KR20150002563A - Antibody for epitope tagging and hybridoma cell line - Google Patents

Abstract

The present invention relates to: peptide tags derived through Bacteriophytochrome (BphP) which is a light accepting protein of Deinococcus radiodurans; an antibody capable of specifically recognizing the peptide tags or a hybridoma cell line capable of producing the same; a polynucleotide coding the peptide tags or a vector or transformant including the same; and a fused protein including the peptide tags or a method for producing, detecting, and refining the same. The novel peptide tags according to the present invention have short length but can completely remove a nonspecific reaction which existing c-myc tags and FLAG tags have. Moreover, when the novel peptide tags according to the present invention and an antibody for the same are used, a fused protein expressed in a recombinant cell can be very effectively detected or refined. Accordingly, an epitope tagging system including the novel peptide tags according to the present invention and the antibody for the same can be applied to various fields such as protein position confirmation in a cell, functionality investigation, detection, refinement, and protein interaction studies.

Description

Antibody for epitope tagging and hybridoma cell line}

The present invention relates to a novel peptide tag that can be used in an epitope tagging system for detection or purification of a protein of interest, an antibody therefor, and a use thereof, and in more detail, a light-receiving protein of Deinococcus radiodurans It relates to a peptide tag derived from phosphorus bacteriophytochrome (BphP), an antibody capable of specifically recognizing the peptide tags, or a hybridoma cell line capable of producing the same. In addition, the present invention relates to a polynucleotide encoding the peptide tag, a vector or transformant comprising the same, a fusion protein comprising the peptide tag, and a method or kit for preparing, detecting or purifying the fusion protein. .

Useful proteins or polypeptides can be produced synthetically or isolated from natural sources. However, this method has disadvantages in that it is uneconomical in terms of cost and time, and the amount of production is limited. Therefore, it is preferable to produce a target protein and a target polypeptide through cultivation of a transformant produced by recombinantly to overexpress the target protein or the target polypeptide. However, however, polypeptides (especially short polypeptides) produced in the cellular environment may be sensitive to degradation due to the action of proteases present in the cell, and antibodies to all the proteins of interest are not present. It may not be easy to purify a protein of interest in which the antibody is not present.

Protein tagging or epitope tagging has been used to overcome this problem. In protein tagging or epitope tagging, a recombinant nucleic acid molecule in which the coding sequence of the epitope tag is linked to the coding sequence of the target protein is produced, expressed in a suitable host cell, and then an antibody against the epitope tag is used. It is a recombinant DNA method used to detect, quantify, and purify a target protein, or to identify the location of a target protein in a cell, or to determine its functionality. Commercially, there are numerous epitope tags and antibodies that are ligands for them.Western blot analysis, immunoprecipitation, immunofluorescence, immune cells when selecting an appropriate epitope tag and an antibody against it Since the target protein can be detected or purified by immunocytochemistry or immunoaffinity purification, it is possible to eliminate the need to generate antibodies against the target protein.

Currently, epitope tags used for protein tagging or epitope tagging include short peptide tags (e.g., 6×His tags) of about 6 amino acid residues to large proteins such as 40 kDa (e.g., MBP). Many unique tags are available (see Stevens, RC, (2000) Structure Fold Des 8:R177-85) and peptide tags consisting of 3 to 30 amino acids are typically used. The His-tagged protein is specifically trapped on a Ni-NTA (nickel-nitrilotriacetic acid) resin, which can be eluted by EDTA or imidazole. In addition, maltose-binding protein (MBP, 396 amino acids, 40 kDa), Staphylococcus protein A, calmodulin-binding peptide (CBP, 26 amino acids, 2.96 kDa), GFP (238 amino acids, 27 kDa) And glutathione-S-transferase (GST, 211 amino acids, 26 kDa) can also be used for both prokaryotic and eukaryotic proteins. In addition, epitope tags that are most commonly used include c-myc tags, HA tags, and FLAG tags. The c-myc tag is a 10 amino acid long epitope tag derived from human c-myc protein (Evans et al., (1985) Mol. Cell. Biol., 12: 3610-3616), and the HA tag is influenza hemaggluti Nin (influenza hemagglutinin) is a 9 amino acid long epitope tag derived from the HA-1 protein (Field et al., (1988) Mol. Cell. Biol., 8: 2159-2165). The FLAG tag is an 8 amino acid long epitope tag derived from bacteriophage T7 (Hopp et al., (1988) Bio/Technology, 6: 1204-1210).

On the other hand, the epitope tag used for epitope tagging is desirable to have minimal influence on the three-dimensional structure and biological activity of the target protein when fused with the target protein. In general, a long epitope tag (for example, a GST tag or MBP tag) has problems such as altering the function of the target protein. On the other hand, epitope tags that are relatively short in length, such as FLAG tags, c-myc tags, etc., have little effect on the properties of the target protein fused with them, and can be very specifically bound to antibodies against them, In some cases, it is currently mainly used because it does not need to be removed from the fusion protein. However, the amino acid sequence of the c-myc tag and the FLAG tag induces a non-specific reaction of the antibody that recognizes the tag because many proteins in the cells of organisms known to date contain the same sequence, and such a non-specific antibody reaction has a specific purpose. There is a problem in that it interferes with the separation and identification of proteins, thereby reducing the reliability of the experiment (Ksenija Gasic et al., (2005) Plant molecular biology reporter 23:9-16). In order to overcome this non-specific reaction problem, an affinity purification system has been developed in which two different tags are successively fused to the N-terminus of a protein (Rigaut, G., et al. (1999) Nat Biotechnol 17:1030). -2).

Therefore, a novel peptide tag having a short amino acid sequence and a paired with it, while removing a non-specific reaction that is a problem in a conventional epitope tag and an epitope tagging system using an antibody therefor, are detected, and a fusion protein expressed in a recombinant host cell is detected. And there is a need to develop antibodies that can be used for purification.

An object of the present invention is to provide a novel peptide tag useful for detection or purification of a protein of interest, a use thereof, and the like.

In addition, another object of the present invention is to provide a novel antibody capable of specifically recognizing a novel epitope tag or selectively binding to a new epitope tag, and a use thereof.

The inventors of the present invention were conducting research to develop a peptide tag useful for detection or purification of a protein of interest and an antibody therefor, while bacteriophytochrome, a light-receiving protein of Deinococcus radiodurans, a heterotrophic sedative bacterium. (Bacteriophytochrome, BphP) or a fragment thereof is used as an immunogen to obtain a hybridoma producing a monoclonal antibody, and the produced antibody is used to target Bacteriophytochrome (BphP) of Deinococcus radiodurans. The present invention was completed by finding a peptide tag having 8 to 9 amino acids by performing epitope mapping.

In order to solve the above object, the present invention provides an antibody against a peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide tag consisting of the amino acid sequence of SEQ ID NO: 2.

In addition, the present invention provides a hybridoma cell line that produces antibodies against a peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide tag consisting of the amino acid sequence of SEQ ID NO: 2.

In addition, the present invention provides a kit comprising the above peptide tag or hybridoma cell line.

The novel peptide tag according to the present invention has the advantage of being able to completely eliminate non-specific reactions of conventional c-myc tags and FLAG tags while having a short length. In addition, when the novel peptide tag according to the present invention and an antibody therefor are used, the fusion protein expressed in the recombinant cell can be detected or purified very efficiently. Accordingly, the novel peptide tag according to the present invention and an epitope tagging system including an antibody therefor can be applied to various fields such as identification of the intracellular location of a specific protein, functional identification, detection, purification, and interaction studies between proteins.

1 is a diagram showing the results of purifying DrBphP and DrBphN using His tag column chromatography. Figure 1 (A) is a schematic diagram showing a gene construct used to express the BphP protein and BphN protein of Deinococcus radiodurans (Deinococcus radiodurans). FL, full length (1-755 amino acids, BphP); ΔPHY/HKD (1-321 amino acids, BphN); (B) of FIG. 1 shows that BphP apoprotein and BphN apoprotein of Deinococcus radiodurans ^{were purified using Ni +} -NTA affinity chromatography, incubated with BV for 20 minutes, and then SDS-PAGE was performed. And, the result of detecting BV binding by zinc-induced fluorescence (right) and the result of staining with Coomassie Blue (left) are shown. 1: crude BphP extract, 2: purified BphP, 3: crude BphN extract, 4: purified BphN. Purification conditions-binding & washing: pH 8.0, 100 mM Tris, 200 mM NaCl, 10 mM imidazole/Elution: pH 8.0, 100 mM Tris, 200 mM NaCl, 150 mM imidazole
2 is a diagram showing the results of Western blot analysis of selected monoclonal antibodies using purified BphP and BphN. SDS-PAGE was performed on the purified BphP and BphN, and Western blot was performed using the purified monoclonal antibodies of Bphp (2B8, 2C11, 3B2, 3D2, 3H7). P; BphP, N; BphN. Of the monoclonal antibodies, it was confirmed by Western blot that the 2B8 antibody recognizes the epitope present at the N-terminus of the BphP protein.
FIG. 3 shows the results of confirming whether Oat PhyA, an oat phytochrome protein having a PCD structure constituting the N-terminal region, similar to DrBphP reacts with five monoclonal antibodies of BphP.
FIG. 4 shows the results of primary epitope mapping for 2B8 antibody through Western blot, and FIG. 5 shows the results of secondary epitope mapping for 2B8 antibody through Western blot. In FIGS. 4 and 5, "a-GST" represents an anti-GST antibody.
6 is a Western blot result showing that the fusion protein with the BRT tag attached to the N-terminus of the GST protein is normally expressed on E. coli and the fusion protein can be detected by the 2B8 antibody. In FIG. 5, "a-myc" represents an anti-myc antibody, and "a-GST" represents an anti-GST antibody.
7 is a Western blot result showing that the fusion protein with the BRT tag attached to the N-terminus of GFP is normally expressed in plant cells and the fusion protein can be detected by the 2B8 antibody. In FIG. 7 "Myc" represents an anti-myc antibody.

One aspect of the present invention relates to a novel peptide tag that can be used for epitope tagging for purification or detection of a protein of interest. The novel peptide tag according to the present invention consists of a peptide comprising the amino acid sequence of SEQ ID NO: 1 or a peptide comprising the amino acid sequence of SEQ ID NO: 2. In the specification of the present invention, the peptide tag may be used interchangeably with a protein tag or an epitope tag. In the present invention, the term "peptide tag" refers to a peptide that can be used as a tag by being fused to a protein of interest. In addition, in the present invention, the term "epitope" refers to an antigen-binding site recognized by a specific antibody or a certain portion of an antigen that reacts with B cells or T cells. In the present invention, when the peptide tag includes the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, the length is not limited, and, for example, 8 to 30 when considering the number of amino acid residues of commonly used epitope tags. It is preferably a peptide having four amino acid residues, and more preferably a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide consisting of the amino acid sequence of SEQ ID NO: 2. The peptide consisting of the amino acid sequence of SEQ ID NO: 1 or the peptide consisting of the amino acid sequence of SEQ ID NO: 2 is derived from Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. Specifically, the peptide consisting of the amino acid sequence of SEQ ID NO: 1 is based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 3) of bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. It is a peptide consisting of amino acid residues corresponding to positions 3 to 11. In addition, the peptide consisting of the amino acid sequence of SEQ ID NO: 2 is based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 3) of bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. It is a peptide consisting of amino acid residues in which one phenylalanine, which is an amino acid residue corresponding to the 8th position or the 9th position, has been deleted from the amino acid residues corresponding to the 3rd to 11th positions.

The peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or the peptide tag consisting of the amino acid sequence of SEQ ID NO: 2 according to the present invention is a hybridoma cell line using a bacteriophytochrome of Deinococcus radiodurans as an immunogen. Was selected, and after obtaining an antibody purified from the hybridoma cell line, it was determined by performing epitope mapping using the antibody. Hereinafter, the bacteriophytochrome of Deinococcus radiodurans is denoted as "DrBphP". Deinococcus radiodurance is a type of extreme microorganism that can grow in cryogenic, dry, low oxygen, and strong acid environments. Phytochrome is a light-receiving protein that can absorb external light signals and transmit signals to the lower part.In the existing theory, it was known to exist only in higher plants, but recently, it is found in cyanobacteria, proteobacteria, actinobacteria, and fungi. Several phytochrome-like photoreceptors have been discovered. In particular, among them, the phytochrome-like photoreceptors found in Deinococcus radiodurance and Pseudomonas aeruginosa were named BphP, of which DrBphP consists of 755 amino acids represented by the amino acid sequence of SEQ ID NO: 3 [Davis SJ, et al., (1999) Science 286, 2517-2520]. BphP is composed of an N-terminal structure similar to plant phytochrome, but a histidine kinase domain (HKD) different from plant phytochrome exists in the C-terminal region [Karniol R, et al., (2005) Photosynth Res 392, 103-116; Giraud E et al., (2008) Photosynth Res 97, 141-153]. And DrBphP combines with biliverdin (BV) without the help of other factors to form a reversible Pr/Pfr isoform [Vierstra RD et al., (2000) Semin Cell Dev Biol 11, 511-521 ; Bhoo SH, et al., (2001) Nature 414, 776-779; Rockwell NC, et al., (2006) Annu Rev Plant Biol 57, 837-858].

Hereinafter, the steps of epitope mapping for determining a novel peptide tag according to the present invention will be described in detail. First, a polypeptide consisting of a gene (SEQ ID NO: 4) corresponding to the full length of BphP of Deinococcus radiodurans and an amino acid at positions 1 to 321 based on the N-terminus of DrBphP (hereinafter referred to as BphN) The corresponding gene (SEQ ID NO: 5) was constructed (see (A) of Fig. 1), inserted into the pET28a(+) vector, and then expressed using BL21 competent cells. ^{Then, protein purification was performed by Ni +} -NTA affinity chromatography (QIAGEN) using the His tag included in the pET28a(+) vector. Since the expressed BphP protein (SEQ ID NO: 3) and BphN protein (SEQ ID NO: 6) contain all of the PAS and GAF domains and Cys-24 residues that play an important role in the binding of BV, binding to BV by itself This is possible. Therefore, in order to confirm the expression and purification of BphP and BphN proteins, BV was added to the purified BphP and BphN proteins and incubated at room temperature for 10 minutes, followed by SDS-PAGE, followed by coomassie staining and zinc blot. As a result, it was possible to confirm the expression and purification of the BphP protein and the BphN protein (see (B) of FIG. 1). Next, in order to prepare a monoclonal antibody against BphP, the BphP protein or BphN protein of Deinococcus radiodurans was mixed with Complete Freund's adjuvant as an antigen in the abdominal cavity of a 6-week-old female BALB/c mouse. After intraperitoneal injection, mice were sacrificed to obtain B lymphocytes. After that, B lymphocytes and myeloma cells were mixed, and the cells were fused and cultured. Thereafter, the HAT medium and HT medium were changed to confirm the generation of antibodies in the fused cells by ELISA, and a total of 24 rear clones of hybridoma cell lines were selected. A fusion plate ELISA test was performed with BphP protein and BphN protein injected as antigens for a total of 24 candidate hybridoma cell line clones to confirm the degree of binding (Table 3). As a result, the 2B8 clone and the 2C11 clone were presumed to recognize the N-terminal region of the BphP protein, as both BphP protein and BphN protein of Deinococcus radiodurans exhibited high color development. However, the 3B2 clone and the 3D2 clone showed high levels in the BphP protein and close to 0 in the BphN protein, so it was estimated that they recognized the C-terminal region of the BphP protein. Unlike these, the 3H7 clone showed high levels in the BphP protein and some low levels in the BphN protein, so it was estimated that the N-terminal region was recognized to some extent in addition to the C-terminus of the BphP protein. Thereafter, the 5 hybridoma cell line clones were subjected to a first cloning plate ELISA test and a second cloning plate ELISA test, and finally ascites were generated to purify the antibody. As a result, 5 monoclonal antibodies, 2B8 antibody, 2C11 antibody, 3B2 antibody, 3D2 antibody, and 3H7 antibody were obtained. Next, Western blot was performed to check whether the purified antibodies showed the same results for the previously expressed and purified BphP protein and BphN protein. For the purified BphP protein and 5 μg of BphN protein, each monoclonal antibody was used as a primary antibody in a ratio of 1:1000 to 2% skim milk, and then a HRP-mouse antibody (SIGMA) was used as a secondary antibody of 1:10000. Western blot was performed by processing at the rate. As a result, the 2B8 antibody and the 2C11 antibody bound to both the BphP protein and the BphN protein as a result of the ELISA test for the hybridoma cell line clone (FIG. 2 ). Therefore, both antibodies could be considered to bind to the N-terminal region of BphP. In addition, as the 3B2 antibody and the 3D2 antibody showed a band for the BphP protein, but no band for the BphN protein, it was possible to obtain a result that the 3B2 antibody and the 3D2 antibody would bind to the C-terminal region of the BphP protein. However, in the case of the 3H7 antibody, it was found that only the BphP protein was recognized, unlike the result in the ELISA test. In addition, as for the degree of binding of each antibody, the 2B8 antibody and the 2C11 antibody, which bind to the N-terminal region, were the most strongly bound, and the 3D2 antibody, which is thought to recognize the C-terminal region, showed a weaker recognition band. Next, a band that strongly binds in the order of 3H7 antibody and 3B2 antibody appeared. On the other hand, DrBphP has a structure similar to that of plant phytochrome.In particular, since both PCDs constituting the N-terminal region have very similar structures including PAS, GAF, and PHY domains, the antibodies are oat phytochrome proteins. I checked whether it reacts with. However, all five monoclonal antibodies against the BphP protein of Deinococcus radiodurans did not bind to the oat phytochrome protein (Oat PhyA) (FIG. 3). Therefore, the monoclonal antibodies against the BphP protein of Deinococcus radiodurans were confirmed to be new BphP-specific antibodies that recognize an epitope different from existing antibodies against Oat phytochrome protein. By isolating the recognized epitope, it was found that it can be used as a specific peptide tag that is not included in any protein of known organisms. Specifically, in order to identify the epitope of the 2B8 antibody that binds most strongly among the monoclonal antibodies against the BphP protein of Deinococcus radiodurans, a recombinant partial peptide of DrBphP was prepared, and epitope mapping was performed. I did. Specifically, of the entire amino acid sequence of DrBphP (SEQ ID NO: 3), the amino acid sequence at position 3-12, the amino acid sequence at position 3-11 (SEQ ID NO: 1), the amino acid sequence at position 3-10, 4- Peptide fragments containing the amino acid sequence at position 12 were each prepared, and the presence or absence of binding was confirmed through Western blot. As a result, it was confirmed that the 2B8 antibody correctly recognized and bound only 9 amino acids (SEQ ID NO: 1) corresponding to positions 3-11 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 3) of DrBphP. . From this, it was confirmed that the epitope of the 2B8 antibody was a peptide having the amino acid sequence of SEQ ID NO: 1, and it was confirmed that it can be used as a peptide tag. In addition, peptide fragments each containing an amino acid sequence in which one amino acid residue was deleted from the amino acid sequence of SEQ ID NO: 1 was prepared, and epitope mapping was performed using the 2B8 antibody. As a result, it was confirmed that another epitope of the 2B8 antibody was a peptide having the amino acid sequence of SEQ ID NO: 2.

In addition, the peptide tag of the present invention may be provided in a form combined with other known epitope tags in order to secure various functions in addition to the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. For example, the peptide tag of the present invention is a HA tag, FLAG tag, His tag, BCCP (biotin) in the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 in order to improve the detection ability, purification ability, and solubility of the target protein. Carboxyl carrier protein) or MBP (maltose binding protein) may be provided in the form of a combined double tag (see U.S. Patent Publication No.20050221308, U.S. Patent Publication No.20060099710, U.S. Patent Publication No.6462254). In addition, the peptide tag of the present invention is a triple tag or multiple tags in which two or more tags selected from HA tag, 6×His tag, c-myc tag, and V5 tag are bound to the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 It may be provided in the form of a tag (see US Patent Publication No. 20100184612). In addition, the peptide tag of the present invention may be provided in a form in which the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 is repeated, such as a 3×FLAG tag, or in a form in which some amino acid residues in the repeated amino acid sequence are substituted and deleted. (See US Patent Publication No. 7135624).

When the peptide tag according to the present invention includes the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, an antibody corresponding thereto can be used. For example, as an antibody against a peptide tag comprising the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, there is the aforementioned 2B8 antibody. On the other hand, in the peptide tag according to the present invention, the amino acid sequence of SEQ ID NO: 1 or some amino acids constituting the amino acid sequence of SEQ ID NO: 2 are individually substituted, deleted, added or modified, while at the same time, the binding activity to the 2B8 antibody is at a predetermined level, for example. For example, it may include a variant and the like having at least 75% or more based on the original binding activity. The amino acid substitution is preferably made by conservative amino acid replacement, which does not change the properties of the peptide. In addition, modification of the amino acid may be performed by glycosylation, acetylation, phosphorylation, or the like. In addition, the peptide tag according to the present invention may include a labeled amino acid. In addition, the peptide tag according to the present invention may include a peptide having increased structural stability against heat, pH, or the like or increased activity against an antibody due to a mutation or modification on an amino acid sequence. Table 1 below shows amino acids that can be substituted for amino acids in peptides by conservative amino acid substitutions.

Amino acid residues in peptides Conservative substituent Ala Ser Arg Lys Asn Gln, His Asp Glu Gln Asn Cys Ser Glu Asp Gly Pro His Asn, Gln Ile Leu, Val Leu Ile, Val Lys Arg, Gln Met Leu, Ile Phe Met, Leu, Tyr Ser Thr, Gly Thr Ser, Val Trp Tyr Tyr Trp, Phe Val Ile, Leu

Another aspect of the present invention relates to a polynucleotide encoding the novel peptide tag described above and a recombinant vector comprising the polynucleotide. In the present invention, the term "polynucleotide" refers to all non-modified or modified polyribonucleotides (RNA) or polydeoxyribonucleotides (DNA). The polynucleotide may be single- or double-stranded DNA, DNA as a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA as a mixture of single- and double-stranded regions, single- or double-stranded, Or hybrid molecules comprising DNA and RNA, which may be a mixture of single- and double-stranded regions. In addition, the polynucleotide of the present invention includes a primer used to synthesize the above-described novel peptide tag as single-stranded RNA or DNA. In addition, the polynucleotide of the present invention can be used interchangeably with a nucleic acid molecule or an oligonucleotide.

The polynucleotide encoding the peptide may or may not contain an untranslated sequence (eg, intron) (eg, cDNA). The information to which the peptide is encoded is specified using codons. Typically, amino acid sequences are encoded by polynucleotides using the Universal Genetic Code. “Codon” refers to a triplet of nucleotides that determine the amino acid sequence in a polypeptide chain. Most organisms use 20 or 21 amino acids to make proteins or their polypeptides, which are protein precursors. Since there are 4 possible nucleotides in DNA: adenine (A), guanine (G), cytosine (C) and thymine (T), there are 20 amino acids and 64 possible triplets that can encode terminal signals. Due to this redundancy, most amino acids are encoded by more than one triplet. Accordingly, it is possible to allow changes in the nucleotide sequence without affecting the amino acid sequence of the encoded polypeptide, which is referred to as "silent mutation" due to "codon degeneracy". All silent variations of the polynucleotides encoding the novel peptide tags of the present invention are within the scope of the present invention. On the other hand, codons specifying a single amino acid cannot be used at the same frequency, and each organism often exhibits a specific "codon-bias" for one of several codons encoding the same given amino acid. When the coding region contains a large number of rare codons or clusters of rare codons, the expression level can be increased by removing the rare codons using gene resynthesis or mutagenesis. [J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001), at 15.12]. Thus, “codon selection” can be used to optimize expression in a selected host. The most preferred codons are those found primarily in highly expressed genes. “Codon preference” in E.coli is described in Konigsberg, et al., Proc. Nat'l. Acad. Sci. U.S.A. See 80:687-91 (1983).

When preparing by chemically synthesizing a nucleotide sequence, a synthetic method well known in the art, for example, a method described in Engels and Uhlmann, Angew Chem IntEd Engl., 37:73-127, 1988, can be used. , Tryester, phosphite, phosphoramidite and H-phosphate methods, PCR and other autoprimer methods, and oligonucleotide synthesis methods on a solid support.

