KR20160092789A - Peptide tag with improved affinity toward 2B8 antibody and use thereof - Google Patents

Abstract

The present invention relates to a peptide tag produced by mutating an original epitope tag derived from bacteriophytochrome (BphP), a photoreceptive protein in Deinococcus radiodurans. The present invention further relates to a use thereof. According to the present invention, the peptide tag shows inherent functions of the original epitope tag such as the short length and minimized nonspecific reactions, and also exhibits higher affinity to antibody than the original counterpart. Thus, the use of the peptide tag and the antibody thereagainst enables efficient detection or purification of fusion proteins expressed in recombinant cells. In addition, an epitope tagging system involving the peptide tag and the antibody thereagainst can be widely applied to various fields associated with intracellular spotting for specific protein, functionality investigation, detection, purification, and a search for protein-protein interaction.

Description

2B8 < / RTI > antibodies and uses thereof. ≪ Desc / Clms Page number 2 >

The present invention relates to a peptide tag used in an epitope tagging system, and more particularly, to a peptide tag derived from Bacteriophytochrome (BphP), a photoreceptor protein of Deinococcus radiodurans, To an improved affinity of the peptide tag. The present invention also relates to the use of peptide tags, and more particularly to techniques for producing fusion proteins using peptide tags and techniques for detecting or purifying fusion proteins.

Useful proteins or polypeptides can be produced by synthesis or isolated from natural sources. However, such a method is disadvantageous in terms of cost, time, and production volume. Therefore, it is preferable to produce a target protein and a target polypeptide through culturing a transformant produced by recombination to over-express the target protein or the target polypeptide. However, a polypeptide produced in a cell environment (particularly a short polypeptide) may be sensitive to the degradation due to the action of the protease present in the cell, and since antibodies to all the target proteins are not present, It may not be easy to purify a target protein that does not exist.

Protein tagging or epitope tagging has been used to overcome this problem. Protein tagging or epitope tagging is performed by preparing a recombinant nucleic acid molecule in which a coding sequence of an epitope tag is linked to a coding sequence of a target protein and expressing it in a suitable host cell and then using an antibody against an epitope tag , Which is a recombinant DNA method used for detecting, quantifying, purifying a target protein, locating a target protein in a cell, or identifying a function. There are a number of commercially available epitope tags and ligand antibodies thereon, and when selecting the appropriate epitope tag and antibody thereto, Western blot analysis, immunoprecipitation, immunofluorescence, The target protein can be detected or purified by immunocytochemistry, immunoaffinity purification, or the like, thereby eliminating the need for antibody production to the target protein.

Currently, epitope tags used for protein tagging or epitope tagging include short peptide tags (eg, 6 × His tag) of about 6 amino acid residues to large proteins of about 40 kDa (eg, MBP) (See Stevens, RC, (2000) Structure Fold Des 8: R177-85). Peptide tags, typically composed of 3 to 30 amino acids, are used. His-tagged proteins are specifically trapped on Ni-NTA (nickel-nitrilotriacetic acid) resin, which can be eluted by EDTA or imidazole. In addition, maltose binding protein (MBP, 396 amino acids, 40 kDa), staphylococcus protein A, calmodulin-binding peptide (CBP, 26 amino acids, 2.96 kDa), GFP (238 amino acids, 27 kDa) Glutathione-S-transferase (GST, 211 amino acids, 26 kDa) can be used for the detection or purification of prokaryotic and eukaryotic proteins. In general, the most frequently used epitope tags include c-myc tags, HA tags, and FLAG tags. The c-myc tag is a 10 amino acid long epitope tag derived from human c-myc protein [Evans et al., (1985) Mol. Cell. Biol., 12: 3610-3616), the HA tag is an epitope tag of nine amino acid lengths derived from the influenza hemagglutinin HA-1 protein [Field et al. (1988) Mol. Cell. Biol., 8: 2159-2165). The FLAG tag is an eight amino acid length epitope tag derived from the bacteriophage T7 [Hopp et al., (1988) Bio / Technology, 6: 1204-1210].

On the other hand, the epitope tag used in epitope tagging preferably minimally affects the three-dimensional structure and biological activity of the target protein when fused with the target protein. Generally, a long epitope tag (for example, a GST tag or MBP tag) have problems such as changing the function of a target protein. On the other hand, relatively short epitope tags such as the FLAG tag and the c-myc tag have very little effect on the characteristics of the target protein fused with it, In some cases it is currently used primarily because it does not need to be removed from the fusion protein. However, since the amino acid sequence of the c-myc tag and the FLAG tag contains the same sequence in many proteins of known proteins in living cells, it induces a nonspecific reaction of the tag-recognizing antibody, and this non- (Ksenija Gasic et al., (2005) Plant molecular biology reporter 23: 9-16]. In order to overcome this nonspecific reaction problem, an affinity purification system has been developed in which two different tags are fused successively to the N-terminus of the protein (Rigaut, G., et al. (1999) Nat Biotechnol 17: 1030-2]. Korean Patent Registration No. 10-12416667 and Korean Patent Registration No. 10-1342974 also disclose a non-specific reaction originating from Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans A peptide tag with a short amino acid sequence that can be minimized and at the same time a 2B8 monoclonal antibody that can be used in pairs is disclosed.

The inventors of the present invention have previously developed an epitope tagging system containing a 2B8 monoclonal antibody and its original epitope tag using Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans, I have applied for a patent. The present invention has been made under these circumstances, and an object of the present invention is to provide a mutant peptide tag having improved affinity for a 2B8 monoclonal antibody than the original epitope tag, and its use.

The inventors of the present invention confirmed that the affinity for the 2B8 monoclonal antibody is improved when the original epitope tag for the 2B8 monoclonal antibody is mutated by a specific means, and the present invention has been completed.

In order to solve the above object, the present invention provides a peptide comprising aspartic acid glutamic acid, which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 10, or aspartic acid which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: There is provided a peptide tag comprising a peptide in which phenylalanine, which is a sixth amino acid residue of a peptide substituted with glutamic acid, is substituted with a hydrophilic amino acid, as a recognition site of an antibody or a binding site of an antibody. The hydrophilic amino acid is preferably tyrosine.

The present invention also provides polynucleotides encoding the aforementioned peptide tags. The polynucleotide encoding the peptide tag is preferably a forward primer having the nucleotide sequence of SEQ ID NO: 32 and a primer pair consisting of the reverse primer having the nucleotide sequence of SEQ ID NO: 33 or a forward primer having the nucleotide sequence of SEQ ID NO: And a reverse primer having the nucleotide sequence of SEQ ID NO: 41.

The present invention also provides a primer pair for synthesizing a polynucleotide encoding the above-mentioned peptide tag. The primer pair comprises a forward primer having the nucleotide sequence of SEQ ID NO: 32 and a reverse primer having the nucleotide sequence of SEQ ID NO: 33 or a forward primer having the nucleotide sequence of SEQ ID NO: 40 and a reverse primer having the nucleotide sequence of SEQ ID NO: .

The present invention also provides a recombinant vector comprising a polynucleotide encoding the aforementioned peptide tag. The recombinant vector may be a cloning vector or an expression vector. In addition, the expression vector preferably further comprises a polynucleotide encoding a target protein, and the polynucleotide of interest is linked to a polynucleotide encoding a peptide tag.

The present invention also provides a fusion protein comprising a target protein and a peptide tag linked thereto. The peptide tag constituting the fusion protein includes a peptide in which aspartic acid is replaced with glutamic acid, which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 10, or aspartic acid, which is the second amino acid residue in the peptide consisting of the amino acid sequence of SEQ ID NO: A peptide in which phenylalanine, which is the sixth amino acid residue, is substituted with a hydrophilic amino acid is included as a recognition site of the antibody or a binding site of the antibody. The hydrophilic amino acid is preferably tyrosine.

The present invention also provides polynucleotides encoding the aforementioned fusion proteins.

In addition, the present invention relates to a polynucleotide encoding the aforementioned peptide tag, a recombinant vector comprising a polynucleotide encoding the above-mentioned peptide tag, a polynucleotide encoding the above-mentioned fusion protein, and a polynucleotide encoding the aforementioned fusion protein And a recombinant vector comprising the recombinant vector is introduced.

The present invention also relates to a method for producing a fusion protein comprising the steps of: (a) contacting said fusion protein with an antibody to a peptide tag; And detecting the presence or amount of the fusion protein bound to the antibody. The fusion protein can be expressed by a transformant into which a recombinant vector having a polynucleotide encoding a fusion protein is introduced or a polynucleotide encoding a fusion protein is introduced. Preferably, the antibody is a monoclonal antibody produced by a hybridoma cell line with a deposit number of KCTC 12283BP.

The present invention also relates to a method for producing a fusion protein comprising the steps of: (a) contacting said fusion protein with an antibody to a peptide tag; And recovering the fusion protein bound to the antibody. The fusion protein can be expressed by a transformant into which a recombinant vector having a polynucleotide encoding a fusion protein is introduced or a polynucleotide encoding a fusion protein is introduced. Preferably, the antibody is a monoclonal antibody produced by a hybridoma cell line with a deposit number of KCTC 12283BP.

The present invention also relates to a method for producing a fusion protein comprising a polynucleotide encoding the above-mentioned peptide tag, a primer pair for synthesizing a polynucleotide encoding the aforementioned peptide tag, a recombinant vector comprising the polynucleotide encoding the peptide tag described above, A recombinant vector comprising a polynucleotide encoding a fusion protein and a polynucleotide encoding a fusion protein described above; And the peptide consisting of the amino acid sequence of SEQ ID NO: 10, wherein the aspartic acid, which is the second amino acid residue, is substituted with glutamic acid, or the peptide consisting of the amino acid sequence of SEQ ID NO: An antibody that specifically binds to a peptide in which phenylalanine residue is substituted with a hydrophilic amino acid, and a hybridoma cell line that produces the antibody. The present invention also provides a kit for detecting or purifying a fusion protein. The hybridoma cell line is preferably characterized in that the accession number is KCTC 12283BP.

The peptide tag according to the present invention retains the advantages of the original epitope tag such as short length and minimization of nonspecific reaction, while at the same time being more excellent in affinity for the antibody than the original epitope tag. Therefore, when the peptide tag of the present invention and the antibody thereof are used, the fusion protein expressed in the recombinant cell can be detected or purified very efficiently. In addition, the epitope tagging system including the peptide tag and the antibody according to the present invention can be applied to various fields such as identification of a specific protein, intracellular localization, functional identification, detection, purification, and protein interactions.

