CN110734888B

CN110734888B - TIM3 human single-chain antibody fusion gene transformed lactic acid bacteria and application thereof

Info

Publication number: CN110734888B
Application number: CN201910873901.4A
Authority: CN
Inventors: 曾位森; 陈泽荣; 范宏英; 白杨; 孟晓静
Original assignee: Guangzhou Weishengjun Biotechnology Co ltd
Current assignee: Guangzhou Weishengjun Biotechnology Co ltd
Priority date: 2019-09-17
Filing date: 2019-09-17
Publication date: 2021-08-03
Anticipated expiration: 2039-09-17
Also published as: CN110734888A

Abstract

The invention discloses TIM3 human single-chain antibody (TIM3Fv) fusion gene transformed lactic acid bacteria, which comprise TIM3Fv gene or CTB-TIM3Fv fusion gene transformed lactic acid bacteria, and are obtained by inserting the TIM3Fv gene or CTB-TIM3Fv fusion gene into a lactic acid bacteria expression vector pLN and transforming the lactic acid bacteria, and also discloses application of the transformed bacteria in preparing oral viable bacteria medicaments with disease immunotherapy effects. The TIM3Fv and CTB-TIM3Fv fusion gene transformed lactobacillus can be prepared into viable bacteria preparations such as viable bacteria suspension, dairy products, viable bacteria powder, bacteria tablets or capsules, can be proliferated and colonized in human intestinal tracts after being taken orally as an immunotherapy viable bacteria medicament, and is applied to prevention and treatment of diseases such as tumors, virus infection or intracellular bacterial infection, primary and secondary low immunity and the like.

Description

TIM3 human single-chain antibody fusion gene transformed lactic acid bacteria and application thereof

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to TIM3 human single-chain antibody fusion gene transformed lactic acid bacteria and application thereof.

Background

In recent years, immunotherapy targeting immune checkpoint (checkpoint) molecules is the hot spot of current anti-tumor research, and various immune checkpoint inhibitor drugs, such as PD-1 and PD-L1 humanized antibodies, have been approved for clinical application and have achieved good therapeutic effects.

The main reason why malignant tumors can evade immune surveillance is that both malignant tumor cells and immune cells express some immune co-suppression molecules (co-suppression molecules), also called immune checkpoint molecules, to generate immune suppression and evade immune surveillance of the body. This is also a major obstacle to breakthrough for tumor therapy. T cells, upon activation, express a range of immune checkpoint molecules, such as cytotoxic T cell antigen 4(CTLA-4), receptor programmed death factor 1 (PD-1), T cell immunoglobulin mucin molecule 3(T cell immunoglobulin-3, TIM3), lymphocyte activation gene 3 (LAG-3, CD223), T cell ITIM domain-containing immunoglobulin (T cell immunoglobulin and ITIM domain protein, TIGIT), and the like. These prevent excessive immune responses leading to inflammatory responses and autoimmune diseases by controlling the magnitude and duration of the immune response through negative feedback regulatory mechanisms.

Malignant tumor cells, Antigen Presenting Cells (APC), regulatory T cells (Treg), suppressive immune cells and the like also express some immune co-suppression molecules and participate in immune negative regulation. B7-H1(CD274) and B7-DC (CD273) are two important immunosuppressive molecules, both of which are homologous molecules of CD80(B7.1), and can bind to PD-1 on T cells to inhibitGenerating anti-tumor immunity and inhibiting the killing effect of effector T cells (Te) on tumors. Thus, both are also referred to as PD-1 ligand 1(PD-L1) and ligand 2(PD-L2), respectively. PD-L1 is widely expressed in various malignant tumor cells and is up-regulated by cytokines such as interferon gamma (IFN-gamma) and tumor necrosis factor alpha (TNF-alpha). PD-L2 is mainly expressed in DC, macrophage, mast cell, etc. PD-1 is predominantly expressed on activated mature T cells. The unactivated T cells have little expression of PD-1, and only after the T cells are activated, there is expression of PD-1. In addition, double negativity in the thymus (CD 4)^-CD8^-) T cells, activated NK cells, monocytes and immature Langerhans cells, PD-1 is low expressed.

In recent years, targeted therapy of immunosuppressive molecules such as PD-1 and its ligands PD-L1, PD-L2, and CTLA-4 has become a hotspot of research on antitumor therapy. The PD-1 and PD-L1 antibodies block the combination of PD-1/PD-L1,2 through the combination with corresponding molecules, the inhibition effect of PD-1/PD-L1 on immune cells is relieved, and the cytotoxic effect of Te on tumor cells is improved. In addition, the immunosuppression of PD-1/PD-L2 can be relieved, so that the body can be promoted to generate anti-tumor active immunity to a certain extent, and the number of Te cells is increased.

The PD-1 humanized antibody nivolumab and pembrolizumab, PD-L1 antibody atezolizumab, were originally used for malignant melanoma treatment, and were successively approved by FDA in Japan, USA, Australia and other countries for marketing. The humanized antibodies or inhibitors of PD-1, PD-L1, PD-L2 and CTLA-4 obtain favorable curative effects in clinical treatment tests of malignant tumors such as breast cancer, colon cancer, lung cancer and the like, and currently, 2 PD-1 antibodies and 3 PD-L1 antibodies are approved to be clinically applied in dozens of countries such as Europe and America.

However, in addition to the over 60% effectiveness of treatment with PD-1 or PD-L1 antibody via classical hodgkin lymphoma, the effectiveness of PD-1/PD-L1 antibody was only 10% -30% in unselected solid tumor patients. This is because the main effect of the PD-1/PD-L1 antibody is to improve the killing effect of Te cells on tumor, and the effect of stimulating organism to generate active anti-tumor immunity is very small. Most tumors have high heterogeneity and immunosuppression problems, only a part of tumor patients have good immunity, enough activated lymphocytes and Te cells can be generated by the tumor patients, and only the partially activated lymphocytes and a small part of malignant tumor cells have PD-1 or PD-L1 expression. Therefore, the malignant tumor needs a combination therapy of multiple factors and multiple drugs to achieve an ideal curative effect.