Therefore, the polynucleotide encoding the novel peptide tag of the present invention may be composed of various nucleotide sequences, for example, the polynucleotide encoding the peptide tag composed of the amino acid sequence of SEQ ID NO: 1 is preferably the base of SEQ ID NO: 7 The polynucleotide encoding the peptide tag consisting of the amino acid sequence of SEQ ID NO: 2 may be composed of a sequence, and preferably may be composed of the nucleotide sequence of SEQ ID NO: 8.

In addition, the present invention provides a recombinant vector comprising a polynucleotide encoding a novel peptide tag. For example, the recombinant vector according to the present invention may include a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8. The recombinant vector may be provided in the form of inserting a polynucleotide encoding a novel peptide tag into a cloning vector or an expression vector using a known standard method. It can be provided in the form of a recombinant vector. In the present invention, the term "vector" refers to any medium for cloning and/or transfer of a base into a host cell. The vector may be a replicon capable of binding other DNA fragments to bring about replication of the bound fragment. "Replication unit" refers to any genetic unit (eg, plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, that is, can replicate by its own regulation. . The term “vector” includes viral and non-viral mediators for introducing a base into a host cell in vitro, ex vivo or in vivo. The term “vector” may also include minispherical DNA. For example, the vector may be a plasmid that does not have a bacterial DNA sequence. Removal of the abundant bacterial DNA sequence in the CpG region is being done to reduce transgene expression silencing and result in more sustained expression from plasmid DNA vectors. The term “vector” may also include transposons such as Sleeping Beauty (Izsvak et al. J. MoI. Biol. 302:93-102 (2000)), or artificial chromosomes. In the present invention, the term "cloning vector" is defined as a material capable of carrying and reproducing a DNA fragment into a host cell. In the present invention, the cloning vector may further include a polyadenylation signal, a transcription termination sequence, and a multiple cloning site. In this case, the multiple cloning site includes at least one endonuclease restriction enzyme restriction site. In addition, the cloning vector may further include a promoter. For example, in the present invention, the polynucleotide encoding the novel peptide tag may be located upstream of a polyadenylation signal and a transcription termination sequence, and at least one endonuclease (endonuclease) Restriction sites may be located upstream of a polyadenylation signal and a transcription termination sequence. In addition, in the present invention, the term "expression vector" is defined as a DNA sequence necessary for transcription and translation of the cloned DNA in an appropriate host. In addition, the term "expression vector" in the present invention refers to a genetic construct comprising essential regulatory elements operably linked to the insert so that the insert is expressed when it is present in the cells of an individual. The expression vector can be prepared and purified using standard recombinant DNA techniques. The type of expression vector is not particularly limited as long as it has a function of expressing a desired gene in various host cells of prokaryotic and eukaryotic cells and producing a desired protein, but it is in a natural state while retaining a promoter exhibiting strong activity and strong expression power. A vector capable of mass-producing a foreign protein in a form similar to the one is preferred. It is preferable that the expression vector contains at least a promoter, a start codon, a gene encoding a desired protein, and a stop codon terminator. In addition, DNA encoding a signal peptide, additional expression control sequences, untranslated regions on the 5'and 3'sides of a desired gene, a selection marker region, or a replicable unit may be appropriately included. “Promoter” means a minimal sequence sufficient to direct transcription. In addition, promoter constructs sufficient to express cell type-specific or regulated promoter-dependent genes induced by external signals or agents may be included, and these constructs may be located in the 5'or 3'portion of the gene. . Both conservative and inducible promoters are included. The promoter sequence can be derived from prokaryote, eukaryote or virus. The term “operably linked” means that a function of one is regulated by another by association of a polynucleotide sequence on a single polynucleotide. For example, if the promoter is capable of controlling the expression of the coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter), the promoter is linked to the coding sequence and operated, or the ribosome binding site can facilitate translation. If located, the ribosome binding site is operated by linking to the coding sequence. The coding sequence can be operated by linking to a regulatory sequence in the sense or antisense direction. The expression vector according to the present invention is a preferred example of a polynucleotide encoding a novel peptide tag, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8, and a target polynucleotide encoding a protein of interest. Includes.

Another aspect of the invention relates to a fusion protein comprising the novel peptide tag described above. In the present invention, the term "fusion protein" refers to a polymer in which two or more peptides, oligopeptides, polypeptides or proteins having different functions are linked to each other. In the present invention, the fusion protein may be used interchangeably with a fusion polypeptide, a fusion oligopeptide, a recombinant polypeptide, a recombinant oligopeptide, or a recombinant protein. The first portion of the fusion protein according to the present invention includes at least one of the novel peptide tags described above, and the second portion of the fusion protein includes at least one of the target protein. In the present invention, the protein of interest may be used interchangeably with the peptide of interest, oligopeptide of interest, or polypeptide of interest. The fusion protein in which the novel peptide tag according to the present invention is linked to the codon region of the protein of interest can be efficiently detected or purified using an antibody against the novel peptide tag. The peptide tag according to the present invention may be inserted anywhere inside the protein as long as it does not substantially affect the C-terminus of the target protein, as well as the N-terminus or the function of the protein. Here, the fact that it does not substantially affect the functionality of the protein means that the activity of the protein is maintained at least 80%, preferably at least 95%, before the peptide tag is fused. Any protein may be used as the protein of interest used in the present invention, for example, single-chain FV (ScFv), thrombopoietin (TPO), B of the humanized antibody AKA/HzK against TAG-72, which is a cancer-related antigen. -Lymphocyte stimulator (B-lymphocyte stimulator) can be exemplified. The fusion protein according to the present invention includes a combination of two or more peptides, for example a combination of a peptide tag and a protein of interest, and the two or more peptides may be linked by covalent bonds or non-covalent bonds. At this time, the peptide tag and the target protein may be directly linked to each other without any mediator, or may be indirectly linked by a mediator such as a peptide linker. In a preferred embodiment, the fusion protein may be designed such that the desired protein can be recovered from the fusion protein by chemically and/or enzymatically cleaving the cleavable linker thereafter, including at least one cleavable peptide linker. Thus, the fusion protein according to the present invention may preferably be designed to contain one or more tags, a cleavable peptide linker and a protein of interest. Linkers generally have no specific biological activity other than associating proteins or maintaining a minimum spacing or other spatial relationship between these proteins, but the constituent amino acids of a peptide linker are not subject to the properties of the molecule, such as folding, net charge, or hydrophobicity. It can be chosen to have some influence. The peptide linker may optionally contain a site for separation of the fused constituent polypeptide, for example a site that can be cleaved by a protease. The cleavable peptide linker may be 1 to about 50 amino acids in length, preferably 1 to about 20 amino acids in length. As an example of a peptide linker cleavable by an enzyme, it may comprise a caspase-3 cleavage sequence, and may comprise an acid cleavable aspartic acid-proline dipeptide (D-P) moiety. Cleavable peptide linkers can be incorporated into fusion proteins using a number of techniques well known in the art. In addition, a flexible peptide linker may be used, and a peptide linker having a GGSGGT amino acid sequence, a GGGGS amino acid sequence, and a GGGGSGGGGS amino acid sequence may be used, but is not limited thereto. The peptide linker operably connects the polynucleotide containing the peptide linker in frame between polynucleotides encoding each peptide of the fusion protein, and can be expressed through an expression vector.

Means for preparing peptides (peptide tags, cleavable peptide linkers, peptides of interest, and/or fusion peptides) in the present invention are well known in the art (for example, Stewart et al., Solid Phase Peptide Synthesis, Pierce Chemical Co., Rockford, IL, 1984]; [Bodanszky, Principles of Peptide Synthesis, Springer-Verlag, New York, 1984]; And [Pennington et al., Peptide Synthesis Protocols, Humana Press, Totowa, NJ, 1994] Reference). The various components of the fusion peptides described herein (tag peptide, peptide of interest, and cleavable linker etc./cleavage sequence) can be prepared by known chemical synthesis methods (see, eg, Hermanson, Greg T. , Bioconjugate Techniques, Academic Press, New York (1996)), chemical synthesis is often limited to peptides less than about 50 amino acids in length due to cost and/or impurities. The peptides described herein can preferably be prepared using standard recombinant DNA and molecular cloning techniques. [Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Silhavy, TJ, et al., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Cold Press Spring Harbor, NY (1984); And in Ausubel, FM et. al., Short Protocols in Molecular Biology, 5th Ed. Current Protocols and John Wiley and Sons, Inc., NY, 2002]

Another aspect of the present invention relates to a transformant comprising the above-described expression vector. In the present invention, the term "transformant" refers to a cell transformed by introducing an expression vector having a polynucleotide encoding one or more proteins of interest into a host cell. Methods for preparing transformants by introducing the expression vector into host cells include transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection ( liposemmediated transfection), DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation, electroinjection, PEG, etc. There is a chemical treatment method, a method using a gene gun, etc., but is not limited thereto. When the transformant expressing the expression vector is cultured in a nutrient medium, a fusion protein can be produced in large quantities and can be separated. The medium and culture conditions can be appropriately selected and used according to the host cell. During cultivation, conditions such as temperature, pH of the medium, and culture time should be appropriately adjusted to suit the growth of cells and mass production of proteins. Host cells that can be transformed with the expression vector according to the present invention are not greatly limited, as long as they are known in the art, such as prokaryotic cells, plant cells, insect cells, and animal cells, and preferably the DNA introduction efficiency is A host having high and high expression efficiency of the introduced DNA is usually used. For example, known prokaryotic hosts such as Escherichia, Pseudomonas, Bacillus, and Streptomyces may be used as host cells, and E. coli may be used preferably. Expression of the protein by the host cell can be induced by using isopropyl-1-thio-β-D-galactopyranoside (IPTG), which is an inducing factor, and the induction time can be adjusted to maximize the amount of protein. The protein produced recombinantly in the present invention can be recovered from a medium or cell lysate. In the case of membrane bound type, it can be released from the membrane using a suitable surfactant solution (eg Triton-X 100) or by enzymatic cleavage. Cells used for protein expression can be destroyed by various physical or chemical means such as freeze-thaw repetition, sonication, mechanical destruction, or cytolysis, and can be separated or purified by conventional biochemical separation techniques (Sambrook et al., Molecular Cloning: A laborarory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989; Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 182. Academic Press. Inc., San Diego, CA, 1990). For example, methods of separating or purifying proteins expressed by host cells include electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion exchange chromatography, affinity chromatography, immunosorbent affinity chromatography, reverse phase HPLC). , Gel permeation HPLC), isoelectric focus and various variations or complex methods thereof. Meanwhile, the fusion protein comprising the peptide tag according to the present invention may be separated and purified using immunosorbent affinity chromatography using an antibody against the peptide tag.

Another aspect of the present invention relates to an antibody against the above-described novel peptide tag and a hybridoma cell line capable of producing the same. The antibody according to the present invention is an antibody capable of specifically recognizing or specifically or selectively binding to a peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide tag consisting of the amino acid sequence of SEQ ID NO: 2. In the present invention, the term "antibody" refers to a substance produced by stimulation of a specific antigen in the immune system, and can specifically bind to the specific antigen to induce an antigen-antibody reaction, and not only the natural form produced by the immune system , And functional fragments of antibody molecules having an activity equivalent to that of the natural form. The natural type of antibody is generally a structure having two light chains and two heavy chains, and each light chain is connected to a heavy chain by a disulfide bond. The functional fragment of an antibody molecule refers to a fragment having an antigen-binding function, and includes Fab, F(ab'), F(ab')2, Fv, and the like. Among antibody fragments, Fab has a structure having a light chain and a heavy chain variable region, a light chain constant region, and a heavy chain first constant region (CH1), and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region containing at least one cysteine residue at the C-terminus of the heavy chain CH1 domain. F(ab')2 is generated when the cysteine residue of the hinge region of Fab' forms a disulfide bond. Fv is the smallest antibody fragment having only the variable region of the heavy chain and the variable region of the light chain, and the recombinant technology for generating the Fv fragment is disclosed in International Patent Publications WO 88/10649, WO 88/106630, WO 88/07085, WO 88/07086 and WO 88. /09344. The double-chain Fv (dsFv) is a disulfide bond to connect the heavy chain variable region and the light chain variable region, and the single chain Fv (scFv) is generally covalently linked to the heavy chain variable region and the light chain variable region through a peptide linker. . Such antibody fragments can be obtained using proteolytic enzymes (e.g., restriction cleavage of the entire antibody with papain can yield Fab, and cleavage with pepsin yields F(ab')2 fragments), preferably It can be produced through genetic recombination technology. For the purposes of the present invention, the antibody may be an antibody capable of specifically binding to the peptide tag of the present invention, preferably in the form of a Fab or a whole antibody, more preferably in the form of a monoclonal antibody. . In addition, the present invention provides a hybridoma cell line capable of producing a monoclonal antibody against the novel peptide tag described above. The hybridoma cell line was deposited with the Korea Research Institute of Bioscience and Biotechnology Life Resource Center (KCTC) on September 24, 2012, and the accession number is KCTC 12283BP.

