KR101241667B1 - Novel peptide tag and uses thereof - Google Patents

Abstract

PURPOSE: A novel peptide tag and a use thereof are provided to completely remove non-specific reaction and to effectively detect and purify a polypeptide expressed in a recombinant cell. CONSTITUTION: A novel peptide tag has an amino acid sequence of sequence number 1 or 3. A polynucleotide encodes the peptide tag. An expression vector contains the polynucleotide. A fusion protein contains the peptide tag. A method for preparing the fusion peptide comprises: a step of transforming the polynucleotide into E.coli and preparing a transformant; a step of culturing the transformant to prepare a culture; and a step of collecting the fusion protein form the culture.

Description

Novel peptide tag and uses thereof

The present invention relates to a novel peptide tag and its use, and more particularly, to a peptide comprising amino acids 3 to 11 from the N terminus of the bacteriophytochrome (DrBphP) protein of Deinococcus radiodurans . A tag, a polynucleotide encoding the peptide tag, a fusion protein comprising the peptide tag; Polynucleotides encoding the fusion protein; An expression vector comprising the polynucleotide; A transformant into which the expression vector is introduced; A method for producing the fusion protein comprising culturing the transformant to recover a desired fusion protein; A method of detecting or purifying a fusion protein to which a target polypeptide is linked to a peptide tag of the present invention using a monoclonal antibody specific for the peptide tag; And kits used to perform the method.

Useful proteins and peptides can be produced synthetically or isolated from natural sources. However, this method is disadvantageous in terms of cost and time, and limited production. Thus, it is possible to produce proteins and peptides, preferably through culturing the recombinantly produced transformant to overexpress the desired protein or peptide. However, peptides (especially short peptides) produced in the cellular environment may be susceptible to degradation due to the action of natural cell proteases, and may not be easy to purify because they may contain no antibodies depending on the protein of interest. have.

Protein tagging has been used to overcome the above problems. Protein tagging, or epitope tagging, is a recombinant DNA method in which the amino acid sequence of an epitope for an antibody is linked to a coding sequence of a protein that is to be expressed so that the protein is tagged with the epitope when expressed in a suitable host cell. . Epitope tags generally consist of 5 to 30 amino acids, and do not affect the biological activity of the tagged protein.

Tagged proteins are characterized by specific antibodies to epitope tags in Western blot analysis, immunoprecipitation, immunofluorescence, immunocytochemistry, immunoaffinity purification methods, and the like. Can be detected and purified.

As tags, many unique tags are available, ranging from short peptides on the order of six amino acid residues (eg His tags) to large proteins on the order of 40 kDa (eg MBP) (Stevens, RC, (2000) Structure Fold Des 8: R177-85). His-tagged proteins are trapped specifically on Ni-NTA (nickel-nitrilotriacetic acid) resins, which can be eluted by EDTA or imidazole. In addition, maltose-binding protein (MBP, 370 amino acids, 41 kDa), Staphylococcus protein A, calmodulin-binding peptide (CBP), GFP (238 amino acids, 27 kDa) and glutathione-S-transferra Agase (GST, 211 amino acids, 26 kDa) can also be used for both prokaryotic and eukaryotic proteins. In addition, c-myc tag, HA tag, FLAG tag and the like can be used. The C-myc tag is a 10 amino acid long epitope derived from human c-myc protein (Evans et al., (1985) Mol. Cell. Biol., 12: 3610-3616) and the HA tag is influenza hemaggluti 9 amino acid long epitopes derived from influenza hemagglutinin HA-1 protein (Field et al., (1988) Mol. Cell. Biol., 8: 2159-2165). The FLAG tag is an 8 amino acid long epitope derived from bacteriophage T7 (Hopp et al., (1988) Bio / Technology, 6: 1204-1210).

However, the tag sequences of Myc and Flag, which are widely used because of their short lengths that have minimal effect on the commercially available tags, in particular, the target protein, contain the same sequence in many of the proteins in the cells of the organisms known to date. Antibodies that recognize tags induce nonspecific responses. Such non-specific antibody reactions interfere with the isolation and identification of specific target proteins, resulting in unreliable experiments. To overcome this nonspecific reaction problem, affinity purification systems have been developed that use two different tags that are fused sequentially to the N-terminus of the protein (Rigaut, G., et al. (1999) Nat Biotechnol 17: 1030 -2).

Therefore, the present inventors continue to develop a peptide tag more useful for the purification of the polypeptide, 3-11 of the bacteriophytochrome (DrBphP) of the heterotrophic bacterium Deinococcus radiodurans The fact that a peptide tag with an amino acid sequence contains a short amino acid sequence, it is very efficient for completely eliminating the non-specific reaction, a weakness of the existing tag, and for detecting and purifying polypeptide expressed in recombinant cells. The discovery has completed the present invention.

One object of the present invention is to provide a peptide tag comprising amino acids 3 to 11 from the N terminus of the bacteriophytochrome (DrBphP) protein of Deinococcus radiodurans .

Another object of the present invention is to provide a polynucleotide encoding the peptide tag.

Still another object of the present invention is to provide a fusion protein comprising the peptide tag.

Still another object of the present invention is to provide a polynucleotide encoding the fusion protein.

Still another object of the present invention is to provide an expression vector comprising the polynucleotide.

Still another object of the present invention is to provide a transformant into which the expression vector is introduced.

Still another object of the present invention is to provide a method for preparing the fusion protein comprising culturing the transformant to recover the desired fusion protein.

Still another object of the present invention is to provide a method for detecting or purifying a fusion protein to which a target polypeptide is linked to a peptide tag of the present invention using a monoclonal antibody specific for the peptide tag, and a kit for use in performing the method. It is.

As one embodiment of the present invention, the present invention provides a peptide tag comprising amino acids 3 to 11 from the N terminus of the bacteriophytochrome (DrBphP) protein of Deinococcus radiodurans . In this specification, peptide tags, protein tags, epitope tags can be used interchangeably.

The peptide tag of the present invention was determined by performing epitope mapping from the bacteriophytochrome (DrBphP) of Deinococcus radiodurans . Dayococcus radiodurance is a microorganism that can grow in cryogenic, dry, low oxygen, and strong acid environments. Phytochrome is a light-sensing protein that can absorb external light signals and transmit signals to the lower ones. In the past, phytochromes were known to exist only in higher plants, but recently in cyanobacteria, proteobacteria, actinobacteria, fungi, etc. Several phytochrome-like photoreceptors have been found. In particular, phytochrome-like photoreceptors found in Daynococcus radiodurance and Pseudomonas aeruginosa were named BphP, and among them, the daynococcus radiodurance BphP (DrBphP) consists of 755 amino acids. Davids SJ, et al., (1999) Science 286, 2517-2520. BphP is composed of an N-terminal region structure similar to plant phytochrome, but has a histidine kinase domain (HKD) different from that of plant phytochrome [Karniol R, et al., (2005) Photosynth Res 392, 103-116; Giraud E et al., (2008) Photosynth Res 97, 141-153. DrBphP binds to biliberdine (BV) without the help of other elements to form reversible Pr / Pfr isoforms [Vierstra RD et al., (2000) Semin Cell Dev Biol 11, 511-521 ; Bhoo SH, et al., (2001) Nature 414, 776-779; Rockwell NC, et al., (2006) Annu Rev Plant Biol 57, 837-858.

In a specific embodiment of the present invention, epitope mapping was performed through the following steps. First, the full-length DrBphP gene (SEQ ID NO: 4) and the BphN gene from 1 to 321 amino acids of the N-terminal region of DrBphP were inserted into a pET28 vector (FIG. 1A) and expressed in E. coli using BL21 competent cells. . Then, protein purification was performed by Ni ⁺ -NTA affinity chromatography (QIAGEN) using His tag protein included in the pET28 vector. The expressed BphP protein (SEQ ID NO: 5) and the BphN protein include all of the PAS, GAF domain, and Cys-24 residues, which play an important role in the binding of BV. Therefore, in order to confirm the expression and purification of BphP and BphN proteins, BV was added to purified BphP protein and BphN protein, followed by incubation at room temperature for 10 minutes, followed by SDS-PAGE, followed by coomassie staining and zinc blot. As a result, the expression and purification of BphP and BphN proteins could be confirmed (FIG. 1B).