TIM-3 is one of the members of the T-cell immunoglobulin (TIM) family, expressed predominantly on the surface of activated T lymphocytes, regulatory T cells (tregs), natural immune cells (dendritic cells, natural killer cells, monocytes). TIM-3 has various ligands, such as phosphatidylserine (PtdSer), galectin 9(galectin-9), high mobility protein B1(HMGB1), and carcinoembryonic antigen associated adhesion molecule 1(CEACAM 1). TIM-3 in class I CD4 only⁺Helper T cells (Th1) and CD8⁺Cytotoxic T Cells (CTL) are up-regulated, the formation of Tregs is promoted, and the synergistic immunosuppressive effect is participated in. TIM-3 plays a key role in the depletion of T cells in tumors. Activation of TIM-3 by galectin-9 and PtdSer can induce apoptosis of Th1 and CTL, inhibit activity of Te cell and cause immune tolerance. HMGB1 is primarily involved in the innate immune response. HMGB1 binds to DNA leaked from dead cells and elicits innate immune responses by endocytosis of innate immune cells via Toll-like receptors (TLRs). HMGB1 and TIM-3⁺Cell binding may suppress the innate immune response. CEACAM1 is normally expressed on CD4+ and CD + T cells together with TIM-3, both of which can form heterodimers, inducing Th1 and CTL failure.

Abnormally high expression of TIM-3 is closely associated with cancer and chronic viral infections. For tumor patients, TIM-3 is highly expressed not only in T cells and other innate immune cells, but also in some tumor cells themselves (renal clear cell carcinoma). TIM-3 high expression is closely associated with immune surveillance for malignant cell escape. Therefore, TIM-3 antibodies are a hot spot for immunotherapy of malignancies and chronic viral infections. The TIM-3 antibody can be used alone or in combination with the PD-1 antibody for treatment to remarkably recover the function of Te cells, and the therapeutic effect on malignant tumors and chronic viral infection is better. The TIM-3 antibody and the PD-1 antibody are combined to inhibit the generation of drug resistance of the PD-1 antibody.

However, the existing checkpoint inhibitors, such as immunotherapeutic drugs like PD-1 and PD-L1 antibodies, have two inherent disadvantages of high production cost and inconvenient administration, which limit their clinical application. The traditional biological medicines (including antibodies) can not be produced by separating and purifying proteins, and must be administered by injection, so that the two inherent disadvantages of high production cost and inconvenient administration exist. For example, the mean time to onset of PD-1/PD-L1 antibody is about 2-4 months. For most patients with malignant tumors, the PD-1/PD-L1 antibody will be administered for at least 1 year; patients with advanced, systemic metastases, are advised to take the drug for at least 2 years. The long-term treatment with the PD-1/PD-L1 antibody generally causes no ability to bear high medicine cost in ordinary families and is difficult to bear the pain of long-term injection. When the TIM-3 antibody is prepared by adopting the traditional production mode, the problems of high production cost and inconvenient administration are still existed, which are difficult to overcome. Therefore, there is a need to explore new expression production modes and administration routes of immunotherapeutic antibody drugs.

The gastrointestinal tract is the simplest and most convenient and economic bioreactor for generating and transforming biological medicines, and probiotics such as lactic acid bacteria and the like are good carriers for oral administration of immunotherapy medicines. The gastrointestinal tract of the human body is a complex and dynamic ' micro-ecological world ' and is also a high-efficiency ' factory ' for biochemical metabolism '. It is estimated that the total number of bacteria in the intestine of an adult exceeds 10¹⁴The total amount of biochemical metabolism corresponds to the total amount of metabolism of the liver. If the "factory" of the gastrointestinal tract could be effectively utilized as a bioreactor for drug production and transformation, the advantages of economy, convenience and high efficiency would no doubt be provided, and a new approach for disease prevention and treatment would be provided.

Lactic acid bacteria and bifidobacteria are the most suitable and safer host bacteria for the intestinal bioreactor. The probiotics such as lactobacillus and bifidobacterium grow in oral cavity, vagina and digestive tract of human body for a long time, especially anoxic parts such as lower digestive tract (ileum, colon) and the like, and the human body even takes the probiotics as a part of the human body, so that immunological rejection reaction is not generated basically. The probiotics have the functions of improving the intestinal micro-ecological environment, inhibiting the growth of pathogenic bacteria, promoting nutrient absorption, decomposing toxic products, regulating immunity, preventing tumorigenesis and the like. The lactobacillus and the bifidobacterium have long residence time and large quantity in the lower digestive tract, have accumulation effect, are beneficial to the expression, absorption and utilization of peptide drugs, and are very suitable to be used as carriers for the expression and administration of the polypeptide drugs in the intestinal tract.

In recent years, the use of genetically engineered probiotics for oral vaccine preparation or gene therapy has become a research hotspot. The probiotics can be used for expressing rotavirus antigens, tetanus toxin C and other antigens to prepare oral vaccines or expressing Cytosine Deaminase (CD) genes to carry out gene therapy of malignant tumors. The use of probiotics such as lactobacillus to express immune factors such as interferon, thymosin and the like obtains positive curative effect in the treatment research of animal models with diseases such as virus infection, malignant tumor and the like. Phase II clinical trials have been completed with studies on the treatment of enteritis with lactococcus expressing interleukin 10 (IL-10).

The lactobacillus is used for expressing the checkpoint inhibitor, and the drug is taken by oral intestinal tract, which is most suitable for treating malignant tumor of gastrointestinal tract. If the lactic acid bacteria are expressed to exert systemic anti-tumor immunity, the problem to be solved is how to make the checkpoint inhibitor macromolecules cross the intestinal mucosal barrier into the blood circulation. The expression of the fusion with cholera toxin subunit B (CTB) is an effective way to promote the crossing of intestinal mucosa barrier by macromolecular drugs. CTB is a regulatory subunit recognized and bound by cholera toxin and intestinal epithelial cells. Cholera toxin consists of 1 a subunit (CTA) and 5B subunits (CTB). CTB binds specifically to the receptor on intestinal epithelial cells, ganglioside M1(GM1), without enterotoxicity. Intestinal epithelial cells are rich in GM 1. Fusion expression with CTB is an effective method for recombinant proteins to cross the intestinal mucosal barrier. Therefore, oral vaccines generally employ expression methods fused with CTB for enhancing mucosal immunity.