A monoclonal antibody having specific binding to the peptide tag of the present invention can be prepared by using the peptide tag or a polypeptide containing the same as an immunogen. More specifically, first, as an immunogen, the peptide tag is injected subcutaneously, intramuscularly, intravenously, or intraperitoneally in mammals other than humans once or more to sensitize the immune system. At this time, the peptide tag is used in a mixed form with Freund adjutant, if necessary. The mammals other than humans are preferably mice, rats, hamsters, molemots, rabbits, cats, dogs, pigs, goats, sheep, donkeys, horses or cattle (such as transgenic mice producing human antibodies. (Including transgenic animals engineered to produce antibodies derived from other animals), and more preferably, mice, rats, hamsters, molemots or rabbits. Immunization is performed 1 to 4 times every about 1 to 21 days from the first immunization, and cells producing antibodies from immune-sensitized mammals can be obtained about 1 to 10 days after the final immunization. The number of times and time intervals for immunization can be appropriately changed depending on the characteristics of the immunogen to be used. Preparation of a hybridoma secreting a monoclonal antibody can be carried out according to a method such as Keira and Mirstein (Nature, 1975, Vol. 256, p. 495-497) and a method similar thereto. Any one selected from the group consisting of the spleen, lymph nodes, bone marrow, or tonsils collected from animals other than humans that have been immune-sensitized as described above, preferably derived from a mammal without the ability to produce antibodies and antibodies contained in the spleen. Hybridoma cells can be produced by fusion of myeloma cells of As myeloma cells used for the cell fusion, mouse-derived myeloma P3/X63-AG8. 653(653), P3/NSI/1-Ag4-1(NS-1), P3/X63-Ag8. U1 (P3U1), SP2/0-Ag14 (Sp2/O, Sp2), PAI, F0 or BW5147; Rat-derived myeloma 210 RCY3-Ag. 2.3; Alternatively, human myeloma U-266 AR1, GM1500-6TG-A1-2, UC729-6, CEM-AGR, D1R11 or CEM-T15 can be used. For cell fusion, for example, a method using a fusion promoter including polyethylene glycol or Sendai virus or an electric pulse is used. For example, antibody-producing cells and cells of mammalian origin capable of infinite proliferation in a fusion medium containing a fusion promoter. Is suspended in a ratio of about 1:1 to 1:10, and incubated for about 1 to 5 minutes at about 30 to 40°C in this state. As the fusion medium, for example, MEM medium, RPMI1640 medium, and Iscove's Modified Dulbecco's Medium may be used as usual, and it is preferable to exclude sera such as bovine serum. In the method of screening for hybridoma cell clones producing monoclonal antibodies, the obtained fusion cells are transferred to a selection medium such as HAT medium, and cultured at about 30 to 40° C. for about 3 days to 3 weeks to prevent hybridoma cells. Kills its cells. Subsequently, after culturing hybridoma cells on a microtiter plate, etc., the reactivity between the immunogen used for the immune response of animals other than humans and the culture supernatant described above was determined by using a radioactive substance-marked immuno antibody (RIA) or It is confirmed through an immunoassay method such as ELISA (Enzyme-Linked Immunosorbent Assay), and hybridoma cells with increased reactivity are found. Hybridoma cell clones producing the monoclonal antibodies found above show specific binding power to the immunogen. The monoclonal antibody of the present invention can be obtained by culturing a hybridoma cell line in vitro or in vitro. In the cultivation, a conventional method for culturing mammalian-derived cells is used, and in order to collect a monoclonal antibody from a culture or the like, a conventional method in this field for purifying the general antibody is used. As a method for purifying the antibody, for example, salting out, dialysis, filtration, concentration, centrifugation, fractional precipitation, gel filtration chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography, Gel electrophoresis, isoelectric point electrophoresis, and the like, and these are applied in combination as necessary. The purified monoclonal antibody is then concentrated, dried, and stored in a liquid or solid state depending on the intended use. In addition, the monoclonal antibody of the present invention includes DNA encoding heavy and light chain variable regions, respectively, known DNA encoding heavy and light chain constant regions (for example, Japanese Laid-Open Patent Publication No. 2007-252372) and Each ligated gene was synthesized by PCR or chemical synthesis, and the synthesized gene was introduced into a known expression vector (for example, pcDNA 3.1 (available from Invitrogen)), and then a transformant was prepared using the expression vector. , Transformed CHO cells or host cells such as E. coli can be cultured and expressed. From such a culture medium, the expressed antibody can be obtained by purifying the expressed antibody using a Protein A column or the like.

Another aspect of the present invention relates to the use of the novel peptide tag described above, a polynucleotide encoding the peptide tag, or an antibody against the peptide tag.

For example, an example of the present invention provides a method of preparing the fusion protein described above. A method for producing a fusion protein according to an embodiment of the present invention includes the step of culturing a transformant into which a polynucleotide encoding the fusion protein is introduced to express the fusion protein. At this time, the polynucleotide encoding the fusion protein is preferably introduced into the transformant in a form contained in a recombinant vector. In addition, the method for producing a fusion protein according to the present invention may further include the step of recovering the expressed fusion protein. In addition, the recombinant vector includes a polynucleotide encoding a peptide tag and a target polynucleotide encoding a target protein linked thereto, wherein the two polynucleotides preferably include a site that can be cleaved by a proteolytic enzyme or the like. It is connected by the coding sequence of a peptide linker.

In addition, an example of the present invention provides a method for detecting the above-described fusion protein. A method for detecting a fusion protein according to an embodiment of the present invention includes the steps of contacting and binding a peptide tag and a fusion protein to which a target protein is linked to an antibody against the peptide tag; And confirming the presence or analyzing the amount of the fusion protein bound to the antibody. At this time, the method for detecting a fusion protein according to an embodiment of the present invention is specifically Western blot, ELISA (Enzyme-linked immunosorbent assay), immunoprecipitation, immunofluorescence, immunocytochemistry, or protein micro Arrays or the like can be used. In this case, the protein microarray can be used for analysis of large-scale samples by immobilizing a specific antibody against the peptide tag of the present invention on a glass or silicone substrate.

In addition, an example of the present invention provides a method for purifying the above-described fusion protein. A method for purifying a fusion protein according to an embodiment of the present invention includes the steps of contacting and binding a peptide tag and a fusion protein to which a target protein is linked to an antibody against the peptide tag; And recovering the fusion protein bound to the antibody. At this time, the antibody is immobilized on a support, preferably a solid support. Examples of the support for immobilizing the antibody include columns, beads, adsorbents, nitrocellulose paper, and the like, and the antibody may be immobilized on the support through various known immobilization methods. A specific example of a method for purifying a fusion protein according to the present invention includes contacting a sample containing a tagged protein with a support to which an antibody is immobilized, and the tagged protein is a protein covalently linked to a peptide tag. And the peptide tag has a specific binding activity for the antibody, and the contacting is made under conditions in which the antibody binds to the peptide tag, and includes removing unbound components and separating the tagged protein from the support. I can. In this case, the support and the antibody immobilized thereon are used as a medium for immuno-affinity chromatography, and immuno-affinity column chromatography may be performed using a column packed with the medium. A fusion protein purified with high purity can be obtained by the purification method of the present invention, and further, it does not affect the function of the target protein at all.

In addition, an example of the present invention provides a kit for expression, detection or purification of a fusion protein. The kit for expression, detection or purification of a fusion protein according to the present invention includes the above-described novel peptide tag, a polynucleotide encoding the peptide tag, a primer pair for synthesizing the polynucleotide, a recombinant vector containing a polynucleotide, and the polynucleotide. It includes any one selected from a transformant transformed with a nucleotide or a recombinant vector. In addition, the kit for expression, detection or purification of a fusion protein according to the present invention may include any one selected from an antibody against the above-described novel peptide tag or a hybridoma cell line that produces the antibody. In addition, the kit for expression of a fusion protein according to the present invention preferably comprises a recombinant vector comprising a polynucleotide encoding the novel peptide tag of the present invention, and the kit for detection or purification of a fusion protein according to the present invention is preferably It includes antibodies against the novel peptides of the present invention. At this time, the recombinant vector constituting the kit is preferably provided in a form in which a user can produce an expression vector containing a polynucleotide encoding a fusion protein. The fusion protein is a polypeptide to which a peptide tag and a protein of interest are linked. In addition, it is preferable that the antibody constituting the kit is provided in a form immobilized on an appropriate support. In addition, it is preferable that the fusion protein detection kit further includes a means capable of detecting an antibody against the peptide tag. At this time, the means capable of detecting the antibody of the present invention is preferably a secondary antibody. In addition, the antibody or secondary antibody of the present invention constituting the kit for detecting the fusion protein may be preferably labeled with a labeling material such as an enzyme, a radioactive material, or a fluorescent material, and the labeling method is preferably conjugation. . In addition, the kit for purifying the fusion protein may further include a proteolytic enzyme for separating the peptide tag. In addition, the kit according to the present invention may further include instructions, restriction enzymes, ligase, and buffer solutions.

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are only intended to clearly illustrate the present invention, and do not limit the scope of the present invention.

Example 1: Cloning of BphP gene and BphN gene of Deinococcus radiodurans

Deinococcus radiodurans (Deinococcus radiodurans) bacteriophytochrome protein (BphP) gene encoding the entire length (SEQ ID NO: 4) and a polypeptide (BphN) consisting of amino acids at positions 1 to 321 based on the N-terminus of DrBphP The encoding gene (SEQ ID NO: 5) was cloned using PCR. Specifically, the gene (SEQ ID NO: 4) encoding the entire length of Deinococcus radiodurans bacteriophytochrome protein (BphP) is used as a template, and a primer for cloning the BphP gene or a primer for cloning the BphN gene, and PCR was performed around 30 cycles using Ex-Taq (TAKARA) polymerase, and amplified BphP DNA products and BphN DNA products were obtained. Table 2 below shows the primers used to obtain the amplified BphP DNA product and the BphN DNA product. The primers shown in Table 2 below and all primers described below were produced by requesting Bioneer co., KR.

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 9 Forward primer for BphP cloning GCCATATGATGAGCCGGGACCCGTTGCCC Nde I 10 Reverse primer for BphP cloning GCCTCGAGTCAGGCATCGGCGGCTCCCGG Xho I 11 Forward primer for BphN cloning GCCATATGATGAGCCGGGACCCGTTGCCC Nde I 12 Reverse primer for BphN cloning GCCTCGAGCGCTTCCTTGACCTGAACTTG Xho I

The amplified PCR product was run on a 1% agarose gel (QA-Agarose gel TM, Q-BIO, CAT#AGAH0250), and the size of the amplified DNA was checked through an ultraviolet irradiator. After that, only the band on the gel corresponding to the DNA amplification product is cut out, and only the desired DNA is separated using a gel elution kit (FavorPrep GEL/PCR purification mini kit, FAVORGEN, CAT#FAGCK001-1), and then Easy T-vector (promega) Was bound to, and commissioned to Bioneer co., KR to measure the nucleotide sequence. As a result, it was confirmed that the DNA product generated through PCR had the desired target nucleotide sequences, BphP DNA and BphN DNA.

Thereafter, the BphP DNA product and BphN DNA product amplified using restriction enzymes Nde I and Xho I were inserted into pET28a(+) vector (manufacturer: Novagen), respectively, and BL21 competent cells (manufacturer: RBC, Taipei, etc.) Taiwan) was transformed by applying heat shock at 42° C. for 1 minute, and cultured on LB medium containing kanamycin to express BphP protein and BphN protein.