Next, in order to produce monoclonal antibodies against BphP, antigens were mixed in the abdominal cavity of 6-week-old female BALB / c mice with Complete Freund's adjuvant, followed by intraperitoneal injection, and the mice were sacrificed to sacrifice B lymphocytes and myeloma cells. The cells were mixed and cultured by fusion. After that, the HAT medium and the HT medium were changed, and antibody production of fusion cells was confirmed by ELISA. Fusion plate ELISA test was performed, ELISA test with the BphP protein and BphN protein injected with the antigen to a total of 24 candidate clones to confirm the degree of binding (Table 1).

As a result, it was estimated that 2B8 and 2C11 clones developed similar high levels in both BphP protein and BphN protein, and thus recognized the N-terminal region of BphP protein. However, the 3B2 and 3D2 clones showed high levels in the BphP protein and near zero in the BphN protein, indicating that the C-terminal region of the BphP protein was recognized. Unlike these, 3H7 showed high levels in BphP protein and some low values in BphN protein. Therefore, it was estimated that the 3H7 also recognized the N-terminal part in addition to the BphP protein C-terminus. Thereafter, the first 5 clones were subjected to a first cloning plate ELISA test and a second cloning plate ELISA test. Finally, ascites were generated and the antibodies were purified. As a result, five monoclonal antibodies (2B8, 2C11, 3B2, 3D2 and 3H7) were obtained.

Next, Western blot was performed to confirm whether the purified antibodies showed the same results for the pre-expressed and purified BphP protein and BphN protein. Each monoclonal antibody against 5 mg of purified BphP protein and BphN protein was used as a primary antibody in a ratio of 1: 1000 for 2% skim milk, and then HRP-mouse antibody (SIGMA) as a secondary antibody was used as 1: 10000. Western blots were performed by treatment in proportions. As a result, 2B8 and 2C11 were found to bind both BphP protein and BphN protein in the same manner as the ELISA test (FIG. 2). Therefore, both of them could be considered to bind to the N-terminal region of BphP. In addition, 3B2 and 3D2 showed a band for the BphP protein but no band for the BphN protein, indicating that the BBP and 3D2 would bind to the C-terminal region of the BphP protein. 3H7, however, differed from the ELISA test only by the BphP protein. In addition, the binding degree of each antibody was strongly bound by 2B8 and 2C11 binding to the N-terminal region, and 3D2, which is thought to recognize the C-terminal region, showed a weaker band than that. Next came the bands that bound strongly in the order of 3H7, 3B2.

On the other hand, DrBphP has a structure similar to that of phytochrome. Especially, PCDs constituting N-terminal region have very similar structures including PAS, GAF and PHY domains. Therefore, And whether or not they responded. However, all of the BphP monoclonal antibodies did not bind to Oat PhyA (Fig. 4). Therefore, the antibodies were confirmed to be BphP-specific novel antibodies that recognize epitopes different from existing Oat phytochrome antibodies, and the present inventors have isolated epitopes recognized by the antibodies, so that they are not included in any protein of the known organism. It has been found that it can be used as a specific peptide tag.

The inventors produced a recombinant partial protein for securing the at least amino acid sequence of DrBphP to which the antibody binds the most strongly bound 2B8 antibody. Peptide fragments consisting of 3-12 amino acids (SEQ ID NO: 3), 3-11 amino acids (SEQ ID NO: 1), 3-10 amino acids, and 4-12 amino acids were prepared to determine whether binding was possible through Western blot. As a result, it was confirmed that the 2B8 antibody correctly recognizes and binds an epitope when only 9 amino acids (SEQ ID NO: 1) up to 3-11 of BphP exist. From this it was confirmed that the epitope of the 2B8 antibody is the amino acid sequence 3-11 of DrBphP having SEQ ID NO: 1, it can be used as a peptide tag.

Any peptide having a binding activity to the antibody may be included in the peptide tag of the present invention regardless of its length. For example, a peptide tag may include a peptide having specific binding activity for an antibody or a mutant thereof having binding activity for an antibody, and the like. The peptide tag of the present invention may be a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide containing the amino acid sequence of SEQ ID NO: 1 and having antibody binding activity. It may also include peptides modified with glycosylation, acetylation, phosphorylation, and the like, and peptides comprising one or more amino acid analogs or labeled amino acids may also be included in the peptide tags of the present invention. In addition, peptide sequences include “conservatively modified variants” in which individual substitutions, deletions, or additions are made, which modifications result in substitution of chemically similar amino acids for amino acids. The most commonly occurring exchanges are amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Exchange between Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, Asp / Gly. In addition, the peptide may include a peptide whose structural stability to the heat, pH, etc. of the peptide is increased or peptide activity is increased by variation or modification on the amino acid sequence.

As another embodiment of the present invention, the present invention provides a polynucleotide encoding the peptide tag, and an expression vector comprising the polynucleotide.

As used herein, the term "polynucleotide" refers to all non-modified or modified polyribonucleotides (RNA) or polydeoxyribonucleotides (DNA). The polynucleotides may comprise single- or double-stranded DNA, single- and double-stranded DNA, single- and double-stranded RNA, single- and double-stranded RNA, single- and double-stranded RNA, single- or double-stranded regions, Or hybrid molecules comprising DNA and RNA, which may be a mixture of single- and double-stranded regions.

The polynucleotides encoding the peptides may or may not include untranslated sequences (eg introns) (eg cDNA). The information on which the peptide is encoded is specified using codons. Typically, amino acid sequences are encoded by polynucleotides using the universal genetic code. "Codon" refers to a triplet of nucleotides that determines the amino acid sequence in a polypeptide chain. Most organisms use 20 or 21 amino acids to prepare their polypeptides which are proteins or protein precursors. Since there are four possible nucleotide adenine (A), guanine (G), cytosine (C) and thymine (T) in DNA, there are 64 possible triplets capable of encoding 20 amino acids and terminal signals. Because of this redundancy, most amino acids are coded by one or more triplets. Accordingly, changes in the nucleotide sequence can be allowed without affecting the amino acid sequence of the encoded polypeptide, which is referred to as "silent variation" by "codon degeneracy." All silent variations of the polynucleotides encoding polypeptides of the invention are within the scope of the invention.

On the other hand, codons that specify a single amino acid cannot be used at the same frequency, and each organism often exhibits "codon-bias" specific to one of several codons that encode the same given amino acid. If the coding region contains a rare codon or a cluster of rare codons, recombination or mutagenesis of the gene can be used to increase the expression level by removing the rare codon. [J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001), at 15.12]. Thus, "codon selection" can be used to optimize expression in a selected host. The most preferred codons are codons found primarily in highly expressed genes. In " codon preference "in E. coli, Konigsberg, et al., Proc. Nat'l. Acad. Sci. U.S.A. 80: 687-91 (1983).

When chemically synthesizing a nucleotide sequence, synthesis methods well known in the art may be used, for example, those described in Engels and Uhlmann, Angew Chem Int Ed Eng., 37: 73-127, 1988. , Triester, phosphite, phosphoramidite and H-phosphate methods, PCR and other autoprimer methods, oligonucleotide synthesis on a solid support, and the like.

In a preferred embodiment of the present invention, the polynucleotide encoding the peptide tag is not particularly limited, but may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2.

As another embodiment of the present invention, the present invention provides a fusion protein comprising the peptide tag.

