 antibody, Hyb 364 antibody, Hyb 366.6.7 antibody, Hyb 3 antibody, Hyb 3.6.7 antibody, Hyb 3, Hyb 3.7, Hyb 3.6.7, Hyb 3 antibody, Hyb 3.7 antibody, Hyb 3, Hyb 3.7, Hyb 3, Hyb 3.7, Hyb 3, Hyb 3, Hyb 3, Hyb 3, Hyb 3, an anti-mPDGF-C goat IgG antibody, a C3.1 antibody, a PDGFR-B1 monoclonal antibody, a PDGFR-B2 monoclonal antibody, a 6D11 monoclonal antibody, a Sis 1 monoclonal antibody, a PR7212 monoclonal antibody, a PR292 monoclonal antibody, a HYB 9610 monoclonal antibody, a HYB 9611 monoclonal antibody, a HYB 9612 monoclonal antibody or a HYB 9613 monoclonal antibody, or a pharmaceutically acceptable salt of any of the foregoing.

In a preferred embodiment, one or more ligand binding molecules described herein are administered in combination with a PDGFR- β antibody (such as an antibody developed by Regeneron inc. for an ocular indication) or an anti-PDGF aptamer (such as E10030 developed by Ophthotech inc. for an ocular indication).

Antibody fragments, such as VEGF-A and PGDF inhibitor products, including Fab, Fab ', F (ab') 2, Fv, scFv are also contemplated. The term "specific to" as used to describe the antibodies of the invention means that the variable region of the antibodies of the invention specifically recognizes and binds the polypeptide of interest (i.e., is capable of distinguishing the polypeptide of interest from other known polypeptides of the same family by virtue of a measurable difference in binding affinity, although there may be local sequence identity, homology or similarity between the family members). It will be appreciated that a specific antibody may also interact with other proteins (e.g. staphylococcus aureus (s. aureus) protein a or other antibodies in ELISA techniques), by interacting with sequences outside the variable region of the antibody and in particular in the constant region of the molecule. Screening assays for determining the binding specificity of the antibodies of the invention are well known in the art and are performed in a routine manner. For a thorough discussion of such analysis, see Harlow et al (editors), Antibodies a Laboratory Manual; a Cold Spring Harbor Laboratory; cold Spring Harbor, NY (1988), Chapter 6. The antibodies of the invention can be prepared using any method known in the art and practiced in a conventional manner.

In another embodiment, the methods described herein optionally comprise administering to the subject an antisense (e.g., antisense to VEGFR-2) nucleic acid molecule. Antisense nucleic acid molecules to a particular protein (e.g., VEGFR-2) can be used therapeutically to inhibit translation of mRNA encoding that protein (e.g., VEGFR-2), wherein a therapeutic target includes a desire to eliminate the presence or down-regulate the level of the protein. The VEGFR-2 antisense RNA may be used, for example, as a VEGFR-2 antagonist in the treatment of diseases in which VEGFR-2 is involved as a pathogen (e.g., inflammatory diseases).

An antisense nucleic acid comprises a nucleotide sequence that is complementary to a "sense" nucleic acid encoding a protein (e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence). (see, e.g., the VEGFR-3 cDNA sequence of SEQ ID NO: 1). Methods for designing and optimizing antisense nucleotides are described in Lima et al (J Biol Chem; 272: 626-38.1997) and Kurreck et al (Nucleic Acids Res.; 30: 1911-8.2002). In particular aspects, antisense nucleic acid molecules are provided that comprise a sequence that is complementary to at least about 10, 25, 50, 100, 250, or 500 nucleotides or the entire protein (e.g., VEGFR-2) coding strand or only a portion thereof. Also contemplated are nucleic acid molecules encoding fragments, homologs, derivatives, and analogs of a protein (e.g., VEGFR-2) or antisense nucleic acids complementary to a protein (VEGFR-2) nucleic acid sequence.

In one embodiment, the antisense nucleic acid molecule is antisense to a "coding region" of the coding strand of a nucleotide sequence encoding a protein, such as, for example, VEGFR-2. The term "coding region" refers to a region of a nucleotide sequence that contains codons that are translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is antisense to a "let step" region of the coding strand of a nucleotide sequence encoding a protein, such as, for example, VEGFR-2. The term "trafficking region" refers to 5 'and 3' sequences flanking the coding region that are not translated into amino acids (i.e., also referred to as 5 'and 3' untranslated regions).

Antisense nucleic acids of the invention can be designed according to Watson-Crick (Watson and Crick) or Hoogsteen base pairing rules. The antisense nucleic acid molecule may be complementary to the entire coding region of the protein mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or non-coding region of the protein mRNA. The antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides in length. Antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art. For example, antisense nucleic acids (e.g., antisense oligonucleotides) can be synthesized using chemical methods, using naturally occurring nucleotides or nucleotides that are variously modified to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids (e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used).

Examples of modified nucleotides that can be used to generate antisense nucleic acids include: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β -D-galactosylglucosides, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosyl braided glycoside, 5' -methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxoacetic acid (v), wybutoxosine, pseudouracil, braided glycoside, 2-thiocytosine, 5-methyl-2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxoacetic acid methyl ester, uracil-5-oxoacetic acid (v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w and 2, 6-diaminopurine. Alternatively, antisense nucleic acids can be produced biologically using expression vectors into which the nucleic acid has been subcloned in an antisense orientation.

Antisense nucleic acid molecules are typically administered to a subject or generated in situ such that they hybridize to or bind to cellular mRNA and/or genomic DNA encoding a protein (e.g., VEGFR-2), thereby inhibiting expression of the protein (e.g., by inhibiting transcription and/or translation). Hybridization can be by conventional nucleotide complementarity forming a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to a DNA duplex, by specific interactions in the major groove of the double helix structure.

In another embodiment, the protein RNA may be used to induce RNA interference (RNAi) using double stranded RNA (dsRNA) (Fire et al, Nature 391: 806-811.1998) or short interfering RNA (siRNA) sequences (Yu et al, Proc Natl Acad Sci U S A.99: 6047-52, 2002). "RNAi" is a process by which dsRNA induces homology-dependent degradation of complementary mRNA. In one embodiment, the nucleic acid molecules of the invention hybridize by complementary base pairing to the "sense" ribonucleic acids of the invention, thereby forming double-stranded RNA. dsRNA antisense and sense nucleic acid molecules corresponding to at least about 20, 25, 50, 100, 250, or 500 nucleotides or the entire protein (e.g., VEGFR-2) coding strand or only a portion thereof are provided. In another embodiment, the siRNA is 30 nucleotides or less in length, more preferably 21 to 23 nucleotides, with a characteristic 2 to 3 nucleotide 3' overhang, which is generated by rnase III cleavage from longer dsRNA. See, e.g., Tuschl T. (Nat Biotechnol.20: 446-48.2002). The preparation and use of RNAi compounds is described in U.S. patent publication No. 2004/0023390, the disclosure of which is incorporated herein by reference in its entirety.

Intracellular transcription of small RNA molecules can be achieved by cloning siRNA templates into RNA polymerase iii (pol iii) transcription units that typically encode small nuclear RNA (snrna) U6 or human RNAse P RNA H1. Two methods can be used to express siRNA: in one embodiment, the sense and antisense strands that make up the siRNA duplex are transcribed from separate promoters (Lee et al, nat. Biotechnol.20, 500-505.2002); in another embodiment, the siRNA is expressed as a stem-loop hairpin RNA structure that upon intracellular processing produces the siRNA (Brummelkamp et al, Science 296: 550-553.2002) (incorporated herein by reference).

dsRNA/siRNA is most often administered by annealing sense and antisense RNA strands in vitro prior to delivery to an organism. In an alternative embodiment, RNAi can be performed by administering the sense and antisense nucleic acids of the invention in the same solution without annealing prior to administration, and can even be performed by administering the nucleic acids contained in different vehicles in extremely close time periods. Also contemplated are nucleic acid molecules encoding fragments, homologs, derivatives, and analogs of proteins (such as, for example, VEGFR-2) or antisense nucleic acids complementary to mVEGFR-2 nucleic acid sequences.

Aptamers are another nucleic acid-based approach for interfering with the interaction of receptors and their cognate ligands (such as, for example, VEGFR-2 and VEGF-a, and PDGFR and PGDF). Aptamers are DNA or RNA molecules that have been selected from random pools based on their ability to bind other molecules. Aptamers have been selected that bind nucleic acids, proteins, small organic compounds and even whole organisms. Methods and compositions for identifying and making aptamers are known to those skilled in the art and are described, for example, in U.S. Pat. No. 5,840,867 and U.S. Pat. No. 5,582,981, each of which is incorporated herein by reference in its entirety.

Recent advances in the field of combinatorial science have identified short polymer sequences with high affinity and specificity for a given target. For example, SELEX technology has been used to identify DNA and RNA aptamers with binding properties that compete with mammalian antibodies, the field of immunology has generated and isolated antibodies or antibody fragments that bind to a myriad of compounds, and phage display has been used to find new peptide sequences with very favorable binding properties. Based on the success of these molecular evolution techniques, it is believed that molecules can be generated that bind to any target molecule. The loop back structure generally participates in providing the required binding properties, as in the following cases: naturally derived antibodies using combinatorial configurations of circular hypervariable regions and novel phage display libraries using cyclic peptides that show improved results when compared to linear peptide phage display library results are typically used with aptamers that have hairpin loops generated from short regions without complementary base pairs. Thus, there has been sufficient evidence that high affinity ligands can be generated and recognized by combinatorial molecular evolution techniques. For the purposes of the present invention, molecular evolution techniques can be used to isolate ligand binding molecules specific for the ligands described herein. For more information on Aptamers, see generally Gold, l., Singer, b., He, y.y., brody.e., "Aptamers As Therapeutic And Diagnostic Agents," j.biotechnol.74: 5-13(2000). Related techniques for producing aptamers can be found in U.S. Pat. No. 6,699,843, which is incorporated by reference in its entirety.

In some embodiments, aptamers may be produced by: preparing a nucleic acid library; contacting the library of nucleic acids with a growth factor, wherein nucleic acids having a higher binding affinity for the growth factor (relative to other library nucleic acids) are screened and amplified to produce a mixture of nucleic acids enriched for nucleic acids having a higher affinity and specificity for binding to the growth factor. The process can be repeated and the selected nucleic acids mutated and rescreened, thereby identifying growth factor aptamers.

In yet another variation, the VEGF-A inhibitor product comprises a soluble ECD fragment of VEGFR-1 that binds VEGF and inhibits binding of VEGF to VEGFR-2. In SEQ ID NO: 10 and SEQ ID NO: the cDNA and amino acid sequences of VEGFR-1 are set forth in FIG. 11. Exemplary ECD fragments of VEGFR-1 are described in U.S. patent publication No. 2006/0030000 and international patent publication No. WO 2005/087808, the disclosures of which are incorporated herein by reference in their entirety.