FIG. 1 shows the results of purifying DrBphP and DrBphN using His tag column chromatography. FIG. 1 (A) is a schematic diagram showing a gene construct used for expressing BphP protein and BphN protein of Deinococcus radiodurans [FL, total length (1-755 amino acid, BphP); ? PHY / HKD (1-321 amino acids, BphN)]; Figure 1 (B) shows the results of SDS-PAGE after purification of BphP apoprotein and BphN apoprotein of Deinococcus radiodurans using Ni ⁺ -NTA affinity chromatography and incubation with BV for 20 minutes , The result of detection of BV binding by zinc-induced fluorescence (right) and the result of staining with Coomassie Blue (left). 1: BphP crude extract, 2: purified BphP, 3: BphN crude extract, 4: purified BphN. Purification conditions - Binding & Washing: pH 8.0, 100 mM Tris, 200 mM NaCl, 10 mM imidazole / elution: pH 8.0, 100 mM Tris, 200 mM NaCl,
Figure 2 shows the results of Western blot performed on purified BphP and BphN using selected monoclonal antibodies. SDS-PAGE was performed on the purified BphP and BphN and western blotting was performed using the purified monoclonal antibodies (2B8, 2C11, 3B2, 3D2, 3H7) of Bphp. P; BphP, N; BphN. Western blot confirmed that the 2B8 antibody in the monoclonal antibody recognizes an epitope present at the N-terminus of the BphP protein.
FIG. 3 shows the result of confirming whether the PCD structure constituting the N-terminal region reacts with 5 kinds of monoclonal antibodies of BphP, Oat PhyA, which is an otopicochrome protein similar to DrBphP.
Figure 4 shows the results of epitope mapping for antibody 2B8 via Western blot.
FIG. 5 shows the affinity of the original epitope tag and the mutated peptide for the 2B8 antibody through Western blot. FIG. 6 shows the affinity of the original epitope tag and the mutant peptide for the 2B8 antibody in an indirect ELISA (enzyme-linked immunosorbent assay) Respectively.

One aspect of the present invention relates to a peptide tag that can be used in an epitope tagging system for purifying or detecting a target protein, and the like. The peptide tag according to the present invention is a mutated tag of the original epitope tag having the amino acid sequence of SEQ ID NO: 10 and is characterized in that the affinity with the 2B8 monoclonal antibody is improved. The peptide tag according to the present invention includes a peptide in which aspartic acid, which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 10, is substituted with glutamic acid, as a recognition site of the antibody or a binding site of the antibody. In addition, the peptide tag of the present invention is characterized in that a peptide in which phenylalanine, which is the sixth amino acid residue of the peptide substituted with glutamic acid, which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 10 is substituted with hydrophilic amino acid, Or as a binding site for the antibody. In addition, the hydrophilic amino acid is preferably selected from hydrophilic amino acids having a neutral charge such as asparagine, glutamine, serine, threonine, and tyrosine, more preferably double tyrosine.

In the context of the present invention, peptide tags can be used interchangeably with protein tags or epitope tags. The term "peptide tag" in the present invention means a peptide that can be fused to a target protein and used as a tag. The term "epitope" in the present invention means an antigen binding site recognized by a specific antibody, or a certain site of an antigen that reacts with B cells or T cells.

Further, the length of the peptide tag according to the present invention is not limited to a great extent. For example, the peptide tag according to the present invention is preferably a peptide having 9 to 30 amino acid residues in consideration of the number of amino acid residues of a commonly used epitope tag, preferably a peptide consisting of the amino acid sequence of SEQ ID NO: 22, 26 < / RTI > amino acid sequence. The peptide consisting of the amino acid sequence of SEQ ID NO: 22 is the third amino acid sequence of the entire amino acid sequence (SEQ ID NO: 1) of Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans, And the aspartic acid, which is the fourth amino acid residue, is substituted with glutamic acid. The peptide consisting of the amino acid sequence of SEQ ID NO: 26 is also referred to as the N-terminal of the entire amino acid sequence (SEQ ID NO: 1) of Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans A peptide having an amino acid sequence corresponding to the 11th position from the 3 rd position and substituted at the same time with tyrosine as the eighth amino acid residue, phenylalanine.

In addition, the peptide tag of the present invention may be provided in a form combined with other known epitope tags in order to secure versatility in addition to the amino acid sequence of SEQ ID NO: 22 or the amino acid sequence of SEQ ID NO: 26. For example, the peptide tag of the present invention may contain an HA tag, a FLAG tag, a His tag, a BCCP (biotin (SEQ ID NO: 22) or SEQ ID NO: 26) in the amino acid sequence of SEQ ID NO: 22 or SEQ ID NO: 26 to improve the detection ability, purification ability, (US Patent Publication No. 20050221308, US Patent Publication No. 20060099710, US Patent No. 6,642,254) combined with a carboxyl carrier protein or a maltose binding protein (MBP). In addition, the peptide tag of the present invention may comprise a triple tag in which two or more tags selected from the HA tag, the 6 × His tag, the c-myc tag and the V5 tag are bonded to the amino acid sequence of SEQ ID NO: 22 or the amino acid sequence of SEQ ID NO: Tag (see US-A-20100184612). In addition, the peptide tag of the present invention may be provided in a form in which the amino acid sequence of SEQ ID NO: 22 or the amino acid sequence of SEQ ID NO: 26 is repeated or a form in which some amino acid residues in the repeated amino acid sequence are substituted or deleted, (See U.S. Patent No. 7,135,624).

When the peptide tag according to the present invention comprises the amino acid sequence of SEQ ID NO: 22 or the amino acid sequence of SEQ ID NO: 26, the corresponding antibody can be used. For example, as an antibody against a peptide tag comprising the amino acid sequence of SEQ ID NO: 22 or the amino acid sequence of SEQ ID NO: 26, 2B8 single antibody disclosed in Korean Patent Registration No. 10-12416667 and Korean Patent Registration No. 10-1342974 There are clonal antibodies. Meanwhile, the amino acid sequence of SEQ ID NO: 22 or the amino acid sequence of SEQ ID NO: 26 is partially substituted, deleted, added or modified while some amino acids constituting the amino acid sequence of SEQ ID NO: 26 are simultaneously substituted for the 2B8 monoclonal antibody For example, at least 75% or more based on the original binding activity, and the like. Substitution of the amino acid is preferably accomplished by conservative amino acid replacement, in which the nature of the peptide is not altered. Further, the modification of the amino acid may be carried out by glycosylation, acetylation, phosphorylation, and the like. In addition, the peptide tag according to the present invention may contain a labeled amino acid. In addition, the peptide tag according to the present invention may include a peptide having increased structural stability against heat, pH, or the like due to mutation or modification of the amino acid sequence or increased activity against the antibody. For example, the equivalent range of the peptide tag according to the present invention is based on the N-terminal of the entire amino acid sequence (SEQ ID NO: 1) of Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans, The aspartic acid residue, which is the 4th amino acid residue, is substituted with glutamic acid, and the 8th amino acid residue, phenylalanine, is substituted with another hydrophobic amino acid (for example, alanine) Lt; / RTI > peptide. The inventors of the present invention have confirmed that the peptide tag composed of the amino acid sequence of "REPLPAFPP " has a much higher affinity for the 2B8 monoclonal antibody than the original epitope tag (no result). Meanwhile, the peptide tag according to the present invention includes the amino acid sequence (SEQ ID NO: 1) of Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans, The aspartic acid residue having the amino acid sequence corresponding to the 11th position and the 4th amino acid residue replaced with glutamic acid and the 8th amino acid residue phenylalanine substituted with tyrosine are not included. The inventors of the present invention have confirmed that the peptide tag composed of the amino acid sequence of "REPLPYFPP " has a lower affinity for the 2B8 monoclonal antibody than the original epitope tag (no result).

Another aspect of the present invention relates to a polynucleotide encoding the aforementioned peptide tag and a recombinant vector comprising the polynucleotide. The term "polynucleotide" as used herein means any non-modified or modified polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA). The polynucleotides can be single- or double-stranded DNA, DNA which is a mixture of single- and double-stranded regions, single- or double-stranded RNA, RNA which is a mixture of single- and double- Or a hybrid molecule comprising DNA and RNA which may be a mixture of single- and double-stranded regions. In addition, the polynucleotide of the present invention includes a pair of primers used to synthesize the above-mentioned novel peptide tag as single-stranded RNA or DNA. The polynucleotides of the present invention can also be used interchangeably with nucleic acid molecules or oligonucleotides.

Polynucleotides encoding the peptides may or may not contain untranslated sequences (e. G., Introns) (e. G., CDNA). The information on which the peptide is encoded is specified using codons. Typically, the amino acid sequence is encoded by a polynucleotide using a universal genetic code. "Codon" refers to a triplet of nucleotides that determine the amino acid sequence in a polypeptide chain. Most organisms use 20 or 21 amino acids to produce their polypeptides, which are protein or protein precursors. Because there are four possible nucleotides, adenine (A), guanine (G), cytosine (C) and thymine (T) in DNA, there are 64 possible triplets capable of coding 20 amino acids and terminal signals. Because of this redundancy, most amino acids are coded by one or more triplets. This allows a change in the nucleotide sequence without affecting the amino acid sequence of the encoded polypeptide, which is referred to as "silent variation" by "codon degeneracy ". All silent variations of the polynucleotides encoding the novel peptide tags of the present invention are within the scope of the present invention. On the other hand, codons that embody a single amino acid can not be used at the same frequency, and each organism often exhibits a particular " codon-bias "for one of several codons encoding the same given amino acid. If the coding region contains a large number of clusters of rare codons or rare codons, the level of expression can be increased by removing the rare codons using recombination or mutagenesis of the gene [J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001), at 15.12]. Thus, "codon selection" can be used to optimize expression in a selected host. The most preferred codons are codons found primarily in highly expressed genes. In " codon preference "in E. coli, Konigsberg, et al., Proc. Nat'l. Acad. Sci. U.S.A. 80: 687-91 (1983).

When the nucleotide sequence is prepared by chemically synthesizing, it is possible to use a method well known in the art, for example, a method described in Engels and Uhlmann, Angew Chem IntEd Engl., 37: 73-127, 1988 , Triesters, phosphites, phosphoramidites and H-phosphate methods, PCR and other auto primer methods, and oligonucleotide synthesis on solid supports.

Accordingly, the polynucleotide encoding the peptide tag of the present invention can be composed of various base sequences. The primer pair for synthesizing the polynucleotide encoding the peptide tag of the present invention comprises a forward primer having the nucleotide sequence of SEQ ID NO: 32 and a reverse primer having the nucleotide sequence of SEQ ID NO: 33; Or a forward primer having the nucleotide sequence of SEQ ID NO: 40 and a reverse primer having the nucleotide sequence of SEQ ID NO: 41.

