KR20150080463A - Novel peptide tag, antibody for epitope tagging, hybridoma cell line and use thereof - Google Patents

Abstract

The present invention relates to a peptide tag originating from Bacteriophytochrome (BphP) which is a photoreceptor protein of Deinococcus radiodurans, an antibody capable of specifically recognizing the peptide tags, a hybridoma cell line capable of producing the antibody, and a use thereof. The novel peptide tag according to the present invention has a short length, maintaining the same level of detection ability as commercial tags and minimizing nonspecific reactions. Therefore, when using the novel peptide tag and the antibody of the novel peptide tag, fusion protein expressed in recombinant cells can be efficiently detected or refined. In addition, the epitope tagging system including the novel peptide tag and the antibody of the novel peptide tag can be applied to various fields of research including intracellular location checking of specific proteins, functional identification, detection, refinement, and interaction between proteins.

Description

Novel peptide tag, antibody for epitope tagging, hybridoma cell line and use thereof

The present invention relates to an epitope tagging system for detection or purification of a protein of interest, and more particularly, a novel peptide tag derived from Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. The present invention relates to an antibody capable of specifically recognizing the peptide tags and a hybridoma cell line capable of producing the antibody. In addition, the present invention relates to a polynucleotide encoding the peptide tags, a vector or transformant containing the same, a fusion protein containing the peptide tags, and a method or kit for preparing, detecting or purifying the fusion protein. .

Useful proteins or polypeptides can be produced synthetically or isolated from natural sources. However, this method has disadvantages in that it is uneconomical in terms of cost and time, and the amount of production is limited. Therefore, it is preferable to produce a target protein and a target polypeptide through cultivation of a transformant produced by recombinantly to overexpress the target protein or the target polypeptide. However, polypeptides (especially short polypeptides) produced in the cellular environment may be sensitive to degradation due to the action of proteases present in cells, and antibodies to all target proteins are not present, so the corresponding antibodies are It may not be easy to purify a protein of interest that is not present.

Protein tagging or epitope tagging has been used to overcome this problem. In protein tagging or epitope tagging, a recombinant nucleic acid molecule in which the coding sequence of the epitope tag is linked to the coding sequence of the target protein is produced, expressed in a suitable host cell, and then an antibody against the epitope tag is used. It is a recombinant DNA method used to detect, quantify, and purify a target protein, or to identify the location of a target protein in a cell, or to determine its functionality. Commercially, there are numerous epitope tags and antibodies that are ligands for them.Western blot analysis, immunoprecipitation, immunofluorescence, immune cells when selecting an appropriate epitope tag and an antibody against it Since the target protein can be detected or purified by immunocytochemistry or immunoaffinity purification, it is possible to eliminate the need to generate antibodies against the target protein.

Currently, epitope tags used for protein tagging or epitope tagging include short peptide tags (e.g., 6×His tags) of about 6 amino acid residues to large proteins (e.g., MBP) of about 40 kDa. Many unique tags are available [see Stevens, RC, (2000) Structure Fold Des 8:R177-85] and peptide tags consisting of 3 to 30 amino acids are typically used. His-tagged proteins are specifically trapped on a Ni-NTA (nickel-nitrilotriacetic acid) resin, which can be eluted by EDTA or imidazole. In addition, maltose-binding protein (MBP, 396 amino acids, 40 kDa), Staphylococcus protein A, calmodulin-binding peptide (CBP, 26 amino acids, 2.96 kDa), GFP (238 amino acids, 27 kDa) and Glutathione-S-transferase (GST, 211 amino acids, 26 kDa) can be used for detection or purification of prokaryotic and eukaryotic proteins. In addition, epitope tags that are most commonly used include c-myc tags, HA tags, and FLAG tags. The c-myc tag is a 10 amino acid long epitope tag derived from the human c-myc protein [Evans et al., (1985) Mol. Cell. Biol., 12: 3610-3616], the HA tag is a 9 amino acid long epitope tag derived from the influenza hemagglutinin HA-1 protein [Field et al., (1988) Mol. Cell. Biol., 8: 2159-2165]. The FLAG tag is an 8 amino acid long epitope tag derived from bacteriophage T7 [Hopp et al., (1988) Bio/Technology, 6: 1204-1210].

On the other hand, the epitope tag used for epitope tagging is desirable to have minimal influence on the three-dimensional structure and biological activity of the target protein when fused with the target protein. In general, a long epitope tag (for example, a GST tag or MBP tag) has problems such as altering the function of the target protein. On the other hand, epitope tags that are relatively short in length, such as FLAG tags, c-myc tags, etc., have little effect on the properties of the target protein fused with them, and can be very specifically bound to antibodies against them, In some cases, it is currently mainly used because it does not need to be removed from the fusion protein. However, the amino acid sequence of the c-myc tag and the FLAG tag induces a non-specific reaction of the antibody that recognizes the tag because many proteins in the cells of organisms known to date contain the same sequence, and such a non-specific antibody reaction has a specific purpose. There is a problem in that it interferes with the separation and identification of proteins, which degrades the reliability of the experiment [Ksenija Gasic et al., (2005) Plant molecular biology reporter 23:9-16]. In order to overcome this non-specific reaction problem, an affinity purification system has been developed in which two different tags are successively fused to the N-terminus of a protein [Rigaut, G., et al. (1999) Nat Biotechnol 17:1030-2].

Therefore, it is possible to minimize non-specific reactions that are problematic in the conventional epitope tagging system for detecting and purifying a fusion protein expressed in a recombinant host cell using an epitope tag and an antibody therefor, and at the same time, a novel having a short amino acid sequence. There is a need to develop a peptide tag and an antibody that can be paired with it.

An object of the present invention is to provide a novel peptide tag useful for detection or purification of a protein of interest, a use thereof, and the like.

Another object of the present invention is to provide a novel antibody capable of specifically recognizing a novel epitope tag or selectively binding to a new epitope tag, a hybridoma cell line capable of producing the antibody, and uses thereof.