Anti-inflammatory agents

In another embodiment, the methods described herein optionally comprise administering one or more anti-inflammatory agents to the subject. In some embodiments, the anti-inflammatory agent and the ligand binding molecule are co-administered in a single composition. In other embodiments, the anti-inflammatory agent is administered as a separate composition from the ligand binding molecule. Combinations comprising a ligand binding molecule, a VEGF-a inhibitor product, and an anti-inflammatory agent are specifically contemplated. As used herein, the term "anti-inflammatory agent" generally refers to any agent that reduces inflammation or swelling in a subject. While a number of exemplary anti-inflammatory agents are recited herein, it should be understood that there may be other suitable anti-inflammatory agents not specifically recited herein, but encompassed by the present invention.

In one variation, the anti-inflammatory agent is a non-steroidal anti-inflammatory drug (NSAID). Exemplary NSAIDs include, but are not limited to: aspirin, Sulfasalazine^TM、Asacol^TM、Dipendtum^TM、Pentasa^TM、Anaprox^TM、Anaprox DS^TM(naproxen sodium); ansoid^TM(flurbiprofen); arthrotec^TM(diclofenac sodium + misoprostol); cataflam^TM/Voltaren^TM(diclofenac potassium); clinoril^TM(sulindac); daypro^TM(oxaprozin); disalcid^TM(disalicylate); dolobid^TM(diflunisal); EC Napro syn^TM(naproxen sodium); feldene^TM(piroxicam); indocin^TM、Indocin SR^TM(indomethacin); lodine^TM、Lodine XL^TM(etodolac); motrin^TM(ibuprofen); naprelan^TM(naproxen); naprosyn^TM(naproxen); orudis^TM(ketoprofen); oruvail^TM(ketoprofen); relafen^TM(nabumetone); tolectin^TM(tolmetin sodium); trilisate^TM(choline magnesium trisalicylate); a Cox-1 inhibitor; cox-2 inhibitors such as Vioxx^TM(rofecoxib); arcoxia (Arcoxia)^tm(Etoricoxib) and Celebrex^TM(celecoxib); mobic^TM(meloxicam); bextra^TM(valdecoxib), Dynastat^TMParecoxib sodium; prexige^TM(lumixim) and naproxone (nabumetone). Other suitable NSAIDs include, but are not limited to, the following: 5-aminosalicylic acid (5-ASA, mesalamine, lisapazine), □ -acetamidohexanoic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amitriptrine (amitriptine), anidazole (anitrazafen), antrofinine (antrafenine), bendazac (bendazac), bendazac lysine (bendazac lysine), benzydamine (benzydamine), bepromazine, bromopimol (bropamole), bucolone (bucolome), butylbenzoic acid (bufazolac), ciprofloxacin (ciquaprothone), cloxacetate (cloximate), daclizine (dazamine), beboxam (debaxamet), detomidine (pyridoxamine), diphenhydramine (diffenfamide), diniamidine (dinium), difloramine (difenoconazole), flufenazole (flufenazole), flufenazamide (flufenazamide), flufenazamide (flufenamate), flufenazamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide (flufenamide), flufenamide, Fluropaquinone (fluprozone), vopiroctone (fopirtolone), fossalate (fosfosfosfosfosfamil), guamerosal (guaimesal), guaiazolene, isonixin, leflunomide (lefetamine HCl), leflunomide (leflunomide), lofeimidazole (lofemizole), lotifazole (lotifazole), lysine chloronicotinate (lysin clonicinate), mesalazone (mesclazone), nabumetone (nabumetone), nicontindole (nicendole), Nimesulide (Nimesulide), superoxide (orgotein), oxyphenosine (orpanoxin), oxaprolone (oxaepreprepirol), oxaprodol (oxaproxol), ryptin (piperacillin), piperazinone (piperazinone), piroxicam (pirenoxime), piroxicam (pirfenidone), piroxicam (piroxicam), piroxicam (piperazinone (piperazone), piroxicam (piroxicam), piroxicam (propiconazole), and piroxicam (piroxicam), propiconazole (propiconazole), and piroxicam) in (propiconazole), or a) and a ne), propiconazole (proxazole), thielavin B, tefluimidazole (tiflamizole), timegadine (timegadine), tolmetin (tollectin), tolpadol (tolpadol), triptamex (tryptamide) and those named by company numbers such as: 480156S, AA861, AD1590, AFP802, AFP860, AI77B, AP504, AU8001, BPPC, BW540C, CHINOIN 127, CN100, EB382, EL508, F1044, FK-506, GV3658, ITF182, KCNTEI6090, KME4, LA2851, MR714, MR897, MY309, ONO3144, PR823, PV102, PV108, R830, RS2131, SCR152, SH440, SIR133, SPAS510, SQ27239, ST281, SY6001, TA60, TAI-901 (4-benzoyl-1-indane formic acid), TVX2706, U60257, UR2301 and WY 41770.

In another variation, the anti-inflammatory agent comprises a compound that inhibits the interaction of inflammatory cytokines and their receptors. Examples of cytokine inhibitors that may be used in combination with a specific binding agent of the invention include, for example, antagonists (e.g., antibodies) to TGF- α (e.g., Remicade), and antagonists (e.g., antibodies) to interleukins involved in inflammation. Such interleukins are described herein and preferably include, but are not limited to, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-8, IL-9, IL-12, IL-13, IL-17, and IL-18. See Feghali et al, Frontiers in biosci, 2: 12-26(1997).

In another variation, the anti-inflammatory agent is a corticosteroid. Exemplary corticosteroids include, but are not limited to: difluoropine diacetate (diflorasone diacetate), clobetasol propionate, halobetasol propionate, betamethasone dipropionate, budesonide (budesonide), cortisone (cortisone), dexamethasone, fluocinonide (fluocinonide), halcinonide (halcinonide), desoximethasone (desoximethasone), triamcinolone, fluticasone propionate (fluticasone propionate), fluocinonide (fluandrenolide), mometasone furoate (mometasone furoate), betamethasone (betamethasone), fluticasone propionate, fluocinonide, beclomethasone dipropionate (acetolomethasone dipropionate), methylprednisolone, prednisolone, prednisone, triamcinolone, desonide and hydrocortisone.

In another variation, the anti-inflammatory agent is cyclosporine.

Antibiotic

In another embodiment, the methods described herein optionally further comprise administering an antibiotic to the subject. In some embodiments, the antibiotic and the ligand binding molecule are co-administered in a single composition. In other embodiments, the antibiotic is administered as a separate composition from the ligand binding molecule. Exemplary antibiotics include, but are not limited to: tetracycline, amifostide, penicillin, cephalosporin, sulfa drugs, chloramphenicol sodium succinate, erythromycin, vancomycin, lincomycin, clindamycin, nystatin, amphotericin B, amantadine, idoxuridine, para-aminosalicylic acid, isoniazid, rifampin, actinomycin D, mithramycin, daunorubicin, doxorubicin, bleomycin, vinblastine, vincristine, procarbazine, and imidazole carboxamide.

Tyrosine kinase inhibitors

In another embodiment, the methods described herein optionally further comprise administering a tyrosine kinase inhibitor that inhibits VEGFR-2 and/or VEGFR-3 activity.

Exemplary tyrosine kinase inhibitors for use in the methods described herein include, but are not limited to: AEE788(TKI, VEGFR-2, EGFR: Novartis); ZD6474(TKI, VEGFR-1, -2, -3, EGFR: vandetanib: AstraZeneca); AZD2171(TKI, VEGFR-1, -2: AstraZeneca); SU 11248(TKI, VEGFR-1, -2, PDGFR: sunitinib: Pfizer); AG13925(TKI, VEGFR-1, -2: Pfizer); AG013736(TKI, VEGFR-1, -2: Pfizer); CEP-7055(TKI, VEGFR-1, -2, -3: Cephalon); CP-547, 632(TKI, VEGFR-1, -2: Pfizer); GW7S6024(TKL VEGFR-1, -2, -3: GlaxoSmithKline); GW786034(TKI, VEGFR-1, -2, -3: GlaxoSmithKline); sorafenib (TKI, Bay 43-9006, VEGFR-1, -2, PDGFR: Bayer/Onyx); SU4312(TKI, VEGFR-2, PDGFR: Pfizer); AMG706(TKI, VEGFR-1, -2, -3: Amgen); XL647(TKI, EGFR, HER2, VEGFR, ErbB 4: Exelix); XL999(TKl, FGFR, VEGFR, PDGFR, Fll-3: Exelixis); PKC412(TKI, KIT, PDGFR, PKC, FLT3, VEGFR-2: Novartis); AEE788(TKI, EGFR, VEGFR2, VEGFR-1: Novartis); OSI-030(TKI, c-kil, VEGFR: OSI Pharmaceuticals); OS1-817(TKI c-kit, VEGFR: OSI Pharmaceuticals); DMPQ (TKI, ERGF, PDGFR, erbb2.p56.pka, pkC); MLN518(TKI, Flt3, PDGFR, c-KIT (T53518: Millennium Pharmaceuticals), lesaurinib (TKI, FLT3, CEP-701, Cephalon), ZD 1839(TKI, EGFR: gefitinib, Iressa: AstraZcneca), OSI-774(TKI, EGFR: erlotinib: Tarceva: OSI Pharmaceuticals), lapatinib (TKI, ErbB-2, EGFR, and GD-2016: Tacker: GlaxoSmithKline).

In some embodiments, the methods described herein further comprise administering to the subject a tyrosine kinase inhibitor that inhibits angiogenesis. Exemplary anti-angiogenic tyrosine kinase inhibitors and targets thereof are provided in table 2 below.

In an embodiment, the ligand binding molecules of the invention are administered in combination with a PDGF inhibitor product and a VEGF-a inhibitor product. For example, a ligand binding molecule (such as one comprising the amino acid sequence of SEQ ID NO: 3) can be conjugated to (i) Abbericept

And (ii) PDGFR antibodies (such as those developed by Regeneron inc. for ocular indications) or PDGF aptamers (such as E10030 (Fovista) developed by ophthtech inc. for ocular indications^TM) ) combined administration.

Administration of combination therapy

Combination therapy in combination with one or more other active agents described herein can be achieved by administering to a subject a single composition or pharmaceutical formulation comprising the ligand-binding molecule and the one or more other active agents, or by administering to the subject two (or more) different compositions or formulations simultaneously, wherein one composition comprises the ligand-binding molecule and the other composition comprises the other active agent.