The present invention also provides a recombinant vector comprising a polynucleotide encoding the aforementioned peptide tag. The recombinant vector may be provided in the form of a polynucleotide encoding a peptide tag inserted into a cloning vector or an expression vector using known standard methods. As used herein, the term "vector" refers to any medium for cloning and / or transfer of a base into a host cell. In the present invention, the vector may be a replicon capable of bringing about the replication of foreign DNA fragments. Refers to any genetic unit (e.g., a plasmid, phage, cosmid, chromosome, or virus) that functions in vivo as an autologous unit of DNA replication, that is, . The term "vector" includes viral and non-viral mediators for introducing a base into a host cell in vitro, in vitro or in vivo. The term "vector" may also include mini-spherical DNA. For example, the vector may be a plasmid without a bacterial DNA sequence. Removal of abundant bacterial DNA sequences in the CpG region has been done to reduce transgene expression silencing and to bring about a more sustained expression from the plasmid DNA vector. The term "vector" also includes transposons such as Sleeping Beauty (Izsvak et al. J. MoI. Biol. 302: 93-102 (2000)), or artificial chromosomes. The term "cloning vector" in the present invention is defined as a substance capable of carrying a DNA fragment into a host cell and regenerating it. In the present invention, the cloning vector may further include a polyadenylation signal, a transcription termination sequence, and a multiple cloning site. Wherein the multiple cloning site comprises at least one restriction site of an endonuclease restriction enzyme. In addition, the cloning vector may further include a promoter. For example, in the present invention, the polynucleotide encoding the novel peptide tag may be located upstream of a polyadenylation signal and a transcription termination sequence, and may comprise at least one endonuclease an endonuclease restriction site may be located upstream of a polyadenylation signal and a transcription termination sequence. In addition, the term "expression vector" in the present invention is defined as a DNA sequence necessary for transcription and translation of the cloned DNA in an appropriate host. In addition, the term "expression vector" in the present invention means a gene construct comprising an essential regulatory element operably linked to an insert such that the insert is expressed when present in the cell of the individual. The expression vector can be prepared and purified using standard recombinant DNA techniques. The expression vector is not particularly limited as long as it expresses a desired gene in various host cells of prokaryotic and eukaryotic cells and produces a desired protein. However, the expression vector has a promoter that exhibits strong activity, A vector capable of producing a large amount of exogenous protein in a form similar to that of the wild type. The expression vector preferably contains at least a promoter, an initiation codon, a gene encoding a desired protein, and a termination codon terminator. In addition, DNA encoding the signal peptide, additional expression control sequences, non-translation regions on the 5 'side and the 3' side of the desired gene, a selectable marker region, or a replicable unit may be suitably contained. A "promoter" means a minimal sequence sufficient to direct transcription. Also, a promoter construct sufficient to allow expression of a regulatable, promoter-dependent gene that is induced by a cell type-specific or external signal or agent may be included, and such constructs may be located at the 5 ' or 3 ' . The expression vector according to the invention may contain both conservative and inducible promoters. Promoter sequences may be derived from prokaryotes, eukaryotes or viruses. The term "operably linked" means that polynucleotide sequence associations on a single polynucleotide are modulated by one function. For example, if the promoter is capable of controlling the expression of the coding sequence (i. E., The coding sequence is under transcriptional control of the promoter), the promoter may be operatively linked to the coding sequence or the ribosomal binding site If present, the ribosomal binding site is operatively linked to the coding sequence. The coding sequence may be operatively linked to the regulatory sequence in the sense or antisense direction. An expression vector according to the present invention comprises, as a preferred example, a polynucleotide encoding a peptide tag and a polynucleotide encoding a target protein. At this time, the target polynucleotide encoding the target protein is indirectly linked to a polynucleotide encoding a peptide tag, a base sequence encoding a known protease recognition site, or a base sequence serving as a linker.

Yet another aspect of the present invention relates to a fusion protein comprising the above-mentioned peptide tag. The term "fusion protein" in the present invention means a polymer in which two or more peptides, oligopeptides, polypeptides or proteins having different functions are linked to each other. In the present invention, the fusion protein can be used interchangeably with a fusion polypeptide, a fusion oligopeptide, a recombinant polypeptide, a recombinant oligopeptide or a recombinant protein. The first part of the fusion protein according to the invention comprises at least one of the above-mentioned peptide tags and the second part of the fusion protein comprises at least one of the target proteins. In the present invention, a target protein can be used interchangeably with a target peptide, a target oligopeptide or a target polypeptide. The fusion protein according to the present invention can be efficiently detected or purified using an antibody against a novel peptide tag because the peptide tag is linked to the codon region of the target protein. The peptide tag according to the present invention can be inserted anywhere within the protein, as long as it does not substantially affect the C-terminus of the target protein as well as the N-terminus or the functionality of the protein. Here, the fact that the protein does not substantially affect the functionality thereof means that the activity of the protein is retained by 80% or more, preferably 95% or more, before fusion of the peptide tag. As the target protein used in the present invention, any protein can be used. For example, a short-chain FV (ScFv) of humanized antibody AKA / HzK to TAG-72 which is a cancer-associated antigen, thrombopoietin (TPO), B - lymphocyte stimulator (B-lymphocyte stimulator), and the like. A fusion protein according to the present invention comprises a combination of two or more peptides, for example, a peptide tag and a combination of a target protein, wherein the two or more peptides may be linked by covalent bonds or noncovalent bonds. At this time, the peptide tag and the target protein may be directly connected to each other without any mediator, or may be indirectly connected by a mediator such as a peptide linker. In a preferred embodiment, when the fusion protein comprises at least one cleavable peptide linker, the cleavable linker can be chemically and / or enzymatically cleaved to recover the desired protein from the fusion protein. Thus, a fusion protein according to the invention can preferably be designed to include one or more tags, a cleavable peptide linker and a target protein. Linkers generally do not have specific biological activity other than to associate proteins or to maintain a minimum spacing or other spatial relationship between these proteins, but the constituent amino acids of the peptide linker are not affected by the properties of the molecule, such as folding, net charge, or hydrophobicity May be selected to have some effect. The peptide linker may optionally include a site for the separation of the fused constituent polypeptide, for example, a site that can be cleaved by a protease. The cleavable peptide linker may be from 1 to about 50 amino acids in length, preferably from 1 to about 20 amino acids. Peptide linkers cleavable by enzymes may comprise, for example, the caspase-3 truncation sequence, and the peptide linker cleavable by the acid includes, for example, an aspartic acid-proline dipeptide (DP) moiety . Cleavable peptide linkers may be incorporated into the fusion protein using a variety of techniques well known in the art. In addition, a flexible peptide linker can be used, and peptide linkers having a GGSGGT amino acid sequence, a GGGGS amino acid sequence, and a GGGGSGGGGS amino acid sequence can be used, but are not limited thereto. A peptide linker can be operably linked in-frame between polynucleotides encoding each peptide of the fusion protein and the polynucleotide comprising the peptide linker and expressed through an expression vector.

Means for producing peptides (peptide tags, cleavable peptide linkers, target peptides, and / or fusion peptides) in the present invention are well known in the art (Stewart et al., Solid Phase Peptide Synthesis, Pierce Chemical Co., Rockford, IL, 1984; Bodanszky, Principles of Peptide Synthesis, Springer-Verlag, New York, 1984; And Pennington et al., Peptide Synthesis Protocols, Humana Press, Totowa, NJ, 1994). The various components of the fusion peptides described herein (tag peptides, target peptides, and cleavable linkers / truncated sequences) can be prepared by known chemical synthetic methods [Hermanson, Greg T., Bioconjugate Techniques, Academic Press , New York (1996)), chemical synthesis is often limited to peptides that are less than about 50 amino acids in length due to cost and / or impurities. The peptides described herein can preferably be prepared using standard recombinant DNA and molecular cloning techniques [Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); Silhavy, TJ, et al., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Cold Spring Spring Harbor, NY (1984); And Ausubel, FM et. al., < / RTI > Short Protocols in Molecular Biology, 5th Ed. Current Protocols and John Wiley and Sons, Inc., NY, 2002].

Another aspect of the invention relates to a transformant comprising the above-described expression vector. In the present invention, the term "transformant" means a cell transformed by introduction of an expression vector having a polynucleotide encoding at least one target protein into a host cell. Methods for preparing the transformant by introducing the expression vector into a host cell include transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome mediated transfection liposemmediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, electroporation, electroinjection, PEG, and the like A chemical treatment method, a method using a gene gun or the like, but the present invention is not limited thereto. When the transformant into which the expression vector is introduced is cultured in a nutrient medium, the fusion protein can be produced in large quantities and can be isolated. The culture medium and culture conditions can be appropriately selected and used depending on the host cell. The conditions such as temperature, medium pH and incubation time should be appropriately adjusted so as to be suitable for cell growth and mass production of the protein during culturing. The host cell that can be transformed with the expression vector according to the present invention is not limited in its kind as long as it is known in the art such as prokaryotic cells, plant cells, insect cells, animal cells, etc. Preferably, A host having high expression efficiency of introduced DNA is usually used. For example, as host cells, well-known prokaryotic hosts such as Escherichia, Pseudomonas, Bacillus, Streptomyces can be used, and Escherichia coli can be preferably used. Expression of the protein by the host cell can be induced using IPTG (isopropyl-1-thio-β-D-galactopyranoside), and the induction time can be controlled to maximize the amount of protein. In the present invention, the recombinantly produced protein can be recovered from the medium or cell lysate. If the recombinant protein is membrane bound, it can be liberated from the membrane by using a suitable surfactant solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells used for protein expression can be disrupted by various physical or chemical means such as freeze-thaw cycles, sonication, mechanical disruption or cell disruption, and can be isolated or purified by conventional biochemical separation techniques (Sambrook Inc., San Diego, Calif., USA), < RTI ID = 0.0 > Molecular Cloning: A laborarory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989. Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 1990). For example, methods for separating or purifying proteins expressed by host cells include electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion exchange chromatography, affinity chromatography, immuno adsorption affinity chromatography, HPLC, gel permeation HPLC), isometric focus, and various variations or combinations thereof. Meanwhile, the fusion protein comprising the peptide tag according to the present invention can be isolated and purified by using immunoabsorption affinity chromatography using an antibody against the peptide tag.

Yet another aspect of the present invention relates to the aforementioned peptide tag, the use of a polynucleotide encoding the peptide tag, and the like.

For example, one example of the present invention provides a method for producing the aforementioned fusion protein. A method for preparing a fusion protein according to an embodiment of the present invention includes culturing a transformant into which a polynucleotide encoding a fusion protein has been introduced to express a fusion protein. At this time, the polynucleotide encoding the fusion protein is preferably introduced into the transformant in a form contained in the recombinant vector. In addition, the recombinant vector comprises a polynucleotide encoding a peptide tag and a polynucleotide encoding a target protein linked thereto, wherein the two polynucleotides preferably include a site that can be cleaved by a protease or the like Lt; RTI ID = 0.0 > linker. ≪ / RTI >

In addition, one example of the present invention provides a method for detecting the aforementioned fusion protein. A method of detecting a fusion protein according to an exemplary embodiment of the present invention includes: binding a fusion protein to which a peptide tag and a target protein are linked by contacting the antibody against the peptide tag; And identifying or quantitating the presence of the fusion protein bound to the antibody. Herein, the method of detecting a fusion protein according to an exemplary embodiment of the present invention may be performed by Western blotting, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, immunofluorescence, immunocytochemistry, An array or the like can be used. Wherein the protein microarray is immobilized on a glass substrate or a silicon substrate with a specific antibody for the peptide tag of the present invention and can be used for the analysis of large-scale samples.

In addition, one example of the present invention provides a method for purifying the fusion protein described above. A method for purifying a fusion protein according to an exemplary embodiment of the present invention includes: binding a fusion protein to which a peptide tag and a target protein are linked by contacting the antibody against the peptide tag; And recovering the fusion protein bound to the antibody. At this time, the antibody is immobilized on a support, preferably a solid support. Examples of the support for immobilizing the antibody include a column, a bead, an adsorbent, a nitrocellulose paper and the like, and the antibody can be immobilized on the support through various known immobilization methods. A specific example of a method for purifying a fusion protein according to the present invention includes a step of contacting a sample containing a tagged protein with a support on which the antibody is immobilized. Here, the tagged protein is a protein to which a target protein is covalently linked to a peptide tag, and the peptide tag has a specific binding activity to an antibody, and the contacting is performed under the condition that the antibody binds to the peptide tag. The method of purifying the fusion protein according to the present invention may further include a step of removing components not bound to the antibody and a step of separating the tagged protein from the support. At this time, the supporter and the antibody immobilized thereto are used as a medium for immunoaffinity chromatography. Immunoaffinity column chromatography can be performed using a column packed with the medium. By using the purification method of the present invention, a highly purified purified fusion protein can be obtained, and further, the target protein contained in the fusion protein can maintain its unique function.