Researches show that the efficiency of GFP and IFN-alpha absorbed through intestinal mucosa and entering blood circulation after the tobacco leaves are orally taken can be remarkably improved by carrying out fusion expression on Green Fluorescent Protein (GFP) or IFN-alpha and CTB in the tobacco. A certain amount of GFP can be detected in tissues such as submucosa, inferior vena cava, liver, spleen and the like. Adding a special protease enzyme digestion sequence between the GFP and the CTB, carrying out enzyme digestion after the fusion protein enters the intestinal epithelial cells, and dissociating the GFP and the CTB. CTB could only be detected in epithelial cells, while free GFP could only be detected in tissues such as inferior vena cava, liver, spleen, etc. The fusion expression of the target protein and CTB is expected to break through the intestinal mucosa barrier.

Disclosure of Invention

The invention aims to provide TIM-3 human single-chain antibody (TIM3Fv) fusion gene transformed lactic acid bacteria, which can be prepared into oral dosage forms, does not carry antibiotics or drug resistance genes, can be induced and expressed in vivo or in vitro, particularly in intestinal tracts by an inducer Nisin (lactoglobulin), and is used for preventing and treating various diseases such as tumors and the like.

The invention also aims to provide application of the TIM-3 humanized single-chain antibody (TIM3Fv) fusion gene transformed lactic acid bacteria in preparation of oral viable bacteria medicaments with tumor immunotherapy effects.

The first object of the present invention can be achieved by the following technical solutions: TIM-3 human single-chain antibody (TIM3Fv) fusion gene transformed lactic acid bacteria comprise a TIM3Fv gene or CTB-TIM3Fv fusion gene transformed lactic acid bacteria, and the TIM3Fv gene or CTB-TIM3Fv fusion gene is inserted into a lactic acid bacteria expression vector pLN and transformed into lactic acid bacteria, wherein the CTB-TIM3Fv fusion gene is mainly formed by connecting a TIM3Fv gene and a CTB gene, a cDNA sequence corresponding to a furin enzyme digestion polypeptide sequence is introduced between the TIM3Fv gene and the CTB gene, and a secretory signal peptide SPK1 is introduced at the N end of the TIM3Fv gene and the CTB-TIM3Fv fusion gene.

The fusion gene of TIM3Fv and CTB-TIM3Fv in the invention is transformed into lactic acid bacteria and is characterized by not carrying antibiotic or drug resistance genes.

The fusion gene of TIM3Fv and CTB-TIM3Fv in the fusion gene transformation bacteria of TIM3Fv and CTB-TIM3Fv can be induced and expressed by an inducer Nisin in vitro or in vivo, particularly in intestinal tracts.

The fusion protein of TIM3Fv and CTB-TIM3Fv expressed by the transformed bacteria can directly act on colon and rectal cancer cells highly expressing TIM3, or act on immune cells on intestinal mucosa to block immune suppression and T cell failure, and play an anti-tumor role; the CTB-TIM3Fv fusion protein expressed by the transformed bacteria can be endocytosed by intestinal epithelial cells through the endocytosis mediated by a CTB receptor, and is specifically digested by furin, and free TIM3Fv with retained immunological activity is released to the outside of cells or in blood circulation to cross an intestinal mucosa barrier, so that lymphocyte activation is stimulated, the cellular immune level of an organism is improved, and a TIM-3 immunosuppressive pathway is blocked to play an anti-tumor role.

The preparation method of the TIM-3 humanized single-chain antibody fusion gene transformed lactic acid bacteria can comprise the following steps:

(1) firstly, synthesizing a TIM3Fv and CTB-TIM3Fv fusion gene, and introducing a cDNA sequence corresponding to a furin enzyme digestion polypeptide sequence between a TIM3Fv gene and a CTB gene in the CTB-TIM3Fv fusion gene;

(2) inserting TIM3Fv and/or CTB-TIM3Fv fusion gene into a lactobacillus expression vector pLN, transforming the recombinant TIM3Fv and CTB-TIM3Fv fusion gene expression vector into lactobacillus with lacF gene deletion by an electrotransformation method, and screening the TIM3Fv and CTB-TIM3Fv fusion gene transformed lactobacillus by adopting a selective medium taking lactose as a unique carbon source.

In the preparation method of the TIM-3 humanized single-chain antibody fusion gene transformed lactic acid bacteria, the method comprises the following steps:

alternatively, the lactobacillus expression vector pLN of step (2) contains a LacF nutrition screening gene, does not contain an antibiotic resistance gene, and can be a plasmid vector capable of inducing the expression of a target gene in vitro or in the intestinal lumen by using an inducer nisin (lactococcus).

Optionally, the lactic acid bacteria in step (2) are lactic acid bacteria of the genus Lactobacillus such as lactococcus lactis (lactococcus lactis), Lactobacillus Acidophilus (Lactobacillus Acidophilus) or Lactobacillus plantarum (Lactobacillus plantarum).

Further, the preparation method of the TIM-3 humanized single-chain antibody fusion gene transformed lactic acid bacteria comprises the following steps:

(1) firstly, synthesizing a SPK1-TIM3Fv and SPK1-CTB-TIM3Fv fusion gene, and introducing a cDNA sequence corresponding to a furin enzyme digestion polypeptide sequence between a TIM3Fv gene and a CTB gene in the CTB-TIM3Fv fusion gene;

(2) inserting the fusion gene of SPK1-TIM3Fv and SPK1-CTB-TIM3Fv into a lactobacillus expression vector pLN to obtain recombinant plasmids pLN-TIM3Fv and pLN-CTB-TIM3 Fv;

(3) recombinant plasmids pLN-TIM3Fv and pLN-CTB-TIM3Fv were transformed into LacF gene-deficient lactic acid bacteria by conventional electrotransformation method, and TIM3Fv gene or CTB-TIM3Fv fusion gene transformed lactic acid bacteria were selected using selection medium with lactose as sole carbon source.