The term "fusion protein" or "fusion peptide" refers to a polymer of amino acids (peptides, oligopeptides, polypeptides, or proteins) in which each portion comprises at least two portions that comprise distinct functions. At least one first portion of the fusion peptide comprises at least one tag of the present invention and at least one second portion of the fusion peptide comprises at least one target peptide. The epitope of the Denococcus radioduration DrBphP determined in the present invention can be used as a peptide tag which is usefully used for detection and purification of the target peptide by connecting to the codon region of the target peptide.

The peptide tag of the present invention can be inserted anywhere inside the protein as well as the C-terminus of the protein of interest, as long as the N-terminus or the functionality of the protein is not substantially affected. Here, having no substantial effect on the functionality of the protein means that the protein retains at least 80%, preferably at least 95%, activity before the peptide tag is fused.

Any protein can be used as the target protein used in the present invention, and the short-chain FV (ScFv), thrombopoietin (TPO), and B-lymphocyte stimulation of the humanized antibody AKA / HzK against cancer-associated antigen TAG-72 Factor (B-lymphocyte stimulator) and the like can be exemplified.

Fusion proteins include a combination of two or more peptides, wherein the two or more peptides can be linked covalently or non-covalently. The two or more separate polypeptides may be directly contacted with each other without any mediator, or may be mediated by mediators such as peptide linkers.

In a preferred embodiment, the fusion protein may be designed to include at least one cleavable peptide linker so that the cleavable linker can then be chemically and / or enzymatically cleaved so that the desired peptide can be recovered from the fusion protein. Fusion proteins can be designed to include one or more tags, cleavable peptide linkers, and regions encoding the desired peptide.

Linkers generally do not have specific biological activities other than to associate proteins or to maintain minimal spacing or other spatial relationships between these proteins, but the constituent amino acids of the peptide linkers are dependent upon the characteristics of the molecule, such as folding, pure charge, or hydrophobicity. It may be chosen to have some effect. The peptide linker may optionally include a site for degradation by the protease, separation of the fused constituent polypeptide.

Cleavable peptide linkers may be from 1 to about 50 amino acids in length, preferably from 1 to about 20 amino acids. An example of an enzyme cleavable peptide linker may include a caspase-3 cleavage sequence, and may include an aspartic acid-proline dipeptide (D-P) moiety cleavable by acid. Cleavable peptide linkers can be incorporated into fusion proteins using many techniques well known in the art. In addition, a flexible peptide linker may be used, and a peptide linker having a GGSGGT amino acid sequence, a GGGGS amino acid sequence, or a GGGGSGGGGS amino acid sequence may be used, but is not limited thereto. The peptide linker may be expressed by operably linking the polynucleotides encoding the peptide linkers in-frame between the polynucleotides encoding the respective peptides of the fusion protein in frame.

Means for preparing the peptides of the invention (tags, cleavable peptide linkers, target peptides, spacer peptides, and / or fusion peptides) are well known in the art (see, e.g., Stewart et al., Solid Phase Peptide). Synthesis, Pierce Chemical Co., Rockford, IL, 1984; Bodanszky, Principles of Peptide Synthesis, Springer-Verlag, New York, 1984; and Pennington et al., Peptide Synthesis Protocols, Humana Press, Totowa, NJ, 1994). The various components (tags, target peptides, and cleavable linker / cleavage sequences) of the fusion peptides described herein can be used as carbodiimide coupling agents (see, eg, Hersonson, Greg T., Bioconjugate Techniques, Academic Press). , New York (1996)), diacid chlorides, diisocyanates and other difunctional coupling reagents reactive with terminal amines and / or carboxylic acid groups of peptides, although chemical synthesis is often cost and And / or impurities are limited to peptides less than about 50 amino acids in length. In a preferred embodiment, the peptides described herein can be prepared using standard recombinant DNA and molecular cloning techniques. [Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY (2001); And Silhavy, TJ, et al., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Cold Press Spring Harbor, NY (1984); And in Ausubel, FM et. al., Short Protocols in Molecular Biology, 5 ^th Ed. Current Protocols and John Wiley and Sons, Inc., NY, 2002]

As another embodiment of the present invention, the present invention is a polynucleotide encoding the fusion protein; An expression vector comprising the polynucleotide; A transformant into which the expression vector is introduced; And culturing the transformant to recover a desired fusion protein.

To prepare the fusion proteins of the invention, polynucleotides can be designed to encode a fusion protein comprising a protein of interest and a peptide tag. The polynucleotides encoding the fusion protein are then introduced into the vector, which is then used to modify the appropriate host cell. Alternatively, an expression vector comprising a polynucleotide encoding a peptide tag may be introduced to operably link a polynucleotide encoding a protein of interest.

As used herein, the term “expression vector” refers to a gene construct comprising an essential regulatory element operably linked to an insert such that the expression is present when present in a cell of an individual. The expression vector can be prepared and purified using standard recombinant DNA techniques. The type of the expression vector is not particularly limited as long as it functions to express a desired gene in various host cells of prokaryotic and eukaryotic cells and to produce a desired protein, but has a promoter that exhibits strong activity and a strong expression ability, and a natural state. Vectors capable of producing large quantities of foreign proteins in the form of The expression vector preferably contains at least a promoter, an initiation codon, a gene encoding a desired protein, and a termination codon terminator. In addition, a DNA encoding a signal peptide, an additional expression control sequence, an untranslated region, a selection marker region, or a replicable unit on the 5 'and 3' sides of a desired gene may be appropriately included.

"Promoter" means the minimum sequence sufficient to direct transcription. In addition, sufficient promoter constructs may be included to express a regulated promoter dependent gene induced by cell type specific or external signals or agents, which constructs may be located in the 5 'or 3' portion of the gene. . Both conservative promoters and inducible promoters are included. Promoter sequences may be derived from prokaryotes, eukaryotes or viruses.

The term “operably linked” means that polynucleotide sequence association on a single polynucleotide means that one function is regulated by the other. For example, if a promoter can control the expression of a coding sequence (ie, when the coding sequence is under transcriptional control of the promoter), the promoter may be linked to the coding sequence to operate, or the ribosomal binding site may facilitate translation. If located, the ribosomal binding site is linked to the coding sequence to operate. The coding sequence can be linked to and operate in regulatory sequences in either the sense direction or the antisense direction.

As used herein, the term "transformer" refers to a cell transformed by introducing a vector having a polynucleotide encoding at least one target protein into a host cell, and preparing a transformant by introducing an expression vector into the host cell. Methods for doing this include the calcium phosphate method or the calcium / rubidium chloride method described in Sambrook, J., et al., Molecular Cloning, A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory, 1. 74, 1989. , Electroporation, electroinjection, chemical treatment such as PEG, a method using a gene gun, and the like. When the transformant expressing the vector is cultured in a nutrient medium, the target protein can be prepared and separated in large quantities. The culture medium and culture conditions can be appropriately selected and used depending on the host cell. The conditions such as temperature, medium pH and incubation time should be appropriately adjusted so as to be suitable for cell growth and mass production of the protein during culturing. Host cells that can be transformed with the expression vector according to the present invention include prokaryotic cells, and a host with high expression efficiency of introduced DNA and a high expression efficiency of introduced DNA is usually used. Bacteria, for example, known prokaryotic hosts such as Escherichia, Pseudomonas, Bacillus, Streptomyces, are examples of host cells that can be used. Preferably E. coli can be used. Expression of the peptide can be induced using inducer IPTG and induction time can be controlled to maximize the amount of protein. In the present invention, recombinantly produced peptides can be recovered from medium or cell lysate. If membrane bound, it may be liberated from the membrane using a suitable surfactant solution (eg Triton-X 100) or by enzymatic cleavage. Cells used for peptide expression can be disrupted by various physical or chemical means, such as freeze-thaw repetition, sonication, mechanical disruption or cell digestion, and are isolated by conventional biochemical separation techniques. Purification is possible (Sambrook et al., Molecular Cloning: A laborarory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989; Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 182. Academic Press. Inc., San Diego, CA, 1990). Electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion exchange chromatography, affinity chromatography, immunosorbent affinity chromatography, reverse phase HPLC, gel permeation HPLC), isoelectric focus and various variations and combinations thereof Including but not limited to.