Alternatively, combination therapy with the ligand binding molecules described herein may precede or follow treatment with the second agent at intervals ranging from minutes to weeks. In embodiments where the second agent and ligand-binding molecule are administered separately, it will generally be ensured that an effective period of time does not expire between each delivery, such that the agent and ligand-binding molecule will still be able to exert a favorable combined effect. In such cases, it is contemplated that the two forms will be administered within about 12-24 hours of each other, more preferably within about 6-12 hours of each other, and most preferably, the delay time is only about 12 hours. However, in some cases, it may be desirable to significantly extend the period of treatment, with days (2, 3, 4, 5, 6, or 7 days) to weeks (1, 2, 3, 4, 5, 6, 7, or 8 weeks) between respective administrations. Repeated treatments with one or both agents are specifically contemplated.

Formulations and pharmaceutically acceptable carriers

The invention also provides pharmaceutical compositions comprising the ligand binding molecules of the invention. Such compositions comprise a therapeutically effective amount of one or more ligand binding molecules and a pharmaceutically acceptable carrier. In one embodiment, such compositions comprise one or more ligand binding molecules and optionally one or more other active agents (in the case of combination therapy). In one embodiment, such compositions comprise one or more ligand binding molecules and optionally one or more other active agents selected from the group consisting of PDGF inhibitor products and VEGF-a inhibitor products. In another embodiment, a composition comprising one or more ligand binding molecules of the invention and another composition comprising a PDGF inhibitor product or a VEGF-a inhibitor product are administered.

The term "pharmaceutically acceptable" means approved by a regulatory agency of the federal or a state government or listed in the U.S. pharmacopeia (u.s.pharmacopeia) or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. If desired, the compositions may also contain minor amounts of wetting or emulsifying agents or pH buffering agents.

The compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, granules, gels (including hydrogels), pastes, ointments, creams, delivery devices, sustained release formulations, suppositories, injections, implants, sprays, drops, aerosols, and the like. Compositions comprising a ligand binding molecule, one or more additional active agents, or both, may be formulated in accordance with conventional Pharmaceutical Practice (see, e.g., Remington: The Science and Practice of Pharmacy (20 th edition), eds. A.R. Gennaro, 2000, Lippincott Williams & Wilkins, Philadelphia, Pa., e.g., Encyclopedia of Pharmaceutical Technology, eds. J.Swarbrick and J.C. Boylan, 1988-2002, Marcel Dekker, New York). Examples of suitable Pharmaceutical carriers are described by martin "Remington's Pharmaceutical Sciences".

Administration of the composition can be by any suitable means that results in an amount of ligand binding molecule and/or other active agent effective to treat or prevent the particular disease or condition. Each ligand binding molecule may, for example, be mixed with a suitable carrier material and is typically present in an amount of from 1 to 95% by weight, based on the total weight of the composition. The compositions can be provided in a dosage form suitable for ophthalmic, oral, parenteral (e.g., intravenous, intramuscular, subcutaneous), rectal, transdermal, nasal, or inhalation administration. In one embodiment, the composition is in a form suitable for direct injection into the eye.

The ligand binding molecules of the present invention, and if present in combination therapy, one or more other active agents may be formulated in neutral or salt form. Pharmaceutically acceptable salts include those formed with free hydrogen groups, such as salts derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, and the like; and those formed with free carboxyl groups, such as salts derived from sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine (procaine), and the like.

The ligand binding molecules and other active agents of the present invention may have functional groups that are sufficiently basic to be capable of reacting with any of a number of inorganic and organic acids to form pharmaceutically acceptable salts. As is well known in the art, pharmaceutically acceptable acid addition salts are formed from pharmaceutically acceptable acids. Such salts include the pharmaceutically acceptable salts listed in the following: journal of Pharmaceutical Science, 66, 2-19(1977) and The Handbook of Pharmaceutical Salts; properties, Selection, and use, p.h.stahl and c.g.wermuth (ed.), Verlag, zurich (switzerland)2002, which are incorporated herein by reference in their entirety.

Pharmaceutically acceptable salts include sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, pamoate, phenylacetate, trifluoroacetate, acrylate, chlorobenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, methylbenzoate, o-acetoxybenzoate, naphthalene-2-benzoate, salts of benzoic acid, salts of benzoic acid, salts of benzoic acid, salts of benzoic acid, salts of benzoic acid, salts of benzoic acid, isobutyrate, phenylbutyrate, alpha-hydroxybutyrate, butyne-1, 4-dicarboxylate, hexyne-1, 4-dicarboxylate, decanoate, octanoate, cinnamate, glycolate, heptanoate, hippurate, malate, hydroxymaleate, malonate, mandelate, methanesulfonate, nicotinate, phthalate, terephthalate, propiolate, propionate, phenylpropionate, sebacate, suberate, p-bromobenzenesulfonate, chlorobenzenesulfonate, ethylsulfonate, 2-isethionate, methylsulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, naphthalene-1, 5-sulfonate, xylenesulfonate, and tartrate.

The term "pharmaceutically acceptable salts" also refers to salts of ligand binding molecules and other active agents with bases that have acidic functional groups, such as carboxylic acid functional groups. Suitable bases include, but are not limited to: hydroxides of alkali metals such as sodium, potassium and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals such as aluminum and zinc; ammonia and organic amines such as unsubstituted or hydroxy-substituted mono-, di-or trialkylamines, dicyclohexylamines; tributylamine; pyridine; n-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-or tris- (2-OH-lower alkyl amines) such as mono-, bis-or tris- (2-hydroxyethyl) amine, 2-hydroxy-tert-butylamine or tris (hydroxymethyl) methylamine, N' N-di-lower alkyl-N (hydroxy-lower alkyl) -amines such as N, N-dimethyl-N- (2-hydroxyethyl) amine or tris- (2-hydroxyethyl) amine; N-methyl-D-glucamine; and amino acids such as arginine, lysine, and the like. The term "pharmaceutically acceptable salt" also includes hydrates of the compounds of the present invention.

In one useful aspect, the composition is administered parenterally (e.g., by intramuscular, intraperitoneal, intravenous, intraocular, intravitreal, retrobulbar, subconjunctival, intracapsular or subcutaneous injection or implantation) or systemically. Formulations for parenteral or systemic administration include sterile aqueous or non-aqueous solutions, suspensions or emulsions. Various aqueous carriers can be used, for example, water, buffered water, saline, and the like. Examples of other suitable vehicles include polypropylene glycol, polyethylene glycol, vegetable oils, gelatin, hydrogels, hydrogenated naphthalenes, and injectable organic esters such as ethyl oleate. Such formulations may also contain auxiliary substances, such as preserving, wetting, buffering, emulsifying and/or dispersing agents. Biocompatible biodegradable lactide polymers, lactide/glycolide copolymers or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of the active ingredient.

Alternatively, the composition may be administered orally. Compositions intended for oral administration may be prepared in solid or liquid form according to any method known in the art for the manufacture of pharmaceutical compositions.

Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules. Typically, these pharmaceutical formulations comprise the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients. These include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, sucrose, glucose, mannitol, cellulose, starch, calcium phosphate, sodium phosphate, kaolin, and the like. Binders, buffers, and/or lubricants (e.g., magnesium stearate) may also be used. Tablets and pills may additionally be prepared with an enteric coating. The compositions may optionally include sweetening agents, flavoring agents, coloring agents, flavoring agents, and preserving agents to provide a more palatable preparation.

The solid dosage forms may be used to treat ocular disorders. Compositions useful for ophthalmic use include tablets comprising a mixture of one or more ligand binding molecules and a pharmaceutically acceptable excipient. These excipients may be, for example, inert diluents or fillers (e.g., sucrose and sorbitol), lubricants, glidants, and antiadherents (e.g., magnesium stearate, zinc stearate, stearic acid, silica, hydrogenated vegetable oils, or talc).

The compositions of the present invention may be administered intraocularly by intravitreal injection into the eye as well as by subconjunctival and intrafascial injection into the eye. Other routes of administration include transscleral, retrobulbar, intraperitoneal, intramuscular, and intravenous. Alternatively, the composition may be administered using a drug delivery device or intraocular implant.

Liquid dosage forms for oral administration may include pharmaceutically acceptable emulsions, solutions, suspensions, syrups and soft gelatin capsules. These forms may contain inert diluents commonly used in the art, such as aqueous or oily media, and may also include adjuvants, such as wetting agents, emulsifying agents, and suspending agents.

In some cases, the composition may also be administered topically, for example, by patch or by direct application to an area susceptible to or affected by a neovascular disorder, such as the epidermis or the eye, or by iontophoresis.

In the case of the combination therapies of the present invention, the ligand binding molecule and one or more other active agents may be mixed in a tablet or other vehicle, or may be dispensed. In one embodiment, the ligand binding molecule is contained within the interior of the tablet and one other active agent is located on the exterior such that a substantial portion of the other active agent is released prior to the release of the contained ligand binding molecule.

In one embodiment, a composition comprising a ligand binding molecule (and optionally one or more other active agents) may comprise one or more pharmaceutically acceptable excipients. In one embodiment, such excipients include, but are not limited to, buffers, nonionic surfactants, preservatives, osmotic agents, amino acids, sugars, and pH adjusting agents. Suitable buffering agents include, but are not limited to, sodium dihydrogen phosphate, disodium hydrogen phosphate, and sodium acetate. Suitable nonionic surfactants include, but are not limited to, polyoxyethylene sorbitan fatty acid esters such as polysorbate 20 and polysorbate 80. Suitable preservatives include, but are not limited to, benzyl alcohol. Suitable osmotic agents include, but are not limited to, sodium chloride, mannitol, and sorbitol. Suitable saccharides include, but are not limited to, alpha-trehalose dehydrate. Suitable amino acids include, but are not limited to, glycine and histidine. Suitable pH adjusters include, but are not limited to, hydrochloric acid, acetic acid, and sodium hydroxide. In one embodiment, the one or more pH adjusting agents are present in an amount effective to provide a pH of from about 3 to about 8, from about 4 to about 7, from about 5 to about 6, from about 6 to about 7, or from about 7 to about 7.5. In one embodiment, the composition comprising the ligand binding molecule does not comprise a preservative. In another embodiment, the composition comprising the ligand binding molecule does not comprise an antibacterial agent. In another embodiment, the composition comprising the ligand binding molecule does not comprise an antibiotic agent.

In one embodiment, the composition comprising the ligand binding molecule (and optionally one or more other active agents) is in the form of an aqueous solution suitable for injection. In one embodiment, the composition comprises a ligand binding molecule, a buffer, a pH adjusting agent, and water for injection. In another embodiment, the composition comprises a ligand binding molecule, monobasic sodium phosphate, dibasic sodium phosphate, sodium chloride, hydrochloric acid, and sodium hydroxide. In another embodiment, a composition comprises a ligand binding molecule, a phosphate salt (e.g., sodium dihydrogen phosphate), trehalose, sodium chloride, and a polysorbate.