The inventors of the present invention were conducting research to develop a peptide tag useful for detection or purification of a protein of interest and an antibody therefor, while bacteriophytochrome, a light-receiving protein of Deinococcus radiodurans, a heterotrophic sedative bacterium. (Bacteriophytochrome, BphP) or a fragment thereof is used as an immunogen to obtain a hybridoma producing a monoclonal antibody, and the produced antibody is used to target Bacteriophytochrome (BphP) of Deinococcus radiodurans. The present invention was completed by discovering an epitope consisting of 6 to 7 amino acids by performing epitope mapping.

In order to solve the above object, the present invention is a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, and glutamic acid, the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 15, is a hydrophobic amino acid. There is provided a peptide tag including a peptide substituted with or a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 16, is substituted with a hydrophobic amino acid, as a recognition site of an antibody or a binding site of an antibody. At this time, the hydrophobic amino acid is preferably any one selected from methionine, alanine, or leucine, and more preferably alanine. In addition, the peptide in which glutamic acid, which is the fifth amino acid residue, is substituted with a hydrophobic amino acid among the peptides consisting of the amino acid sequence of SEQ ID NO: 16 is preferably formed of the amino acid sequence of SEQ ID NO: 35.

In addition, the present invention provides a polynucleotide encoding the peptide tag. In this case, the polynucleotide encoding the peptide tag may preferably include the nucleotide sequence of SEQ ID NO: 33, the nucleotide sequence of SEQ ID NO: 34, or the nucleotide sequence of SEQ ID NO: 48. In addition, the polynucleotide encoding the peptide tag is preferably a primer pair consisting of a forward primer having a nucleotide sequence of SEQ ID NO: 29 and a reverse primer having a nucleotide sequence of SEQ ID NO: 30, and having a nucleotide sequence of SEQ ID NO: 31. Synthesis by a primer pair consisting of a forward primer and a reverse primer having the nucleotide sequence of SEQ ID NO: 32 or a primer pair consisting of a forward primer having the nucleotide sequence of SEQ ID NO: 44 and a reverse primer having the nucleotide sequence of SEQ ID NO: 45 Can be.

In addition, the present invention provides a primer pair for synthesizing a polynucleotide encoding a peptide tag. In this case, the primer pair is preferably a forward primer having a nucleotide sequence of SEQ ID NO: 29 and a reverse primer having a nucleotide sequence of SEQ ID NO: 30; A forward primer having the nucleotide sequence of SEQ ID NO: 31 and a reverse primer having the nucleotide sequence of SEQ ID NO: 32; Alternatively, it may be composed of a forward primer having the nucleotide sequence of SEQ ID NO: 44 and a reverse primer having the nucleotide sequence of SEQ ID NO: 45.

In addition, the present invention includes a recombinant vector comprising a polynucleotide encoding the peptide tag. In this case, the recombinant vector may be a cloning vector or an expression vector. In addition, the expression vector preferably further comprises a target polynucleotide encoding a target protein, and the target polynucleotide is characterized in that it is linked to a polynucleotide encoding a peptide tag.

In addition, the present invention includes a fusion protein comprising a protein of interest and a peptide tag linked thereto. At this time, the peptide tag constituting the fusion protein is a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, and glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 15, is a hydrophobic amino acid. A peptide substituted with or a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 16, is substituted with a hydrophobic amino acid, is included as a recognition site of an antibody or a binding site of an antibody.

In addition, the present invention provides a polynucleotide encoding the fusion protein.

In addition, the present invention relates to a polynucleotide encoding the peptide tag, a recombinant vector including a polynucleotide encoding the peptide tag, a polynucleotide encoding the fusion protein, and a recombinant vector including a polynucleotide encoding the fusion protein It provides a transformant, characterized in that any one selected from the group consisting of is introduced.

In addition, the present invention comprises the steps of contacting and binding the fusion protein with an antibody against a peptide tag; And confirming the presence or analyzing the amount of the fusion protein bound to the antibody. In this case, the fusion protein may be expressed by a polynucleotide encoding the fusion protein or a transformant into which a recombinant vector containing the same is introduced. In addition, the antibody is preferably characterized in that it is a monoclonal antibody produced by a hybridoma cell line having an accession number of KCTC 12442BP.

In addition, the present invention comprises the steps of contacting and binding the fusion protein with an antibody against a peptide tag; And recovering the fusion protein bound to the antibody. In this case, the fusion protein may be expressed by a polynucleotide encoding the fusion protein or a transformant into which a recombinant vector containing the same is introduced. In addition, the antibody is preferably characterized in that it is a monoclonal antibody produced by a hybridoma cell line having an accession number of KCTC 12442BP.

In addition, the present invention relates to a polynucleotide encoding the peptide tag, a primer pair for synthesizing a polynucleotide encoding the peptide tag, a recombinant vector comprising a polynucleotide encoding the peptide tag, and a polynucleotide encoding the fusion protein. Any one selected from the group consisting of a nucleotide and a recombinant vector containing a polynucleotide encoding the fusion protein; And a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 15, is substituted with a hydrophobic amino acid, or an amino acid of SEQ ID NO: 16. A kit for detecting or purifying a fusion protein comprising an antibody that specifically binds to a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides consisting of a sequence, is substituted with a hydrophobic amino acid, or a hybridoma cell line that produces the antibody. Provides. In this case, the antibody is preferably a monoclonal antibody produced by a hybridoma cell line having an accession number of KCTC 12442BP.

In order to solve the above other object, the present invention is a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, and glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 15, is a hydrophobic amino acid. It provides an antibody against a peptide substituted with a hydrophobic amino acid in which glutamic acid, which is the fifth amino acid residue, among the peptides substituted with or consisting of the amino acid sequence of SEQ ID NO: 16. In this case, the antibody is preferably characterized in that it is a monoclonal antibody.

In addition, the present invention provides a hybridoma cell line that produces the antibody. At this time, the hybridoma cell line is characterized in that the accession number is KCTC 12442BP.