As another embodiment for achieving the object of the present invention, the present invention is a method for detecting or purifying the fusion protein linked to the polypeptide of the invention and the peptide tag of the invention using a monoclonal antibody specific for the peptide tag And it provides a kit used to perform the method.

The fusion protein purification method includes the steps of contacting a fusion protein to which a peptide tag and a target polypeptide of the present invention are linked to an antibody that specifically binds to the peptide tag; And recovering a fusion protein bound to the antibody, wherein the method for detecting a fusion protein comprises contacting a fusion protein to which a peptide tag and a target polypeptide of the present invention are linked to an antibody that specifically binds to the peptide tag. step; And quantitatively analyzing the amount of the fusion protein bound to the antibody.

As used herein, the term "antibody" refers to a substance produced by stimulation of a specific antigen in the immune system, which can specifically bind to the specific antigen to cause an antigen-antibody reaction, as well as the natural form produced in the immune system, It may be a functional fragment of an antibody molecule having an activity equivalent to that of the native form. The whole antibody in its native form has a structure having two full length light chains and two full length heavy chains, and each light chain is linked by a heavy chain and a disulfide bond. A functional fragment of an antibody molecule refers to a fragment having an antigen binding function and includes Fab, F (ab ') 2, F (ab') 2, Fv and the like. Fab in the antibody fragment has a structure having a variable region of the light and heavy chains, a constant region of the light chain and the first constant region of the heavy chain (CH1) has one antigen binding site. Fab 'differs from Fab in that it has a hinge region that contains at least one cysteine residue at the C-terminus of the heavy chain CH1 domain. F (ab ') 2 antibodies are produced by disulfide bonds of cysteine residues in the hinge region of Fab'. Recombinant techniques for generating Fv fragments with minimal antibody fragments having only a heavy chain variable region and a light chain variable region are disclosed in WO 88/10649, WO 88/106630, WO 88/07085, WO 88/07086 and WO 88 / 09344. Double-chain Fv (dsFv) is a disulfide bond is linked to the heavy chain variable region and light chain variable region, and short-chain Fv (scFv) is generally covalently linked to the variable region of the heavy chain and the light chain through a peptide linker. Such antibody fragments can be obtained using proteolytic enzymes (e.g., the entire antibody can be restricted to papain and Fabs can be obtained and pepsin can be used to obtain F (ab ') 2 fragments). Can be produced through genetic recombination techniques. For the purposes of the present invention, the antibody may be an antibody that can specifically bind to the peptide tag of the present invention, preferably in the form of Fab or whole antibody, and more preferably in the form of monoclonal antibody. .

In one embodiment of the invention, the method comprises linking an antibody with a peptide tag having specific binding activity for the antibody, wherein the antibody is immobilized on a support and the peptide tag binds to a protein to be purified. It may be. In one embodiment, the method comprises contacting a sample comprising a tagged protein with a support to which the antibody is immobilized, wherein the tagged protein is a protein covalently linked to a peptide tag, wherein the peptide tag is Having specific binding activity for the antibody, the contacting may be made under conditions that the antibody binds to the peptide tag, and the removal of unbound components and removal of the protein from the support. It is also possible to use immunoaffinity chromatography media comprising an immunoaffinity chromatography medium comprising a support and an antibody and a column packed with the affinity chromatography medium.

In addition, tagged proteins may be incorporated into peptide tags using Western blot analysis, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, immunofluorescence, immunocytochemistry, or the like. Can be detected by specific antibodies against.

In addition, tagged proteins can be analyzed on a large scale using protein microarrays that immobilize specific antibodies against peptide tags on glass or silicon substrates.

Purity of the polypeptide purified according to the purification method of the present invention is very excellent as 95 to 100%, it can be confirmed that does not affect the function of the target protein at all.

The present invention also provides a kit for use in the method, the peptide tag of the present invention or a polynucleotide encoding the peptide tag, or an expression vector comprising a polynucleotide, specific binding to the peptide tag of the present invention Kits are provided that include antibodies, and instructions. The fusion protein may be prepared using the peptide tag or the polynucleotide encoding the peptide tag, or an expression vector comprising the polynucleotide, and the antibody may be used to purify and detect the fusion protein. The antibody may be in the form of immobilized on a support, or in the form of a hybridoma cell line producing the antibody.

Monoclonal antibodies having specific binding to the peptide tag of the present invention can be prepared using the peptide tag as an immunogen. More specifically, first, the peptide tag (with Freund's adjutant, if necessary) as an immunogen is used once or more in the subcutaneous, muscle, vein, bulge or abdominal cavity of a mammal, except humans. Injecting is immune sensitized. Mammals other than humans are preferably mice, rats, hamsters, malmots, rabbits, cats, dogs, pigs, goats, sheep, donkeys, horses or cattle (transgenic mice that produce human antibodies). And transgenic animals engineered to produce antibodies from other animals), more preferably mice, rats, hamsters, malmots or rabbits. Immunization can be performed 1 to 4 times every 1 to 21 days from the first immunization, to obtain cells producing antibodies from immune sensitized mammals about 1 to 10 days after the final immunization. The number and time interval of immunization can be appropriately changed depending on the characteristics of the immunogen to be used.

The production of hybridomas that secrete monoclonal antibodies can be carried out according to methods such as Keira and Mirstein (Nature, 1975, Vol. 256, p. 495-497) and the equivalent method. Any one selected from the group consisting of spleen, lymph node, bone marrow, or tonsils taken from animals other than humans sensitized as described above, preferably from an antibody-producing cell contained in the spleen and from a mammal having no ability to produce autoantibodies Hybridomas can be prepared by cell fusion of myeloma cells. The mammal may be a mouse, rat, malmot, hamster, rabbit or human, preferably mouse, rat or human.

In addition, myeloma cells (myeloma cells) used for cell fusion are mouse-derived myeloma P3 / X63-AG8. 653 (653), P3 / NSI / 1-Ag4-1 (NS-1), P3 / X63-Ag8. U1 (P3U1), SP2 / 0-Ag14 (Sp2 / O, Sp2), PAI, F0 or BW5147; Rat-derived myeloma 210 RCY3-Ag. 2. 3; Or human derived myeloma U-266 AR1, GM1500-6TG-A1-2, UC729-6, CEM-AGR, D1R11 or CEM-T15.

For cell fusion, for example, a fusion accelerator or an electric pulse method including polyethylene glycol or Sendai virus is used. For example, antibody-producing cells and cells derived from mammals capable of infinite propagation in a fusion medium containing a fusion promoter are used. Is suspended at a ratio of about 1: 1 to 1:10, and in this state, incubated at about 30 to 40 ° C for about 1 to 5 minutes. As the fusion medium, for example, conventional general ones such as MEM medium, RPMI1640 medium, and Iscove's Modified Dulbecco's Medium may be used, and serum such as bovine serum is preferably removed.

In the method for screening the hybridoma clone producing the monoclonal antibody, first, the fusion cells obtained as described above are transferred to a medium for selection, such as HAT medium, and cultured for about 3 to 3 weeks at about 30 to 40 ° C. This kills cells other than hybridomas. Subsequently, after culturing the hybridomas in a microtiter plate or the like, the portion of increased reactivity between the immunogen used in the immune response of the animal except the human described above and the culture supernatant is described. This can be done by an immunoassay such as antibody or ELISA (Enzyme-Linked Immunosorbent Assay). And the clone producing the monoclonal antibody found above shows a specific binding capacity to the immunogen.