In addition, one example of the present invention provides a kit for expression, detection, or purification of a fusion protein. The kit for expression, detection, or purification of the fusion protein according to the present invention comprises the above-mentioned peptide tag, a polynucleotide encoding the peptide tag, a pair of primers for synthesizing the polynucleotide, a recombinant vector containing the polynucleotide, Or a transformant transformed with a nucleotide or a recombinant vector. In addition, the kit for expression, detection, or purification of the fusion protein according to the present invention may comprise any one selected from an antibody against the above-mentioned peptide tag or a hybridoma cell line producing the antibody. In addition, the kit for expressing a fusion protein according to the present invention preferably comprises a recombinant vector comprising a polynucleotide encoding the peptide tag of the present invention. In addition, the kit for detecting or purifying a fusion protein according to the present invention preferably includes an antibody against the peptide of the present invention. Here, the recombinant vector constituting the kit may be an expression vector containing a polynucleotide encoding a fusion protein, or may be provided in a form in which a user can easily produce an expression vector. The fusion protein is a polypeptide to which a peptide tag and a target protein are linked. In addition, the antibody constituting the kit is preferably provided in a fixed form on a suitable support. In addition, the kit for detecting a fusion protein preferably further comprises means for detecting an antibody against a peptide tag. Here, the means for detecting the antibody against the peptide tag of the present invention is preferably a secondary antibody. In addition, the antibody or the secondary antibody against the peptide tag of the present invention constituting the kit for detecting a fusion protein may be labeled with a labeling substance such as an enzyme, a radioactive substance, a fluorescent substance, etc., . In addition, the fusion protein purification kit may further comprise a protease for separation of the peptide tag. In addition, the kit according to the present invention may further include instructions, restriction enzymes, ligases, buffer solutions and the like.

Hereinafter, the present invention will be described in more detail with reference to examples. The following examples are intended to clearly illustrate the technical features of the present invention, but do not limit the scope of protection of the present invention.

Example  One: Deinococus Of the radioactive deurans (Deinococcus radiodurans) BphP  Gene and BphN  Gene Cloning

(SEQ ID NO: 2) encoding the entire length of Deanococcus radiodurans bacteriophytochrome monophrotein (BphP; SEQ ID NO: 1) and a polypeptide consisting of amino acids 1-321 based on the N-terminus of DrBphP (SEQ ID NO: 4) coding for BphN (SEQ ID NO: 3) was cloned by PCR. Specifically, a primer for cloning a BphP gene or a primer for cloning a BphN gene is used as a template for a gene encoding the entire length of Deinococcus radiodurans bacteriophytochrome protein (BphP) (SEQ ID NO: 2) PCR was performed with Ex-Taq (TAKARA) polymerase for about 30 cycles to obtain amplified BphP DNA product and BphN DNA product. Table 1 below shows the primers used to obtain amplified BphP DNA products and BphN DNA products. The primers shown in Table 1 below and all the primers described below were manufactured by Bioneer co. (KR).

SEQ ID NO: Type of primer The base sequence (5 '- > 3') The restriction enzyme recognition site contained in the primer 5 Forward primer for BphP cloning GCCATATGATGAGCCGGGACCCGTTGCCC Nde I 6 Reverse primer for BphP cloning GCCTCGAGTCAGGCATCGGCGGCTCCCGG Xho I 7 Forward primer for BphN cloning GCCATATGATGAGCCGGGACCCGTTGCCC Nde I 8 Reverse primer for BphN cloning GCCTCGAGCGCTTCCTTGACCTGAACTTG Xho I

The amplified PCR product was run on 1% agarose gel (QA-Agarose gel, Q-BIO, CAT # AGAH0250) and the size of amplified DNA was confirmed by ultraviolet irradiation. After removing only the desired DNA from the amplified products, the desired DNA was isolated using gel elution kit (FavorPrep GEL / PCR purification kit, FAVORGEN, CAT # FAGCK001-1) , And the nucleotide sequence was measured with reference to Bioneer co. (KR). As a result, it was confirmed that the DNA product generated through PCR had BphP DNA and BphN DNA as desired target sequences.

Then, BphP DNA product and BphN DNA product amplified using restriction enzymes Nde I and Xho I were inserted into pET28a (+) vector (manufacturer: Novagen), and BL21 competent cells (manufactured by RBC, Taipei, Taiwan) was transformed by heat shock at 42 ° C for 1 minute and then cultured on LB medium containing kanamycin to express BphP protein and BphN protein.

Example  2 : Deinococus Of the radioactive deurans (Deinococcus radiodurans) BphP  Protein and BphN  Expression of protein

Colony colonies transformed into BL21 competent cells and grown on LB medium were inoculated on LB medium containing kanamycin and seed culture was carried out at 37 ° C for about 8 hours or more. The seeded cells were inoculated into LB medium containing kanamycin, grown to a concentration of 0.6 at OD ₆₀₀ , and cultured in IPTG (isopropyl-1-thio-β-D-galactopyranoside ) Was added and protein expression was induced at 25 DEG C for 6 hours. The cells were then centrifuged to discard the supernatant and the pellet resuspended in binding buffer (100 mM Tris-Cl, 150 mM NaCl, and 10 mM imidazole, pH 8.0). Next, the pellet resuspension was sonicated, the cells were disrupted, and the supernatant was separated by centrifugation again. The protein was purified using a Ni ⁺ -NTA column (QIAGEN). The purified protein was then stored at -70 < 0 > C.

1 (A) is a schematic diagram showing a gene construct used for expressing BphP protein and BphN protein of Deinococcus radiodurans [FL, total length (1-755 amino acid, BphP); ? PHY / HKD (1-321 amino acids, BphN)]. As shown in Fig. 1, the BphP protein and the BphN protein contain the PAS, the GAF domain and the Cys-24 residue, both of which play an important role in the binding of BV, and thus bind to BV alone. Virilverdin (BV, 2 μg / ml, Frontier, Scientific, Carnforth, UK) was added to purified Apo-BphP protein and Apo-BphN protein to obtain holo-BphP protein and reacted for 10 minutes at room temperature. Subsequently, the reaction samples were subjected to SDS-PAGE, followed by reaction with zinc acetate solution (20 mM zinc acetate, 150 mM Tris-Cl, pH 7.0) for 20 minutes. In addition, the reaction samples were subjected to SDS-PAGE followed by coomassie staining. The left side of FIG. 1 (B) shows the result of coomassie staining, and the right side of FIG. 1 (B) shows the result of the zinc blot. As shown in FIG. 1 (B), it was confirmed that the expression and purification of BphP protein and BphN protein were smooth.

Example  3: Deinococus Of the radioactive deurans (Deinococcus radiodurans) BphP  Protein and BphN  Preparation of monoclonal antibodies specifically binding to proteins

3-1: Immunization

The purified BphP protein or BphN protein was used as an antigen, and complete Freund's adjuvant was mixed therein, and injected into the abdominal cavity of female BALB / c mice at 6 weeks of age. Immersion was mixed with vortexer for 1 hour and then injected intraperitoneally with Incomplete Freund's adjuvant and antigen in the same manner. After 2 weeks, blood was drawn from the tail of the mouse and used for cell fusion when the antibody titer after 1/1000 to 1.0 was tested after the ELISA test. At 4 weeks after the second immunization for cell fusion, the same amount of antigen was diluted in PBS and injected intraperitoneally. Three days later, mice were sacrificed and cell fusion was performed.

3-2: Cell fusion for monoclonal antibody production

As a B lymphocyte cell source, the abdominal incision was made to remove the fat and other organs as much as possible, and the spleen was aseptically removed to prevent excessive bleeding. The cells were homogenized with a cell strainer, diluted with the basic medium, and centrifuged twice. B lymphocytes and myeloma cells were mixed at an appropriate ratio, centrifuged for 5 minutes, the supernatant was discarded, and the remaining cell mixture was gently shaken. 10 ml of prewarmed RBC lysis buffer was added and suspended, followed by incubation at 37 ° C for 20 minutes FBS was added and centrifuged. Cell fusion was performed as follows. First, PEG (polyethlyene glycerol) 1500 solution was slowly added to the centrifuged cell mixture while maintaining the temperature at 37 ° C, and then the reaction was stopped by adding the basic medium again. Then, the cells were quickly centrifuged, the supernatant was discarded, and the remaining cell mixture was carefully suspended in a macrophage culture medium, and the cells were placed in a 96-well tissue culture plate and cultured in a carbon dioxide incubator at 37 ° C.

3-3: Selection of fusion cell

Five days after the cell fusion, HAT medium, a selective medium for fused cells, was added to each well. Then, the HAT medium was added at the intervals of 3 days in the same manner. After 11 days of cell fusion, HT medium supplemented with HT supplement was added to the complete medium and observed with a microscope every day for confirming the growth of the fusion cells. The supernatant of the wells in which the growth has been confirmed is taken and the antibody production is confirmed by ELISA. The fusion cell line once determined to secrete the desired antibody is subjected to 1, 2 and 3 cloning by limiting dilution, ≪ / RTI >

3-4: Selection of fusion cells by ELISA

Immunostimulation of immunity and monoclonal antibody production were carried out at 4 ° C in a 96 well tissue culture plate by adding antigen protein solution diluted with ELISA coating buffer solution. Subsequently, the antigen protein solution was inhaled and removed, and the blocking solution was added to the remaining surface of each well, followed by reaction at 37 ° C for 1 hour. The blocking solution was then removed and washed three times with PBST solution. The fusion cell culture supernatant was added to each well, reacted at 37 ° C, and the solution was removed and washed three times with PBST solution. A solution of Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG) diluted in PBS was added to each well. OPD (orthophenylenediamine dihydrochloride) substrate solution was added to the wells, reacted at room temperature for 10 minutes, and the reaction was stopped with stop solution. At this time, the absorbance was measured with an ELISA reader at 492 nm in order to confirm the degree of the reaction, and a total of 24 candidate hybridoma cell clones were selected based on the measured results.

3-5: Fusion plate ELISA test to confirm the binding with the antigen and purification of the antibody

A total of 24 candidate hybridoma cell clones were tested for Fusion plate ELISA with BphP protein and BphN protein injected as antigen, and the degree of binding was confirmed. The results are shown in Table 2 below. As shown in the following Table 2, 2B8 clones and 2C11 clones were found to be highly expressed in both BphP protein and BphN protein of Deinococcus radiodurans, and thus it was presumed to recognize the N-terminal region of BphP protein . However, 3B2 and 3D2 clones were found to recognize the C-terminal region of the BphP protein, indicating that the BphP protein has a high level and the BphN protein has a value close to zero. In contrast, the 3H7 clone exhibited a high level of BphP protein and a low level of BphN protein, suggesting that the N-terminal region of the BphP protein was also recognized to some extent.