Namely, the preparation method of the transformed lactic acid bacteria comprises the following steps: firstly, synthesizing fusion genes of TIM3Fv and CTB-TIM3Fv, and optimizing codons to enable the fusion genes to be suitable for lactic acid bacteria expression; introducing an amino acid digestion sequence which is unique to furin between TIM3Fv and CTB gene; inserting the fusion gene of TIM3Fv and CTB-TIM3Fv into a broad host expression vector pLN of gram-positive bacteria, connecting the upstream with a gene sequence of SPK1 signal peptide (pediococcus K1 signal peptide), and controlling the expression by a lactoglobulin promoter (Pnisin); then, the TIM3Fv or CTB-TIM3Fv fusion gene expression vector is transformed into LacF gene-deleted lactic acid bacteria by an electrotransformation method, and selection medium with lactose as a unique carbon source is adopted to screen the transformation lactic acid bacteria of TIM3Fv and CTB-TIM3 Fv.

In the preparation method of the transformed lactic acid bacteria:

alternatively, the lactic acid bacterium host bacterium is lactococcus lactis (lactococcus lactis) in which the lacF gene is deleted.

Alternatively, the method for cloning the SPK1-TIM3Fv or SPK1-CTB-TIM3Fv fusion gene into the lactobacillus expression vector pLN is a conventional gene recombination and cloning method.

Optionally, the lactobacillus expression vector pLN is derived from nisin induced expression system (NICE), contains LacF nutrition screening gene, and does not contain antibiotic resistance gene (nisin induced expression system (NICE) is currently a more general expression vector, and the commercially available vector is pNICE).

Optionally, the shock condition at the time of electrotransformation is: the voltage is 1.6kV-2.5kV, the capacitance is 25 muF, and the resistance is 200 omega.

Optionally, the selection medium is an EM medium containing only lactose as a sole carbon source, and the mass volume percentage of the lactose is 0.5% -2.0%.

Further, the preparation method of the transformed lactic acid bacteria comprises the following steps:

synthesis of TIM3Fv fusion genes SPK1-TIM3Fv and SPK1-CTBTIM3 Fv:

(1.1) optimizing codons according to the SPK1 signal peptide amino acid sequence to obtain a cDNA sequence of the SPK1 gene, wherein the sequence table is shown as SEQ ID NO: 1 is shown in the specification;

(1.2) designing a complementary DNA gene sequence according to the amino acid sequence and the functional region structure of the TIM3 human antibody, connecting a heavy chain variable region (VH) and a light chain variable region (VL) through a connecting peptide segment (Linker) and a Flag tag sequence to form a TIM3Fv gene, and optimizing codons to ensure that the gene is suitable for efficient expression of lactic acid bacteria, wherein the sequence table is shown as SEQ ID NO: 2 is shown in the specification;

(1.3) according to the CTB gene sequence, optimizing the codon to obtain the CTB gene cDNA sequence, wherein the sequence table is shown as SEQ ID NO: 3 is shown in the specification;

(1.4) connecting the cDNA sequences of the SPK1 and the TIM3Fv gene to form a fusion gene, and adding restriction endonuclease digestion sequences of NcoI and XbaI to the 5 'end and the 3' end of the fusion gene respectively to synthesize an SPK1-TIM3Fv gene;

(1.5) connecting cDNA sequences of the SPK1, CTB and TIM3Fv genes to form a fusion gene, introducing a cDNA sequence corresponding to a furin enzyme digestion polypeptide sequence between the CTB and the TIM3Fv genes, and adding NcoI and XbaI restriction endonuclease digestion sequences to the 5 'end and the 3' end of the fusion gene respectively to synthesize an SPK1-CTB-TIM3Fv fusion gene;

construction of transformants of the two, TIM3Fv and CTB-TIM3Fv fusion genes

(2.1) fusing SPK1-TIM3Fv and SPK1-CTB-TIM3Fv in a gene-fused lactic acid bacteria expression vector pLN to obtain a connector;

(2.2) transforming the connector into lactococcus lactis with lacF gene deletion by adopting an electric shock transformation method, and screening by adopting a selective medium EM (effective medium) with lactose as a unique carbon source to obtain a TIM3Fv gene or a CTB-TIM3Fv fusion gene transformed lactobacillus.

The second object of the present invention can be achieved by the following technical solutions: the application of the TIM-3 humanized single-chain antibody fusion gene transformed lactobacillus in preparing oral viable bacteria medicament with disease immunotherapy effect.

Optionally, the disease is a tumor, a virus-infected disease, an intracellular bacterial-infected disease, a primary and a secondary hypoimmunity disease.

Optionally, the tumor is renal adenocarcinoma or colorectal cancer.

Optionally, the oral viable bacteria medicament is a viable bacteria suspension, a dairy product, a viable bacteria powder, a bacteria tablet or a capsule.

The TIM-3 humanized single-chain antibody fusion gene transformed lactic acid bacteria have the effect of inhibiting tumor growth.