In addition, the present invention provides a kit comprising the antibody or the hybridoma cell line. In this case, the antibody is characterized in that it is immobilized on a support. In addition, the kit is preferably the antibody (a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, and the fifth amino acid residue of the peptide consisting of the amino acid sequence of SEQ ID NO: 15) is a hydrophobic amino acid. A means for detecting an antibody against a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides substituted with or consisting of the amino acid sequence of SEQ ID NO: 16, is substituted with a hydrophobic amino acid) may be further included. The detection means is a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, a peptide in which glutamic acid, which is the fifth amino acid residue, of the peptide consisting of the amino acid sequence of SEQ ID NO: 15 is substituted with a hydrophobic amino acid, or SEQ ID NO: It is preferable that it is a secondary antibody capable of binding to an antibody against a peptide in which glutamic acid, which is the fifth amino acid residue, is substituted with a hydrophobic amino acid among the peptides having the amino acid sequence of 16. In addition, the secondary antibody may be preferably conjugated with a labeling material selected from an enzyme, a radioactive material, or a fluorescent material. In addition, the kit may be used for detection or purification of a fusion protein including a target protein and a peptide tag linked thereto. In this case, the peptide tag is a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, and a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 15, is substituted with a hydrophobic amino acid, or Among the peptides consisting of the amino acid sequence of SEQ ID NO: 16, a peptide in which glutamic acid, which is the fifth amino acid residue, is substituted with a hydrophobic amino acid is included as a recognition site for an antibody or a binding site for an antibody.

The novel peptide tag according to the present invention has a short length and exhibits a detection capability equivalent to that of a commercial tag, and non-specific reactions can be minimized. Therefore, when the novel peptide tag according to the present invention and an antibody therefor are used, a fusion protein expressed in a recombinant cell can be detected or purified very efficiently. In addition, the novel peptide tag according to the present invention and the epitope tagging system including an antibody therefor can be applied to various fields such as identification of the intracellular location of a specific protein, functional identification, detection, purification, and interaction studies between proteins.

1 is a diagram showing the results of purifying DrBphP and DrBphN using His tag column chromatography. Figure 1 (A) is a schematic diagram showing a gene construct used to express the BphP protein and BphN protein of Deinococcus radiodurans (Deinococcus radiodurans). FL, full length (1-755 amino acids, BphP); ΔPHY/HKD (1-321 amino acids, BphN); (B) of FIG. 1 shows that BphP apoprotein and BphN apoprotein of Deinococcus radiodurans ^{were purified using Ni +} -NTA affinity chromatography, incubated with BV for 20 minutes, and then SDS-PAGE was performed. And, the result of detecting BV binding by zinc-induced fluorescence (right) and the result of staining with Coomassie Blue (left) are shown. 1: crude BphP extract, 2: purified BphP, 3: crude BphN extract, 4: purified BphN. Purification conditions-binding & washing: pH 8.0, 100 mM Tris, 200 mM NaCl, 10 mM imidazole/Elution: pH 8.0, 100 mM Tris, 200 mM NaCl, 150 mM imidazole
2 is a diagram showing the results of Western blots performed on BphP and BphN purified using the selected monoclonal antibody. SDS-PAGE was performed on the purified BphP and BphN, and Western blot was performed using the purified monoclonal antibodies of Bphp (2B8, 2C11, 3B2, 3D2, 3H7). P; BphP, N; BphN. Of the monoclonal antibodies, it was confirmed by Western blot that the 2B8 antibody recognizes the epitope present at the N-terminus of the BphP protein.
FIG. 3 shows the results of confirming whether Oat PhyA, an oat phytochrome protein having a PCD structure constituting the N-terminal region, similar to DrBphP reacts with five monoclonal antibodies of BphP.
4 shows the results of primary epitope mapping for 3H7 antibody through Western blot and coomassie staining, and FIG. 5 shows the results of secondary epitope mapping for 3H7 antibody through Western blot and coomassie staining. In FIGS. 4 and 5, "3H7" represents a 3H7 antibody and "Anti-GST" represents an anti-GST antibody.
6 is a result of performing Western blot to compare the reactivity of three epitopes to 3H7 antibody. In FIG. 6, "485-490" and "485-491" refer to a peptide consisting of an amino acid sequence at positions 485 to 490 and a peptide consisting of an amino acid sequence at positions 485 to 491 based on the N-terminus of the total amino acid sequence of rBphP, respectively. And "E489A" refers to a peptide containing the amino acid sequence at positions 485-490 based on the N-terminus of the entire amino acid sequence of DrBphP, and at the same time, glutamic acid, which is the 489th amino acid residue, is substituted with alanine. In addition, in FIG. 6, "3H7" represents a 3H7 antibody and "Anti-GST" represents an anti-GST antibody.
7 is a Western blot result showing that the fusion protein with the peptide tag of the present invention attached to the N-terminus of the GST protein is normally expressed on E. coli and the fusion protein can be detected by the 3H7 antibody. In FIG. 7 "Anti-Tag" represents each antibody against the tags used.