Hybridoma cell line clone The degree of binding with the antigen protein (absorbance at 492 nm) BphN BphP (full) 1B6 0.0660 1.3190 1B11 0.1560 2.3700 1D6 0.0550 2.3180 2B8 2.3400 2.4200 2 C11 2.3480 2.4040 2D9 0.1430 2.2730 2E3 2.1720 1.8020 2F7 0.1220 2.4430 2H8 0.0650 1.3440 3A4 1.9180 2.3770 3B2 0.0980 2.2900 3B3 0.0700 2.1650 3C11 1.9730 2.2590 3 D2 0.0640 2.2830 3D10 0.1180 2.4280 3D11 1.6850 2.3130 3F10 0.0730 2.3570 3G2 0.0880 2.0510 3G9 0.0800 1.5580 3H1 1.7840 2.0950 3 H7 0.4640 2.3490 4B7 1.9730 2.2620 4E2 0.2050 2.3770 4E3 0.0550 2.2650

Then, the 5 clones of the hybridoma cell line were subjected to a primary cloning plate ELISA test and a secondary cloning plate ELISA test. Ultimately, ascites was purified to purify the antibody. As a result, 5 monoclonal antibodies, 2B8 antibody, 2C11 antibody, 3B2 antibody, 3D2 antibody and 3H7 antibody were obtained. Purification of the antibody was carried out in the following manner. After 0.5 ml of pristane was injected intraperitoneally into BALB / c mice over 8 weeks, hybridoma cells were cultured after 1 to 10 days, washed three times with PBS, and then washed with PBS (5 × 10 ⁶ cells / And injected into the abdominal cavity using a syringe. After 1 to 10 days of ascites, the mice were sacrificed by cervical dislocations and a small hole was made in the abdomen. The ascites was collected using a serum separation tube while avoiding the flow of ascites. The mixture was allowed to stand at room temperature for about 1 hour and centrifuged to remove RBC. An appropriate amount of PBS was added to the collected samples, and the mixture was slowly mixed with ammonium sulfate at 4 ° C. After centrifugation at 4 ° C, the solution was passed through a filter. An appropriate amount of Protein A and DFMF mixed beads was added, and then Tris buffer solution was washed with 10 times of the bed volume. After adding the antibody and mixing well with the protein A / G, the fraction was collected, washed with Tris buffer, and then eluted several times with glycine. The purified antibody was dialyzed in PBS buffer for 3 hours, replaced with PBS buffer overnight, dialyzed overnight, and dialyzed.

Example  4: Specificity analysis of monoclonal antibodies

Western blotting was performed to confirm whether the obtained antibodies exhibited the same results for the pre-expressing and purified BphP protein and BphN protein. Each of the monoclonal antibodies having a concentration of 1 mg / ml as the primary antibody was used at a ratio of 1: 1000 to 2% skim milk, and HRP-mouse antibody ( SIGMA) at a ratio of 1: 10000 to perform Western blotting. As a result, 2B8 antibody and 2C11 antibody resulted in binding to BphP protein and BphN protein as a result of ELISA test on hybridoma cell line clone (FIG. 2). Therefore, all of the two antibodies could be considered to bind to the N-terminal region of BphP. The 3B2 antibody and the 3D2 antibody showed a band for the BphP protein but no band for the BphN protein, indicating that the antibody binds to the C-terminal region of the BphP protein. However, in the case of the 3H7 antibody, only the BphP protein was recognized, unlike the results in the ELISA test. In addition, the degree of binding of each antibody was most strongly bound to 2B8 antibody and 2C11 antibody binding at the N-terminal site, and the 3D2 antibody thought to recognize the C-terminal site exhibited a weaker recognition band. Followed by 3H7 antibody and 3B2 antibody in that order.

On the other hand, DrBphP has a structure similar to that of phytochrome. Especially, PCDs constituting N-terminal region have very similar structures including PAS, GAF and PHY domains. Therefore, And whether or not they responded. However, all five monoclonal antibodies against the BphP protein of Deinococcus radiodurans did not bind to the Ophtocrome protein (Oat PhyA) (FIG. 3). Therefore, it was confirmed that monoclonal antibodies against the BphP protein of Deinococcus radiodurans are new BphP-specific antibodies recognizing epitopes different from the antibodies against the existing Oat phytochrome protein.

The present inventors have developed a hybridoma cell line 2B8 of the 2B8 antibody most strongly bound to the BphP protein of Deinococcus radiodurans on September 24, 2012 by KCTC ), And the accession number of hybridoma cell line 2B8 is KCTC 12283BP. The isotype of 2B8 antibody was determined by ELISA using a mouse antibody. The heavy chain isotype of the 2B8 antibody was IgG 2a and the light chain isotype was kappa.

Example  5: 2B8 monoclonal antibody Epitope  For confirmation Epitope Mapping

In order to confirm the epitope of the 2B8 antibody as a monoclonal antibody against the BphP protein of Deinococcus radiodurans, a recombinant partial peptide of DrBphP was prepared and subjected to epitope mapping.

First, DNA coding for the amino acid sequence (SEQ ID NO: 9) at positions 3-12 of the entire amino acid sequence (SEQ ID NO: 1) of DrBphP and the amino acid sequence at SEQ ID NO: (SEQ ID NO: 11), and a DNA encoding the amino acid sequence of SEQ ID NO: 12 (SEQ ID NO: 12) were prepared. PCR was performed using primers and PrimeSTAR HS (TAKARA, R040) polymerase that were prepared for about 30 cycles to obtain amplified DNA products. The PCR reaction for DNA cloning does not require a separate template, and in one cycle of PCR, a template for amplification can be obtained by combining a forward primer and a reverse primer. Table 3 below shows primers used in PCR to obtain DNA amplification products encoding the four DrBphP recombinant partial peptides.

SEQ ID NO: Type of primer The base sequence (5 '- > 3') The restriction enzyme recognition site contained in the primer 13 BphP 3-12 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 14 BphP 3-12 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA AAGCGGTGGAAAAAAGGGCAA EcoR I 15 BphP 3-11 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 16 BphP 3-11 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA CGGTGGAAAAAAGGGCAACGG EcoR I 17 BphP 3-10 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 18 BphP 3-10 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA TGGAAAAAAGGGCAACGGGTC EcoR I 19 BphP 4-12 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG GACCCGTTGCCCTTTTTTCCA BamH I 20 BphP 4-12 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA AAGCGGTGGAAAAAAGGGCAA EcoR I

The amplified PCR product was run on 1% agarose gel (QA-Agarose gel, Q-BIO, CAT # AGAH0250) and the size of amplified DNA was confirmed by ultraviolet irradiation. Then, only the DNA band corresponding to the DNA amplification product was cut out, and only the desired DNA was isolated using a gel elution kit (FavorPrep GEL / PCR purification kit, FAVORGEN, CAT # FAGCK001-1), followed by pJET (CloneJET PCR cloning kit, Fermentas, # K1232) vector. DH5? Competent cells (manufactured by Invitrogen), about 30 to 50 占 퐇 of Escherichia coli, were added to a binding vector of about 10 to 20 占 퐇, incubated on ice for 20 minutes and then heat shocked for 1 minute at 42 占 폚 shock, and then resuspended on ice for 20 minutes, spread on an LB plate containing ampicillin, and incubated overnight at 37 ° C. for transformation. Then, when the colonies grew, the cells were inoculated on LB medium containing ampicillin and cultured overnight at 37 ° C. Then, plasmids were grown using the FavorPrep plasmid extraction kit (FAVORGEN, cat # FAPDE300) And extracted. Then, the extracted plasmid was consigned to Bioneer co., KR and the nucleotide sequence thereof was measured. As a result, it was confirmed that the DNA product generated through PCR had a desired base sequence.

After digesting the plasmid extracted with the restriction enzyme and the pGEX4T1 vector (GE Healthcare, Piscataway, NJ, USA) having the GST tag by itself, N (SEQ ID NO: 1) of the entire amino acid sequence of DrBphP (SEQ ID NO: 10), a DNA encoding the amino acid sequence at positions 3 to 10 (SEQ ID NO: 9), a DNA encoding the amino acid sequence at positions 3 to 11 ) And the DNA encoding the amino acid sequence at position 4-12 (SEQ ID NO: 12) were ligated to the pGEX4T1 vector, which is a protein expression vector, respectively. Then, pGEX4T1 vector containing the target DNA was used for BL21 After culturing the competent cells (manufacturer: RBC, Taipei, Taiwan) on the LB medium containing ampicillin, the protein expression was induced. Then, the cultured cells were disrupted using sonication, After separating the supernatant, GST resin (Glutathion Sepharose ™ High Performance, GE Healthcare). Western blotting was performed on the purified protein and the BphP protein of Deinococcus radiodurans. 2B8 monoclonal antibody and anti-GST antibody were used as primary antibodies and Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG; Sigma) was used as the secondary antibody. In addition, after SDS-PAGE, the Amersham 占 ECL Western Blotting Detection Reagents (GE Healthcare, RPN2106OL / AF) were used. Figure 4 shows the results of epitope mapping for antibody 2B8 via Western blot. As shown in FIG. 4, the epitope of 2B8 antibody is a peptide (SEQ ID NO: 10) consisting of 9 amino acid sequences corresponding to 3-11 positions based on the N-terminal of the entire amino acid sequence of DrBphP (SEQ ID NO: 1) It can be used as an epitope tag. In addition, Blast search was performed on the amino acid sequence of SEQ ID NO: 10, and it was confirmed that no amino acid sequences overlapping in common Escherichia coli or plants were observed except for some bacteria and the like. From this, it can be seen that the possibility of non-specific binding is very low when a peptide consisting of the amino acid sequence of SEQ ID NO: 10 is used as an epitope tag.

Example  6: original Epitope  Mutation of tags and affinity analysis of mutated peptides for 2B8 monoclonal antibodies

In order to improve the affinity for the 2B8 antibody, a mutant peptide is prepared by substituting some of the amino acid residues constituting the original epitope tag (peptide consisting of the amino acid sequence of SEQ ID NO: 10) with another amino acid, and using Western blot The affinity of the mutant peptides for the 2B8 antibody was analyzed.

First, a DNA encoding a peptide consisting of an amino acid sequence at the 3-11 position (denoted by '3-11-ori', SEQ ID NO: 10) based on the N-terminal of the entire amino acid sequence of DrBphP (SEQ ID NO: (3-11-R3K ') consisting of the amino acid sequence of 3-11 positions based on the N-terminal of the entire amino acid sequence of DrBphP (SEQ ID NO: 1) and arginine being the third amino acid residue thereof substituted with lysine (SEQ ID NO: 21), a DNA encoding an amino acid sequence of 3-11 positions based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 1) and the aspartic acid which is a 4th amino acid residue is substituted with glutamic acid (SEQ ID NO: 1) of DrBphP, a DNA coding for a peptide (indicated by '3-11-D4E', SEQ ID NO: 22) and an amino acid sequence of 3-11 positions based on the N-terminus of DrBphP The fourth amino acid residue, aspartate (SEQ ID NO: 23), a DNA coding for a peptide substituted with this asparagine (denoted by 3-11-D4N, SEQ ID NO: 23), an amino acid at 3-11 positions based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 24) coding for a peptide (SEQ ID NO: 24) substituted with leucine isoleucine, which is a 6th amino acid residue and at the same time, a total amino acid sequence (SEQ ID NO: 1) of DrBphP A DNA coding for a peptide (referred to as '3-11-L6V', SEQ ID NO: 25) consisting of an amino acid sequence of 3-11 positions on the N-terminus and substituted with a leucine valine which is a sixth amino acid residue, (3-11-F8Y ') consisting of an amino acid sequence of 3-11 positions based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 1) and phenylalanine which is an eighth amino acid residue thereof substituted with tyrosine 26, SEQ ID NO: 26) and DrBphP (3-11-F9Y ') consisting of an amino acid sequence of 3-11 positions based on the N-terminus of the sialic acid sequence (SEQ ID NO: 1) and substituted at the 9th amino acid residue by tyrosine, SEQ ID NO: 27) was prepared. PCR was performed using primers and PrimeSTAR HS (TAKARA, R040) polymerase that were prepared for about 30 cycles to obtain amplified DNA products. The PCR reaction for DNA cloning does not require a separate template, and in one cycle of PCR, a template for amplification can be obtained by combining a forward primer and a reverse primer. Table 4 below shows the primers used in the PCR for obtaining the original epitope tag and the DNA amplification product coding for the seven mutated peptides.