The monoclonal antibody of the present invention can be obtained by culturing such hybridomas in vitro and in vivo. In the culture, a conventional method for culturing mammalian cells is used, and in order to collect monoclonal antibodies from cultures and the like, conventional methods in this field for purifying the antibody in general are used. As each method, for example, salting out, dialysis, filtration, concentration, centrifugation, fractional precipitation, gel filtration chromatography, ion exchange chromatography, affinity chromatography, high-performance liquid chromatography, gel electrophoresis And isoelectric point electrophoresis, and the like, which are applied in combination as necessary. The purified monoclonal antibody is then concentrated and dried to form a liquid or solid phase depending on the use.

In addition, the monoclonal antibody of the present invention is a DNA encoding a heavy chain and a light chain variable region, respectively, a known DNA encoding a normal role of heavy and light chains (for example, Japanese 2007- Genes linked with 252372) were synthesized by PCR or chemical synthesis, and then transplanted into a known expression vector (pcDNA 3.1 (Invitrogen)) or the like to enable expression of the transformant. The antibody can be produced by producing the antibody by expression in a host such as CHO cells or Escherichia coli, and purified from the culture medium using a Protein A column or the like.

The novel peptide tag of the present invention is a short-length tag and completely eliminates non-specific reactions, which are weak points of existing tags such as Myc and Flag, and detects and purifies polypeptides expressed in recombinant cells. Since it is very efficient, it can be used in all fields using peptide tags, and can be particularly useful for detecting, detecting and purifying specific proteins.

1 is a diagram showing the results of purification of DrBphP and DrBphN using His tag column chromatography. (A) Schematic diagram of the constructs used for BphP expression. FL, full length (1-755 amino acids, BphP); ΔPHY / HKD (1-321 amino acids, BphN) (B) BphP and BphN apoproteins were purified using Ni ⁺ -NTA affinity chromatography, incubated with BV for 20 minutes, followed by SDS-PAGE, and zinc ( BV binding by zinc) -induced fluorescence was detected (right) and stained with Coomassie Blue (left). 1: BphP crude extract, 2: purified BphP, 3: BphN crude extract, 4: purified BphN. Purification Conditions-Binding & Washing: pH 8.0, 100 mM Tris, 200 mM NaCl, 10 mM imidazole-Elution: pH 8.0, 100 mM Tris, 200 mM NaCl, 150 mM imidazole
Figure 2 is a diagram showing the results of Western blot analysis of selected monoclonal antibodies using purified BphP and BphN. Purified BphP and BphN were subjected to SDS-PAGE and Western blot was performed using purified monoclonal antibodies (2B8, 2C11, 3B2, 3D2, 3H7) of Bphp. P; BphP, N; BphN. Western blot confirmed that 2B8 of the monoclonal antibody recognized the epitope present at the N-terminus of the BphP protein.
Figure 3 shows the results confirmed by Western blot the minimum amino acid sequence that recognizes the 2B8 antibody.
4 shows the results of confirming whether or not the PCD structure constituting DrBphP and the N-terminal region reacts with Oat PhyA, which is a similar oat phytochrome protein, to five BphP monoclonal antibodies.
Figure 5 shows the normal expression in E. coli of the fusion protein containing a BRT tag containing a 3-11 amino acid sequence, and whether or not detectable using a 2B8 monoclonal antibody, GST protein N-terminal The result of detecting the attached BRT tag using 2B8 antibody is shown.
Figure 6 is to confirm the normal expression in the plant (tobacco) of the fusion protein containing a BRT tag comprising a 3-11 amino acid sequence, and to determine whether or not detectable using 2B8 monoclonal antibody, GFP protein N-terminal The result of having detected the BRT tag attached to using the 2B8 antibody is shown.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1 Cloning of BphP, BphN, Recombinant Partial BphP

A full-length Deinococcus radiodurans bacteriophytochrome (DrBphP) and a BphN containing N-terminal sites up to 321 amino acids were used as primers (BphP primers: 1-F: GCCATATGATGAGCCGGGACCCGTTGCCC (SEQ ID NO: 6). ), 755-R: GCCTCGAGTCAGGCATCGGCGGCTCCCGG (Xho I) (SEQ ID NO: 7); BphN Primer: 1-F: GCCATATGATGAGCCGGGACCCGTTGCCC (Nde I) (SEQ ID NO: 8), 321-R: GCCTCGAGCGCTTCCTTGACCTGAACT (Xho I) Cloning was performed by PCR with, and EX-Taq. The BphP and BphN DNA templates amplified by PCR were easily T-vector (promega) bound to confirm their nucleotide sequence, and then transferred to the pET21a vector, an E. coli protein expression vector (FIG. 1A), using BL21 competent cells (RBC). By expression. Recombinant partial BphP proteins that lost some of the rest were expressed in the pET28a (+) vector mainly in the same way, and very short peptides of tens of amino acids were used to facilitate identification on Western blots. It was expressed in pGEX4T1 vector with GST tag.

Example 2: Expression and Purification of BphP, BphN, Recombinant Portion BphP

The transformed cells were grown in LB medium to a concentration of OD _{600 up} to 0.6, and protein expression was induced for 6 hours by adding 0.5 mM IPTG at 25 ° C. The cells were then centrifuged to discard the supernatant and the pellet resuspended in binding buffer (100 mM Tris-Cl, 150 mM NaCl, and 10 mM imidazole, pH 8.0). The BphP protein and the BphN protein are capable of binding to BV alone, as they contain both the PAS, the GAF domain, and the Cys-24 residue, which play an important role in BV binding. To obtain holo-BphP protein, biliberdine (BV, 2 μg / ml, Frontier, Scientific, Carnforth, UK) was added and reacted at room temperature for 10 minutes. Next, the cells were broken by sonication and centrifuged again to separate only the supernatant, followed by purification of the protein using a Ni ⁺ -NTA column (QIAGEN). The protein was then stored at -70 ° C.

Zinc blots were performed to confirm the binding between the protein samples and the BV. In the experimental method, SDS-PAGE of the samples reacted for 10 minutes by adding BV to Apo-BphP proteins was carried out in zinc acetate solution (20 mM zinc acetate, 150 mM Tris-Cl, pH 7.0) for 20 minutes, and then the protein under UV. The fluorescent signal of was observed.

For western blot, for purified BphP protein and BphN protein, each monoclonal antibody was used at a ratio of 1: 1000 for 2% skim milk as the primary antibody, and then HRP-mouse antibody (SIGMA) as the secondary antibody. ) Was processed at a ratio of 1: 10000 to perform Western blot.

As a result, the expression and purification of BphP and BphN proteins could be confirmed (FIG. 1B).

Example 3: Preparation of Monoclonal Antibody Specifically Binding to DrBphP Protein

Immunization

The abdominal cavity of 6 week old female BALB / c mice was injected intraperitoneally with the antigen mixed with complete Freund's adjuvant. Immersion was intraperitoneally injected with Incomplete Freund's adjuvant and antigen in the same way after 1 hour mixing with vortexer. Two weeks later, blood was collected from the tail of the mouse and used for cell fusion when the titer of the antibody was 1/1000 to 1.0 or more after the ELISA test. At 4 weeks from secondary immunization for cell fusion, the same amount of antigen was diluted in PBS and injected intraperitoneally. Three days later mice were sacrificed and cell fused.

Cell fusion for monoclonal antibody production

As a B lymphocyte cell source, the abdominal incision was made to separate fat or other organs as much as possible, and the spleen was aseptically removed to prevent excessive bleeding, homogenized with a cell strainer, diluted with basal medium, and centrifugation was washed twice. B lymphocytes and myeloma cells were mixed at an appropriate ratio, centrifuged for 5 minutes, the supernatant was discarded, and the remaining cell mixture was gently shaken. 10 ml of pre-warmed RBC lysis buffer was added, suspended and incubated at 37 ° C. for 20 minutes, followed by FBS. Was added and centrifuged. Cell fusion was slowly added to the PEG (polyethlyene glycerol) 1500 solution at 37 ℃, and the reaction was stopped by adding a basic medium again. Rapidly centrifuged, the supernatant was discarded, and the remaining cell mixture was carefully suspended in prepared macrophage medium and dispensed into 96 well tissue culture plates and incubated in a 37 ° C., carbon dioxide incubator.