One aspect of the present invention relates to a novel peptide tag that can be used in an epitope tagging system for purification or detection of a protein of interest. The novel peptide tag according to the present invention includes a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, and a peptide consisting of the amino acid sequence of SEQ ID NO: 15, wherein glutamic acid, which is the fifth amino acid residue, is substituted with a hydrophobic amino acid. A peptide or a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 16, is substituted with a hydrophobic amino acid, is included as an antibody recognition site or an antibody binding site. In the specification of the present invention, the peptide tag may be used interchangeably with a protein tag or an epitope tag. In the present invention, the term "peptide tag" refers to a peptide that can be used as a tag by being fused to a protein of interest. In addition, in the present invention, the term "epitope" refers to an antigen-binding site recognized by a specific antibody or a certain portion of an antigen that reacts with B cells or T cells. The peptide tag according to the present invention includes a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, and a peptide in which glutamic acid, which is the fifth amino acid residue, is substituted with a hydrophobic amino acid among the peptides consisting of the amino acid sequence of SEQ ID NO: 15. Alternatively, when a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 16, is substituted with a hydrophobic amino acid, is included as a recognition site of an antibody or a binding site of an antibody, the length is not greatly limited. For example, the peptide tag according to the present invention is preferably a peptide having 6 to 30 amino acid residues in consideration of the number of amino acid residues of a commonly used epitope tag, and a peptide consisting of the amino acid sequence of SEQ ID NO: 15, SEQ ID NO: It is more preferable that the peptide consisting of the amino acid sequence of 16, the peptide consisting of the amino acid sequence of SEQ ID NO: 16 is substituted for glutamic acid, the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 15, with a hydrophobic amino acid. Among the peptide tags according to the present invention, the peptide consisting of the amino acid sequence of SEQ ID NO: 15 and the peptide consisting of the amino acid sequence of SEQ ID NO: 16 are derived from Bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. It was done. Specifically, the peptide consisting of the amino acid sequence of SEQ ID NO: 15 is based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) of bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. It is a peptide consisting of amino acid residues corresponding to positions 485 to 491. In addition, the peptide consisting of the amino acid sequence of SEQ ID NO: 16 is based on the N-terminus of the total amino acid sequence (SEQ ID NO: 1) of bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. It is a peptide consisting of amino acid residues corresponding to positions 485 to 490. In the peptide consisting of the amino acid sequence of SEQ ID NO: 15 or the peptide consisting of the amino acid sequence of SEQ ID NO: 16, glutamic acid, which is the fifth amino acid residue, is presumed to play a secondary role in the binding reaction with the antibody, and even if substituted with a hydrophobic amino acid, SEQ ID NO: 15 It does not significantly impair the function as an epitope tag of the peptide consisting of the amino acid sequence of or the peptide consisting of the amino acid sequence of SEQ ID NO: 16. At this time, the hydrophobic amino acid may be selected from phenylalanine, tryptophan, isoleucine, leucine, proline, methionine, valine, alanine, and the like, and is preferably any one selected from methionine, alanine, or leucine, and more preferably alanine. For example, among the peptides consisting of the amino acid sequence of SEQ ID NO: 16, a peptide in which glutamic acid, which is the 5th amino acid residue, is substituted with alanine has the amino acid sequence of SEQ ID NO: 35. The peptide consisting of the amino acid sequence of SEQ ID NO: 35 is the 485th based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) of bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. It is a peptide in which glutamic acid, which is an amino acid residue corresponding to position 489 among amino acid residues corresponding to position 490 from position, is substituted with alanine.

The peptide tag consisting of the amino acid sequence of SEQ ID NO: 15 or the peptide tag consisting of the amino acid sequence of SEQ ID NO: 16 according to an embodiment of the present invention is high by a conventional method using bacteriophytochrome of Deinococcus radiodurans as an immunogen. After selecting a bridoma cell line, obtaining an antibody purified from the hybridoma cell line, it was determined by performing epitope mapping using the antibody. Hereinafter, the bacteriophytochrome of Deinococcus radiodurans is expressed as "DrBphP" or "BphP". Deinococcus radiodurance is a type of extreme microorganism that can grow in cryogenic, dry, low oxygen, and strong acid environments. Phytochrome is a light-receiving protein that can absorb external light signals and transmit signals to the lower part.In the existing theory, it was known to exist only in higher plants, but recently, it is found in cyanobacteria, proteobacteria, actinobacteria, and fungi. Several phytochrome-like photoreceptors have been discovered. In particular, the phytochrome-like photoreceptors found in Deinococcus radiodurance and Pseudomonas aeruginosa were named BphP, of which DrBphP is composed of 755 amino acids represented by the amino acid sequence of SEQ ID NO: 1. [Davis SJ, et al., (1999) Science 286, 2517-2520]. The N-terminal region of BphP has a structure similar to that of plant phytochrome, but a histidine kinase domain (HKD) different from plant phytochrome exists in the C-terminal region [Karniol R, et al., (2005) Photosynth Res 392 , 103-116; Giraud E et al., (2008) Photosynth Res 97, 141-153]. And DrBphP combines with biliverdin (BV) without the help of other factors to form a reversible Pr/Pfr isoform [Vierstra RD et al., (2000) Semin Cell Dev Biol 11, 511-521; Bhoo SH, et al., (2001) Nature 414, 776-779; Rockwell NC, et al., (2006) Annu Rev Plant Biol 57, 837-858].