SEQ ID NO: Type of primer The base sequence (5 '- > 3') The restriction enzyme recognition site contained in the primer 28 Forward primer for 3-11-ori cloning GC GGATCC CGGGACCCGTTGCCCTTTTTTCCACCG BamH I 29 Reverse primer for 3-11-ori cloning GC GAATTC CGGTGGAAAAAAGGGCAACGGGTCCCG EcoR I 30 3-11-forward primer for R3K cloning GC GGATCC ATGAAAGACCCGTTGCCCTTTTTTCCACCG BamH I 31 3-11-reverse primer for R3K cloning GC GAATTC TCACGGTGGAAAAAAGGGCAACGGGTCTTT EcoR I 32 3-11-forward primer for D4E cloning GC GGATCC ATGCGGGAACCGTTGCCCTTTTTTCCACCG BamH I 33 3-11-reverse primer for D4E cloning GC GAATTC TCACGGTGGAAAAAAGGGCAACGGTTCCCG EcoR I 34 3-11-forward primer for D4N cloning GC GGATCC ATGCGGAACCCGTTGCCCTTTTTTCCACCG BamH I 35 Reverse primer for 3-11-D4N cloning GC GAATTC TCACGGTGGAAAAAAGGGCAACGGGTTCCG EcoR I 36 3-11-forward primer for L6I cloning GC GGATCC ATGCGGGACCCGATTCCCTTTTTTCCACCG BamH I 37 Reverse primer for 3-11-L6I cloning GC GAATTC TCACGGTGGAAAAAAGGGAATCGGGTCCCG EcoR I 38 3-11-forward primer for L6V cloning GC GGATCC ATGCGGGACCCGGTGCCCTTTTTTCCACCG BamH I 39 Reverse primer for 3-11-L6V cloning GC GAATTC TCACGGTGGAAAAAAGGGCACCGGGTCCCG EcoR I 40 3-11-F8Y forward primer for cloning GC GGATCC ATGCGGGACCCGTTGCCCTATTTTCCACCG BamH I 41 3-11-F8Y reverse primer for cloning GC GAATTC TCACGGTGGAAAATAGGGCAACGGGTCCCG EcoR I 42 3-11-F9Y forward primer for cloning GC GGATCC ATGCGGGACCCGTTGCCCTTTTATCCACCG BamH I 43 Reverse primer for 3-11-F9Y cloning GC GAATTC TCACGGTGGATAAAAGGGCAACGGGTCCCG EcoR I

Then, only the band of the gel phase corresponding to the DNA amplification product was cut out, and only the desired DNA was isolated using gel elution kit (FavorPrep GEL / PCR purification kit, FAVORGEN, CAT # FAGCK001-1), followed by pJET (CloneJET PCR cloning kit, Fermentas, # K1232) vector. DH5? Competent cells (manufactured by Invitrogen), about 30 to 50 占 퐇 of Escherichia coli, were added to a binding vector of about 10 to 20 占 퐇 and cultured on ice for 20 minutes. Then, heat shock shock, and then restored on ice for 20 minutes, spread on an ampicillin-containing LB medium plate, and then transformed overnight at 37 ° C. Then, when the colonies grew, the cells were inoculated on LB medium containing ampicillin and cultured overnight at 37 ° C. Then, plasmids were grown using the FavorPrep plasmid extraction kit (FAVORGEN, cat # FAPDE300) And extracted. Then, the extracted plasmid was consigned to Bioneer co., KR and the nucleotide sequence thereof was measured. As a result, it was confirmed that the DNA product generated through PCR had a desired base sequence.

After digesting the plasmid extracted with the restriction enzyme and the pGEX4T1 vector (GE Healthcare, Piscataway, NJ, USA) having its own GST tag, the target DNA encoding the original epitope tag and the seven mutant peptides And then ligated to the pGEX4T1 vector, which is a protein expression vector. Then, BL21 competent cells (manufacturer: RBC, Taipei, Taiwan), which is an Escherichia coli, were transformed with a pGEX4T1 vector containing the target DNA and then transformed into LB medium containing ampicillin The cultured cells were then suspended in PBS solution (phosphate buffered saline solution: 137 mM NaCl, 2.7 mM KCl, 10 mM Na ₂ HPO ₄ , 2 mM KH ₂ PO ₄ , pH 7.4) The cells were disrupted using sonication, and only the supernatant obtained by centrifugation was separated. Then, GST resin (Glutathion Sepharose ™ High Performance, GE Healthcare). Western blotting was performed on the purified protein. 2B8 monoclonal antibody and anti-GST antibody were used as primary antibodies and Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG; Sigma) was used as the secondary antibody. The purified protein was subjected to SDS-PAGE and transferred to a polyfluorinated vinylidene (PVDF) membrane. Then, the PVDF membrane was treated with 5% skim milk for 30 minutes, and the primary antibody and the secondary antibody were sequentially treated for 2 hours and 1 hour. Then, Amersham ™ ECL ™ And developed using Western Blotting Detection Reagents (GE Healthcare, RPN2106OL / AF). In addition, an indirect enzyme-linked immunosorbent assay (ELISA) was performed on the purified protein. The purified protein was dissolved in a 0.05 M carbonate buffer (pH 9.6) at a concentration of 1 / / ml, placed in a 96-well plate, and cultured at about 4 캜 for 12 hours. Lt; / RTI > Then, the well surface was treated with 5% skim milk for 1 hour, and the primary antibody and the secondary antibody were sequentially treated for 2 hours and 1 hour. After the addition of TMB One Component HRP Microwell substrate (SurModics BioFx, Eden Prairie, MN, USA), the reaction was terminated with 2M sulfuric acid (H ₂ SO ₄ ) Nm absorbance was measured. FIG. 5 shows the affinity of the original epitope tag and the mutated peptide for the 2B8 antibody through Western blot. FIG. 6 shows the affinity of the original epitope tag and the mutant peptide for the 2B8 antibody in an indirect ELISA (enzyme-linked immunosorbent assay) Respectively. As shown in FIG. 5 and FIG. 6, a peptide having an amino acid sequence of 3-11 positions based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 1) and having the aspartic acid replaced with glutamic acid (3-11-D4E ', SEQ ID NO: 22) and DrBphP (SEQ ID NO: 1), and the 8th amino acid residue, phenylalanine The peptide (3-11-F8Y) substituted with this tyrosine (SEQ ID NO: 26) has an amino acid sequence of 3-11 positions based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) of DrBphP which is the original epitope tag (3-11-ori, SEQ ID NO: 10) of the 2B8 monoclonal antibody. Thus, 3-11-D4E and 3-11-F8Y can be used as novel peptide tags for 2B8 monoclonal antibodies.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Therefore, the scope of the present invention should be construed as including all embodiments falling within the scope of the appended claims.