Compared with the prior art, the invention has the following advantages:

(1) the fusion gene of TIM3Fv and CTB-TIM3Fv in the invention is transformed into lactobacillus and is characterized in that no antibiotic or drug resistance gene is carried;

(2) the fusion gene of TIM3Fv and CTB-TIM3Fv in the invention is transformed into the fusion gene of TIM3Fv and CTB-TIM3Fv in lactic acid bacteria, and the fusion gene can be induced and expressed by an inducer Nisin in vitro or in vivo, particularly in intestinal tracts;

(3) the fusion gene of TIM3Fv and CTB-TIM3Fv in the invention transforms lactobacillus to express in intestinal tract, and can directly act in the intestinal tract to prevent and treat intestinal tumor;

(4) according to the invention, CTB-TIM3Fv fusion gene is transformed into CTB-TIM3Fv fusion protein expressed by lactic acid bacteria, the CTB-TIM3Fv fusion protein can be endocytosed by intestinal epithelial cells through CTB receptor-mediated endocytosis, and is specifically digested by furin, and free TIM3Fv with retained immunological activity is released to the outside of cells or in blood circulation, so that an intestinal mucosa barrier is broken through, lymphocyte activation is stimulated, the cellular immunity level of an organism is improved, and a TIM-3 immunosuppressive pathway is blocked to play an anti-tumor role;

(5) the TIM3Fv and CTB-TIM3Fv fusion gene transformed lactobacillus can be prepared into viable bacteria preparations such as viable bacteria suspension, dairy products, viable bacteria powder, bacteria tablets or capsules, can be proliferated and colonized in intestinal tracts of human bodies after being orally taken, and is applied to prevention and treatment of diseases such as tumors, virus infection or intracellular bacterial infection, primary and secondary low immunity and the like.

Drawings

FIG. 1 is a schematic diagram showing the construction of a lactic acid bacterium expression vector for the CTB-TIM3Fv fusion gene in example 1;

FIG. 2 is a graph comparing the oral administration of live TIM3Fv and CTB-TIM3Fv transformed lactic acid bacteria in example 2, which significantly inhibited the growth of mouse renal adenocarcinoma RAG cell subcutaneous transplanted tumors, and A is a dissected photograph; b is a tumor body size statistical chart;

FIG. 3 is a statistical graph showing that oral administration of live TIM3Fv and CTB-TIM3Fv transformed lactic acid bacteria significantly stimulates differentiation and maturation of spleen lymphocytes of mice bearing RAG tumor in example 2, wherein A is a distribution map of spleen lymphocyte subtype ratios and B is a distribution map of spleen activated lymphocyte ratios;

FIG. 4 is a graph comparing the number of tumor sizes of live bacteria of TIM3Fv and CTB-TIM3Fv transformed lactic acid bacteria significantly inhibiting the growth of primary colon cancer in APC mice in example 3 by oral administration.

Detailed Description

The method of the present invention is further illustrated by the following examples. The following examples and drawings are illustrative only and are not to be construed as limiting the invention. Unless otherwise specified, the reagent raw materials used in the following examples are raw reagent raw materials which are conventionally commercially available or commercially available, and unless otherwise specified, the methods and apparatuses used in the following examples are those conventionally used in the art.

Example 1 preparation, screening and characterization of lactic acid bacteria transformed with the fusion Gene of TIM3Fv and CTB-TIM3Fv

1. Synthesis and recombination of TIM3Fv and CTB-TIM3Fv fusion gene

(1) According to the amino acid sequence of the SPK1 signal peptide, codons are optimized to be suitable for efficient expression of lactic acid bacteria, and a cDNA sequence (SEQ ID NO: 1) of the SPK1 gene is designed.

(2) A complementary DNA gene sequence is designed according to an amino acid sequence and a functional region structure of a TIM3 humanized antibody, a heavy chain variable region (VH) and a light chain variable region (VL) are connected through a connecting peptide segment (Linker) and a Flag tag sequence to form a TIM3Fv gene, and codons are optimized to enable the TIM3Fv gene to be suitable for lactic acid bacteria to express efficiently (SEQ ID NO: 2).

(3) According to the CTB gene sequence, the codon is optimized to be suitable for the high-efficiency expression of lactic acid bacteria, and the CTB gene cDNA sequence (SEQ ID NO: 3) is designed.

(4) The DNA sequences of the SPK1 and TIM3Fv genes are connected to form a fusion gene SPK1-TIM3 Fv. NcoI and XbaI restriction endonuclease digestion sequences are respectively introduced into the 5 'end and the 3' end of the fusion gene, and the recombinant SPK1-TIM3Fv fusion gene complete gene double-stranded DNA is synthesized by a chemical synthesis method.

(5) The DNA sequences of the SPK1, CTB and TIM3Fv genes are connected to form a SPK1-CTB-TIM3Fv fusion gene, and a DNA sequence corresponding to a furin enzyme digestion polypeptide sequence is introduced between the CTB and the TIM3Fv genes. NcoI and XbaI restriction endonuclease enzyme digestion sequences are respectively introduced at the 5 'end and the 3' end of the fusion gene, and the recombinant SPK1-CTB-TIM3Fv fusion gene whole gene double-stranded DNA is synthesized by a chemical synthesis method.

2. Construction of TIM3Fv and CTB-TIM3Fv fusion gene lactobacillus expression vector

(1) The fusion gene fragment of SPK1-TIM3Fv and SPK1-CTB-TIM3Fv and the lactic acid bacteria expression vector pLN were digested with NcoI and XbaI endonucleases, respectively, and the objective gene fragment and the vector fragment were separated by agarose electrophoresis.

(2) The fusion gene fragment of SPK1-TIM3Fv or SPK1-CTB-TIM3Fv and the vector pLN digested fragment were excised, and the desired DNA fragment was recovered using an agarose gel DNA recovery kit. Mixing the two DNA fragments according to a certain proportion, adding a connection buffer solution and T4 DNA ligase, connecting for 6-12 hours at 16 ℃ and connecting to obtain a recombinant expression vector pLN-TIM3Fv or pLN-CTB-TIM3 Fv.

(3) The lactobacillus is transformed by electroporation. Adding 100-500 mu g of recombinant expression vector pLN-TIM3Fv or pLN-CTB-TIM3Fv ligation product into competent cell suspension of 100 mu LLacF gene-deleted lactococcus, uniformly mixing, transferring into a 2mm wide electric shock cup, placing the electric shock cup into an electric shock groove, and setting electric shock conditions: 2.5kV, a capacitance of 25 muF and a resistance of 200 omega.