Hereinafter, the steps of epitope mapping for determining a novel peptide tag according to the present invention will be described in detail. First, a polypeptide consisting of a gene corresponding to the full length of BphP of Deinococcus radiodurans (SEQ ID NO: 2) and amino acids at positions 1 to 321 based on the N-terminus of DrBphP (SEQ ID NO: 3; hereinafter, BphN Alternatively, a gene (SEQ ID NO: 4) corresponding to (referred to as DrBphN) was constructed [see Fig. 1 (A)], inserted into the pET28a(+) vector, and then expressed using BL21 competent cells. ^{Then, protein purification was performed by Ni +} -NTA affinity chromatography (QIAGEN) using the His tag included in the pET28a(+) vector. Since the expressed BphP protein (SEQ ID NO: 1) and BphN protein (SEQ ID NO: 3) contain all of the PAS and GAF domains and Cys-24 residues that play an important role in the binding of BV, binding to BV by itself This is possible. To confirm the expression and purification of BphP protein and BphN protein, BV was added to the purified BphP protein and BphN protein, incubated at room temperature for 10 minutes, SDS-PAGE was performed, and coomassie staining and zinc blot were performed. , It was possible to confirm the expression and purification of the BphP protein and the BphN protein [see Fig. 1 (B)]. Next, in order to prepare a monoclonal antibody against BphP, the BphP protein or BphN protein of Deinococcus radiodurans was mixed with Complete Freund's adjuvant as an antigen in the abdominal cavity of a 6-week-old female BALB/c mouse. After intraperitoneal injection, mice were sacrificed to obtain B lymphocytes. Thereafter, B lymphocytes and myeloma cells were mixed and cell-fused and cultured. Thereafter, the HAT medium and HT medium were changed to confirm the generation of antibodies of the fused cells by ELISA, and a total of 24 candidate clones for hybridoma cell lines were selected. A fusion plate ELISA test was performed with BphP protein and BphN protein injected as antigens for a total of 24 hybridoma cell line candidate clones to confirm the degree of binding (Table 2). As a result, the 2B8 clone and the 2C11 clone were presumed to recognize the N-terminal region of the BphP protein, as both BphP protein and BphN protein of Deinococcus radiodurans exhibited high color development. However, the 3B2 clone and the 3D2 clone showed high levels in the BphP protein and close to 0 in the BphN protein, so it was estimated that they recognized the C-terminal region of the BphP protein. Unlike these, the 3H7 clone showed a high level in the BphP protein and a predetermined level in the BphN protein, so it was estimated that the N-terminal region in addition to the C-terminus of the BphP protein was recognized to some extent. Thereafter, the 5 hybridoma cell line clones were subjected to a first cloning plate ELISA test and a second cloning plate ELISA test, and finally ascites were generated to purify the antibody. As a result, five monoclonal antibodies, 2B8 antibody, 2C11 antibody, 3B2 antibody, 3D2 antibody, and 3H7 antibody were obtained. Next, Western blot was performed to check whether the purified antibodies showed the same results for the previously expressed and purified BphP protein and BphN protein. For the purified BphP protein and 5 μg of BphN protein, each monoclonal antibody was used as a primary antibody in a ratio of 1:1000 to 2% skim milk, and then HRP-mouse antibody (SIGMA) was used as a secondary antibody of 1:10000. Western blot was performed by processing at the rate. As a result, the 2B8 antibody and the 2C11 antibody bound to both the BphP protein and the BphN protein as a result of the ELISA test for the hybridoma cell line clone (FIG. 2 ). Therefore, both antibodies could be considered to bind to the N-terminal region of BphP. In addition, as the 3B2 antibody and the 3D2 antibody showed a band for the BphP protein, but no band for the BphN protein, it was possible to obtain a result that the 3B2 antibody and the 3D2 antibody would bind to the C-terminal region of the BphP protein. However, in the case of the 3H7 antibody, unlike the results in the ELISA test, the result of recognizing only the BphP protein came out. In addition, looking at the degree of binding of each antibody, the 2B8 antibody and the 2C11 antibody that bind to the N-terminal region were the most strongly bound, and the 3D2 antibody, which is thought to recognize the C-terminal region, showed a weaker recognition band. Next, a band that strongly binds in the order of 3H7 antibody and 3B2 antibody appeared. Meanwhile, DrBphP has a structure similar to that of plant phytochrome. In particular, PCD constituting the N-terminal region includes PAS, GAF, and PHY domains in both DrBphP and plant phytochrome. It was confirmed whether the antibodies reacted with an oat phytochrome protein similar to DrBphP. However, all five monoclonal antibodies against the BphP protein of Deinococcus radiodurans did not bind to the oat phytochrome protein (Oat PhyA) (FIG. 3). Therefore, it was confirmed that the monoclonal antibodies against the BphP protein of Deinococcus radiodurans are new BphP-specific antibodies that recognize an epitope different from the existing antibodies against the Oat phytochrome protein. In addition, the present inventors have found that by isolating the epitope recognized by the antibodies, it can be used as a specific peptide tag that is not included in any protein of an existing known organism. Specifically, a partial peptide of 3H7 antibody showing specific results among monoclonal antibodies against BphP protein of Deinococcus radiodurans was prepared, and epitope mapping was performed. Specifically, as DNA, the amino acid sequence at positions 485 to 500 (SEQ ID NO: 9), the amino acid sequence at positions 481 to 495 (SEQ ID NO: 10), 485 to 495 based on the N-terminal of the entire amino acid sequence (SEQ ID NO: 1) of DrBphP Amino acid sequence at position (SEQ ID NO: 11), amino acid sequence at position 485 to 494 (SEQ ID NO: 12), amino acid sequence at position 485 to 493, amino acid sequence at position 485 to 492 (SEQ ID NO: 14), amino acid at position 485 to 491 Peptide fragments each including the sequence (SEQ ID NO: 15) and the amino acid sequence at positions 485 to 490 (SEQ ID NO: 16) were prepared, and the presence or absence of binding was confirmed through Western blot. As a result, it was confirmed that 3H7 antibody correctly recognizes and binds only 6 amino acid sequences (SEQ ID NO: 16) corresponding to positions 485-490 based on the N-terminal of the entire amino acid sequence of DrBphP (SEQ ID NO: 1). I did. In addition, it was confirmed that the 3H7 antibody binds more strongly to the 7 amino acid sequences (SEQ ID NO: 16) corresponding to positions 485-491 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 1). From this, it was confirmed that the epitope of the 3H7 antibody was a peptide having an amino acid sequence of SEQ ID NO: 15 or a peptide having an amino acid sequence of SEQ ID NO: 16, and it was confirmed that it can be used as a peptide tag. In addition, peptide fragments in which one amino acid residue in the amino acid sequence of SEQ ID NO: 16 was substituted with alanine, which is a hydrophobic amino acid, were prepared, respectively, and epitope mapping was performed using a 3H7 antibody. As a result, it was confirmed that the peptide having the amino acid sequence of SEQ ID NO: 35 can be used as another epitope of the 3H7 antibody.

In addition, the peptide tag of the present invention may be provided in a form combined with other known epitope tags in order to secure various functions in addition to the amino acid sequence of SEQ ID NO: 15, the amino acid sequence of SEQ ID NO: 16, or the amino acid sequence of SEQ ID NO: 35. For example, the peptide tag of the present invention is a HA tag, a FLAG tag in the amino acid sequence of SEQ ID NO: 15, the amino acid sequence of SEQ ID NO: 16, or the amino acid sequence of SEQ ID NO: 35 in order to improve the detection ability, purification ability, solubility, etc. of the target protein. , His tag, BCCP (biotin carboxyl carrier protein) or MBP (maltose binding protein) may be provided in the form of a combined double tag (US Patent Publication No. 20050221308, US Patent Publication No. 20060099710, US registered patent See Publication No. 6462254). In addition, the peptide tag of the present invention includes two or more tags selected from the amino acid sequence of SEQ ID NO: 15, the amino acid sequence of SEQ ID NO: 16, or the amino acid sequence of SEQ ID NO: 35, a HA tag, a 6×His tag, a c-myc tag, and a V5 tag. May be provided in the form of a combined triple tag or multiple tags (see US Patent Publication No. 20100184612). In addition, the peptide tag of the present invention is in a form in which the amino acid sequence of SEQ ID NO: 15, the amino acid sequence of SEQ ID NO: 16, or the amino acid sequence of SEQ ID NO: 35 is repeated, or some amino acid residues in the repeated amino acid sequence are substituted and deleted, as in the 3×FLAG tag. It may be provided in the form of (see US Patent Publication No. 7135624).