Korea Biotechnology Research Institute KCTC12283BP 20120924

<110> University-Industry Cooperation Group of Kyung Hee University          Myongji University Industry and Academia Cooperation Foundation <120> Peptide tag with improved affinity toward 2B8 antibody and use          the <130> DP-15-111 <160> 43 <170> Kopatentin 2.0 <210> 1 <211> 755 <212> PRT <213> Deinococcus radiodurans BphP <400> 1 Met Ser Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu Tyr Leu Gly Gly   1 5 10 15 Pro Glu Ile Thr Thr Glu Asn Cys Glu Arg Glu Pro Ile His Ile Pro              20 25 30 Gly Ser Ile Gln Pro His Gly Ala Leu Leu Thr Ala Asp Gly His Ser          35 40 45 Gly Glu Val Leu Gln Met Ser Leu Asn Ala Ala Thr Phe Leu Gly Gln      50 55 60 Glu Pro Thr Val Leu Arg Gly Gln Thr Leu Ala Leu Leu Pro Glu  65 70 75 80 Gln Trp Pro Ala Leu Gln Ala Ala Leu Pro Pro Gly Cys Pro Asp Ala                  85 90 95 Leu Gln Tyr Arg Ala Thr Leu Asp Trp Pro Ala Ala Gly His Leu Ser             100 105 110 Leu Thr Val His Arg Val Gly Glu Leu Leu Ile Leu Glu Phe Glu Pro         115 120 125 Thr Glu Ala Trp Asp Ser Thr Gly Pro His Ala Leu Arg Asn Ala Met     130 135 140 Phe Ala Leu Glu Ser Ala Pro Asn Leu Arg Ala Leu Ala Glu Val Ala 145 150 155 160 Thr Gln Thr Val Arg Glu Leu Thr Gly Phe Asp Arg Val Met Leu Tyr                 165 170 175 Lys Phe Ala Pro Asp Ala Thr Gly Glu Val Ile Ala Glu Ala Arg Arg             180 185 190 Glu Gly Leu His Ala Phe Leu Gly His Arg Phe Pro Ala Ser Asp Ile         195 200 205 Pro Ala Gln Ala Arg Ala Leu Tyr Thr Arg His Leu Leu Arg Leu Thr     210 215 220 Ala Asp Thr Arg Ala Ala Val Pro Leu Asp Pro Val Leu Asn Pro 225 230 235 240 Gln Thr Asn Ala Pro Thr Pro Leu Gly Gly Ala Val Leu Arg Ala Thr                 245 250 255 Ser Pro Met His Met Gln Tyr Leu Arg Asn Met Gly Val Gly Ser Ser             260 265 270 Leu Ser Val Ser Val Val Val Gly Gly Gln Leu Trp Gly Leu Ile Ala         275 280 285 Cys His His Gln Thr Pro Tyr Val Leu Pro Pro Asp Leu Arg Thr Thr     290 295 300 Leu Glu Tyr Leu Gly Arg Leu Leu Ser Leu Gln Val Gln Val Lys Glu 305 310 315 320 Ala Ala Asp Val Ala Ala Phe Arg Gln Ser Leu Arg Glu His His Ala                 325 330 335 Arg Val Ala Leu Ala Ala Ala His Ser Leu Ser Pro His Asp Thr Leu             340 345 350 Ser Asp Pro Ala Leu Asp Leu Leu Gly Leu Met Arg Ala Gly Gly Leu         355 360 365 Ile Leu Arg Phe Glu Gly Arg Trp Gln Thr Leu Gly Glu Val Pro Pro     370 375 380 Ala Pro Ala Val Asp Ala Leu Ala Trp Leu Glu Thr Gln Pro Gly 385 390 395 400 Ala Leu Val Gln Thr Asp Ala Leu Gly Gln Leu Trp Pro Ala Gly Ala                 405 410 415 Asp Leu Ala Pro Ser Ala Gly Leu Leu Ala Ile Ser Val Gly Glu             420 425 430 Gly Trp Ser Glu Cys Leu Val Trp Leu Arg Pro Glu Leu Arg Leu Glu         435 440 445 Val Ala Trp Gly Gly Ala Thr Pro Asp Gln Ala Lys Asp Asp Leu Gly     450 455 460 Pro Arg His Ser Phe Asp Thr Tyr Leu Glu Glu Lys Arg Gly Tyr Ala 465 470 475 480 Glu Pro Trp His Pro Gly Glu Ile Glu Glu Ala Gln Asp Leu Arg Asp                 485 490 495 Thr Leu Thr Gly Ala Leu Gly Glu Arg Leu Ser Val Ile Arg Asp Leu             500 505 510 Asn Arg Ala Leu Thr Gln Ser Asn Ala Glu Trp Arg Gln Tyr Gly Phe         515 520 525 Val Ile Ser His Met Gln Glu Pro Val Arg Leu Ile Ser Gln Phe     530 535 540 Ala Glu Leu Leu Thr Arg Gln Pro Arg Ala Gln Asp Gly Ser Pro Asp 545 550 555 560 Ser Pro Gln Thr Glu Arg Ile Thr Gly Phe Leu Leu Arg Glu Thr Ser                 565 570 575 Arg Leu Arg Ser Leu Thr Gln Asp Leu His Thr Tyr Thr Ala Leu Leu             580 585 590 Ser Ala Pro Pro Val Arg Arg Pro Thr Pro Leu Gly Arg Val Val         595 600 605 Asp Asp Val Leu Gln Asp Leu Glu Pro Arg Ile Ala Asp Thr Gly Ala     610 615 620 Ser Ile Glu Val Ala Pro Glu Leu Pro Val Ile Ala Ala Asp Ala Gly 625 630 635 640 Leu Leu Arg Asp Leu Leu Leu His Leu Ile Gly Asn Ala Leu Thr Phe                 645 650 655 Gly Gly Pro Glu Pro Arg Ile Ala Val Arg Thr Glu Arg Gln Gly Ala             660 665 670 Gly Trp Ser Ile Ala Val Ser Asp Gln Gly Ala Gly Ile Ala Pro Glu         675 680 685 Tyr Gln Glu Arg Ile Phe Leu Leu Phe Gln Arg Leu Gly Ser Leu Asp     690 695 700 Glu Ala Leu Gly Asn Gly Leu Gly Leu Pro Leu Cys Arg Lys Ile Ala 705 710 715 720 Glu Leu His Gly Gly Thr Leu Thr Val Glu Ser Ala Pro Gly Glu Gly                 725 730 735 Ser Thr Phe Arg Cys Trp Leu Pro Asp Ala Gly Pro Leu Pro Gly Ala             740 745 750 Ala Asp Ala         755 <210> 2 <211> 2268 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP <400> 2 atgagccggg acccgttgcc cttttttcca ccgctttacc ttggtggccc ggaaattacc 60 gccgattc ctgctcactg ccgacgggca cagcggcgag gtgctccaga tgagcctcaa cgcggccact 180 tttctgggac aggaacccac agtgctgcgc ggacagaccacc tcgccgcact gctgcccgag 240 cagtggcccg cgctgcaagc ggccctgccc cccggctgcc ccgacgccct gcaataccgc 300 gcaacgctgg actggcctgc cgccgggcac ctttcgctga cggtgcaccg ggtcggcgag 360 ttgctgattc tggaattcga gccgacggag gcctgggaca gcaccgggcc gcacgcgctg 420 cgcaacgcga tgttcgcgct cgaaagtgcc cccaacctgc gggcgctggc cgaggtggcg 480 acccagacgg tccgcgagct gacgggcttt gaccgggtga tgctctacaa atttgccccc 540 gacgccaccg gcgaagtgat tgccgaggcc cgccgtgagg ggctgcacgc ctttctgggc 600 caccgttttc ccgcgtcgga cattccggcg caggcccgcg cgctctacac ccggcacctg 660 ctgcgcctga ccgccgacac ccgcgccgcc gccgtgccgc tcgatcccgt cctcaacccg 720 cagacgaatg cgcccacccc gctgggcggc gccgtgctgc gcgccacctc gcccatgcac 780 atgcagtacc tgcggaacat gggcgtcggg tcgagcctgt cggtgtcggt ggtggtcggc 840 ggccagctct ggggcctgat cgcctgccac caccagacgc cctacgtgtt gccgcccgac 900 ctgcgaacca cgctcgaata cctgggccgc ttgctgagcc tgcaagttca ggtcaaggaa 960 gcggcggacg tggcggcctt tcgccagagc ctgcgggagc accacgcgcg ggtggccctc 1020 gcggcggcgc actcgctctc gccgcacgac accctcagtg acccggcgct tgacctgctg 1080 ggcctgatgc gggccggggg cctgattctg cgtttcgagg gccgctggca gacgttgggt 1140 gaagtgccgc ctgccccggc ggtggacgcg ctgctggcgt ggctcgaaac ccagccgggc 1200 gccctggtcc agaccgacgc gctgggccaa ctgtggcccg ccggcgccga tctcgccccc 1260 agcgcagcgg gcctgctcgc catcagcgtg ggcgagggct ggtcggagtg cctcgtctgg 1320 ctgcggcccg aactgcggct ggaggtcgcc tggggcgggg ccactcctga ccaggcgaaa 1380 gacgacctcg ggccgcgcca ctcattcgac acctacctcg aagaaaaacg cggctacgcc 1440 gagccctggc atcccggcga aatcgaggag gcgcaggatc tacgtgacac attgaccggg 1500 gcgctgggcg agcgcctgag cgtgattcgt gacctcaacc gggcgctcac acagtcgaac 1560 gccgagtggc ggcagtacgg cttcgttatc agccaccaca tgcaggagcc ggtgcggctc 1620 atctcgcagt tcgccgagtt gctgacgcgc cagccccgcg cccaggacgg gtctccggac 1680 tctccgcaga ccgagcgcat caccggcttt ctgctgcgcg aaacgtcgcg cctgcgcagc 1740 ctgacgcaag acctccacac ctacaccgcg ctgctctcgg caccgccgcc ggtgcgccgc 1800 cccacgccgc tgggccgcgt ggtggacgat gtgctgcaag acctcgaacc ccgcattgcc 1860 gacaccggag cgagcatcga ggtggcgccc gagttgcccg tcatcgctgc cgacgctggc 1920 ctgctgcgcg acctgctgct gcatctgatc ggcaacgcgc tgacgtttgg tggcccggag 1980 ccgcgtattg ccgtaaggac cgaacggcaa ggcgcgggtt ggtctatcgc ggtcagtgac 2040 cagggcgctg gcatcgcgcc cgagtatcag gaacgaatct ttctgctgtt tcagcggctc 2100 ggttcgctcg atgaggcgct gggcaacggc ctgggcctgc cgctgtgccg caagatcgcc 2160 gaactgcatg gcggcaccct gaccgtggag tccgcgccag gcgagggcag caccttccgt 2220 tgctggctgc ccgatgctgg gcctcttccg ggagccgccg atgcctga 2268 <210> 3 <211> 321 <212> PRT &Lt; 213 > Deinococcus radiodurans BphP 1-321 a.a. <400> 3 Met Ser Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu Tyr Leu Gly Gly   1 5 10 15 Pro Glu Ile Thr Thr Glu Asn Cys Glu Arg Glu Pro Ile His Ile Pro              20 25 30 Gly Ser Ile Gln Pro His Gly Ala Leu Leu Thr Ala Asp Gly His Ser          35 40 45 Gly Glu Val Leu Gln Met Ser Leu Asn Ala Ala Thr Phe Leu Gly Gln      50 55 60 Glu Pro Thr Val Leu Arg Gly Gln Thr Leu Ala Leu Leu Pro Glu  65 70 75 80 Gln Trp Pro Ala Leu Gln Ala Ala Leu Pro Pro Gly Cys Pro Asp Ala                  85 90 95 Leu Gln Tyr Arg Ala Thr Leu Asp Trp Pro Ala Ala Gly His Leu Ser             100 105 110 Leu Thr Val His Arg Val Gly Glu Leu Leu Ile Leu Glu Phe Glu Pro         115 120 125 Thr Glu Ala Trp Asp Ser Thr Gly Pro His Ala Leu Arg Asn Ala Met     130 135 140 Phe Ala Leu Glu Ser Ala Pro Asn Leu Arg Ala Leu Ala Glu Val Ala 145 150 155 160 Thr Gln Thr Val Arg Glu Leu Thr Gly Phe Asp Arg Val Met Leu Tyr                 165 170 175 Lys Phe Ala Pro Asp Ala Thr Gly Glu Val Ile Ala Glu Ala Arg Arg             180 185 190 Glu Gly Leu His Ala Phe Leu Gly His Arg Phe Pro Ala Ser Asp Ile         195 200 205 Pro Ala Gln Ala Arg Ala Leu Tyr Thr Arg His Leu Leu Arg Leu Thr     210 215 220 Ala Asp Thr Arg Ala Ala Val Pro Leu Asp Pro Val Leu Asn Pro 225 230 235 240 Gln Thr Asn Ala Pro Thr Pro Leu Gly Gly Ala Val Leu Arg Ala Thr                 245 250 255 Ser Pro Met His Met Gln Tyr Leu Arg Asn Met Gly Val Gly Ser Ser             260 265 270 Leu Ser Val Ser Val Val Val Gly Gly Gln Leu Trp Gly Leu Ile Ala         275 280 285 Cys His His Gln Thr Pro Tyr Val Leu Pro Pro Asp Leu Arg Thr Thr     290 295 300 Leu Glu Tyr Leu Gly Arg Leu Leu Ser Leu Gln Val Gln Val Lys Glu 305 310 315 320 Ala     <210> 4 <211> 963 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP 1-321 a.a. <400> 4 atgagccggg acccgttgcc cttttttcca ccgctttacc ttggtggccc ggaaattacc 60 gccgattc ctgctcactg ccgacgggca cagcggcgag gtgctccaga tgagcctcaa cgcggccact 180 tttctgggac aggaacccac agtgctgcgc ggacagaccacc tcgccgcact gctgcccgag 240 cagtggcccg cgctgcaagc ggccctgccc cccggctgcc ccgacgccct gcaataccgc 300 gcaacgctgg actggcctgc cgccgggcac ctttcgctga cggtgcaccg ggtcggcgag 360 ttgctgattc tggaattcga gccgacggag gcctgggaca gcaccgggcc gcacgcgctg 420 cgcaacgcga tgttcgcgct cgaaagtgcc cccaacctgc gggcgctggc cgaggtggcg 480 acccagacgg tccgcgagct gacgggcttt gaccgggtga tgctctacaa atttgccccc 540 gacgccaccg gcgaagtgat tgccgaggcc cgccgtgagg ggctgcacgc ctttctgggc 600 caccgttttc ccgcgtcgga cattccggcg caggcccgcg cgctctacac ccggcacctg 660 ctgcgcctga ccgccgacac ccgcgccgcc gccgtgccgc tcgatcccgt cctcaacccg 720 cagacgaatg cgcccacccc gctgggcggc gccgtgctgc gcgccacctc gcccatgcac 780 atgcagtacc tgcggaacat gggcgtcggg tcgagcctgt cggtgtcggt ggtggtcggc 840 ggccagctct ggggcctgat cgcctgccac caccagacgc cctacgtgtt gccgcccgac 900 ctgcgaacca cgctcgaata cctgggccgc ttgctgagcc tgcaagttca ggtcaaggaa 960 gcg 963 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP <400> 5 gccatatgat gagccgggac ccgttgccc 29 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Deinococcus radiodurans BphP <400> 6 gcctcgagtc aggcatcggc ggctcccgg 29 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > forward primer for Deinococcus radiodurans BphP 1-321 a.a. <400> 7 gccatatgat gagccgggac ccgttgccc 29 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Deinococcus radiodurans BphP 1-321 a.a. <400> 8 gcctcgagcg cttccttgac ctgaacttg 29 <210> 9 <211> 10 <212> PRT &Lt; 213 > Deinococcus radiodurans BphP 3-12 a.a. <400> 9 Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu   1 5 10 <210> 10 <211> 9 <212> PRT &Lt; 213 > Deinococcus radiodurans BphP 3-11 a.a. <400> 10 Arg Asp Pro Leu Pro Phe Phe Pro Pro   1 5 <210> 11 <211> 8 <212> PRT &Lt; 213 > Deinococcus radiodurans BphP 3-10 a.a. <400> 11 Arg Asp Pro Leu Pro Phe Phe Pro   1 5 <210> 12 <211> 9 <212> PRT <213> Deinococcus radiodurans BphP 4-12 a.a. <400> 12 Asp Pro Leu Pro Phe Phe Pro Pro Leu   1 5 <210> 13 <211> 38 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > forward primer for Deinococcus radiodurans BphP 3-12 a.a. <400> 13 gcctcgaggg atccatgcgg gacccgttgc cctttttt 38 <210> 14 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 3-12 a.a. <400> 14 gcgagctcga attctcaaag cggtggaaaa aagggcaa 38 <210> 15 <211> 38 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > forward primer for Deinococcus radiodurans BphP 3-11 a.a. <400> 15 gcctcgaggg atccatgcgg gacccgttgc cctttttt 38 <210> 16 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 3-11 a.a. <400> 16 gcgagctcga attctcacgg tggaaaaaag ggcaacgg 38 <210> 17 <211> 38 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > forward primer for Deinococcus radiodurans BphP 3-10 a.a. <400> 17 gcctcgaggg atccatgcgg gacccgttgc cctttttt 38 <210> 18 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 3-10 a.a. <400> 18 gcgagctcga attctcatgg aaaaaagggc aacgggtc 38 <210> 19 <211> 38 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > forward primer for Deinococcus radiodurans BphP 4-12 a.a. <400> 19 gcctcgaggg atccatggac ccgttgccct tttttcca 38 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Deinococcus radiodurans BphP 4-12 a.a. <400> 20 gcgagctcga attctcaaag cggtggaaaa aagggcaa 38 <210> 21 <211> 9 <212> PRT <213> Artificial Sequence <220> &Lt; 223 > 3rd Arg-substituted Deinococcus radiodurans BphP 3-11 a.a. <400> 21 Lys Asp Pro Leu Pro Phe Phe Pro Pro   1 5 <210> 22 <211> 9 <212> PRT <213> Artificial Sequence <220> &Lt; 223 > 4th Asp-substituted Deinococcus radiodurans BphP 3-11 a.a. <400> 22 Arg Glu Pro Leu Pro Phe Phe Pro Pro   1 5 <210> 23 <211> 9 <212> PRT <213> Artificial Sequence <220> &Lt; 223 > 4th Asp-substituted Deinococcus radiodurans BphP 3-11 a.a. <400> 23 Arg Asn Pro Leu Pro Phe Phe Pro Pro   1 5 <210> 24 <211> 9 <212> PRT <213> Artificial Sequence <220> &Lt; 223 > 6th Leu-substituted Deinococcus radiodurans BphP 3-11 a.a. <400> 24 Arg Asp Pro Ile Pro Phe Phe Pro Pro   1 5 <210> 25 <211> 9 <212> PRT <213> Artificial Sequence <220> &Lt; 223 > 6th Leu-substituted Deinococcus radiodurans BphP 3-11 a.a. <400> 25 Arg Asp Pro Val Pro Phe Phe Pro Pro   1 5 <210> 26 <211> 9 <212> PRT <213> Artificial Sequence <220> &Lt; 223 > 8th Phe-substituted Deinococcus radiodurans BphP 3-11 a.a. <400> 26 Arg Asp Pro Leu Pro Tyr Phe Pro Pro   1 5 <210> 27 <211> 9 <212> PRT <213> Artificial Sequence <220> 9th Phe-substituted Deinococcus radiodurans BphP 3-11 a.a. <400> 27 Arg Asp Pro Leu Pro Phe Tyr Pro Pro   1 5 <210> 28 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 3-11-ori <400> 28 gcggatcccg ggacccgttg cccttttttc caccg 35 <210> 29 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 3-11-ori <400> 29 gcgaattccg gtggaaaaaa gggcaacggg tcccg 35 <210> 30 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 3-11-R3K <400> 30 gcggatccat gaaagacccg ttgccctttt ttccaccg 38 <210> 31 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 3-11-R3K <400> 31 gcgaattctc acggtggaaa aaagggcaac gggtcttt 38 <210> 32 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 3-11-D4E <400> 32 gcggatccat gcgggaaccg ttgccctttt ttccaccg 38 <210> 33 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 3-11-D4E <400> 33 gcgaattctc acggtggaaa aaagggcaac ggttcccg 38 <210> 34 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 3-11-D4N <400> 34 gcggatccat gcggaacccg ttgccctttt ttccaccg 38 <210> 35 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 3-11-D4N <400> 35 gcgaattctc acggtggaaa aaagggcaac gggttccg 38 <210> 36 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 3-11-L6I <400> 36 gcggatccat gcgggacccg attccctttt ttccaccg 38 <210> 37 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 3-11-L6I <400> 37 gcgaattctc acggtggaaa aaagggaatc gggtcccg 38 <210> 38 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 3-11-L6V <400> 38 gcggatccat gcgggacccg gtgccctttt ttccaccg 38 <210> 39 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 3-11-L6V <400> 39 gcgaattctc acggtggaaa aaagggcacc gggtcccg 38 <210> 40 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 3-11-F8Y <400> 40 gcggatccat gcgggacccg ttgccctatt ttccaccg 38 <210> 41 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 3-11-F8Y <400> 41 gcgaattctc acggtggaaa atagggcaac gggtcccg 38 <210> 42 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 3-11-F9Y <400> 42 gcggatccat gcgggacccg ttgccctttt atccaccg 38 <210> 43 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 3-11-F9Y <400> 43 gcgaattctc acggtggata aaagggcaac gggtcccg 38