(4) Culture screening of TIM3Fv and CTB-TIM3Fv transformed lactic acid bacteria colonies. After the electric shock, 200-400. mu.L of MgCl solution containing 20mM is added₂EM medium with 2mM CaCl, 0.5% lactose suspends and washes bacteria, and spreads to contain 0.5% lactoseAnd an EM agarose plate of 0.04% bromocresol purple, and culturing in an anaerobic chamber at 30 ℃ for 48 h. Single colonies were picked and cultured for 24h in 5mL of EM liquid medium containing 0.5% lactose.

(5) Selecting single colony for amplification culture, extracting plasmid by using a conventional plasmid extraction kit, sending to DNA sequencing company, and carrying out sequencing identification on the transformed lactobacillus by using TIM3Fv and CTB-TIM3Fv by using an expression vector universal sequencing primer (TGCTTTATCAACTGCTGCTT).

(6) Sequencing and identifying correct TIM3Fv and CTB-TIM3Fv transformed lactobacillus, culturing in EM medium, adding glycerol to final concentration of 25%, subpackaging, and storing at-20 deg.C in refrigerator. Obtaining the fusion gene of the TIM3Fv gene and the CTB-TIM3Fv to transform the original strain of the lactobacillus.

Construction of CTB-TIM3Fv fusion Gene lactic acid bacteria expression vector As shown in FIG. 1, the CTB-TIM3Fv fusion gene, to which a signal peptide (signal) for lactic acid bacteria secretion was ligated and a FLAG tag was introduced, was inserted into the NcoI and XbaI restriction sites of the lactic acid bacteria expression vector pLN to obtain a pLN-CTB-TIM3Fv recombinant lactic acid bacteria expression vector, and was then subjected to electroporation to obtain a CTB-TIM3Fv fusion gene-transformed lactic acid bacteria.

Example 2 use of live bacteria of transformed lactic acid bacteria TIM3Fv and CTB-TIM3Fv for prevention and treatment of subcutaneous transplantable tumor of renal adenocarcinoma in mice

(1) Establishment of mouse kidney cancer RAG transplantation tumor model

Healthy male BABL/c mice with age of 8 weeks and body weight of 18-20g are selected, and RAG mice cultured in vitro are suspended from renal adenocarcinoma cells (about 1X 10)⁶One) was injected subcutaneously into each mouse, and the bacterial powder feeding treatment was started after the transplanted tumor of the mouse grew to a diameter of 0.5 cm.

(2) Culture of transformed bacteria

Recovering TIM3Fv and CTB-TIM3Fv with EM culture medium to transform lactobacillus strain (obtained in example 1), inoculating the bacterium to EM culture medium according to a certain ratio (1:100-500) after the bacterium reaches a certain concentration, and when the density of the bacterium reaches OD₆₀₀Collecting bacteria at 0.6-1.0.

(3) Preparation of viable bacterial suspension

After the bacteria are cultured to a certain density, 5000g-10000g of bacteria are collected by centrifugation for 5-10 minutes, and edible sugar and salt mixed solution or beverage is added for heavy suspension, and the mixture is stored in a refrigerator at 4-8 ℃.

(4) Preparation of freeze-dried live bacteria preparation

After bacteria are cultured to a certain density, 5000g-10000g of bacteria are collected by centrifugation for 5-10 minutes, an antifreezing protective solution (15% of skimmed milk powder, 5% of glycerol and 0.9% of NaCl) is added according to a certain proportion for heavy suspension and mixing, the mixture is uniformly dispersed, the mixture is put into an ultra-low temperature refrigerator for pre-freezing until the mixture is completely frozen, and then the mixture is put into a freeze drier for drying under the condition of the vacuum degree of 10.0-12.00Pa until the water content of the bacteria powder is less than 3%. After the freeze drying is finished, taking out the bacterial powder, subpackaging the bacterial powder into a sterile sealed container, and storing at the temperature of minus 20 ℃ for later use.

(5) Preparation of spray-dried enteric viable bacteria preparation

After the bacteria are cultured to a certain density, 5000g to 10000g of bacteria are collected by centrifugation for 5 to 10 minutes, the enteric capsule wall material and the protective agent are added for resuspension, and the enteric viable bacteria powder is obtained by spray drying under the conditions of a certain drying temperature of 100-. Storing in a refrigerator at 4-8 deg.C for use.

(6) Determination of bacterial activity of transformed live lactobacillus powder

Weighing 0.1g of bacterial powder, resuspending the bacterial powder with 1.0mL of EM culture medium, diluting the bacterial powder in a gradient of 1:100, 1:1000 and 1:1000, respectively taking 0.1mL of bacterial liquid, coating the bacterial liquid on an EM solid culture medium plate, and culturing the bacterial liquid in an anaerobic culture box at 37 ℃ for 48 hours. The colony forming units per gram of bacteria (CFU/g) were calculated.

(7) Application of TIM3Fv and CTB-TIM3Fv transformed live lactobacillus in preventing and treating mouse renal adenocarcinoma subcutaneous transplantation tumor

The RAG renal carcinoma subcutaneous transplantable tumors were divided into 3 groups of 6 mice each. Mice, pLN empty Vector-transformed lactococcus control (Vector), pLN-TIM3Fv (TIM3Fv), and pLN-CTB-TIM3Fv (CTB-TIM3Fv), respectively.

Each group of mice was fed with 0.1mL (about 1X 10) of viable powder of lactic acid bacteria⁹cfu). The feed is administered once daily for 4 weeks. The tumor size of the mice was measured every other day, and the state of each group of mice was observed.

When the tumor body diameter of the VC control group mice exceeds 2.5cm, the hairs are messy and sparse, and the body state is poor, the mice are sacrificed. Before sacrifice, the eyeball is picked to take peripheral blood, the neck is cut off and killed, the size and weight of the tumor body are measured, and the volume and the tumor inhibition rate are calculated.