When the peptide tag according to the present invention includes the amino acid sequence of SEQ ID NO: 15, the amino acid sequence of SEQ ID NO: 16, or the amino acid sequence of SEQ ID NO: 35, an antibody corresponding thereto can be used. For example, as an antibody against a peptide tag comprising the amino acid sequence of SEQ ID NO: 15, the amino acid sequence of SEQ ID NO: 16, or the amino acid sequence of SEQ ID NO: 35, the 3H7 antibody described above is mentioned. On the other hand, in the equivalent range of the peptide tag according to the present invention, some amino acids constituting the amino acid sequence of SEQ ID NO: 15, the amino acid sequence of SEQ ID NO: 16, or the amino acid sequence of SEQ ID NO: 35 are individually substituted, deleted, added or modified while simultaneously 3H7 Variants having a predetermined level of binding activity to the antibody, for example, at least 75% or more based on the original binding activity may be included. The amino acid substitution is preferably made by conservative amino acid replacement, which does not change the properties of the peptide. In addition, modification of the amino acid may be performed by glycosylation, acetylation, phosphorylation, or the like. In addition, the peptide tag according to the present invention may include a labeled amino acid. In addition, the peptide tag according to the present invention may include a peptide having increased structural stability against heat, pH, or the like or increased activity against an antibody due to a mutation or modification on an amino acid sequence. For example, the variant tag of the peptide tag according to the present invention is a peptide consisting of the amino acid sequence of SEQ ID NO: 9, a peptide consisting of the amino acid sequence of SEQ ID NO: 10, a peptide consisting of the amino acid sequence of SEQ ID NO: 11, and the amino acid of SEQ ID NO: 12. A peptide consisting of a sequence, a peptide consisting of the amino acid sequence of SEQ ID NO: 12, a peptide consisting of the amino acid sequence of SEQ ID NO: 13 or a peptide consisting of the amino acid sequence of SEQ ID NO: 13, a peptide consisting of the amino acid sequence of SEQ ID NO: 13 is used as a recognition site of an antibody or It may be included as a binding site of an antibody. In addition, the variant tag of the peptide tag according to the present invention is based on the N-terminus of the total amino acid sequence (SEQ ID NO: 1) of bacteriophytochrome (BphP), a light-receiving protein of Deinococcus radiodurans. The peptide containing the amino acid residues corresponding to the 493th position from the th position and at the same time the amino acid residue of the 491th position, alanine is deleted, or the light-receptive protein of Deinococcus radiodurans, Bacteriophytochrome (BphP). A peptide containing amino acid residues corresponding to positions 485 to 493 from the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) and at the same time deletion of glutamine, an amino acid residue at position 492, is a recognition site of an antibody or an antibody It may be included as a binding site of. The inventors of the present invention confirmed that the peptide from which some of the amino acids were deleted also specifically binds to the 3H7 antibody (result not shown).

Another aspect of the present invention relates to a polynucleotide encoding the novel peptide tag described above and a recombinant vector comprising the polynucleotide. In the present invention, the term "polynucleotide" refers to all non-modified or modified polyribonucleotides (RNA) or polydeoxyribonucleotides (DNA). The polynucleotide may be single- or double-stranded DNA, DNA as a mixture of single- and double-stranded regions, single- or double-stranded RNA, RNA as a mixture of single- and double-stranded regions, single- or double-stranded, Or hybrid molecules comprising DNA and RNA, which may be a mixture of single- and double-stranded regions. In addition, the polynucleotide of the present invention contains a pair of primers used to synthesize the above-described novel peptide tag as single-stranded RNA or DNA. In addition, the polynucleotide of the present invention can be used interchangeably with a nucleic acid molecule or an oligonucleotide.

The polynucleotide encoding the peptide may or may not contain an untranslated sequence (eg, intron) (eg, cDNA). The information to which the peptide is encoded is specified using codons. Typically, amino acid sequences are encoded by polynucleotides using the Universal Genetic Code. “Codon” refers to a triplet of nucleotides that determine the amino acid sequence in a polypeptide chain. Most organisms use 20 or 21 amino acids to make proteins or their polypeptides, which are protein precursors. Since there are 4 possible nucleotides in DNA: adenine (A), guanine (G), cytosine (C) and thymine (T), there are 20 amino acids and 64 possible triplets that can encode terminal signals. Due to this redundancy, most amino acids are encoded by more than one triplet. Accordingly, it is possible to allow changes in the nucleotide sequence without affecting the amino acid sequence of the encoded polypeptide, which is referred to as "silent mutation" due to "codon degeneracy". All silent variations of the polynucleotides encoding the novel peptide tags of the present invention are within the scope of the present invention. On the other hand, codons specifying a single amino acid cannot be used at the same frequency, and each organism often exhibits a specific "codon-bias" for one of several codons encoding the same given amino acid. When the coding region contains a large number of rare codons or clusters of rare codons, the expression level can be increased by removing the rare codons using gene resynthesis or mutagenesis [J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001), at 15.12]. Thus, “codon selection” can be used to optimize expression in a selected host. The most preferred codons are those found primarily in highly expressed genes. “Codon preference” in E.coli is described in Konigsberg, et al., Proc. Nat'l. Acad. Sci. U.S.A. See 80:687-91 (1983).

When preparing by chemically synthesizing a nucleotide sequence, a synthetic method well known in the art, for example, a method described in Engels and Uhlmann, Angew Chem IntEd Engl., 37:73-127, 1988, can be used. , Tryester, phosphite, phosphoramidite and H-phosphate methods, PCR and other autoprimer methods, and oligonucleotide synthesis methods on a solid support.