Example 2 : Daynocaucus Of Deinococcus radiodurans BphP Protein and BphN Protein expression

Colonies transformed into BL21 competent cells and grown on LB medium were inoculated into LB medium containing kanamycin, and seed cultured at 37° C. for about 8 hours or more. The seeded cells were inoculated into LB medium containing kanamycin, grown _{to a concentration until the value at OD 600} became 0.6, IPTG was added so that the total concentration was 0.5 mM, and protein expression was maintained at 25°C for 6 hours. Induced. Thereafter, the cells were centrifuged to discard the supernatant, and the pellet was resuspended in binding buffer (100mM Tris-Cl, 150mM NaCl, and 10mM imidazole, pH 8.0). Next, the pellet was resuspended to break the cells, centrifuged again to separate only the supernatant, and then the protein was purified using a ^{Ni + -NTA column (QIAGEN).} After that, the purified protein was stored at -70°C.

Since the BphP protein and the BphN protein contain all of the PAS and GAF domains and Cys-24 residues, which play an important role in the binding of BV, it is possible to bind to BV by itself. To obtain the holo-BphP protein, biliverdin (BV, 2 μg/ml, Frontier, Scientific, Carnforth, UK) was added to the purified Apo-BphP protein and Apo-BphN protein, and reacted at room temperature for 10 minutes. Subsequently, SDS-PAGE was performed on the reaction samples, and then reacted with zinc acetate solution (20 mM zinc acetate, 150 mM Tris-Cl, pH 7.0) for 20 minutes, and then the fluorescent signal of the protein was observed under UV. In addition, SDS-PAGE was performed on the reaction samples, followed by coomassie staining. The left of FIG. 1B shows the result of coomassie staining, and the right of FIG. 1B shows the result of zinc blot. As shown in (B) of FIG. 1, it was confirmed that the expression and purification of the BphP protein and the BphN protein were smoothly performed.

Example 3: Daynocaucus Of Deinococcus radiodurans BphP Protein and BphN Preparation of monoclonal antibody specifically binding to protein

3-1: Immunization

Purified BphP protein or BphN protein was used as an antigen, complete Freund's adjuvant was mixed therein, and then injected into the abdominal cavity of a 6-week-old female BALB/c mouse. Immersion was mixed for 1 hour with a vortexer, and then Incomplete Freund's adjuvant and antigen were mixed in the same manner and injected intraperitoneally. After 2 weeks, blood was collected from the tail of the mouse and used for cell fusion if the titer of the antibody was 1/1000 to 1.0 or higher after ELISA test. At 4 weeks from the secondary immunization treatment for cell fusion, the same amount of antigen was diluted in PBS and injected intraperitoneally. After 3 days, the mice were sacrificed to allow cell fusion.

3-2: Cell fusion for monoclonal antibody production

As a cell source for B lymphocytes, after abdominal incision, fat or other organs were separated as much as possible and the spleen was aseptically removed to prevent excessive bleeding, homogenized with a cell strainer, diluted with a basic medium, and washed by repeating centrifugation twice. B lymphocytes and myeloma cells are mixed at an appropriate ratio, centrifuged for 5 minutes to discard the supernatant, shake the remaining cell mixture lightly, add 10 ml of pre-warmed RBC lysis buffer, suspend, and incubate at 37°C for 20 minutes. FBS was added and centrifuged. Cell fusion was performed as follows. First, a PEG (polyethlyene glycerol) 1500 solution was slowly added to the centrifuged cell mixture while maintaining at 37°C, and the reaction was stopped by adding a basic medium again. Thereafter, the supernatant was discarded by rapid centrifugation, and the remaining cell mixture was carefully suspended in a macrophage medium, dispensed on a 96 well tissue culture plate, and cultured in a carbon dioxide incubator under conditions of 37°C.

3-3: Selection of fusion cells

Five days after the cell fusion was carried out, HAT medium, which is a selective medium for fusion cells, was added to each well. Thereafter, HAT medium was added in the same manner at intervals of 3 days, and after 11 days of cell fusion, the complete medium was replaced with HT medium supplemented with HT supplement, and the degree of growth of the fused cells was observed under a microscope every day. Take the supernatant of the well with the growth confirmed and confirm antibody production by ELISA, and once the fusion cell line that is determined to secrete the desired antibody is performed 1st, 2nd, and 3rd cloning with a limiting dilution method, the fusion cell population is one cell line. Was made to be a clone derived from.

3-4: Selection of fusion cells by ELISA

After cell fusion for the production of monoclonal antibodies and immunity to the immunized antigen, an antigen protein solution diluted with an ELISA coating buffer was added to a 96 well tissue culture plate for selection of fusion cells and reacted at 4°C. Then, the antigen protein solution was sucked and removed, a blocking solution was added to the remaining surface of each well, and reacted at 37° C. for 1 hour. After that, the blocking solution was removed and washed three times with PBST solution. The fusion cell culture supernatant was added to each well and reacted at 37°C, and the solution was removed and washed three times with PBST solution. Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG) was diluted in PBS to each well. OPD (orthophenylenediammine dihydrochloride) substrate solution was added to the well and reacted at room temperature for 10 minutes, and the reaction was stopped with a stop solution. At this time, the absorbance was measured at 492 nm with an ELISA reader in order to confirm the degree of reaction and color development, and a total of 24 candidate hybridoma cell line clones were selected based on the measured results.

3-5: Reconfirmation of binding degree with antigen and purification of antibody through Fusion plate ELISA test

A fusion plate ELISA test was performed with BphP protein and BphN protein injected as antigens for a total of 24 candidate hybridoma cell line clones to confirm the degree of binding, and the results are shown in Table 3 below. As shown in Table 3 below, the 2B8 clone and the 2C11 clone were presumed to recognize the N-terminal region of the BphP protein, as both BphP protein and BphN protein of Deinococcus radiodurans exhibited high color development. . However, the 3B2 clone and the 3D2 clone showed high levels in the BphP protein and close to zero in the BphN protein, so it was estimated that they recognized the C-terminal region of the BphP protein. Unlike these, the 3H7 clone showed a high level in the BphP protein and a certain low level in the BphN protein, so it was estimated that the N-terminal region was recognized to some extent in addition to the C-terminal side of the BphP protein.

Hybridoma cell line clone Degree of binding to antigenic protein (absorbance at 492 nm) BphN BphP(full) 1B6 0.0660 1.3190 1B11 0.1560 2.3700 1D6 0.0550 2.3180 2B8 2.3400 2.4200 2 C11 2.3480 2.4040 2D9 0.1430 2.2730 2E3 2.1720 1.8020 2F7 0.1220 2.4430 2H8 0.0650 1.3440 3A4 1.9180 2.3770 3B2 0.0980 2.2900 3B3 0.0700 2.1650 3C11 1.9730 2.2590 3 D2 0.0640 2.2830 3D10 0.1180 2.4280 3D11 1.6850 2.3130 3F10 0.0730 2.3570 3G2 0.0880 2.0510 3G9 0.0800 1.5580 3H1 1.7840 2.0950 3 H7 0.4640 2.3490 4B7 1.9730 2.2620 4E2 0.2050 2.3770 4E3 0.0550 2.2650

Thereafter, the 5 hybridoma cell line clones were subjected to a first cloning plate ELISA test and a second cloning plate ELISA test, and finally ascites were generated to purify the antibody. As a result, 5 monoclonal antibodies, 2B8 antibody, 2C11 antibody, 3B2 antibody, 3D2 antibody, and 3H7 antibody were obtained. The antibody was purified by the following method. After intraperitoneal injection of 0.5 ml of pristane into BALB/c mice of 8 weeks or more, hybridoma cells were cultured 1 to 10 days later, washed 3 times with PBS, and PBS to ^{a concentration of 5×10 6} cells/0.5 ml. After diluted with, it was injected into the abdominal cavity using a syringe. After 1 week to 10 days, ascites were observed to fill, and ascites were collected using a serum separation tube while sacrificing the mouse by cervical dislocation, making a small hole in the abdomen, and taking care not to flow ascites. It was allowed to stand at room temperature for about 1 hour and centrifuged to remove RBC. After adding an appropriate amount of PBS to the collected ascites, it was slowly mixed with ammonium sulfate at 4°C. After centrifugation at 4° C., it was passed through a filter. After adding an appropriate amount of beads mixed with Protein A and DFMF, the Tris buffer solution was washed with 10 times the volume of the bed. When the antibody was added and well mixed with protein A/G, a fraction was obtained, washed with Tris buffer, and then elution was performed several times with glycine. The thus-purified antibody was placed in a dialysis bag, dialyzed in PBS buffer for 3 hours, replaced with PBS buffer, dialyzed overnight, and the antibody after dialysis was quantified and stored.

Example 4: Analysis of the specificity of monoclonal antibodies

Western blot was performed to check whether the obtained antibodies showed the same results for the previously expressed and purified BphP protein and BphN protein. Each monoclonal antibody with a concentration of 1 mg/ml as a primary antibody against the purified BphP protein and 5 μg of BphN protein was used in a ratio of 1:1000 for 2% skim milk, and then HRP-mouse antibody as a secondary antibody ( SIGMA) was treated at a ratio of 1:10000 to perform Western blot. As a result, the 2B8 antibody and the 2C11 antibody bound to both the BphP protein and the BphN protein as a result of the ELISA test for the hybridoma cell line clone (FIG. 2). Therefore, both antibodies could be considered to bind to the N-terminal region of BphP. In addition, as the 3B2 antibody and the 3D2 antibody showed a band for the BphP protein, but no band for the BphN protein, it was possible to obtain a result that the 3B2 antibody and the 3D2 antibody would bind to the C-terminal region of the BphP protein. However, in the case of the 3H7 antibody, it was found that only the BphP protein was recognized, unlike the result in the ELISA test. In addition, as for the degree of binding of each antibody, the 2B8 antibody and the 2C11 antibody that bind to the N-terminal region were the most strongly bound, and the 3D2 antibody, which is thought to recognize the C-terminal region, showed a weaker recognition band. Next, a band that strongly binds in the order of 3H7 antibody and 3B2 antibody appeared.

On the other hand, DrBphP has a structure similar to that of plant phytochrome.In particular, since both PCDs constituting the N-terminal region have very similar structures including PAS, GAF, and PHY domains, the antibodies are oat phytochrome proteins. I checked whether it reacts with. However, all five monoclonal antibodies against the BphP protein of Deinococcus radiodurans did not bind to the oat phytochrome protein (Oat PhyA) (FIG. 3). Therefore, it was confirmed that the monoclonal antibodies against the BphP protein of Deinococcus radiodurans are new BphP-specific antibodies that recognize an epitope different from the existing antibodies against the Oat phytochrome protein.

As of September 24, 2012, the present inventors developed the hybridoma cell line 2B8 of the 2B8 antibody, which is the most strongly bound among monoclonal antibodies against the BphP protein of Deinococcus radiodurans. ), and the accession number of the hybridoma cell line 2B8 is KCTC 12283BP. Then, the isotype of the 2B8 antibody was determined by ELISA using a mouse antibody. The heavy chain isotype of the 2B8 antibody was IgG 2a, and the light chain isotype was κ(kappa).

Example 5: 2B8 monoclonal antibody Epitope For confirmation Epitope Mapping

5-1: primary epitope mapping

In order to identify the epitope of the 2B8 antibody that binds most strongly among the monoclonal antibodies against the BphP protein of Deinococcus radiodurans, a DrBphP recombinant partial peptide was prepared, and epitope mapping was performed.

First, DNA encoding the amino acid sequence (SEQ ID NO: 13) at positions 3-12 (SEQ ID NO: 13) based on the N-terminal of the entire amino acid sequence (SEQ ID NO: 3) of DrBphP, encoding the amino acid sequence at positions 3-11 (SEQ ID NO: 1) In order to clone the DNA, the DNA encoding the amino acid sequence at positions 3-10, and the DNA encoding the amino acid sequence at positions 4-12, primers were prepared for each. PCR was performed around 30 cycles using the prepared primer and PrimeSTAR HS (TAKARA, R040) polymerase, and an amplified DNA product was obtained. The PCR reaction for DNA cloning does not require a separate template, and a template for amplification can be obtained by combining a forward primer and a reverse primer during one cycle of PCR. Table 4 below shows the primers used in PCR to obtain DNA amplification products encoding the four DrBphP recombinant partial peptides.