Aqueous compositions useful for practicing the methods of the invention in the ocular environment have ophthalmically compatible pH and osmolality. One or more ophthalmically acceptable pH adjusting agents and/or buffering agents may be included in the compositions of the present invention, including acids such as acetic acid, boric acid, citric acid, lactic acid, phosphoric acid and hydrochloric acid; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate and sodium lactate; and buffers such as citrate/dextrose, sodium bicarbonate, and ammonium chloride. Such acids, bases and buffers are included in amounts necessary to maintain the pH of the composition within an ophthalmically acceptable range. One or more ophthalmically acceptable salts may be included in the composition in an amount sufficient to provide a degree of penetration of the composition within an ophthalmically acceptable range. Such salts include those having a sodium, potassium or ammonium cation and a chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anion.

In some embodiments, a composition comprising a ligand binding molecule of the invention is formulated for delivery to the eye of a subject. Suitable ophthalmic carriers are known to those skilled in the art and all such conventional carriers can be used in the present invention. Exemplary compounds that are incorporated to facilitate and expedite transdermal delivery of the topical composition to ocular or accessory tissues include, but are not limited to: alcohols (ethanol, propanol and nonanol), fatty alcohols (lauryl alcohol), fatty acids (valeric acid, caproic acid and capric acid), fatty acid esters (isopropyl myristate and isopropyl caproate), alkyl esters (ethyl acetate and butyl acetate), polyols (propylene glycol, propanedione and hexanetriol), sulfoxides (dimethyl sulfoxide and decylmethyl sulfoxide), amides (urea, dimethylacetamide and pyrrolidone derivatives), surfactants (sodium lauryl sulfate, cetyltrimethylammonium bromide, poloxamers (polaxamers), spans, tweens, bile salts and lecithin), terpenes (d-limonene, alpha-terpineol, 1, 8-cineole and menthone) and alkanones (n-heptane and n-nonane). In addition, the topically administered compositions comprise surface adhesion molecule modulators, including but not limited to cadherin antagonists, selectin antagonists, and integrin antagonists. Thus, a particular carrier may take the form of a sterile ophthalmic ointment, cream, gel, solution or dispersion. Sustained release polymers such as "oculert" polymers, "Hydron" polymers, and the like are also included as suitable ophthalmic carriers.

Exemplary ophthalmic viscosity enhancing agents that may be used in the present formulations include: sodium carboxymethylcellulose; methyl cellulose; hydroxypropyl cellulose; hydroxypropyl methylcellulose; hydroxyethyl cellulose; polyethylene glycol 300; polyethylene glycol 400; polyvinyl alcohol; and povidone.

Some natural products, such as magnesium aluminum silicate (veegum), alginates, xanthan gum, gelatin, gum arabic, and tragacanth, may also be used to increase the viscosity of ophthalmic solutions.

Tonicity is important because hypotonic eye drops cause edema of the cornea, while hypertonic eye drops cause deformation of the cornea. The ideal tonicity is about 300 mOsM. The tonicity can be determined by methods known to those skilled in the art described in Remington: the Science and Practice of Pharmacy.

Stabilizers such as, for example, chelating agents, e.g., EDTA, may also be used. Antioxidants such as sodium bisulfite, sodium thiosulfite, 8-hydroxyquinoline or ascorbic acid may also be used. The sterility of aqueous formulations will typically be maintained by conventional ophthalmic preservatives (e.g., chlorobutanol, benzalkonium chloride, cetylpyridinium chloride, phenyl mercuric salts, thimerosal, etc.), and such preservatives are used in non-toxic amounts and typically vary from about 0.001% to about 0.1% by weight of the aqueous solution. Conventional preservatives for ointments include methyl paraben and propyl paraben. Typical ointment bases include white petrolatum and mineral oil or liquid petrolatum. However, preserved aqueous carriers are preferred. The solution may be delivered manually into the eye in a suitable dosage form, such as eye drops, or by suitable droplet or spray devices which typically provide metered doses of the drug. Examples of suitable ophthalmic carriers include substantially isotonic sterile aqueous solutions containing small amounts (i.e., less than about 5% by weight) of hydroxypropyl methylcellulose, polyvinyl alcohol, carboxymethyl cellulose, hydroxyethyl cellulose, glycerin, and EDTA. The solution is preferably maintained at a substantially neutral pH and is isotonic with appropriate amounts of conventional buffers such as phosphate, borate, acetate, tris.

In some embodiments, the penetration enhancer is added to the ophthalmic vehicle.

The amount of ligand binding molecule that will be effective for its intended therapeutic use can be determined by standard clinical techniques according to the present specification. In addition, in vitro assays may optionally be employed to help determine optimal dosage ranges. The amount of ligand binding molecule mixed with the carrier material to produce a single dose can vary depending on the mammal being treated and the particular mode of administration.

The dosage of the ligand binding molecule may depend on several factors, including the severity of the condition (whether the condition is to be treated or prevented) and the age, weight and health of the individual to be treated. In addition, pharmacogenomic (the effect of genotype on the pharmacokinetic, pharmacodynamic, or efficacy profile of a therapeutic) information about a particular patient may influence the dosage used. In addition, the exact individual dosage may be adjusted somewhat depending on a variety of factors including the particular combination therapy administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disease being treated (e.g., the particular ocular disorder being treated), the severity of the disorder, and the anatomical location of the neovascular disorder. Some variation in dosage may be expected.

Typically, when administered orally to a mammal, the ligand binding molecules of the invention are typically administered at a dose of 0.001 mg/kg/day to 100 mg/kg/day, 0.01 mg/kg/day to 50 mg/kg/day, or 0.1 mg/kg/day to 10 mg/kg/day. Typically, when administered orally to a human, the dose of an antagonist of the invention is typically from 0.001 mg/day to 300 mg/day, from 1 mg/day to 200 mg/day, or from 5 mg/day to 50 mg/day. Doses up to 200 mg/day may be necessary.

For administration of the antagonists of the invention by parenteral injection, the dosage is typically from 0.1 mg/day to 250 mg/day, from 1 mg/day to 20 mg/day, or from 3 mg/day to 5 mg/day. Four injections per day are possible.

Typically, the dosage of ligand binding molecules for use in the present invention is typically from 0.1 mg/day to 1500 mg/day, or from 0.5 mg/day to 10 mg/day, or from 0.5 mg/day to 5 mg/day, when administered orally or parenterally. Doses up to 3000 mg/day may be administered.

When administered to a human ophthalmically (e.g., intravitreally), the dose of ligand-binding molecule administered per eye is typically in the range of 0.003mg, 0.03mg, 0.1mg, or 0.5mg to 5.0mg, 4mg, 3mg, 2mg, or 1mg, or 0.5mg to 1.0 mg. The dosage of ligand binding molecule is generally in the following range: 0.003mg to 5.0mg per eye, or 0.03mg to 4.0mg per eye, or 0.1mg to 4.0mg per eye, or 0.03mg to 3.0mg per eye, or 0.1mg to 1.0mg per eye, or 0.5mg to 4.0mg per eye, or 0.5mg to 3.0mg per eye, 0.5mg to 2.0mg per eye, or 1.0mg to 4.0mg per eye, or 1.0mg to 3.0mg per eye, or 1.0mg to 2.0mg per eye. In some embodiments, the ligand binding molecule is administered at a concentration of about 1mg, or about 2mg, or about 3mg, or about 4mg, or about 5mg, or about 6mg per eye per administration. In some embodiments, the ligand binding molecule is present in a volume of 10. mu.l, 15. mu.l, 20. mu.l, 25. mu.l, 30. mu.l, 35. mu.l, 40. mu.l, 45. mu.l, 50. mu.l, 60. mu.l, 70. mu.l, 80. mu.l, 90. mu.l, 95. mu.l or 100. mu.l at any of the concentrations listed above. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4mg/50 μ l. The dose volume may range from 0.01mL to 0.2mL per eye, or from 0.03mL to 0.15mL per eye, or from 0.05mL to 0.10mL per eye.

In some embodiments, when administered by intravitreal injection, the ligand binding molecule is administered at a concentration of about 2mg to about 4mg per eye (or about 1mg to about 3mg, or about 1mg to about 4mg, or about 3mg to about 4mg, or about 1mg to about 2mg per eye). In some embodiments, the ligand binding molecule is administered at a concentration of about 1mg, or about 2mg, or about 3mg, or about 4mg, or about 5mg, or about 6mg per eye. In some embodiments, the ligand binding molecule is present in a volume of 10. mu.l, 15. mu.l, 20. mu.l, 25. mu.l, 30. mu.l, 35. mu.l, 40. mu.l, 45. mu.l, 50. mu.l, 60. mu.l, 70. mu.l, 80. mu.l, 90. mu.l, 95. mu.l or 100. mu.l at any of the concentrations listed above. In some embodiments, the ligand binding molecule is administered at a concentration of about 2-4mg/50 μ l.

Generally, suitable dosages for intravenous administration will range generally from about 50 to 5000 micrograms of active compound per kilogram of body weight. Suitable dosages for intranasal administration typically range from about 0.01pg/kg body weight to 1mg/kg body weight. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

For systemic administration, the therapeutically effective dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes IC50 as determined in cell culture. This information can be used to more accurately determine useful doses in humans. Initial doses can also be estimated from in vivo data, such as animal models, using techniques well known in the art. Administration to humans can be readily optimized by one of ordinary skill in the art based on animal data.

In individually adjusted doses and time intervals to provide plasma levels of the compound sufficient to maintain a therapeutic effect. In the case of topical administration or selective uptake, the effective local concentration of the compound may be independent of the plasma concentration. One skilled in the art will be able to optimize therapeutically effective local dosages without undue experimentation.

The amount of compound administered will, of course, depend on the subject being treated, the weight of the subject, the severity of the affliction, the mode of administration and the judgment of the prescribing physician. Treatments may be repeated intermittently when symptoms are detectable or even when they are not. The treatment may be provided alone or in combination with other drugs.

Administration of the ligand binding molecule and other agents (when present in combination therapy) may independently be one to four times daily or one to four times monthly or one to six times per year or once every two, three, four or five years. The duration of administration may be one day or one month, two months, three months, six months, one year, two years, three years, and may even be the lifetime of the patient. In one embodiment, the administration is performed once a month for three months. Chronic long-term administration will be required in many cases. The dose may be administered as a single dose or divided into multiple doses. In general, the desired dose should be administered at set intervals over an extended period of time, usually at least up to several weeks or months, but longer administration periods of months or years or more may also be required.