Accordingly, the polynucleotide encoding the novel peptide tag of the present invention may be composed of various nucleotide sequences, for example, the polynucleotide encoding the peptide tag composed of the amino acid sequence of SEQ ID NO: 15 is preferably the base of SEQ ID NO: 33. The polynucleotide encoding a peptide tag consisting of a sequence, and consisting of the amino acid sequence of SEQ ID NO: 16, may preferably consist of a nucleotide sequence of SEQ ID NO: 34, and encoding a peptide tag consisting of the amino acid sequence of SEQ ID NO: 35. The polynucleotide may preferably consist of the nucleotide sequence of SEQ ID NO: 48.

In addition, primer pairs for synthesizing the polynucleotide encoding the peptide tag of the present invention include a forward primer having a nucleotide sequence of SEQ ID NO: 29 and a reverse primer having a nucleotide sequence of SEQ ID NO: 30; A forward primer having the nucleotide sequence of SEQ ID NO: 31 and a reverse primer having the nucleotide sequence of SEQ ID NO: 32; Alternatively, it may be composed of a forward primer having the nucleotide sequence of SEQ ID NO: 44 and a reverse primer having the nucleotide sequence of SEQ ID NO: 45.

In addition, the present invention provides a recombinant vector comprising a polynucleotide encoding a novel peptide tag. For example, the recombinant vector according to the present invention may include a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 33, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 34, or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 48. The recombinant vector may be provided in the form of inserting a polynucleotide encoding a novel peptide tag into a cloning vector or an expression vector using a known standard method. In the present invention, the term "vector" refers to any medium for cloning and/or transfer of a base into a host cell. In the present invention, the vector may be a replicon capable of bringing about the replication of foreign DNA fragments. "Replication unit" refers to any genetic unit (eg, plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, that is, replicable by its own regulation. . The term “vector” includes viral and non-viral mediators for introducing a base into a host cell in vitro, ex vivo or in vivo. The term “vector” may also include minispherical DNA. For example, the vector may be a plasmid that does not have a bacterial DNA sequence. Removal of the abundant bacterial DNA sequence in the CpG region is being done to reduce transgene expression silencing and result in more sustained expression from plasmid DNA vectors. In addition, the term “vector” refers to transposons such as Sleeping Beauty [Izsvak et al. J. MoI. Biol. 302:93-102 (2000)], or artificial chromosomes. In the present invention, the term "cloning vector" is defined as a material capable of carrying and reproducing a DNA fragment into a host cell. In the present invention, the cloning vector may further include a polyadenylation signal, a transcription termination sequence, and a multiple cloning site. In this case, the multiple cloning site includes at least one endonuclease restriction enzyme restriction site. In addition, the cloning vector may further include a promoter. For example, in the present invention, the polynucleotide encoding the novel peptide tag may be located upstream of a polyadenylation signal and a transcription termination sequence, and at least one endonuclease (endonuclease) Restriction sites may be located upstream of a polyadenylation signal and a transcription termination sequence. In addition, in the present invention, the term "expression vector" is defined as a DNA sequence necessary for transcription and translation of the cloned DNA in an appropriate host. In addition, the term "expression vector" in the present invention refers to a genetic construct comprising essential regulatory elements operably linked to the insert so that the insert is expressed when it is present in the cells of an individual. The expression vector can be prepared and purified using standard recombinant DNA techniques. The type of expression vector is not particularly limited as long as it has a function of expressing a desired gene in various host cells of prokaryotic and eukaryotic cells and producing a desired protein, but it is in a natural state while retaining a promoter exhibiting strong activity and strong expression power. A vector capable of mass-producing a foreign protein in a form similar to the one is preferred. It is preferable that the expression vector contains at least a promoter, a start codon, a gene encoding a desired protein, and a stop codon terminator. In addition, DNA encoding a signal peptide, additional expression control sequences, untranslated regions on the 5'and 3'sides of a desired gene, a selection marker region, or a replicable unit may be appropriately included. “Promoter” means a minimal sequence sufficient to direct transcription. In addition, promoter constructs sufficient to express cell type-specific or regulated promoter-dependent genes induced by external signals or agents may be included, and these constructs may be located in the 5'or 3'portion of the gene. . The expression vector according to the present invention may contain both a conservative promoter and an inducible promoter. The promoter sequence can be derived from prokaryote, eukaryote or virus. The term “operably linked” means that a function of one is regulated by another by association of a polynucleotide sequence on a single polynucleotide. For example, if the promoter is capable of controlling the expression of the coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter), the promoter is linked to the coding sequence and operated, or the ribosome binding site can facilitate translation. If located, the ribosome binding site is operated by linking to the coding sequence. The coding sequence can be operated by linking to a regulatory sequence in the sense or antisense direction. The expression vector according to the present invention is a preferred example of a polynucleotide encoding a novel peptide tag, for example, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 33, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 34, or SEQ ID NO: 48 Any one of the polynucleotides consisting of the base sequence of and a target polynucleotide encoding a target protein are included.