Dissecting the mouse, and observing the tumor metastasis condition; separating spleen lymphocytes, and analyzing the immune level of the mouse cells by flow cytometry; taking tissues such as tumor, liver, spleen, kidney, stomach, intestinal contents, muscle and the like, and immunologically determining the content and distribution of TIM3 Fv; fixing the above materials in 4% paraformaldehyde solution, and slicing to observe pathological changes and tumor metastasis.

As shown in FIG. 2, oral administration of live bacteria of TIM3Fv and CTB-TIM3Fv transformed lactic acid bacteria significantly inhibited the growth of renal cancer in RAG mice. The volume of TIM3Fv transformed group (TIM3Fv) nodules was slightly less than the empty Vector transformed group (Vector) nodules. The volume of CTB-TIM3Fv transformed lactobacillus (CTB-TIM3Fv) tumor bodies was significantly smaller than that of TIM3Fv and Vector.

As shown in FIG. 3, oral administration of live bacterium of TIM3Fv and CTB-TIM3Fv transformed lactic acid bacteria significantly stimulated differentiation and maturation of spleen lymphocytes of RAG tumor-bearing mice, and spleen mature lymphocytes (CD 3) of mice of TIM3Fv transformed bacteria group (TIM3Fv)⁺CD8⁺) Ratio and activation of lymphocytes (CD 3)⁺CD69⁺) The proportion is obviously higher than that of an empty Vector transformation bacterium group (Vector) mouse; CTB-TIM3Fv group of transformed lactic acid bacteria (CTB-TIM3Fv) CD3⁺CD8⁺The cell proportion is higher than that of a Vector group; CD3⁺CD69⁺The cell ratios were significantly higher than both TIM3Fv and Vector groups.

Example 3 use of TIM3Fv and CTB-TIM3Fv to transform live lactic bacteria for the prevention and treatment of Primary colorectal cancer

(1) The procedures for recovering and culturing transformed lactic acid bacteria, and preparing viable bacteria powder using TIM3Fv and CTB-TIM3Fv were the same as those in example 2.

(2) Colorectal cancer APCmin/+ model construction

APCmin/+ male mice and C57BL female mice were selected and combined in a ratio of 1 male mouse to three female mice per cage. After 2 weeks of delivery, the foot and toe markers are clipped, and a small tail or small ear is clipped. Extracting tissue genome DNA by a conventional method, amplifying a target DNA fragment by a Polymerase Chain Reaction (PCR) method according to a Nanjing model animal resource library method, and identifying APCmin/+ heterozygote. Only 700bp bands of PCR products are wild mice; only 300bp bands are mutant homozygote mice; meanwhile, the 300bp and 700bp bands are the APCmin/+ heterozygote mice.

APCmin/+ Male and female molds were made 6-8 weeks old, and each mouse was injected with 1mg/mL AOM (azomethane) per body weight at a dose of 10. mu.L AOM/g. And then feeding high-fat feed, observing the state and the excrement condition of the mouse, measuring the weight of the mouse every 3 days, and successfully molding when the mouse has hematochezia and even has proctoptosis.

(3) Application of orally taken intestinal tract route of TIM3Fv and CTB-TIM3Fv transformed live lactobacillus for preventing and treating primary mouse colon cancer

APC model mice were randomly divided into 3 groups with a minimum of 6 mice per group. APCmin/+, successfully modeled, was selected for the treatment study and the treatment group was fed 0.1mL (approximately 6X 109 cfu).

The pLN-TIM3Fv group (TIM3Fv) and the pLN-CTB-TIM3Fv group (CTB-TIM3Fv), respectively, were fed once daily; the empty Vector control group (Vector group) was fed with the same amount of pLN-transformed lactobacillus powder.

The food intake and the body weight of the mice are measured every other day, the state and the excrement condition of the mice are observed, and the mice are sacrificed when the blood and the anus are seriously rectocele and the body weight is obviously reduced in a blank control group of mice. Fasting is carried out for 12h before sacrifice, after eyeballs are picked and peripheral blood is taken, neck is cut off and sacrifice is carried out, the length of an intestinal canal is measured, the size of a tumor body in the intestinal canal is observed, whether metastatic foci exist in mesenteric lymph nodes, livers and lungs of mice or not is investigated, and intestinal canal tissues and intestinal contents are cut and stored for later use.

As shown in FIG. 4, oral administration of live bacteria of transformed lactic acid bacteria, TIM3Fv and CTB-TIM3Fv, significantly inhibited the growth of primary colon cancer in APC mice.

The number and size of nodules and rectal tumors of the TIM3Fv and CTB-TIM3Fv transformed lactobacillus group (TIM3Fv group and CTB-TIM3Fv group) were significantly smaller than those of mice in the empty Vector transformed bacterium group (Vector). The TIM3Fv group showed the best therapeutic effect, the tumor volume at the node and rectum was the least, and the tumor volume was smaller with signs of atrophy.

The invention is not limited to the specific embodiments described above, which are intended to illustrate the use of the invention in detail, and functionally equivalent production methods and technical details are part of the disclosure. In fact, a person skilled in the art, on the basis of the preceding description, will be able to find different modifications according to his own needs, which modifications are intended to be within the scope of the claims appended hereto.