In addition to treating existing conditions, the compositions can be administered prophylactically to prevent or slow the onset of such conditions. In prophylactic applications, the compositions may be administered to a patient susceptible to or otherwise at risk of a particular disorder, such as an ocular disorder.

Route of administration

Compositions containing the ligand binding molecules described herein can be administered to a patient in a variety of ways depending, in part, on the type of agent to be administered and the patient's medical history, risk factors, and symptoms. Routes of administration suitable for use in the methods of the invention include systemic administration and topical administration. As used herein, the term "systemic administration" means a mode of administration that results in delivery of a pharmaceutical composition to substantially all of the body of a patient. Exemplary modes of systemic administration include, but are not limited to, intravenous injection and oral administration. As used herein, the term "local administration" means a mode of administration that results in significantly more of the pharmaceutical composition being delivered to and around the eye (or tumor or other target tissue) than areas away from the eye (or tumor or other target tissue).

Systemic and local routes of administration that may be used in the methods of the present invention include, but are not limited to: performing intragastric administration; intravenous injection; performing intraperitoneal injection; intramuscular injection; subcutaneous injection; transdermal diffusion and electrophoresis; external eye drops and ointments; periocular and intraocular injections, including subconjunctival injections; an extended release delivery device comprising a locally implanted extended release device; as well as intraocular and periocular implants, including bioerodible and reservoir-based implants.

Thus, in one aspect, a method of treating an ocular disorder associated with retinal neovascularization is carried out by topically administering to a subject a ligand-binding molecule. For example, in some embodiments, the pharmaceutical composition comprising the ligand binding molecule is administered topically, or by local injection (e.g., by intraocular (e.g., intravitreal) injection), or released from an intraocular or periocular implant such as a bioerodible or reservoir-based implant. The composition is preferably administered in an amount effective to inhibit binding of VEGF-C and/or VEGF-D in the eye of the subject to, or stimulate expression of VEGFR-2 and/or VEGFR-3 in cells of the eye or blood vessels of the eye.

In the case of combination therapy, administration of the ligand binding molecule and other agents may be sequential or simultaneous in time. When administered sequentially, each may be administered by the same or different route. In one embodiment, the additional agent (e.g., VEGF-a or PDGF inhibitor product) is administered within 90 days, 30 days, 10 days, 5 days, 24 hours, 1 hour, 30 minutes, 10 minutes, 5 minutes, or within one minute after administration of the ligand binding molecule. Where the additional agent is administered prior to the ligand binding molecule, the ligand binding molecule is administered in an amount and over a period of time such that the total amount of the additional agent and the ligand binding molecule is effective to treat or prevent the target indication, e.g., an ocular disorder. When the ligand binding molecule is administered before the other agent, the other agent is administered in an amount over a period of time such that the total amount of the other agent and the ligand binding molecule is effective to treat or prevent the target indication, e.g., an ocular disorder.

The pharmaceutical compositions according to the invention may be formulated to release the ligand binding molecule and optionally other agents in combination therapy substantially immediately after administration or using a controlled release formulation at any predetermined time period after administration. For example, the pharmaceutical composition may be provided in a sustained release form. The use of immediate or sustained release compositions depends on the nature of the condition being treated. If the condition consists of an acute disorder, the immediate release form can be used for treatment rather than a long-term release composition. Sustained release compositions may also be suitable for certain prophylactic or long term treatments.

It is useful to administer the ligand-binding molecule or ligand-binding molecule and one or more other agents in a controlled release formulation, wherein the ligand-binding molecule, alone or in combination, has (i) a narrow therapeutic index (e.g., there is little difference between plasma concentrations that produce adverse side effects or toxic reactions and plasma concentrations that produce a therapeutic effect; typically, the therapeutic index TI is defined as the ratio of the semi-lethal dose (LD50) to the semi-effective dose (ED 50)); (ii) a narrow absorption window in the gastrointestinal tract; or (iii) short biological half-life, thus requiring frequent dosing during the day in order to maintain plasma concentrations at therapeutic levels.

Many strategies can be implemented to obtain controlled release, wherein the release rate of the active component exceeds its degradation or metabolism rate. For example, controlled release may be obtained by appropriate selection of formulation parameters and ingredients, including, for example, appropriate controlled release compositions and coatings. Examples include single unit or multiple unit tablet or capsule compositions, oil solutions, suspensions, emulsions, microcapsules, microspheres, nanoparticles, patches, and liposomes. Methods for preparing such sustained or controlled release formulations are well known in the art.

Drug delivery devices such as implants may also be used to deliver the ligand binding molecules and other agents, if present. As used herein, the term "implant" refers to any material that does not significantly migrate from the insertion site after implantation. The implant may be biodegradable, non-biodegradable or composed of biodegradable and non-biodegradable materials. The non-biodegradable implant may include a refillable reservoir if necessary. Implants useful in the methods of the invention include, for example, patches, particles, flakes, plaques, microcapsules, and the like, and can be of any shape and size compatible with the selected insertion site, which can be, but is not limited to, the posterior chamber, anterior chamber, suprachoroid, or subconjunctival. It will be appreciated that the implants useful in the present invention generally release the implanted pharmaceutical composition to the eye of the patient in an effective dose for an extended period of time.

Various ocular implants and extended release formulations suitable for ocular release are well known in the art, as described, for example, in U.S. Pat. nos. 5,869,079 and 5,443,505, the disclosures of which are incorporated herein by reference in their entirety. The ocular drug delivery device may be inserted into a chamber of the eye, such as the anterior or posterior chamber, or may be implanted in or on the sclera, the choroidal space, or an avascular region outside the vitreous. In one embodiment, the implant may be positioned on an avascular region, such as the sclera, so as to allow transscleral diffusion of the ligand binding molecule and any other agents to the desired treatment site, such as the intraocular space and the macula of the eye. In addition, the site of transscleral spreading may be close to the site of neovascularization, such as near the macula. Suitable drug delivery devices are described, for example, in U.S. publication nos. 2008/0286334; 2008/0145406 No. C; 2007/0184089 No. C; 2006/0233860 No. C; 2005/0244500 No. C; 2005/0244471 No. C; and 2005/0244462, and U.S. patent nos. 6,808,719 and 5,322,691, the contents of each of which are incorporated herein by reference in their entirety.

In other embodiments, the ligand binding molecules described herein are administered to the eye via a liposome. In another embodiment, the ligand binding molecule is contained within a continuous release device or a selective release device, e.g., a membrane, such as, but not limited to, in Ocusert^TMThose employed in System (Alza Corp., Palo Alto, Calif.). As another embodiment, the ligand binding molecule is contained within, carried by, or attached to a contact lens placed on the eye. In yet another embodiment, the ligand binding molecule is contained within a swab or sponge that can be applied to the ocular surface. Another embodiment of the present invention relates to a composition comprisingA ligand binding molecule within a liquid spray onto the ocular surface.

In one embodiment, the implant comprises the ligand binding molecule and optionally other agents (if present) dispersed in a biodegradable polymer matrix. The matrix may comprise PLGA (polylactic-polyglycolic acid copolymer), ester-capped polymer, acid-capped polymer, or a mixture thereof. In another embodiment, the implant comprises a ligand binding molecule and optionally other agents (if present), a surfactant and a lipophilic compound. The lipophilic compound may be present in an amount of about 80-99% by weight of the implant. Suitable lipophilic compounds include, but are not limited to: glyceryl palmitostearate, diethylene glycol monostearate, propylene glycol monostearate, glyceryl monolinoleate, glyceryl monooleate, glyceryl monopalmitate, glyceryl monolaurate, glyceryl dilaurate, glyceryl monomyristate, glyceryl dimyristate, glyceryl monopalmitate, glyceryl dipalmitate, glyceryl monostearate, glyceryl distearate, glyceryl monooleate, glyceryl dioleate, glyceryl monolinoleate, glyceryl dilinoleate, glyceryl monoarachidate, glyceryl diaarachidate, glyceryl monobehenate, glyceryl dibehenate, and mixtures thereof. In another embodiment, the implant comprises a ligand binding molecule and optionally other agents (if present) housed within the hollow sleeve. The ligand binding molecule and optional other agents (if present) are delivered to the eye by: the cannula is inserted into the eye, the implant is released from the cannula into the eye, and the cannula is then removed from the eye. An example of such a delivery device is described in U.S. publication No. 2005/0244462, which is hereby incorporated by reference in its entirety.

In one embodiment, the implant is a flexible ocular insertion device suitable for controlled sustained release of the ligand binding molecule and optional other agents (if present) into the eye. In one embodiment, the device comprises an elongate body of polymeric material in the form of a rod or tube containing the ligand binding molecule and optionally other reagents (if present), wherein at least two anchoring protrusions extend radially outwardly from the body. The device may have a length of at least 8mm and its body portion including the projection has a diameter of no more than 1.9 mm. The sustained release mechanism may be, for example, by diffusion or by osmosis or bioerosion. The insertion device may be inserted into the upper or lower fornix of the eye so as to be independent of the eye's motion by virtue of the vault anatomy. The protrusions may have various shapes such as, for example, ribs, threads, dimples or protrusions, truncated conical segments, or intertwined braided segments. In another embodiment, the polymeric material of the body is selected to be a material that swells in a liquid environment. Thus, a device having a smaller initial size can be employed. The insertion device may be of a size and configuration such that, after insertion into the upper or lower fornices, the device remains out of view so as to remain well in place and imperceptible to the recipient for an extended period of use. The device may be retained in the upper or lower fornix for 7 to 14 days or more. An example of such a device is described in U.S. patent No. 5,322,691, which is hereby incorporated by reference in its entirety.

In another aspect, a method of inhibiting neovascularization in a subject who has been diagnosed with a tumor is carried out by topically administering to the subject a ligand binding molecule. For example, in some embodiments, a pharmaceutical composition comprising a ligand binding molecule is administered locally to a tumor or to an organ or tissue from which a tumor has been surgically excised. In such embodiments, the composition is preferably administered in an amount effective to inhibit neovascularization in the tumor.

In the case where the ligand binding molecule is a nucleic acid molecule, administration of the pharmaceutical composition comprising the nucleic acid molecule may be carried out using one of many methods well known in the art of gene therapy. Such methods include, but are not limited to, lentiviral transformation, adenoviral transformation, cytomegalovirus transformation, microinjection, and electroporation.

Test kit and unit dose

The invention also relates to kits comprising one or more pharmaceutical compositions and instructions for use. The ligand binding molecule may be packaged or formulated with another ligand binding molecule or other therapeutic agent described herein, e.g., in a kit or package or unit dose, to allow for co-administration; the two components may be formulated together (i.e., mixed) or in separate dosages in different compositions (i.e., not mixed). Each composition in the kit may be contained within a container. In some embodiments, the two components of the kit/unit dose are packaged together with instructions for administering the two compounds to a human subject for treatment of one of the conditions and diseases described herein.