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 14 BphP 3-12 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 15 BphP 3-12 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA AAGCGGTGGAAAAAAGGGCAA EcoR I 16 BphP 3-11 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 17 BphP 3-11 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA CGGTGGAAAAAAGGGCAACGG EcoR I 18 BphP 3-10 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 19 BphP 3-10 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA TGGAAAAAAGGGCAACGGGTC EcoR I 20 BphP 4-12 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG GACCCGTTGCCCTTTTTTCCA BamH I 21 BphP 4-12 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA AAGCGGTGGAAAAAAGGGCAA EcoR I

The amplified PCR product was run on a 1% agarose gel (QA-Agarose gel TM, Q-BIO, CAT#AGAH0250), and the size of the amplified DNA was checked through an ultraviolet irradiator. After that, only the band on the gel corresponding to the DNA amplification product was cut out, and only the desired DNA was separated using a gel elution kit (FavorPrep GEL/PCR purification mini kit, FAVORGEN, CAT#FAGCK001-1), and then pJET (CloneJET PCR cloning kit, Fermentas, #K1232) was ligated to the vector. Thereafter, 30 to 50 µl of DH5 α competent cells (manufacturer: Invitrogen) were added to about 10 to 20 µl of binding vector, incubated on ice for 20 minutes, and then heat shocked at 42°C for 1 minute. shock), recovered on ice for another 20 minutes, spread on an LB medium plate containing ampicillin, and cultured overnight at 37°C to incubate. Thereafter, when colonies grow, inoculate in LB medium containing ampicillin and culture at 37°C overnight to grow cells, and then plasmids using a plasmid extraction kit (FavorPrep Plasmid Extraction kit, FAVORGEN, cat#FAPDE300). Extracted. Thereafter, the extracted plasmid was entrusted to Bioneer co., KR to measure the base sequence. As a result, it was confirmed that the DNA product generated through PCR had the desired target nucleotide sequence.

In addition, after digesting the plasmid and pGEX4T1 vector ((GE Healthcare, Piscataway, NJ, USA) extracted using restriction enzymes BamH Ⅰ and EcoR Ⅰ, the N-terminus of the total amino acid sequence (SEQ ID NO: 3) of the target DNA DrBphP DNA encoding the amino acid sequence at positions 3-12 (SEQ ID NO: 13), DNA encoding the amino acid sequence at positions 3-11 (SEQ ID NO: 1), DNA encoding the amino acid sequence at positions 3-10, 4 DNA encoding the amino acid sequence at position -12 was ligated to the pGEX4T1 vector, which is a protein expression vector, followed by a pGEX4T1 vector containing the target DNA, which is an E. coli BL21 competent cell (manufacturer: RBC, Taipei, Taiwan) Was transformed, and cultured on LB medium containing ampicillin to induce protein expression After that, the cultured cells were crushed using sonication, and only the supernatant obtained by centrifugation was separated, and then GST resin (Glutathion Sepharose). ™ High Performance, GE Healthcare) was used to purify the protein. Western blot was performed on the purified protein and the BphP protein of Deinococcus radiodurans. At this time, 2B8 monoclonal antibody and anti-GST antibody were used as the primary antibody, and Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG; Sigma) was used as the secondary antibody. In addition, Amersham™ ECL™ is used to develop samples transferred to cellulose membranes after SDS-PGAE. Western Blotting Detection Reagents (GE Healthcare, RPN2106OL/AF) were used. Figure 4 shows the results of the primary epitope mapping for the 2B8 antibody through Western blot. As shown in Figure 4, the epitope of the 2B8 antibody is 9 amino acids (SEQ ID NO: 1) corresponding to positions 3-11 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 3), which can be used as a peptide tag. It was confirmed that it can be. In addition, the peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 was named "BRT tag".

5-2: Secondary epitope mapping

Through the primary epitope mapping, it was confirmed that the BRT tag consisting of the amino acid sequence of SEQ ID NO: 1 is an epitope of the 2B8 antibody. The present inventors performed secondary epitope mapping to determine whether the 2B8 antibody recognizes the DrBphP modified partial peptide, which is a peptide in which one amino acid is deleted from the amino acid sequence of SEQ ID NO: 1 constituting the BRT tag.

First, a peptide containing the amino acid sequence at position 3-11 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 3) and at the same time the fourth amino acid residue, aspartic acid, has been deleted (represented by 3-11-Δ4D) DNA encoding a, a peptide (3-11-Δ5P) containing the amino acid sequence at the 3-11 position based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 3) of DrBphP and at the same time deleting the 5th amino acid residue, proline. DNA encoding), a peptide containing the amino acid sequence at position 3-11 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 3) of DrBphP and at the same time the 6th amino acid residue, leucine, is deleted (3-11 DNA encoding -Δ6L), a peptide containing the amino acid sequence at positions 3-11 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 3) and at the same time the 7th amino acid residue, proline, is deleted ( DNA encoding 3-11-Δ7P), including the amino acid sequence at position 3-11 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 3), and at the same time, the 8th amino acid residue, phenylalanine, is deleted. Primers for each were prepared in order to clone DNA encoding the resulting peptide (indicated by 3-11-Δ8F). PCR was performed around 30 cycles using the prepared primer and PrimeSTAR HS (TAKARA, R040) polymerase, and an amplified DNA product was obtained. The PCR reaction for DNA cloning does not require a separate template, and a template for amplification can be obtained by combining a forward primer and a reverse primer during one cycle of PCR. Table 5 below shows the primers used in PCR to obtain DNA amplification products encoding the five DrBphP modified partial peptides. Since the process after obtaining the DNA amplification product by PCR is the same as that of the primary epitope mapping, the description will be omitted.

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 22 Forward primer for 3-11-Δ4D cloning GCGGATCCATGCGGCCGTTGCCCTTTTTTCCACCG BamH I 23 Reverse primer for 3-11-Δ4D cloning GCGAATTCTCACGGTGGAAAAAAGGGCAACGGCCG EcoR I 24 3-11-Δ5P forward primer for cloning GCGGATCCATGCGGGACTTGCCCTTTTTTCCACCG BamH I 25 Reverse primer for 3-11-Δ5P cloning GCGAATTCTCACGGTGGAAAAAAGGGCAAGTCCCG EcoR I 26 3-11-Δ6L forward primer for cloning GCGGATCCATGCGGGACCCGCCCTTTTTTCCACCG BamH I 27 3-11-Δ6L reverse primer for cloning GCGAATTCTCACGGTGGAAAAAAGGGCGGGTCCCG EcoR I 28 3-11-Δ7P forward primer for cloning GCGGATCCATGCGGGACCCGTTGTTTTTTCCACCG BamH I 29 3-11-Δ7P reverse primer for cloning GCGAATTCTCACGGTGGAAAAAACAACGGGTCCCG EcoR I 30 3-11-Δ8F forward primer for cloning GCGGATCCATGCGGGACCCGTTGCCCTTTCCACCG BamH I 31 Reverse primer for 3-11-Δ8F cloning GCGAATTCTCACGGTGGAAAGGGCAACGGGTCCCG EcoR I

5 shows the results of secondary epitope mapping for 2B8 antibody through Western blot. As shown in Figure 5, the other epitope of the 2B8 antibody is the 8th position or the 9th position from the amino acid residues corresponding to the 3rd to 11th positions based on the N-terminal of the entire amino acid sequence of DrBphP (SEQ ID NO: 3). It was confirmed that one of the amino acid residues of phenylalanine was deleted (SEQ ID NO: 2), and another epitope of the 2B8 antibody may also be used as a peptide tag. The peptide tag consisting of the amino acid sequence of SEQ ID NO: 2 was named "BRT-ΔF tag".

Example 6: BRT Preparation of fusion protein using tag and BRT Detection of a fusion protein using an antibody against a tag

A fusion protein was prepared using the BRT tag of the present invention, and the fusion protein was detected using the B28 antibody, which is a monoclonal antibody against the BRT tag.

6-1: Expression and detection of fusion proteins in E.coli

GST (Glutathion-S-Transferase) to confirm whether the fusion protein containing the BRT tag of the present invention is normally expressed on E. coli , and whether the expressed fusion protein can be detected with a 2B8 monoclonal antibody. ) A DNA construct encoding a fusion protein to which a BRT tag was linked in front of the protein was prepared. In order to clone the DNA encoding the BRT tag of the present invention and the DNA encoding the c-myc tag, primers were prepared for each. PCR was performed around 30 cycles using the prepared primer and PrimeSTAR HS (TAKARA, R040) polymerase, and an amplified DNA product was obtained. The PCR reaction for DNA cloning does not require a separate template, and a template for amplification can be obtained by combining a forward primer and a reverse primer during one cycle of PCR. Table 6 below shows the primers used in PCR to obtain the two DNA amplification products. After separating only the desired DNA from the amplified PCR product, it was ligated to a pJET (CloneJET PCR cloning kit, Fermentas, #K1232) vector. Thereafter, the binding vector was entrusted to Bioneer co., KR to measure the base sequence. As a result, it was confirmed that the DNA product generated through PCR had the desired target nucleotide sequence.

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 32 Forward primer for BRT tag cloning GCCTCGAGGGATCCATGCGGGACCCGTTGCCCTTTTTT BamH I 33 Reverse primer for cloning BRT tags GCGAGCTCGAATTCTCACGGTGGAAAAAAGGGCAACGG EcoR I 34 Forward primer for c-myc tag cloning GCGGATCCATGGAACAAAAATTAATTTCTGAAGAAGATTTA BamH I 35 Reverse primer for cloning c-myc tags GCGAATTCTCATAAATCTTCTTCAGAAATTAATTTTTGTTC EcoR I

Subsequently, the isolated DNA product was bound to a pGEX4T1 vector ((GE Healthcare, Piscataway, NJ, USA) containing DNA encoding GST (Glutathion-S-Transferase) protein as an expression vector. The DNA product and the pGEX4T1 vector ((GE Healthcare, Piscataway, NJ, USA) were digested using restriction enzymes BamH I and EcoR I, and ligated using ligase. BL21 competent cells (manufacturer: RBC, Taipei, Taiwan) were transformed by applying heat shock at 42°C for 1 minute, cultured on LB medium containing ampicillin, and fusion with BRT tag linked to GST protein Protein (represented by 3-11::GST) and a fusion protein (represented by Myc::GST) with a c-myc tag linked to the GST protein were respectively expressed, specifically BL21 competent cells were transformed into LB medium. Colonies grown on the bed were inoculated into LB medium containing ampicillin and seeded for more than about 8 hours at 37° C. The seeded cultured cells were inoculated into LB medium containing ampicillin and _{the value at OD 600} would be 0.6. IPTG was added so that the total concentration was 0.5 mM, and protein expression was induced for 6 hours at 25° C. After that, commercially available GST resin (Glutathion Sepharose™) High Performance, GE Healthcare) was used to purify the protein. Western blot was performed on the purified protein and the BphP protein of Deinococcus radiodurans. At this time, 2B8 monoclonal antibody and anti-myc antibody were used as the primary antibody, and Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG; Sigma) was used as the secondary antibody. In addition, Amersham™ ECL™ is used to develop samples transferred to cellulose membranes after SDS-PGAE. Western Blotting Detection Reagents (GE Healthcare, RPN2106OL/AF) were used. 6 is a Western blot result showing that the fusion protein with the BRT tag attached to the N-terminus of the GST protein is normally expressed on E. coli and the fusion protein can be detected by the 2B8 antibody. As shown in FIG. 6, the fusion protein tagged with the BRT at the N-terminus of the GST protein was smoothly expressed in E. coli , and the expressed protein was well detected without non-specific binding by the 2B8 antibody. In addition, the epitope tagging system using the BRT tag and the 2B8 antibody showed almost the same level of effect as compared to the c-myc tag, which is a commonly used tag, and the epitope tagging system using an antibody therefor.