Selection of Fusion Cells

Five days after the cell fusion, HAT medium, a selective medium for fused cells, was added to each well. After that, the HAT medium was added in the same manner every three days, and after 11 days of cell fusion, the HT medium added with HT supplement to the complete medium was changed and observed daily under a microscope to confirm the growth of fusion cells. The supernatant of the wells in which growth was confirmed was taken, and the antibody production was confirmed by ELISA, and the fusion cell line once determined to secrete the desired antibody was subjected to 1,2,3 cloning by limiting dilution so that the fusion cell population was one cell line. Clones derived from.

Fusion cell selection by ELISA

After the cell fusion for immunity to the immunized antigen and the production of monoclonal antibodies, an antigen protein solution diluted with ELISA coating buffer was added to a 96 well tissue culture plate and reacted at 4 ° C. Then, the antigenic protein solution was aspirated to remove, a blocking solution was added to the remaining surface of each well, and reacted at 37 ° C for 1 hour. The blocking solution was then removed and washed three times with PBST solution. After fusion cell culture supernatant was added to each well and reacted at 37 ° C, the solution was removed and washed three times with PBST solution. A solution diluted with Horseradish peroxidase (HRP) conjugate anti-mouse immunoglobulin (anti-mouse IgG) in PBS was added to each well. The OPD (orthophenylenediammine dihydrochloride) substrate solution was added to the well and reacted at room temperature for 10 minutes, and the reaction was stopped with a stop solution. At this time, the absorbance was measured at 492 nm with an ELISA reader to confirm the degree of color development. The obtained antibody was determined isotype by ELISA method using a mouse antibody.

Purification of antibodies

After intraperitoneal injection of 0.5 ml of pristane in BALB / c mice older than 8 weeks, hybridoma cells were cultured three weeks later, washed three times with PBS, and diluted in PBS to 5x10 ⁶ cells / 0.5 ml. Was injected into the abdominal cavity. After one to ten days, the ascites was observed, and the mice were sacrificed by cervical distal bone to make a small hole in the abdomen, and the ascites was collected using a serum separation tube while keeping the ascites from flowing. RBC was removed by standing at room temperature for about 1 hour and centrifuging.

After the appropriate amount of PBS was added to the collected ascites, it was slowly mixed with ammonium sulfate at 4 ° C. After centrifugation at 4 ° C, the solution was passed through a filter. After adding the appropriate amount of Protein A and DFMF beads, tris buffer was washed 10 times the bed vol. When the antibody was added and mixed with protein A / G, a fraction was obtained, washed with tris buffer solution, and glycine was added and elution several times. The purified antibody was placed in a dialysis bag and dialyzed in PBS buffer for 3 hours, replaced with PBS buffer overnight, and dialyzed overnight, and the dialysis antibody was quantitatively stored.

Rechecking the degree of binding to the antigen

Fusion plate ELISA test was performed, ELISA test with the BphP protein and BphN protein injected with the antigen to a total of 24 candidate clones to confirm the degree of binding (Table 1).

Clone Full N P (Full) 1B6 1.0910 0.0660 1.3190 1B11 2.3120 0.1560 2.3700 1D6 2.1260 0.0550 2.3180 2B8 2.2720 2.3400 2.4200 2 C11 2.2890 2.3480 2.4040 2D9 2.1810 0.1430 2.2730 2E3 1.5320 2.1720 1.8020 2F7 2.3100 0.1220 2.4430 2H8 1.0680 0.0650 1.3440 3A4 2.2530 1.9180 2.3770 3B2 2.1510 0.0980 2.2900 3B3 1.9800 0.0700 2.1650 3C11 2.2030 1.9730 2.2590 3 D2 2.2350 0.0640 2.2830 3D10 2.3910 0.1180 2.4280 3D11 1.9360 1.6850 2.3130 3F10 2.3590 0.0730 2.3570 3G2 1.6760 0.0880 2.0510 3G9 1.5370 0.0800 1.5580 3H1 1.8520 1.7840 2.0950 3 H7 2.2620 0.4640 2.3490 4B7 2.1590 1.9730 2.2620 4E2 2.4060 0.2050 2.3770 4E3 2.1900 0.0550 2.2650

As a result, it was estimated that 2B8 and 2C11 clones developed similar high levels in both BphP protein and BphN protein, and thus recognized the N-terminal region of BphP protein. However, the 3B2 and 3D2 clones showed high levels in the BphP protein and near zero in the BphN protein, indicating that the C-terminal region of the BphP protein was recognized. Unlike these, 3H7 showed high levels in BphP protein and some low values in BphN protein. Therefore, it was estimated that the 3H7 also recognized the N-terminal part in addition to the BphP protein C-terminus. Thereafter, the first 5 clones were subjected to a first cloning plate ELISA test and a second cloning plate ELISA test. Finally, ascites were generated and the antibodies were purified. As a result, five monoclonal antibodies (2B8, 2C11, 3B2, 3D2 and 3H7) were obtained.

Example 4: Specificity Analysis of Monoclonal Antibodies

Western blot was performed to confirm whether the obtained antibodies are applied to the BphP and BphN proteins. Each monoclonal antibody against 5 μg of purified BphP protein and BphN protein was used as a primary antibody in a ratio of 1: 1000 for 2% skim milk, followed by 1: 10000 HRP-mouse antibody (SIGMA) as secondary antibody. Western blots were performed by treatment in proportions. As a result, 2B8 and 2C11 were found to bind both BphP protein and BphN protein in the same manner as the ELISA test (FIG. 2). Therefore, both of them could be considered to bind to the N-terminal region of BphP. In addition, 3B2 and 3D2 showed a band for the BphP protein but no band for the BphN protein, indicating that the BBP and 3D2 would bind to the C-terminal region of the BphP protein. 3H7, however, differed from the ELISA test only by the BphP protein. In addition, the binding degree of each antibody was strongly bound by 2B8 and 2C11 binding to the N-terminal region, and 3D2, which is considered to recognize the C-terminal region, showed a weaker band than that. Next came the bands that bound strongly in the order of 3H7, 3B2.

Notably, DrBphP has a similar structure to plant phytochromes, especially since the PCDs that make up the N-terminal site both have very similar structures that include the PAS, GAF, and PHY domains. It was checked whether it reacts with phytochrome protein. However, all of the BphP monoclonal antibodies did not bind to Oat PhyA (Fig. 4). Therefore, it was confirmed that the antibodies are BphP-specific novel antibodies that recognize epitopes different from existing Oat phytochrome antibodies.

Example 5: Securing the amino acid sequence of the BRT tag that the monoclonal antibody specifically binds

For the most strongly bound 2B8 antibody of the above antibodies, 3-12 amino acids, 3-11 amino acids, 3-10 amino acids, 4 of DrBphP to determine the minimum amino acid sequence of DrBphP to which the antibody binds, ie the epitope in DrBphP DrBphP (3-12), DrBphP (3-11), DrBphP (3-10) and pGEX4T1 vectors containing genes encoding peptide fragments consisting of -12 amino acids and glutathione-S-transferase (GST) genes; Plasmids containing DrBphP (4-12) were prepared, transformed into E. coli DH5α, and cultured in LB medium to induce the expression of proteins, followed by Western blotting using the monoclonal antibody 2B8. . As a result, it was confirmed that the 2B8 antibody correctly recognizes and binds an epitope when only 9 amino acids (RDPLPFFPP: SEQ ID NO: 1) up to 3-11 exist. From this it was confirmed that the epitope of the 2B8 antibody is the amino acid sequence 3-11 of DrBphP having SEQ ID NO: 1, it can be used as a peptide tag.