Claims (20)

Among the peptides consisting of the amino acid sequence of SEQ ID NO: 10, the aspartic acid is replaced with glutamic acid, or the peptide consisting of the amino acid sequence of SEQ ID NO: 10 among the peptides in which aspartic acid, which is the second amino acid residue, A peptide tag comprising a peptide in which phenylalanine is substituted with a hydrophilic amino acid as a recognition site of an antibody or a binding site of an antibody.
The peptide tag according to claim 1, wherein the hydrophilic amino acid is tyrosine.
A polynucleotide encoding a peptide tag,
Wherein the peptide tag comprises a peptide in which aspartic acid is replaced by glutamic acid, which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 10, or a peptide in which aspartic acid which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: Wherein the 6th amino acid residue phenylalanine is substituted with a hydrophilic amino acid as a recognition site of the antibody or a binding site of the antibody.
4. The polynucleotide according to claim 3, wherein the hydrophilic amino acid is tyrosine.
4. The polynucleotide according to claim 3, wherein the polynucleotide encoding the peptide tag is a primer pair consisting of a forward primer having the nucleotide sequence of SEQ ID NO: 32 and a reverse primer having the nucleotide sequence of SEQ ID NO: 33 or a pair of primers having the nucleotide sequence of SEQ ID NO: A forward primer and a reverse primer having a base sequence of SEQ ID NO: 41. The polynucleotide according to claim 1,
A primer pair for synthesizing a polynucleotide encoding a peptide tag,
Wherein the peptide tag comprises a peptide in which aspartic acid is replaced by glutamic acid, which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 10, or a peptide in which aspartic acid which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: Wherein the 6th amino acid residue, phenylalanine, is substituted with a hydrophilic amino acid, as a recognition site of the antibody or a binding site of the antibody.
7. The pair of primers according to claim 6, wherein the hydrophilic amino acid is tyrosine.
[Claim 11] The method according to claim 6, wherein the primer pair comprises a forward primer having a nucleotide sequence of SEQ ID NO: 32 and a reverse primer having a nucleotide sequence of SEQ ID NO: 33 or a forward primer having a nucleotide sequence of SEQ ID NO: Wherein the primer pair comprises a sequence of inverted primers.
As a recombinant vector comprising a polynucleotide encoding a peptide tag,
Wherein the peptide tag comprises a peptide in which aspartic acid is replaced by glutamic acid, which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 10, or a peptide in which aspartic acid which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: Characterized in that a peptide in which phenylalanine, which is a sixth amino acid residue, is substituted with a hydrophilic amino acid is included as a recognition site of the antibody or a binding site of the antibody.
10. The recombinant vector according to claim 9, wherein the hydrophilic amino acid is tyrosine.
The method of claim 9, wherein the polynucleotide encoding the peptide tag comprises a forward primer having the nucleotide sequence of SEQ ID NO: 32 and a pair of primers consisting of the reverse primer having the nucleotide sequence of SEQ ID NO: 33 or a forward primer pair having the nucleotide sequence of SEQ ID NO: And a reverse primer having the nucleotide sequence of SEQ ID NO: 41.
10. The method of claim 9, wherein the recombinant vector further comprises a polynucleotide encoding a target protein,
Wherein said polynucleotide of interest is linked to a polynucleotide encoding a peptide tag.
A fusion protein comprising a target protein and a peptide tag linked thereto,
Wherein the peptide tag comprises a peptide in which aspartic acid is replaced by glutamic acid, which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 10, or a peptide in which aspartic acid which is the second amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: Wherein the peptide comprises a peptide in which phenylalanine, which is a sixth amino acid residue, is substituted with a hydrophilic amino acid, as a recognition site of the antibody or a binding site of the antibody.
14. The fusion protein according to claim 13, wherein the hydrophilic amino acid is tyrosine.
Contacting the fusion protein of claim 13 or 14 in contact with an antibody for a peptide tag; And
And detecting the presence or amount of the fusion protein bound to the antibody.
16. The method for detecting a fusion protein according to claim 15, wherein the antibody is a monoclonal antibody produced by a hybridoma cell line having a deposit number of KCTC 12283BP.
Contacting the fusion protein of claim 13 or 14 in contact with an antibody for a peptide tag; And
And recovering the fusion protein bound to the antibody.
18. The method of claim 17, wherein the antibody is a monoclonal antibody produced by a hybridoma cell line having a deposit number of KCTC 12283BP.
A polynucleotide according to any one of claims 3 to 5, a primer pair according to any one of claims 6 to 8, and a recombinant vector according to any one of claims 9 to 12; And
Among the peptides consisting of the amino acid sequence of SEQ ID NO: 10, the aspartic acid is replaced with glutamic acid, or the peptide consisting of the amino acid sequence of SEQ ID NO: 10 among the peptides in which aspartic acid, which is the second amino acid residue, An antibody that specifically binds to a peptide in which phenylalanine is substituted with a hydrophilic amino acid, and a hybridoma cell line that produces the antibody, and a kit for detecting or purifying a fusion protein.
20. The kit for detecting or purifying a fusion protein according to claim 19, wherein the hybridoma cell line has a deposit number of KCTC 12283BP.

Images