6-2: Expression and detection of fusion proteins in plant cells

In order to check whether the fusion protein containing the BRT tag of the present invention is normally expressed on plant cells, and whether the expressed fusion protein can be detected with a 2B8 monoclonal antibody, a BRT tag is linked in front of GFP (Green Fluorescent Protein). A DNA construct encoding the fusion protein was prepared. Cloning DNA encoding the fusion protein (represented by BRT::GFP) to which the BRT tag of the present invention is linked to GFP and the DNA encoding the fusion protein (represented by Myc::GFP) to which the c-myc tag is linked to GFP To do this, primers were prepared for each. PCR was performed around 30 cycles using the prepared primer and PrimeSTAR HS (TAKARA, R040) polymerase, and DNA encoding GFP (SEQ ID NO: 36) was used as a template for PCR. Table 7 below shows the primers used in PCR to obtain the two DNA amplification products. After separating only the desired DNA from the amplified PCR product, it was ligated to a pJET (CloneJET PCR cloning kit, Fermentas, #K1232) vector. Thereafter, the binding vector was entrusted to Bioneer co., KR to measure the base sequence. As a result, it was confirmed that the DNA product generated through PCR had the desired target nucleotide sequence.

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 37 Forward primer for BRT::GFP cloning GCCTCGAGATGAGGGATCCACTTCCATTCTTCCCTCCAATGGTGAGCAAGGGCGAG Xho Ⅰ 38 Reverse primer for BRT::GFP cloning GCGAGCTCTTACTTGTACAGCTCGTCCAT Sac Ⅰ 39 Forward primer for Myc::GFP cloning GGAGAGGACCTCGAGATGGAACAAAAGCTTATTTCTGAAGAAGATCTTATGGTGAGCAAGGGCGAG Xho Ⅰ 40 Reverse primer for Myc::GFP cloning GCGAGCTCTTACTTGTACAGCTCGTCCAT Sac Ⅰ

Thereafter, the isolated DNA product was bound to the expression vector pBY030.2R vector, and Agrobacterium LBA4404 cells were transformed using the vector. Afterwards, let me do Nicotiana benthamiana (cigarette) Agrobacterium LBA4404 was injected into the plant on the underside of the leaf with a syringe, and a fusion protein with a BRT tag (represented as BRT::GFP) and a fusion protein with a c-myc tag connected to GFP (Myc:: GFP) was transiently expressed in tobacco plants, respectively. For detailed experimental methods, see Imogen et al. al (NATURE PROTOCOL, 2006, Vol. 1, NO.4, 2019-2025). Agrobacterium was _{grown to a concentration until the value at OD 600} became 0.7, and then injected into the plant, and the sample was harvested after holding the plant for 5 days in a culture chamber. The presence or absence of transformation could be confirmed as a plant exhibiting GFP fluorescence by treatment with ultraviolet (UV) light. Harvested samples were flash frozen with liquid nitrogen and stored at -80°C. Thereafter, the tobacco leaf sample was pulverized with TissueLyser (QIAGEN), and an extraction buffer (125mM Tris-HCL pH 8.8, 1% SDS, 10% Glycerol, and 50mM Na ₂ S ₂ O ₅ ) was added, and then using a centrifuge. Only the supernatant was separated and used for Western blot analysis. 7 is a Western blot result showing that the fusion protein with the BRT tag attached to the N-terminus of GFP is normally expressed in plant cells and the fusion protein can be detected by the 2B8 antibody. As shown in FIG. 7, the fusion protein tagged with BRT at the N-terminus of GFP was smoothly expressed in plant cells regardless of leaf growth, and the expressed protein was well detected without non-specific binding by the 2B8 antibody. In addition, the epitope tagging system using the BRT tag and the 2B8 antibody showed almost the same level of effect as compared to the c-myc tag, which is a commonly used tag, and the epitope tagging system using an antibody therefor.

As described above, the present invention has been described through the above embodiments, but the present invention is not necessarily limited thereto, and various modifications may be possible without departing from the scope and spirit of the present invention. Accordingly, the scope of protection of the present invention should be construed as including all embodiments falling within the scope of the claims appended to the present invention.