Example 6: Detection of Fusion Proteins Including BRT Tags

A fusion protein was prepared using the BRT tag of the present invention, and the fusion protein was detected using a BRT tag antibody.

Expression in E. coli of BRT Tag (3-11)

In order to confirm normal expression in E. coli of a fusion protein including a BRT tag including a 3-11 amino acid sequence and to detect whether it is detectable using a 2B8 monoclonal antibody, a commonly used protein tag, GST (Glutathion-S-Transferase) tag protein was expressed by attaching a BRT tag containing a 3-11 amino acid sequence in front. Thereafter, the protein was purified using commercially available GST-resin and subjected to SDS-PAGE gel running, followed by Western blot. As a result, it was confirmed that the BRT tag attached to the N-terminus of the GST protein expressed in E. coli was well detected without the nonspecific binding using the 2B8 antibody (FIG. 5). When compared with a comparative example using a Myc tag which is a commonly used tag, it can be seen that the BRT tag of the present invention has almost the same level of effect.

Expression of BRT Tag (3-11) in Tobacco

In order to confirm normal expression in the plant (tobacco) of the fusion protein containing the BRT tag including the 3-11 amino acid sequence, and to detect whether or not detectable using 2B8 monoclonal antibody, it is a commonly used protein tag Green Fluorescence Protein (GFP) tagged proteins were expressed by attaching a BRT tag containing a 3-11 amino acid sequence. Thereafter, LBA4404 Agrobacterium cells were used to express transient expression in tobacco plants. For the experimental method, refer to the paper method of Imogen et al (NATURE PROTOCOL, 2006, Vol. 1, NO.4, 2019-2025). As a result, it was confirmed that the BRT tag attached to the N-terminus of the GFP protein was well detected without the nonspecific binding using the 2B8 antibody regardless of leaf growth (FIG. 6). When compared with a comparative example using a Myc tag which is a commonly used tag, it can be seen that the BRT tag of the present invention has almost the same level of effect.

<110> University-Industry Cooperation Group of Kyung Hee University          Myongji University Industry and Academia Cooperation Foundation <120> Novel peptide tag and uses <130> PA110706 / KR <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 9 <212> PRT 213 Deinococcus radiodurans BphP 3-11 a.a. <400> 1 Arg Asp Pro Leu Pro Phe Phe Pro Pro   1 5 <210> 2 <211> 27 <212> DNA <213> Nucleotides for Deinococcus radiodurans BphP 3-11 a.a. <400> 2 gagccgggac ccgttgccct tttttcc 27 <210> 3 <211> 10 <212> PRT 213 Deinococcus radiodurans BphP 3-12 a.a. <400> 3 Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu   1 5 10 <210> 4 <211> 2268 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP <400> 4 atgagccggg acccgttgcc cttttttcca ccgctttacc ttggtggccc ggaaattacc 60 gccgattc ctgctcactg ccgacgggca cagcggcgag gtgctccaga tgagcctcaa cgcggccact 180 tttctgggac aggaacccac agtgctgcgc ggacagaccacc tcgccgcact gctgcccgag 240 cagtggcccg cgctgcaagc ggccctgccc cccggctgcc ccgacgccct gcaataccgc 300 gcaacgctgg actggcctgc cgccgggcac ctttcgctga cggtgcaccg ggtcggcgag 360 ttgctgattc tggaattcga gccgacggag gcctgggaca gcaccgggcc gcacgcgctg 420 cgcaacgcga tgttcgcgct cgaaagtgcc cccaacctgc gggcgctggc cgaggtggcg 480 acccagacgg tccgcgagct gacgggcttt gaccgggtga tgctctacaa atttgccccc 540 gacgccaccg gcgaagtgat tgccgaggcc cgccgtgagg ggctgcacgc ctttctgggc 600 caccgttttc ccgcgtcgga cattccggcg caggcccgcg cgctctacac ccggcacctg 660 ctgcgcctga ccgccgacac ccgcgccgcc gccgtgccgc tcgatcccgt cctcaacccg 720 cagacgaatg cgcccacccc gctgggcggc gccgtgctgc gcgccacctc gcccatgcac 780 atgcagtacc tgcggaacat gggcgtcggg tcgagcctgt cggtgtcggt ggtggtcggc 840 ggccagctct ggggcctgat cgcctgccac caccagacgc cctacgtgtt gccgcccgac 900 ctgcgaacca cgctcgaata cctgggccgc ttgctgagcc tgcaagttca ggtcaaggaa 960 gcggcggacg tggcggcctt tcgccagagc ctgcgggagc accacgcgcg ggtggccctc 1020 gcggcggcgc actcgctctc gccgcacgac accctcagtg acccggcgct tgacctgctg 1080 ggcctgatgc gggccggggg cctgattctg cgtttcgagg gccgctggca gacgttgggt 1140 gaagtgccgc ctgccccggc ggtggacgcg ctgctggcgt ggctcgaaac ccagccgggc 1200 gccctggtcc agaccgacgc gctgggccaa ctgtggcccg ccggcgccga tctcgccccc 1260 agcgcagcgg gcctgctcgc catcagcgtg ggcgagggct ggtcggagtg cctcgtctgg 1320 ctgcggcccg aactgcggct ggaggtcgcc tggggcgggg ccactcctga ccaggcgaaa 1380 gacgacctcg ggccgcgcca ctcattcgac acctacctcg aagaaaaacg cggctacgcc 1440 gagccctggc atcccggcga aatcgaggag gcgcaggatc tacgtgacac attgaccggg 1500 gcgctgggcg agcgcctgag cgtgattcgt gacctcaacc gggcgctcac acagtcgaac 1560 gccgagtggc ggcagtacgg cttcgttatc agccaccaca tgcaggagcc ggtgcggctc 1620 atctcgcagt tcgccgagtt gctgacgcgc cagccccgcg cccaggacgg gtctccggac 1680 tctccgcaga ccgagcgcat caccggcttt ctgctgcgcg aaacgtcgcg cctgcgcagc 1740 ctgacgcaag acctccacac ctacaccgcg ctgctctcgg caccgccgcc ggtgcgccgc 1800 cccacgccgc tgggccgcgt ggtggacgat gtgctgcaag acctcgaacc ccgcattgcc 1860 gacaccggag cgagcatcga ggtggcgccc gagttgcccg tcatcgctgc cgacgctggc 1920 ctgctgcgcg acctgctgct gcatctgatc ggcaacgcgc tgacgtttgg tggcccggag 1980 ccgcgtattg ccgtaaggac cgaacggcaa ggcgcgggtt ggtctatcgc ggtcagtgac 2040 cagggcgctg gcatcgcgcc cgagtatcag gaacgaatct ttctgctgtt tcagcggctc 2100 ggttcgctcg atgaggcgct gggcaacggc ctgggcctgc cgctgtgccg caagatcgcc 2160 gaactgcatg gcggcaccct gaccgtggag tccgcgccag gcgagggcag caccttccgt 2220 tgctggctgc ccgatgctgg gcctcttccg ggagccgccg atgcctga 2268 <210> 5 <211> 755 <212> PRT <213> Deinococcus radiodurans BphP <400> 5 Met Ser Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu Tyr Leu Gly Gly   1 5 10 15 Pro Glu Ile Thr Thr Glu Asn Cys Glu Arg Glu Pro Ile His Ile Pro              20 25 30 Gly Ser Ile Gln Pro His Gly Ala Leu Leu Thr Ala Asp Gly His Ser          35 40 45 Gly Glu Val Leu Gln Met Ser Leu Asn Ala Ala Thr Phe Leu Gly Gln      50 55 60 Glu Pro Thr Val Leu Arg Gly Gln Thr Leu Ala Leu Leu Pro Glu  65 70 75 80 Gln Trp Pro Ala Leu Gln Ala Ala Leu Pro Pro Gly Cys Pro Asp Ala                  85 90 95 Leu Gln Tyr Arg Ala Thr Leu Asp Trp Pro Ala Ala Gly His Leu Ser             100 105 110 Leu Thr Val His Arg Val Gly Glu Leu Leu Ile Leu Glu Phe Glu Pro         115 120 125 Thr Glu Ala Trp Asp Ser Thr Gly Pro His Ala Leu Arg Asn Ala Met     130 135 140 Phe Ala Leu Glu Ser Ala Pro Asn Leu Arg Ala Leu Ala Glu Val Ala 145 150 155 160 Thr Gln Thr Val Arg Glu Leu Thr Gly Phe Asp Arg Val Met Leu Tyr                 165 170 175 Lys Phe Ala Pro Asp Ala Thr Gly Glu Val Ile Ala Glu Ala Arg Arg             180 185 190 Glu Gly Leu His Ala Phe Leu Gly His Arg Phe Pro Ala Ser Asp Ile         195 200 205 Pro Ala Gln Ala Arg Ala Leu Tyr Thr Arg His Leu Leu Arg Leu Thr     210 215 220 Ala Asp Thr Arg Ala Ala Val Pro Leu Asp Pro Val Leu Asn Pro 225 230 235 240 Gln Thr Asn Ala Pro Thr Pro Leu Gly Gly Ala Val Leu Arg Ala Thr                 245 250 255 Ser Pro Met His Met Gln Tyr Leu Arg Asn Met Gly Val Gly Ser Ser             260 265 270 Leu Ser Val Ser Val Val Val Gly Gly Gln Leu Trp Gly Leu Ile Ala         275 280 285 Cys His His Gln Thr Pro Tyr Val Leu Pro Pro Asp Leu Arg Thr Thr     290 295 300 Leu Glu Tyr Leu Gly Arg Leu Leu Ser Leu Gln Val Gln Val Lys Glu 305 310 315 320 Ala Ala Asp Val Ala Ala Phe Arg Gln Ser Leu Arg Glu His His Ala                 325 330 335 Arg Val Ala Leu Ala Ala Ala His Ser Leu Ser Pro His Asp Thr Leu             340 345 350 Ser Asp Pro Ala Leu Asp Leu Leu Gly Leu Met Arg Ala Gly Gly Leu         355 360 365 Ile Leu Arg Phe Glu Gly Arg Trp Gln Thr Leu Gly Glu Val Pro Pro     370 375 380 Ala Pro Ala Val Asp Ala Leu Ala Trp Leu Glu Thr Gln Pro Gly 385 390 395 400 Ala Leu Val Gln Thr Asp Ala Leu Gly Gln Leu Trp Pro Ala Gly Ala                 405 410 415 Asp Leu Ala Pro Ser Ala Gly Leu Leu Ala Ile Ser Val Gly Glu             420 425 430 Gly Trp Ser Glu Cys Leu Val Trp Leu Arg Pro Glu Leu Arg Leu Glu         435 440 445 Val Ala Trp Gly Gly Ala Thr Pro Asp Gln Ala Lys Asp Asp Leu Gly     450 455 460 Pro Arg His Ser Phe Asp Thr Tyr Leu Glu Glu Lys Arg Gly Tyr Ala 465 470 475 480 Glu Pro Trp His Pro Gly Glu Ile Glu Glu Ala Gln Asp Leu Arg Asp                 485 490 495 Thr Leu Thr Gly Ala Leu Gly Glu Arg Leu Ser Val Ile Arg Asp Leu             500 505 510 Asn Arg Ala Leu Thr Gln Ser Asn Ala Glu Trp Arg Gln Tyr Gly Phe         515 520 525 Val Ile Ser His Met Gln Glu Pro Val Arg Leu Ile Ser Gln Phe     530 535 540 Ala Glu Leu Leu Thr Arg Gln Pro Arg Ala Gln Asp Gly Ser Pro Asp 545 550 555 560 Ser Pro Gln Thr Glu Arg Ile Thr Gly Phe Leu Leu Arg Glu Thr Ser                 565 570 575 Arg Leu Arg Ser Leu Thr Gln Asp Leu His Thr Tyr Thr Ala Leu Leu             580 585 590 Ser Ala Pro Pro Val Arg Arg Pro Thr Pro Leu Gly Arg Val Val         595 600 605 Asp Asp Val Leu Gln Asp Leu Glu Pro Arg Ile Ala Asp Thr Gly Ala     610 615 620 Ser Ile Glu Val Ala Pro Glu Leu Pro Val Ile Ala Ala Asp Ala Gly 625 630 635 640 Leu Leu Arg Asp Leu Leu Leu His Leu Ile Gly Asn Ala Leu Thr Phe                 645 650 655 Gly Gly Pro Glu Pro Arg Ile Ala Val Arg Thr Glu Arg Gln Gly Ala             660 665 670 Gly Trp Ser Ile Ala Val Ser Asp Gln Gly Ala Gly Ile Ala Pro Glu         675 680 685 Tyr Gln Glu Arg Ile Phe Leu Leu Phe Gln Arg Leu Gly Ser Leu Asp     690 695 700 Glu Ala Leu Gly Asn Gly Leu Gly Leu Pro Leu Cys Arg Lys Ile Ala 705 710 715 720 Glu Leu His Gly Gly Thr Leu Thr Val Glu Ser Ala Pro Gly Glu Gly                 725 730 735 Ser Thr Phe Arg Cys Trp Leu Pro Asp Ala Gly Pro Leu Pro Gly Ala             740 745 750 Ala Asp Ala         755 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer for BphP <400> 6 gccatatgat gagccgggac ccgttgccc 29 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer for BphP <400> 7 gcctcgagtc aggcatcggc ggctcccgg 29 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer for BphN <400> 8 gccatatgat gagccgggac ccgttgccc 29 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer for BphN <400> 9 gcctcgagcg cttccttgac ctgaacttg 29