The kit may comprise a container. The container may be used for separating components and comprises, for example, a separate bottle or a separate foil package. The different compositions may also be contained in a single undivided container, if desired. The kit may further comprise instructions for administration of the components. The kit is particularly advantageous when the different components are administered in different dosage forms, at different dosage levels, or when titration of the individual antagonists is desired.

All publications and patents mentioned herein are incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.

Examples

Example 1-ECD fragment of VEGFR protein.

Experiments were performed to characterize fragments and variants and fusions of VEGFR-3 and/or VEGFR-2 and/or VEGFR-1 that effectively bind to a target ligand (such as VEGF-C and/or VEGF-D and/or VEGF-A). See international patent publication nos. WO 2005/087808, WO 2005/000895, WO 2006/088650, WO 2006/099154, WO 2004/106378, WO 2005/123104, and us 7,855,178, all of which are incorporated herein by reference in their entirety. These studies show that: the ECD of these receptors can be truncated and the domains from the different receptors can recombine to form a ligand binding molecule.

Example 2-production of VGX-301- Δ N2 ligand binding molecules

E.g., Makinen et al, nat. med., 7: 199-205, 2001, the disclosure of which is incorporated herein by reference in its entirety, ligand binding molecules comprising the Ig-like domain I-III of VEGFR-3 (referred to herein as "VGX-300") were prepared.

The key feature of the VGX-300 molecule is that it contains 12 glycosylation sites; 2x6 potential N-linked glycosylation sites, 5 per receptor fragment (VEGFR-3 Ig-like domains I, II and III) and 1 per gamma chain of the Fc region. There is no evidence for O-linked glycosylation.

Glycosylation properties can affect PK, but Fc glycans have minimal effect on PK (Jones et al, Glycobiology, 17(5), 2007, pp 529-. Briefly, asialoglycoprotein receptors bind to complex N-linked glycan structures in which two or more sialic acids are absent, with the bottom galactose (Gal) residue becoming the terminal carbohydrate. In addition, the mannose (Man) receptor recognizes high Man N-linked glycans and terminal N-acetylglucosamine (tGlcNAc) residues. Both receptors can lead to rapid metabolic clearance of the protein.

To identify glycosylation sites important for product activity, each of the five putative N-linked sites was deleted sequentially. Five primer pairs were used to introduce a single mutation into the VGX-300 coding region to disrupt the consensus linkage for each of the five N-linked glycans (N-Q).

The primer pairs used were as follows:

sense of N1: 5 'GACCCCCCCGACCTTGCAGATCACGGAGGAGTCACAC 3' (SEQ ID NO: 12)

N1 antisense: 5 'GTGTGACTCCTCCGTGATCTGCAAGGTCGGGGGGGTC 3' (SEQ ID NO: 13)

Sense of N2: 5 'CTGCACGAGGTACATGCCCAGGACACAGGCAGCTACGTC 3' (SEQ ID NO: 14)

N2 antisense: 5 'GACGTAGCTGCCTGTGTCCTGGGCATGTACCTCGTGCAG 3' (SEQ ID NO: 15)

Sense of N3: 5 'GTCCATCCCCGGCCTCCAAGTCACGCTGCGCTCGC 3' (SEQ ID NO: 16)

N3 antisense: 5 'GCGAGCGCAGCGTGACTTGGAGGCCGGGGATGGAC 3' (SEQ ID NO: 17)

Sense of N4: 5 'GGGAGAAGCTGGTCCTCCAGTGCACCGTGTGGGCTGA 3' (SEQ ID NO: 18)

N4 antisense: 5 'TCAGCCCACACGGTGCACTGGAGGACCAGCTTCTCCC 3' (SEQ ID NO: 19)

Sense of N5: 5 'AGCATCCTGACCATCCACCAGGTCAGCCAGCACGACCT 3' (SEQ ID NO: 20)

N5 antisense: 5 'AGGTCGTGCTGGCTGACCTGGTGGATGGTCAGGATGCT 3' (SEQ ID NO: 21)

The presence of the mutation was determined by sequencing, and the plasmid vector was then transiently transfected into 293T cells (HEK). Culture samples were analyzed by western blotting. The viable constructs can then be passed into 293F cells (HEK) adapted for transient suspension and the supernatants purified by ProSepA chromatography and gel filtration for further testing by enzyme linked immunosorbent assay (ELISA) and BaF/3 bioassays to determine yield and activity. Table 3 below summarizes the expression data and activity of each of the resulting mutants.

Table 3.

Table 3 shows that only the N2 mutant (referred to herein as "VGX-301- Δ N2") exhibited favorable expression and activity characteristics relative to the parent molecule (i.e., VGX-300). VGX-301- Δ N2 and VGX-300 precursors were produced in CHO and HEK cells by transient expression and the Pharmacokinetics (PK) of each molecule was examined as follows. Sprague-Dawley rats were randomly assigned to either group at 2, 3 or 5 per compound in each experiment. Rats in each group received a single dose of VGX-300 or VGX-301- Δ N2 bolus administered intravenously at a dose concentration of 1 mg/kg. Temporary blood samples were collected by lateral tail vein puncture on day-1 (pre-dose) and a total of 12 time points post-dose (from 5 minutes to 14 days after initial treatment). Serum samples were prepared from each blood sample and tested using a quantitative VEGF-C ligand-capture ELISA to determine circulating concentrations of each compound. The results of these analyses are then used to calculate pharmacokinetic parameters. The PK data for VGX-300 and VGX-301- Δ N2 are provided in Table 4 below.

Table 4.

The PK curves provided in fig. 1 and data from table 4 indicate: VGX-301- Δ N2 may have a beneficial effect on PK compared to VGX-300 produced in the same expression system.

Example 3-VGX-301- Δ N2 binding to VEGF-C and VEGF-D

To determine the binding specificity of VGX-300 and VGX-301- Δ N2 for VEGF-C and VEGF-D, VEGF-C or VEGF-D (2 μ g/mL) was pre-coated onto ELISA plates and used as capture antigen. Increasing concentrations of VGX-300 or VGX-301-. DELTA.N 2(0 to 10. mu.g/mL) were applied to the plates and detected using a tetramethylbenzidine substrate kit using rabbit anti-human IgG-horseradish peroxidase conjugate. The results indicate that both VGX-300 and VGX-301- Δ N2 bind to both VEGF-C and VEGF-D. See fig. 2. Unexpectedly, VGX-301- Δ N2 exhibited stronger binding to both ligands than VGX-300.

Example 4-VGX-300 and VGX-301- Δ N2 binding affinities

Binding of VEGF-C and VEGF-D to VGX-300 or VGX-301- Δ N2 was analyzed by Surface Plasmon Resonance (SPR) using a ProteOn XPR36 biosensor (Bio-Rad). VGX-300 or VGX-301- Δ N2 was captured on protein G' immobilized on a GLM sensor chip and the affinity of the molecule for VEGF-C or VEGF-D was determined. The results of the affinity experiments are provided in table 5 below.

Table 5.

The data presented in table 5 above indicate that: VGX-300 and VGX-301- Δ N2 samples bound human VEGF-C and VEGF-D with nearly identical affinities, with both molecules showing stronger binding to VEGF-C than to VEGF-D.

Example 5-VGX-301- Δ N2 blockade of VEGFR-3 binding to and crosslinking with VEGF-C and VEGF-D

Cell-based assays have been developed to assess the ability of VEGF family ligands to bind and cross-link VEGFR-2 and VEGFR-3. These bioassays have been used to study the neutralizing activity of VGX-300 and VGX-301- Δ N2. Bioanalytical cell lines consisted of the mouse IL-3 dependent pro-B cell line Ba/F3 stably transfected with a chimeric receptor consisting of the ECD of VEGFR-2 or VEGFR-3 fused in-frame with the transmembrane and extracellular domains of the mouse erythropoietin receptor (as described in example 5 of WO 2005/087808, the disclosure of which is incorporated herein by reference in its entirety). In the absence of IL-3, these cells survive and proliferate only in the presence of growth factors that are capable of binding and cross-linking the ECD of the corresponding VEGFR.

Briefly, Ba/F3 cells (10,000 cells/well; 96-well plates) transfected with VEGFR-2 or VEGFR-3 were incubated in media supplemented with VEGF-C or VEGF-D at 37 ℃ for 48 hours in the presence of increasing concentrations of VGX-300 or VGX-301- Δ N2(0-100 μ g/mL). Measuring cell proliferation using WST 1 reagent; cells were cultured using WST-1 at 37 ℃ for 4 hours and absorbance was measured at 450nm (n-3; error bars-standard error of mean, SEM).

The results show that: VGX-300 neutralizes the activity of VEGF-C and VEGF-D as shown by the dose response inhibition of VEGF-C and VEGF-D in the VEGFR-2 and VEGFR-3 Ba/F3 bioassays. VGX-300 showed a stronger neutralizing potency against VEGF-C than against VEGF-D in both VEGFR-2 and VEGFR-3 assays. See fig. 3 and 4.

Analysis of VGX-301- Δ N2 showed: the molecules are also capable of blocking the binding of VEGF-C and VEGF-D to VEGFR-3. The neutralizing activity of VGX-301-N2 is slightly stronger than that of VGX-300. See fig. 4. Table 6 shows the binding of VGX-300 and VGX-301- Δ N2 to VEGF-C and VEGF-D in the VEGFR-3 Ba/F3 bioassay (IC 50).

TABLE 6

Example 6-Ocular distribution and pharmacokinetics of VGX-300 and VGX-301. DELTA.N 2 following intravitreal administration

This study was conducted to explore the ocular distribution and pharmacokinetics of VGX-300, VGX-301-. DELTA.N 2, and aflibercept (EYLEA) following a single intravitreal administration to the blue cyan rabbit.

The study design consisted of 3 groups, each assigned 8 female rabbits. Animals were administered 500 μ g of radiolabeled VGX-300, VGX-301-. DELTA.N 2, or aflibercept via a 50 μ L intravitreal bolus into both eyes.

One animal of each group was euthanized at 1, 12, 24, 72, 168, 366, 504, and 672 hours post-dose. Blood (processed into serum) and selected eye tissue were collected at each time point and the radioactivity concentration was determined by radiolysis. The ocular tissues collected include aqueous humor, choroid, cornea, iris-ciliary body (ICB), lens, optic nerve, retina, Retinal Pigment Epithelium (RPE), sclera, trabecular meshwork, and vitreous humor. Figure 5 shows the mean radioactivity concentration in different tissues and sera during monitoring.