Korea Research Institute of Bioscience and Biotechnology KCTC12283BP 20120924

<110> University-Industry Cooperation Group of Kyung Hee University Myongji University Industry and Academia Cooperation Foundation <120> Antibody for epitope tagging and hybridoma cell line <130> DP-13-500 <160> 40 <170> KopatentIn 2.0 <210> 1 <211> 9 <212> PRT <213> Deinococcus radiodurans BphP 3-11 a.a. <400> 1 Arg Asp Pro Leu Pro Phe Phe Pro Pro 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Phe-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 2 Arg Asp Pro Leu Pro Phe Pro Pro 1 5 <210> 3 <211> 755 <212> PRT <213> Deinococcus radiodurans BphP <400> 3 Met Ser Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu Tyr Leu Gly Gly 1 5 10 15 Pro Glu Ile Thr Thr Glu Asn Cys Glu Arg Glu Pro Ile His Ile Pro 20 25 30 Gly Ser Ile Gln Pro His Gly Ala Leu Leu Thr Ala Asp Gly His Ser 35 40 45 Gly Glu Val Leu Gln Met Ser Leu Asn Ala Ala Thr Phe Leu Gly Gln 50 55 60 Glu Pro Thr Val Leu Arg Gly Gln Thr Leu Ala Ala Leu Leu Pro Glu 65 70 75 80 Gln Trp Pro Ala Leu Gln Ala Ala Leu Pro Pro Gly Cys Pro Asp Ala 85 90 95 Leu Gln Tyr Arg Ala Thr Leu Asp Trp Pro Ala Ala Gly His Leu Ser 100 105 110 Leu Thr Val His Arg Val Gly Glu Leu Leu Ile Leu Glu Phe Glu Pro 115 120 125 Thr Glu Ala Trp Asp Ser Thr Gly Pro His Ala Leu Arg Asn Ala Met 130 135 140 Phe Ala Leu Glu Ser Ala Pro Asn Leu Arg Ala Leu Ala Glu Val Ala 145 150 155 160 Thr Gln Thr Val Arg Glu Leu Thr Gly Phe Asp Arg Val Met Leu Tyr 165 170 175 Lys Phe Ala Pro Asp Ala Thr Gly Glu Val Ile Ala Glu Ala Arg Arg 180 185 190 Glu Gly Leu His Ala Phe Leu Gly His Arg Phe Pro Ala Ser Asp Ile 195 200 205 Pro Ala Gln Ala Arg Ala Leu Tyr Thr Arg His Leu Leu Arg Leu Thr 210 215 220 Ala Asp Thr Arg Ala Ala Ala Val Pro Leu Asp Pro Val Leu Asn Pro 225 230 235 240 Gln Thr Asn Ala Pro Thr Pro Leu Gly Gly Ala Val Leu Arg Ala Thr 245 250 255 Ser Pro Met His Met Gln Tyr Leu Arg Asn Met Gly Val Gly Ser Ser 260 265 270 Leu Ser Val Ser Val Val Val Gly Gly Gln Leu Trp Gly Leu Ile Ala 275 280 285 Cys His His Gln Thr Pro Tyr Val Leu Pro Pro Asp Leu Arg Thr Thr 290 295 300 Leu Glu Tyr Leu Gly Arg Leu Leu Ser Leu Gln Val Gln Val Lys Glu 305 310 315 320 Ala Ala Asp Val Ala Ala Phe Arg Gln Ser Leu Arg Glu His His Ala 325 330 335 Arg Val Ala Leu Ala Ala Ala His Ser Leu Ser Pro His Asp Thr Leu 340 345 350 Ser Asp Pro Ala Leu Asp Leu Leu Gly Leu Met Arg Ala Gly Gly Leu 355 360 365 Ile Leu Arg Phe Glu Gly Arg Trp Gln Thr Leu Gly Glu Val Pro Pro 370 375 380 Ala Pro Ala Val Asp Ala Leu Leu Ala Trp Leu Glu Thr Gln Pro Gly 385 390 395 400 Ala Leu Val Gln Thr Asp Ala Leu Gly Gln Leu Trp Pro Ala Gly Ala 405 410 415 Asp Leu Ala Pro Ser Ala Ala Gly Leu Leu Ala Ile Ser Val Gly Glu 420 425 430 Gly Trp Ser Glu Cys Leu Val Trp Leu Arg Pro Glu Leu Arg Leu Glu 435 440 445 Val Ala Trp Gly Gly Ala Thr Pro Asp Gln Ala Lys Asp Asp Leu Gly 450 455 460 Pro Arg His Ser Phe Asp Thr Tyr Leu Glu Glu Lys Arg Gly Tyr Ala 465 470 475 480 Glu Pro Trp His Pro Gly Glu Ile Glu Glu Ala Gln Asp Leu Arg Asp 485 490 495 Thr Leu Thr Gly Ala Leu Gly Glu Arg Leu Ser Val Ile Arg Asp Leu 500 505 510 Asn Arg Ala Leu Thr Gln Ser Asn Ala Glu Trp Arg Gln Tyr Gly Phe 515 520 525 Val Ile Ser His His Met Gln Glu Pro Val Arg Leu Ile Ser Gln Phe 530 535 540 Ala Glu Leu Leu Thr Arg Gln Pro Arg Ala Gln Asp Gly Ser Pro Asp 545 550 555 560 Ser Pro Gln Thr Glu Arg Ile Thr Gly Phe Leu Leu Arg Glu Thr Ser 565 570 575 Arg Leu Arg Ser Leu Thr Gln Asp Leu His Thr Tyr Thr Ala Leu Leu 580 585 590 Ser Ala Pro Pro Pro Val Arg Arg Pro Thr Pro Leu Gly Arg Val Val 595 600 605 Asp Asp Val Leu Gln Asp Leu Glu Pro Arg Ile Ala Asp Thr Gly Ala 610 615 620 Ser Ile Glu Val Ala Pro Glu Leu Pro Val Ile Ala Ala Asp Ala Gly 625 630 635 640 Leu Leu Arg Asp Leu Leu Leu His Leu Ile Gly Asn Ala Leu Thr Phe 645 650 655 Gly Gly Pro Glu Pro Arg Ile Ala Val Arg Thr Glu Arg Gln Gly Ala 660 665 670 Gly Trp Ser Ile Ala Val Ser Asp Gln Gly Ala Gly Ile Ala Pro Glu 675 680 685 Tyr Gln Glu Arg Ile Phe Leu Leu Phe Gln Arg Leu Gly Ser Leu Asp 690 695 700 Glu Ala Leu Gly Asn Gly Leu Gly Leu Pro Leu Cys Arg Lys Ile Ala 705 710 715 720 Glu Leu His Gly Gly Thr Leu Thr Val Glu Ser Ala Pro Gly Glu Gly 725 730 735 Ser Thr Phe Arg Cys Trp Leu Pro Asp Ala Gly Pro Leu Pro Gly Ala 740 745 750 Ala Asp Ala 755 <210> 4 <211> 2268 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP <400> 4 atgagccggg acccgttgcc cttttttcca ccgctttacc ttggtggccc ggaaattacc 60 accgagaact gcgagcgcga gccgattcat attcccggca gcatccagcc gcacggcgcc 120 ctgctcactg ccgacgggca cagcggcgag gtgctccaga tgagcctcaa cgcggccact 180 tttctgggac aggaacccac agtgctgcgc ggacagaccc tcgccgcact gctgcccgag 240 cagtggcccg cgctgcaagc ggccctgccc cccggctgcc ccgacgccct gcaataccgc 300 gcaacgctgg actggcctgc cgccgggcac ctttcgctga cggtgcaccg ggtcggcgag 360 ttgctgattc tggaattcga gccgacggag gcctgggaca gcaccgggcc gcacgcgctg 420 cgcaacgcga tgttcgcgct cgaaagtgcc cccaacctgc gggcgctggc cgaggtggcg 480 acccagacgg tccgcgagct gacgggcttt gaccgggtga tgctctacaa atttgccccc 540 gacgccaccg gcgaagtgat tgccgaggcc cgccgtgagg ggctgcacgc ctttctgggc 600 caccgttttc ccgcgtcgga cattccggcg caggcccgcg cgctctacac ccggcacctg 660 ctgcgcctga ccgccgacac ccgcgccgcc gccgtgccgc tcgatcccgt cctcaacccg 720 cagacgaatg cgcccacccc gctgggcggc gccgtgctgc gcgccacctc gcccatgcac 780 atgcagtacc tgcggaacat gggcgtcggg tcgagcctgt cggtgtcggt ggtggtcggc 840 ggccagctct ggggcctgat cgcctgccac caccagacgc cctacgtgtt gccgcccgac 900 ctgcgaacca cgctcgaata cctgggccgc ttgctgagcc tgcaagttca ggtcaaggaa 960 gcggcggacg tggcggcctt tcgccagagc ctgcgggagc accacgcgcg ggtggccctc 1020 gcggcggcgc actcgctctc gccgcacgac accctcagtg acccggcgct tgacctgctg 1080 ggcctgatgc gggccggggg cctgattctg cgtttcgagg gccgctggca gacgttgggt 1140 gaagtgccgc ctgccccggc ggtggacgcg ctgctggcgt ggctcgaaac ccagccgggc 1200 gccctggtcc agaccgacgc gctgggccaa ctgtggcccg ccggcgccga tctcgccccc 1260 agcgcagcgg gcctgctcgc catcagcgtg ggcgagggct ggtcggagtg cctcgtctgg 1320 ctgcggcccg aactgcggct ggaggtcgcc tggggcgggg ccactcctga ccaggcgaaa 1380 gacgacctcg ggccgcgcca ctcattcgac acctacctcg aagaaaaacg cggctacgcc 1440 gagccctggc atcccggcga aatcgaggag gcgcaggatc tacgtgacac attgaccggg 1500 gcgctgggcg agcgcctgag cgtgattcgt gacctcaacc gggcgctcac acagtcgaac 1560 gccgagtggc ggcagtacgg cttcgttatc agccaccaca tgcaggagcc ggtgcggctc 1620 atctcgcagt tcgccgagtt gctgacgcgc cagccccgcg cccaggacgg gtctccggac 1680 tctccgcaga ccgagcgcat caccggcttt ctgctgcgcg aaacgtcgcg cctgcgcagc 1740 ctgacgcaag acctccacac ctacaccgcg ctgctctcgg caccgccgcc ggtgcgccgc 1800 cccacgccgc tgggccgcgt ggtggacgat gtgctgcaag acctcgaacc ccgcattgcc 1860 gacaccggag cgagcatcga ggtggcgccc gagttgcccg tcatcgctgc cgacgctggc 1920 ctgctgcgcg acctgctgct gcatctgatc ggcaacgcgc tgacgtttgg tggcccggag 1980 ccgcgtattg ccgtaaggac cgaacggcaa ggcgcgggtt ggtctatcgc ggtcagtgac 2040 cagggcgctg gcatcgcgcc cgagtatcag gaacgaatct ttctgctgtt tcagcggctc 2100 ggttcgctcg atgaggcgct gggcaacggc ctgggcctgc cgctgtgccg caagatcgcc 2160 gaactgcatg gcggcaccct gaccgtggag tccgcgccag gcgagggcag caccttccgt 2220 tgctggctgc ccgatgctgg gcctcttccg ggagccgccg atgcctga 2268 <210> 5 <211> 963 <212> DNA <213> Deinococcus radiodurans BphP 1-321 a.a. <400> 5 atgagccggg acccgttgcc cttttttcca ccgctttacc ttggtggccc ggaaattacc 60 accgagaact gcgagcgcga gccgattcat attcccggca gcatccagcc gcacggcgcc 120 ctgctcactg ccgacgggca cagcggcgag gtgctccaga tgagcctcaa cgcggccact 180 tttctgggac aggaacccac agtgctgcgc ggacagaccc tcgccgcact gctgcccgag 240 cagtggcccg cgctgcaagc ggccctgccc cccggctgcc ccgacgccct gcaataccgc 300 gcaacgctgg actggcctgc cgccgggcac ctttcgctga cggtgcaccg ggtcggcgag 360 ttgctgattc tggaattcga gccgacggag gcctgggaca gcaccgggcc gcacgcgctg 420 cgcaacgcga tgttcgcgct cgaaagtgcc cccaacctgc gggcgctggc cgaggtggcg 480 acccagacgg tccgcgagct gacgggcttt gaccgggtga tgctctacaa atttgccccc 540 gacgccaccg gcgaagtgat tgccgaggcc cgccgtgagg ggctgcacgc ctttctgggc 600 caccgttttc ccgcgtcgga cattccggcg caggcccgcg cgctctacac ccggcacctg 660 ctgcgcctga ccgccgacac ccgcgccgcc gccgtgccgc tcgatcccgt cctcaacccg 720 cagacgaatg cgcccacccc gctgggcggc gccgtgctgc gcgccacctc gcccatgcac 780 atgcagtacc tgcggaacat gggcgtcggg tcgagcctgt cggtgtcggt ggtggtcggc 840 ggccagctct ggggcctgat cgcctgccac caccagacgc cctacgtgtt gccgcccgac 900 ctgcgaacca cgctcgaata cctgggccgc ttgctgagcc tgcaagttca ggtcaaggaa 960 gcg 963 <210> 6 <211> 321 <212> PRT <213> Deinococcus radiodurans BphP 1-321 a.a. <400> 6 Met Ser Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu Tyr Leu Gly Gly 1 5 10 15 Pro Glu Ile Thr Thr Glu Asn Cys Glu Arg Glu Pro Ile His Ile Pro 20 25 30 Gly Ser Ile Gln Pro His Gly Ala Leu Leu Thr Ala Asp Gly His Ser 35 40 45 Gly Glu Val Leu Gln Met Ser Leu Asn Ala Ala Thr Phe Leu Gly Gln 50 55 60 Glu Pro Thr Val Leu Arg Gly Gln Thr Leu Ala Ala Leu Leu Pro Glu 65 70 75 80 Gln Trp Pro Ala Leu Gln Ala Ala Leu Pro Pro Gly Cys Pro Asp Ala 85 90 95 Leu Gln Tyr Arg Ala Thr Leu Asp Trp Pro Ala Ala Gly His Leu Ser 100 105 110 Leu Thr Val His Arg Val Gly Glu Leu Leu Ile Leu Glu Phe Glu Pro 115 120 125 Thr Glu Ala Trp Asp Ser Thr Gly Pro His Ala Leu Arg Asn Ala Met 130 135 140 Phe Ala Leu Glu Ser Ala Pro Asn Leu Arg Ala Leu Ala Glu Val Ala 145 150 155 160 Thr Gln Thr Val Arg Glu Leu Thr Gly Phe Asp Arg Val Met Leu Tyr 165 170 175 Lys Phe Ala Pro Asp Ala Thr Gly Glu Val Ile Ala Glu Ala Arg Arg 180 185 190 Glu Gly Leu His Ala Phe Leu Gly His Arg Phe Pro Ala Ser Asp Ile 195 200 205 Pro Ala Gln Ala Arg Ala Leu Tyr Thr Arg His Leu Leu Arg Leu Thr 210 215 220 Ala Asp Thr Arg Ala Ala Ala Val Pro Leu Asp Pro Val Leu Asn Pro 225 230 235 240 Gln Thr Asn Ala Pro Thr Pro Leu Gly Gly Ala Val Leu Arg Ala Thr 245 250 255 Ser Pro Met His Met Gln Tyr Leu Arg Asn Met Gly Val Gly Ser Ser 260 265 270 Leu Ser Val Ser Val Val Val Gly Gly Gln Leu Trp Gly Leu Ile Ala 275 280 285 Cys His His Gln Thr Pro Tyr Val Leu Pro Pro Asp Leu Arg Thr Thr 290 295 300 Leu Glu Tyr Leu Gly Arg Leu Leu Ser Leu Gln Val Gln Val Lys Glu 305 310 315 320 Ala <210> 7 <211> 27 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP 3-11 a.a. <400> 7 cgggacccgt tgcccttttt tccaccg 27 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> nucleotides for Phe-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 8 cgggacccgt tgccctttcc accg 24 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP <400> 9 gccatatgat gagccgggac ccgttgccc 29 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP <400> 10 gcctcgagtc aggcatcggc ggctcccgg 29 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 1-321 a.a. <400> 11 gccatatgat gagccgggac ccgttgccc 29 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 1-321 a.a. <400> 12 gcctcgagcg cttccttgac ctgaacttg 29 <210> 13 <211> 10 <212> PRT <213> Deinococcus radiodurans BphP 3-12 a.a. <400> 13 Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu 1 5 10 <210> 14 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 3-12 a.a. <400> 14 gcctcgaggg atccatgcgg gacccgttgc cctttttt 38 <210> 15 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 3-12 a.a. <400> 15 gcgagctcga attctcaaag cggtggaaaa aagggcaa 38 <210> 16 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 3-11 a.a. <400> 16 gcctcgaggg atccatgcgg gacccgttgc cctttttt 38 <210> 17 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 3-11 a.a. <400> 17 gcgagctcga attctcacgg tggaaaaaag ggcaacgg 38 <210> 18 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 3-10 a.a. <400> 18 gcctcgaggg atccatgcgg gacccgttgc cctttttt 38 <210> 19 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 3-10 a.a. <400> 19 gcgagctcga attctcatgg aaaaaagggc aacgggtc 38 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 4-12 a.a. <400> 20 gcctcgaggg atccatggac ccgttgccct tttttcca 38 <210> 21 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 4-12 a.a. <400> 21 gcgagctcga attctcaaag cggtggaaaa aagggcaa 38 <210> 22 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 4th Asp-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 22 gcggatccat gcggccgttg cccttttttc caccg 35 <210> 23 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 4th Asp-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 23 gcgaattctc acggtggaaa aaagggcaac ggccg 35 <210> 24 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 5th Pro-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 24 gcggatccat gcgggacttg cccttttttc caccg 35 <210> 25 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 5th Pro-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 25 gcgaattctc acggtggaaa aaagggcaag tcccg 35 <210> 26 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 6th Leu-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 26 gcggatccat gcgggacccg cccttttttc caccg 35 <210> 27 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 6th Leu-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 27 gcgaattctc acggtggaaa aaagggcggg tcccg 35 <210> 28 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 7th Pro-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 28 gcggatccat gcgggacccg ttgttttttc caccg 35 <210> 29 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 7th Pro-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 29 gcgaattctc acggtggaaa aaacaacggg tcccg 35 <210> 30 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 8th Phe-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 30 gcggatccat gcgggacccg ttgccctttc caccg 35 <210> 31 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 8th Phe-deleted Deinococcus radiodurans BphP 3-11 a.a. <400> 31 gcgaattctc acggtggaaa gggcaacggg tcccg 35 <210> 32 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 3-11 a.a. <400> 32 gcctcgaggg atccatgcgg gacccgttgc cctttttt 38 <210> 33 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 3-11 a.a. <400> 33 gcgagctcga attctcacgg tggaaaaaag ggcaacgg 38 <210> 34 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> forward primer for c-myc tag <400> 34 gcggatccat ggaacaaaaa ttaatttctg aagaagattt a 41 <210> 35 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for c-myc tag <400> 35 gcgaattctc ataaatcttc ttcagaaatt aatttttgtt c 41 <210> 36 <211> 720 <212> DNA <213> Artificial Sequence <220> <223> nucleotides for Green Fluorescent Protein <400> 36 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga cgccacctac 120 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccttcagcta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540 gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660 ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacaagtaa 720 720 <210> 37 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> forward primer for BRT tagged Green Fluorescent Protein <400> 37 gcctcgagat gagggatcca cttccattct tccctccaat ggtgagcaag ggcgag 56 <210> 38 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for BRT tagged Green Fluorescent Protein <400> 38 gcgagctctt acttgtacag ctcgtccat 29 <210> 39 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> forward primer for c-myc tagged Green Fluorescent Protein <400> 39 ggagaggacc tcgagatgga acaaaagctt atttctgaag aagatcttat ggtgagcaag 60 ggcgag 66 <210> 40 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for c-myc tagged Green Fluorescent Protein <400> 40 gcgagctctt acttgtacag ctcgtccat 29

Claims (7)

A peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence of SEQ ID NO: 2.
2. The antibody of claim 1, wherein the antibody is a monoclonal antibody.
3. The antibody of claim 2, wherein the monoclonal antibody is produced by a hybridoma cell line with a deposit number of KCTC 12283BP.
3. The antibody of claim 2, wherein the heavy chain isotype of said monoclonal antibody is IgG2a.
3. The antibody of claim 2, wherein the light chain isotype of the monoclonal antibody is kappa (kappa).
A hybridoma cell line producing the antibody of any one of claims 1 to 5.
7. A hybridoma cell line according to claim 6, wherein the accession number is KCTC 12283BP.

Images