Sequence listing

<110> Guangzhou Vital Jun Biotechnology GmbH

<120> TIM3 human single-chain antibody fusion gene transformed lactic acid bacteria and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 72

<212> DNA

<213> Pediococcus K1 Signal peptide (SPK1)

<400> 1

atgaaaaaga ttcttacact tgtctttatt tttgttattt caattcttac agctacaaat 60

gttcatgcat ta 72

<210> 2

<211> 816

<212> DNA

<213> TIM-3 human Single-chain antibody (TIM3Fv)

<400> 2

caggtgcagc tggtgcagtc aggcgccgaa gtgaagaaac caggcgctag tgtgaaagtt 60

agctgtaaag ctagtggcta tactttcact tcttataata tgcattgggt ccgtcaggcc 120

ccaggtcaag gcctcgagtg gatcggcgat atctacccag gtcaaggcga cacttcatat 180

aatcagaagt ttaagggtag agctactatg accgccgata agtctacttc taccgtctat 240

atggaactga gttcactgag atctgaggac accgccgtct actactgtgc tagagtgggc 300

ggagccttcc caatggacta ctggggtcaa ggcaccctgg tcaccgtgtc tagcgctagc 360

actaagggcg gtggaggcgg ttcagattat aaagatcatg atggtgatta taaagatcat 420

gatattgatt ataaagatga tgatgataaa ggcggtggcg gatcagctgc cgtgacgcgt 480

aagattgagg tcaagactgg cggaggcttc accagccctg acaagagatc tcagcagtgt 540

tactacgtcg ccgtggacga ggcccagctg agcagtatta ctctgacctt cgacaccggc 600

agtggtagcg gtagctttag agatccagtg ggctcagaag tgaactctgc cgcctacatc 660

ctgctgaagc ctccacaagg tccaaagcag cagtattggc agatgctgag cactggctac 720

tacgaggtct cagaaagtgc tagatgtaac attactgctc gtgagggcct gagcgtcgcc 780

ctgagcgatc catcacagac tctggtcatc gattga 816

<210> 3

<211> 372

<212> DNA

<213> cholera toxin subunit B (CTB)

<400> 3

atgattaaat taaaatttgg tgtttttttt acagttttac tatcttcagc atatgcaaat 60

ggaacacctc aaaatattac tgatttgtgt gcagaatacc acaacacaca aatacatacg 120

ctaaatgata agatattttc gtatacagaa tctctagctg gaaaaagaga gatggctatc 180

attactttta agaatggtgc aacttttcaa gtagaagtac caggtagtca acatatagat 240

tcacaaaaaa aagcgattga aaggatgaag gataccctga ggattgcata tcttactgaa 300

gctaaagtcg aaaagttatg tgtatggaat aataaaacgc ctcatgcgat tgccgcaatt 360

agtatggcaa at 372

Claims

TIM-3 humanized single-chain antibody fusion gene-transformed lactic acid bacteria, which are characterized in that: the lactic acid bacteria transformed by the TIM3Fv gene or the CTB-TIM3Fv fusion gene are obtained by inserting the TIM3Fv gene or the CTB-TIM3Fv fusion gene into a lactic acid bacteria expression vector pLN and transforming the lactic acid bacteria, wherein the CTB-TIM3Fv fusion gene is mainly formed by connecting a TIM3Fv gene and a CTB gene, a cDNA sequence corresponding to a furin enzyme digestion polypeptide sequence is introduced between the TIM3Fv gene and the CTB gene, and a secretory signal peptide SPK1 is introduced at the N end of the TIM3Fv gene and the CTB-TIM3Fv fusion gene;

the TIM-3 humanized single-chain antibody fusion gene-transformed lactic acid bacteria are prepared by the following method:

synthesis of TIM3Fv fusion genes SPK1-TIM3Fv and SPK1-CTB-TIM3 Fv:

(1.1) optimizing codons according to the SPK1 signal peptide amino acid sequence to obtain the SPK1 gene cDNA sequence, wherein the sequence is shown as SEQ ID NO: 1 is shown in the specification;

(1.2) designing a complementary DNA gene sequence according to the amino acid sequence and the functional region structure of the TIM3 human antibody, connecting a heavy chain variable region (VH) and a light chain variable region (VL) through a connecting peptide segment (Linker) and a Flag tag sequence to form a TIM3Fv gene, and optimizing codons to ensure that the gene is suitable for efficient expression of lactic acid bacteria, wherein the sequence is shown as SEQ ID NO: 2 is shown in the specification;

(1.3) according to the CTB gene sequence, optimizing codons to obtain a CTB gene cDNA sequence, wherein the sequence is shown as SEQ ID NO: 3 is shown in the specification;

(1.4) connecting the cDNA sequences of the SPK1 and the TIM3Fv gene to form a fusion gene, and adding restriction endonuclease digestion sequences of NcoI and XbaI to the 5 'end and the 3' end of the fusion gene respectively to synthesize an SPK1-TIM3Fv gene;

(1.5) connecting cDNA sequences of the SPK1, CTB and TIM3Fv genes to form a fusion gene, introducing a cDNA sequence corresponding to a furin enzyme digestion polypeptide sequence between the CTB and the TIM3Fv genes, and adding NcoI and XbaI restriction endonuclease digestion sequences to the 5 'end and the 3' end of the fusion gene respectively to synthesize an SPK1-CTB-TIM3Fv fusion gene;

construction of transformants of the two, TIM3Fv and CTB-TIM3Fv fusion genes

(2.1) fusing a gene-containing lactobacillus expression vector pLN with SPK1-TIM3Fv and SPK1-CTB-TIM3Fv to obtain a connector, wherein the lactobacillus expression vector pLN is a plasmid vector which is derived from a nisin induction expression system NICE, contains a LacF nutrition screening gene and does not contain an antibiotic resistance gene;

(2.2) transforming the connector into lactococcus lactis with lacF gene deletion by adopting an electric shock transformation method, and screening by adopting a selective medium taking lactose as a unique carbon source to obtain TIM3Fv gene or CTB-TIM3Fv fusion gene transformed lactobacillus.
2. TIM-3 human single-chain antibody fusion gene-transformed lactic acid bacteria according to claim 1, characterized by: the transformed lactic acid bacteria do not contain a drug-resistant gene, and can induce expression and secrete recombinant proteins TIM3Fv and/or CTB-TIM3Fv in intestinal lumens or in vitro.
3. Use of the TIM-3 humanized single-chain antibody fusion gene transformed lactic acid bacteria of claim 1 for the preparation of an orally viable bacteria medicament with immunotherapeutic effect on a disease, said disease being a tumor, said tumor being renal adenocarcinoma or colorectal carcinoma.
4. Use according to claim 3, characterized in that: the oral viable bacteria medicament is viable bacteria suspension, dairy product, viable bacteria powder, bacteria tablet or capsule.