Test article [ 2 ]¹²⁵I]VGX-300、[¹²⁵I]Abutilip (EYLEA) and [ 2 ]¹²⁵I]VGX-301- Δ N2 is well tolerated, stable in vitreous humor, and permanently exposed to posterior and anterior ocular tissues. Although¹²⁵I]VGX-300 and [ solution ] of¹²⁵I]The serum exposure after the administration of VGX-301-. DELTA.N 2 in the vitreous body differs, but¹²⁵I]VGX-300 and [ solution ] of¹²⁵I]VGX-301- Δ N2 had only a small systemic exposure compared to aflibercept (EYLEA), probably due to absorption through the choroid and clearance by aqueous humor outflow. Are studied hereThe term "in (1)¹²⁵I]VGX-300 and [ solution ] of¹²⁵I]The PK and biodistribution of VGX-301- Δ N2 are similar for both compounds and are similar to those of [ alpha ], [ delta ] N2¹²⁵I]The PK and biodistribution of aflibercept (EYLEA) were comparable.

Example 7 retinopathy of prematurity model

The following example is an exemplary analysis aimed at evaluating the ability of VGX-300 and VGX-301- Δ N2 to inhibit the onset of retinal neovascularization using a ROP model. In this model, mice on day 7 postpartum (P7) were exposed to hyperoxia (75% oxygen) for 5 days (to P12). After exposure to high oxygen, P12 mice were returned to normoxia and administered with intravitreal injection of human isotype control antibodies VGX-300, VGX-301- Δ N2, Eylea (VEGF-Trap), VGX-300+ Eylea, or VGX-301- Δ N2+ Eylea. All mice were then housed under normoxic conditions for 5 days, then sacrificed at P17, removed and fixed in 10% formalin/PBS. Vessels in each group were quantitatively analyzed using H & E and/or IHC staining.

Example 8 argon laser induced neovascularization (CNV)

In this age-related macular degeneration (AMD) model, CNV was induced by argon laser-induced Bruch's membrane rupture on day 0 (3 burns per mouse). Groups of 10 mice were studied and treated by weekly intravitreal injections (on days 0 and 7) of human isotype control antibody, VGX-301- Δ N2, VGX-300, Eylea (VEGF-Trap), VGX-301- Δ N2+ Eylea, or VGX-300+ Eylea. On day 14, animals were sacrificed and choroidal plate slides were prepared and stained with ICAM-2 and angiogenesis was observed by fluorescence microscopy.

It is expected that VGX-301- Δ N2 as a single agent will significantly inhibit choroidal angiogenesis in mouse models of angiogenic AMD, which may be correlated with

The effects exhibited are comparable.

Example 9 inhibitory Effect of ligand-binding molecules on VEGF-C mediated tumor growth and metastasis

To demonstrate the ability of the ligand binding molecules described herein to inhibit tumor growth and/or metastasis, any acceptable tumor model can be employed. Exemplary models include animals predisposed to developing various cancers, injection of tumors or tumor cells or tumor cell lines from the same or different species, including cells optionally transformed to recombinantly overexpress one or more growth factors, such as VEGF-C or VEGF-D. To provide an in vivo tumor model in which multiple growth factors can be detected, tumor cell lines can be transformed with exogenous DNA to result in the expression of multiple growth factors.

The ligand binding molecules described herein may be administered directly, for example, in protein form, by i.v. infusion or by an implanted micropump, or in nucleic acid form as part of a gene therapy regimen. Subjects are preferably grouped by gender, weight, age, and medical history to help minimize variability among subjects.

Efficacy is measured by reduction in tumor size (volume) and weight. The nature of the effect on tumor size, spread (metastasis) and number of tumors can also be examined. For example, the use of specific cell markers can be used to show that the VEGF-a binding construct is expected to have a greater effect on the former and the VEGF-C binding construct is expected to have a greater effect on the latter relative to the effect of lymphangiogenesis on angiogenesis. Animals can be considered as a whole to derive changes in survival time and weight. Tumors and specimens are examined for evidence of angiogenesis, lymphangiogenesis and/or necrosis.

SCID mice can be used as subjects for obtaining the ability of the ligand binding molecules described herein to inhibit or prevent tumor growth. The ligand binding molecule for use in the treatment is typically selected such that it binds to a growth factor ligand expressed by the tumor cell, particularly a growth factor overexpressed by the tumor cell relative to non-neoplastic cells in the subject. In the SCID model, tumor cells (e.g., MCF-7 cells) can be transfected with a virus encoding a particular growth factor under the control of a promoter or other expression control sequence that provides for overexpression of the growth factor, as described in WO 02/060950. Alternatively, other cell lines may be used, for example HT-1080, as described in U.S. Pat. No. 6,375,929. Tumor cells can be transfected with growth factor ligands that are desired to be overexpressed, or tumor cell lines can be selected that have overexpressed one or more growth factor ligands of interest. One group of subjects was implanted with mock transfected cells, i.e., transfected with a vector lacking a growth factor ligand insert.

The subject is treated with a specific ligand binding molecule prior to, simultaneously with or after tumor implantation of the above cells. There are a number of different ways of administering the ligand binding molecule. In vivo and/or ex vivo gene therapy may be employed. For example, cells can be transfected with an adenovirus or other vector encoding a ligand-binding molecule and implanted with tumor cells expressing the growth factor, and cells transfected with a ligand-binding molecule can be the same as those transfected with (or already overexpressing) the growth factor. In some embodiments, the adenovirus encoding the ligand binding molecule is injected in vivo (e.g., intravenously). In some embodiments, the ligand binding molecule itself (e.g., in protein form) is administered systemically or locally, e.g., using a micropump. In testing the efficacy of a particular binding construct, at least one control is typically employed. For example, for vector-based therapies, a vector or LacZ with an empty insert is used, or the insert may be a ligand binding molecule containing the intact ECD of VEGFR-3 capable of binding VEGF-C or VEGF-D, and this control may employ more than one ECD construct if desired (e.g., for binding multiple ligands, if binding constructs with multiple ligand binding affinities are employed).

A. Exemplary procedure

Preparation of plasmid expression vectors, transfected cells and test cells

The cDNA encoding VEGF-C or VEGF-D or a combination thereof was introduced into the pEBS7 plasmid (Peterson and Legerski, Gene, 107: 279-84, 1991.). This same vector can be used to express the ligand binding molecule.

MCF-7S1 subclones of the human MCF-7 breast cancer cell line were transfected with plasmid DNA by electroporation and stable cell populations were selected and cultured as previously described (Egeblad and Jaattela, int.J. cancer, 86: 617-25, 2000). Cells were metabolically labeled in methionine and cysteine free MEM (Gibco) (Redivue Pro-Mix, Amersham Pharmacia Biotech) supplemented with 100. mu. Ci/ml [35S ] -methionine and [35S ] -cysteine. The labeled growth factors are immunoprecipitated from the conditioned media using antibodies against the expressed growth factors. The immune complexes and binding complexes were precipitated with protein A Sepharose (Amersham Pharmacia Biotech), washed twice in 0.5% BSA, 0.02% Tween 20 in PBS, and once in PBS, and analyzed under reducing conditions under SDS-PAGE.

Subject preparation and treatment

Cells (20,000/well) were seeded in 24-wells in quadruplicate and trypsinized on parallel plates after 1, 4, 6 or 8 days. New media was provided after 4 and 6 days. For tumorigenesis analysis, near confluent cultures were harvested by trypsinization, washed twice, and will be in PBS 10 ⁷Individual cells were seeded into the fat pad of the second (axillary vein) mammary gland of ovariectomized SCID mice carrying a 60 day sustained release pellet containing 0.72mg of 17 β -estradiol (Innovative Research of America). Ovariectomy and implantation of the pellets were performed 4-8 days prior to tumor cell inoculation.

The cDNA encoding the binding construct was cloned into the pAdBgllI plasmid and adenovirus was generated as previously described (Laitinen et al, hum. Gene ther., 9: 1481-6, 1998). At 10⁹pfu/mice ligand binding molecules or LacZ control (Laitinen et al, hum. Gene ther., 9: 1481-6, 1998) adenoviruses were injected intravenously into SCID mice, 3 hours later, and tumor cells were inoculated.

Analysis of therapeutic efficacy

Tumor length and width were measured twice weekly in a blind fashion and tumor volume was calculated as length x width x depth x0.5, assuming the tumor was hemiellipsoidal and the depth and width were the same (Benz et al, Breast Cancer Res. treat., 24: 85-95, 1993).

Tumors were excised, fixed in 4% paraformaldehyde (pH 7.0) for 24 hours, and embedded in paraffin. Sections (7 μm) were immunostained with monoclonal antibodies against, for example, PECAM-1(Pharmingen), VEGFR-1, VEGFR-2, VEGFR-3(Kubo et al, Blood, 96: 546-553, 2000) or PCNA (zymed laboratories), PDGFR- α, PDGFR- β or against LYVE-1(Banerji et al, J Cell Biol, 144: 789-801, 1999), VEGF-C (Joukov et al, EMBO J, 16: 3898-911, 1997), laminin according to the published protocol (Partanen et al, Cancer, 86: 2406-12, 1999) or polyclonal antibodies to any of the growth factors. The mean number of PECAM-1 positive vessels was determined from the three highest density (vessel hot spots) regions (60X magnification) of the sections. All histological analyses were performed using blinded tumor samples.

Three weeks after injection of adenovirus construct and/or protein therapy, four mice of each group were anesthetized, the ventral skin opened, and a few microliters of 3% Evau's blue dye (Sigma) in PBS were injected into the tumor. The tumor was then visualized for dye release.

Blood and blood proteins can also be imaged and monitored, indicating the health of the subject and the length of the tumor vasculature.

Example 10 Effect of combination treatment with ligand binding molecules and chemotherapeutic Agents on tumor progression in a subject

This study was conducted to test the efficacy of combinations using the ligand binding molecules described herein with other anti-cancer therapies. Such therapies include chemotherapy, radiation therapy, antisense therapy, RNA interference, and monoclonal antibodies directed against cancer targets. The combined effect may be additive in its anti-cancer effect, but is preferably synergistic, e.g., prevention, inhibition, regression and elimination of cancer, prolongation of life and/or reduction of side effects.

Subjects are grouped, one group receiving the chemotherapeutic agent, one group receiving the ligand binding molecule, and one group receiving the chemotherapeutic agent and the ligand molecule at regular intervals, e.g., daily, weekly, or monthly. In human studies, subjects are typically grouped by gender, weight, age, and medical history to help minimize variability among subjects. Ideally, the subject is diagnosed with the same type of cancer. Progression can be followed by measuring tumor size, metastasis, weight gain/loss, tumor vascularized white blood cell count in a human or non-human subject.