Claims (18)

delete Peptide tag consisting of the amino acid sequence of SEQ ID NO: 1. Peptide tag consisting of the amino acid sequence of SEQ ID NO: 3. A polynucleotide encoding the peptide tag of any one of claims 2 and 3. The polynucleotide of claim 4, wherein the polynucleotide is included in an expression vector. A fusion protein comprising the peptide tag of any one of claims 2 and 3. A polynucleotide encoding the fusion protein of claim 6. The polynucleotide of claim 7, wherein the polynucleotide is included in an expression vector. The transformant transformed E. coli with the polynucleotide of claim 7. (i) culturing a transformant transformed to E. coli with a polynucleotide encoding a fusion protein comprising the peptide tag of any one of claims 2 and 3 to obtain a culture; And
(ii) recovering the fusion protein from the culture. Contacting the fusion protein to which the peptide tag of claim 2 and the target polypeptide are linked to an antibody that specifically binds to the peptide tag; And
A fusion protein purification method comprising the step of recovering the fusion protein bound to the antibody. The method of claim 11, wherein the method uses immunoaffinity chromatography. Contacting the fusion protein to which the peptide tag of claim 2 and the target polypeptide are linked to an antibody that specifically binds to the peptide tag; And
A fusion protein detection method comprising the step of quantitatively analyzing the amount of fusion protein bound to the antibody. The method of claim 13, wherein the method uses Western blot, Enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, immunofluorescence, immunocytochemistry or protein micro array. A kit for detecting or purifying a polypeptide of interest using the peptide tag of any one of claims 2 and 3 and an antibody that specifically binds to the peptide tag,
The peptide tag of any one of claims 2 and 3 or a polynucleotide encoding the peptide tag; An antibody that specifically binds to the peptide tag; And a kit comprising documentation. The kit of claim 15, wherein the kit is for linking the peptide tag to a desired polypeptide to prepare a fusion protein. The kit of claim 15, wherein said antibody is in a form immobilized on a support. The kit of claim 15, wherein the antibody is a hybridoma cell line that produces the antibody.

Images