Tumor biopsies are taken periodically before and after the start of treatment. For example, biopsies are taken immediately prior to treatment, one week apart, then one month apart, thereafter or whenever possible (e.g., at the time of tumor resection). The biopsy specimens were examined for cellular markers and gross cellular and tissue morphology to assess the effectiveness of the treatment. Additionally or in the alternative, imaging techniques may be employed.

For non-human animal studies, other placebo controls may be employed. Animal studies conducted according to NIH guidelines also offer the advantage of intercalating relatively uniform cancer cell populations and tumors that selectively overproduce one or more growth factors targeted by ligand binding molecules.

Claims (51)

1. A purified or isolated ligand binding polypeptide having an amino acid sequence corresponding to the sequence of amino acids defined by positions 25-314 of SEQ ID NO:2, provided that the N-glycosylation sequence corresponding to position 104-106 of SEQ ID NO:2 is eliminated by: changing the amino acid sequence in position 104-106 of SEQ ID NO. 2 by replacing the amino acid in position 104 with another amino acid selected from the group consisting of glutamine, aspartic acid, glutamic acid, arginine and lysine; and

Wherein said polypeptide binds to at least one ligand polypeptide selected from the group consisting of human VEGF-C, VEGF-D and PlGF.

2. The purified or isolated ligand binding polypeptide of claim 1 which is glycosylated at four N-glycosylation sequence sub-sites corresponding to positions 33-35, 166-168, 251-253 and 299-301 of SEQ ID NO 2.

3. The purified or isolated ligand-binding polypeptide of claim 1 or claim 2 which is a soluble polypeptide.

4. The purified or isolated ligand binding polypeptide of claim 1 or claim 2, which binds to human VEGF-C or human VEGF-D.

5. The purified or isolated ligand binding polypeptide of claim 4, which inhibits binding of VEGF-C or VEGF-D to VEGFR-3 or inhibits stimulation of VEGFR-3 mediated by VEGF-C or VEGF-D in cells expressing VEGFR-3 on their surface.

6. The purified or isolated ligand-binding polypeptide of claim 1 or claim 2, which has a K of 1nM or less_dBinds to human VEGF-C.

7. The purified or isolated ligand-binding polypeptide of claim 1 or claim 2, which has a K of 5nM or less_dBinds to human VEGF-D.

8. The purified or isolated ligand polypeptide of claim 1 or claim 2, wherein said polypeptide corresponds to amino acids 1-290 of SEQ ID No. 3.

9. The purified or isolated ligand binding polypeptide of claim 1 or claim 2, further comprising a signal peptide.

10. The purified or isolated ligand binding polypeptide of claim 1 or claim 2, further comprising at least one polyethylene glycol moiety attached to the polypeptide.

11. The purified or isolated ligand binding polypeptide of claim 10, comprising a 20-40kDa polyethylene glycol attached to the amino terminus of the polypeptide.

12. A ligand binding molecule comprising the ligand binding polypeptide of any one of claims 1 to 11 linked to a heterologous peptide.

13. The ligand binding molecule of claim 12, wherein the heterologous peptide comprises an immunoglobulin constant domain fragment.

14. The ligand binding molecule of claim 13, wherein the immunoglobulin constant domain fragment is an IgG constant domain fragment.

15. The ligand binding molecule of claim 13 wherein the immunoglobulin constant domain fragment comprises amino acids 306 and 537 of SEQ ID NO 3.

16. The ligand-binding molecule of any one of claims 12 to 15, optionally comprising a linker linking the heterologous peptide to the ligand-binding polypeptide.

17. The ligand binding molecule of any one of claims 12 to 15, comprising a polypeptide wherein the C-terminal amino acid of the ligand binding polypeptide is directly attached to the N-terminal amino acid of the heterologous peptide by a peptide bond.

18. The ligand binding molecule of any one of claims 12 to 15, further comprising a signal peptide that directs secretion of the molecule from a cell expressing the molecule.

19. The ligand binding molecule of claim 12, wherein the molecule corresponds to the amino acid sequence set forth in SEQ ID No. 3.

20. The ligand binding molecule of any one of claims 12 to 15, wherein the ligand binding polypeptide and the heterologous peptide are linked by an amide bond to form a single polypeptide chain.

21. The ligand-binding polypeptide of claim 1 or claim 2 or the ligand-binding molecule of any one of claims 12 to 15, further comprising a detectable label.

22. A conjugate comprising a ligand binding polypeptide according to any one of claims 1 to 11 or a ligand binding molecule according to any one of claims 12 to 20 and a chemotherapeutic agent.

23. An isolated polynucleotide comprising an encoding nucleotide sequence encoding the ligand-binding polypeptide of any one of claims 1 to 11 or the ligand-binding molecule of any one of claims 12 to 20.

24. The polynucleotide of claim 23, further comprising a promoter sequence operably linked to the encoding nucleotide sequence to facilitate transcription of the encoding nucleotide sequence in a host cell.

25. A vector comprising the polynucleotide of claim 23 or claim 24.

26. The vector of claim 25, further comprising an expression control sequence operably linked to the encoding nucleotide sequence.

27. The vector of claim 25, wherein the vector is selected from the group consisting of a lentiviral vector, an adeno-associated viral vector, an adenoviral vector, a liposomal vector, and combinations thereof.

28. The vector of claim 27, wherein the vector comprises a replication-defective adenovirus comprising a polynucleotide operably linked to a promoter and flanked by adenovirus polynucleotide sequences.

29. An isolated cell or cell line transformed or transfected with a polynucleotide according to claim 23 or claim 24 or a vector according to any of claims 25 to 28.

30. The isolated cell or cell line of claim 29, which is a eukaryotic cell.

31. The isolated cell or cell line of claim 30, which is a human cell.

32. The isolated cell or cell line of claim 30, which is a Chinese Hamster Ovary (CHO) cell.

33. A method of making a ligand-binding polypeptide or ligand-binding molecule comprising growing a cell according to any one of claims 29 to 32 under conditions in which the ligand-binding polypeptide or ligand-binding molecule encoded by the polynucleotide is expressed.

34. The method of claim 33, further comprising purifying or isolating the ligand-binding polypeptide or ligand-binding molecule from the cell or the growth medium of the cell.

35. A composition comprising a purified ligand-binding polypeptide according to any one of claims 1 to 11 or a ligand-binding molecule according to any one of claims 12 to 20 and a pharmaceutically acceptable diluent, adjuvant, excipient or carrier.

36. A composition comprising a polynucleotide according to claim 23 or claim 24 or a vector according to any one of claims 25 to 28 and a pharmaceutically acceptable diluent, adjuvant, excipient or carrier.

37. The composition of claim 35 or claim 36, formulated for topical administration.

38. The composition of claim 37, in the form of a solid, paste, ointment, gel, liquid, aerosol, spray, polymer, film, emulsion, or suspension.

39. The composition of claim 35 or claim 36, formulated for intravitreal administration.

40. Use of a composition according to any one of claims 35 to 39 in the manufacture of a medicament for inhibiting neovascularization, retinal neovascularization, choroidal neovascularization, or tumor neovascularization in a subject in need thereof.

41. The use of claim 40, wherein the composition is to be administered topically to the eye of the subject.

42. The use of claim 41, wherein the composition is to be administered by intravitreal injection.

43. The use of claim 41, wherein the composition is to be administered by an intravitreal implant.

44. The use of claim 41, wherein the composition is to be administered by topical administration.

45. The use of any one of claims 40-44, wherein the composition is administered in an amount effective to inhibit VEGF-C and/or VEGF-D in the eye of the subject from binding to or stimulating VEGFR-2 and/or VEGFR-3 expression in cells of the eye or blood vessels of the eye.

46. Use of a composition according to any one of claims 35 to 39 in the manufacture of a medicament for the treatment or prevention of: disorders associated with abnormal angiogenesis and/or lymphangiogenesis; clinical conditions characterized by vascular endothelial cell hyperproliferation, vascular permeability, edema or inflammation, cerebral edema associated with injury, stroke or tumor; edema associated with inflammatory disorders, psoriasis, arthritis, rheumatoid arthritis; asthma; general edema associated with burns; ascites and pleural effusions associated with tumors, inflammation or trauma; chronic airway inflammation; capillary leak syndrome; sepsis; renal disease associated with increased protein leakage; ocular diseases associated with neovascularization; choroidal neovascularization; diabetic macular edema; age-related macular degeneration; proliferative diabetic retinopathy; retinal vein occlusion; corneal neovascularization/graft rejection; wet age-related macular degeneration; hypertensive retinopathy; diabetic retinopathy; sickle cell retinopathy; peripheral retinal neovascularization; retinopathy of prematurity; venous occlusive disease; arterial occlusive disease; central serous chorioretinopathy; cystoid macular edema; retinal capillary dilation; giant aneurysm; retinal vascular tumor disease; radiation Induced Retinopathy (RIRP); iris reddening; an ocular tumor, including an eyelid tumor, conjunctival tumor, choroidal tumor, iris tumor, optic nerve tumor, retinal tumor, invasive intraocular tumor, or orbital tumor.

47. The use of any one of claims 40-44 and 46, wherein the medicament is to be administered to the subject in combination with an antibiotic.

48. The use of claim 47, wherein the antibiotic is selected from the group consisting of: amikacin, gentamicin, kanamycin, neomycin, netilmicin, streptomycin, tobramycin, teicoplanin, vancomycin, azithromycin, clarithromycin, dirithromycin, erythromycin, roxithromycin, oleandomycin, amoxicillin, ampicillin, azlocillin, carbenicillin, cloxacillin, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, penicillin, piperacillin, ticarcillin, bacitracin, colistin, polymyxin B, ciprofloxacin, enoxacin, gatifloxacin, levofloxacin, lomefloxacin, moxifloxacin, norfloxacin, ofloxacin, trovafloxacin, mafenide, sulfacetamide, sulfamethoxazole, sulfasalazine, sulfaisoxazole, trimethoprim, sulfamethoxazole, demeclocycline, doxycycline, minocycline, and doxycycline, Oxytetracycline, and tetracycline.

49. The use of claim 40 or 46, wherein the subject has been diagnosed with a tumor, and wherein the composition is to be administered in an amount effective to inhibit neovascularization in the tumor.

50. The use of claim 49, wherein the composition is to be administered locally to the tumor or to an organ or tissue from which a tumor has been surgically removed.

51. The use of claim 49, wherein the composition is to be administered in an amount effective to inhibit VEGF-C and/or VEGF-D in a tumor of the subject from binding to or stimulating VEGFR-2 and/or VEGFR-3 expression in tumor cells.

Images