Another aspect of the invention relates to a fusion protein comprising the novel peptide tag described above. In the present invention, the term "fusion protein" refers to a polymer in which two or more peptides, oligopeptides, polypeptides or proteins having different functions are linked to each other. In the present invention, the fusion protein may be used interchangeably with a fusion polypeptide, a fusion oligopeptide, a recombinant polypeptide, a recombinant oligopeptide, or a recombinant protein. The first portion of the fusion protein according to the present invention includes at least one of the novel peptide tags described above, and the second portion of the fusion protein includes at least one of the target protein. In the present invention, the protein of interest may be used interchangeably with the peptide of interest, oligopeptide of interest, or polypeptide of interest. The fusion protein according to the present invention can be efficiently detected or purified using an antibody against the novel peptide tag because the novel peptide tag is linked to the codon region of the target protein. The peptide tag according to the present invention may be inserted anywhere inside the protein as long as it does not substantially affect the C-terminus of the target protein, as well as the N-terminus or the function of the protein. Here, the fact that it does not substantially affect the functionality of the protein means that the activity of the protein is maintained at least 80%, preferably at least 95%, before the peptide tag is fused. Any protein may be used as the protein of interest used in the present invention, for example, single-chain FV (ScFv), thrombopoietin (TPO), B of the humanized antibody AKA/HzK against TAG-72, which is a cancer-related antigen. -Lymphocyte stimulator (B-lymphocyte stimulator) can be exemplified. The fusion protein according to the present invention includes a combination of two or more peptides, for example a combination of a peptide tag and a protein of interest, and the two or more peptides may be linked by covalent bonds or non-covalent bonds. At this time, the peptide tag and the target protein may be directly linked to each other without any mediator, or may be indirectly linked by a mediator such as a peptide linker. As a preferred example, when the fusion protein includes at least one cleavable peptide linker, the cleavable linker may be chemically and/or enzymatically cleaved to recover the target protein from the fusion protein. Thus, the fusion protein according to the present invention may preferably be designed to contain one or more tags, a cleavable peptide linker and a protein of interest. Linkers generally have no specific biological activity other than associating proteins or maintaining a minimum spacing or other spatial relationship between these proteins, but the constituent amino acids of a peptide linker are not subject to the properties of the molecule, such as folding, net charge, or hydrophobicity. It can be chosen to have some influence. The peptide linker may optionally contain a site for separation of the fused constituent polypeptide, for example a site that can be cleaved by a protease. The cleavable peptide linker may be 1 to about 50 amino acids in length, preferably 1 to about 20 amino acids in length. Enzymatically cleavable peptide linkers may comprise, for example, a caspase-3 cleavable sequence, and acid cleavable peptide linkers may comprise, for example, an aspartic acid-proline dipeptide (DP) moiety. I can. Cleavable peptide linkers can be incorporated into fusion proteins using a number of techniques well known in the art. In addition, a flexible peptide linker may be used, and a peptide linker having a GGSGGT amino acid sequence, a GGGGS amino acid sequence, and a GGGGSGGGGS amino acid sequence may be used, but is not limited thereto. The peptide linker operably connects the polynucleotide containing the peptide linker in frame between polynucleotides encoding each peptide of the fusion protein, and can be expressed through an expression vector.

Means for preparing peptides (peptide tags, cleavable peptide linkers, peptides of interest, and/or fusion peptides) in the present invention are well known in the art [Stewart et al., Solid Phase Peptide Synthesis, Pierce Chemical Co., Rockford, IL, 1984; Bodanszky, Principles of Peptide Synthesis, Springer-Verlag, New York, 1984; And Pennington et al., Peptide Synthesis Protocols, Humana Press, Totowa, NJ, 1994). The various components of the fusion peptide described herein (tag peptide, peptide of interest, and cleavable linker etc./cleavage sequence) can be prepared by known chemical synthesis methods [Hermanson, Greg T., Bioconjugate Techniques, Academic Press , New York (1996)), chemical synthesis is often limited to peptides less than about 50 amino acids in length due to cost and/or impurities. The peptides described herein can be prepared preferably using standard recombinant DNA and molecular cloning techniques [Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring. Harbor, NY (2001); Silhavy, TJ, et al., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Cold Press Spring Harbor, NY (1984); And Ausubel, FM et. al., Short Protocols in Molecular Biology, 5th Ed. Current Protocols and John Wiley and Sons, Inc., NY, 2002].

Another aspect of the present invention relates to a transformant comprising the above-described expression vector. In the present invention, the term "transformant" refers to a cell transformed by introducing an expression vector having a polynucleotide encoding one or more proteins of interest into a host cell. Methods for preparing transformants by introducing the expression vector into host cells include transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection ( liposemmediated transfection), DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation, electroinjection, PEG, etc. There is a chemical treatment method, a method using a gene gun, etc., but is not limited thereto. When the transformant into which the expression vector has been introduced is cultured in a nutrient medium, a fusion protein can be produced in large quantities and can be separated. The medium and culture conditions can be appropriately selected and used according to the host cell. During cultivation, conditions such as temperature, pH of the medium, and culture time should be appropriately adjusted to suit the growth of cells and mass production of proteins. Host cells that can be transformed with the expression vector according to the present invention are not greatly limited, as long as they are known in the art, such as prokaryotic cells, plant cells, insect cells, and animal cells, and preferably the DNA introduction efficiency is A host having high and high expression efficiency of the introduced DNA is usually used. For example, known prokaryotic hosts such as Escherichia, Pseudomonas, Bacillus, and Streptomyces may be used as host cells, and E. coli may be used preferably. Expression of the protein by the host cell can be induced by using isopropyl-1-thio-β-D-galactopyranoside (IPTG), which is an inducing factor, and the induction time can be adjusted to maximize the amount of protein. The protein produced recombinantly in the present invention can be recovered from a medium or cell lysate. When the recombinant protein is membrane-bound, it can be released from the membrane by using a suitable surfactant solution (eg Triton-X 100) or by enzymatic cleavage. Cells used for protein expression can be destroyed by various physical or chemical means such as freeze-thaw repetition, sonication, mechanical destruction, or cytolysis, and can be separated or purified by conventional biochemical separation techniques (Sambrook et al., Molecular Cloning: A laborarory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989; Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 182. Academic Press. Inc., San Diego, CA, 1990). For example, methods of separation or purification of proteins expressed by host cells include electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion exchange chromatography, affinity chromatography, immunosorbent affinity chromatography, reverse phase). HPLC, gel permeation HPLC), isoelectric focus and various variations or complex methods thereof. Meanwhile, the fusion protein comprising the peptide tag according to the present invention may be preferably separated and purified using immunosorbent affinity chromatography using an antibody against the peptide tag.

Another aspect of the present invention relates to an antibody against the above-described novel peptide tag and a hybridoma cell line capable of producing the same. The antibody according to the present invention is a peptide consisting of the amino acid sequence of SEQ ID NO: 15, a peptide consisting of the amino acid sequence of SEQ ID NO: 16, and a peptide in which glutamic acid, which is the fifth amino acid residue among the peptides consisting of the amino acid sequence of SEQ ID NO: 15, is substituted with a hydrophobic amino acid, or It is an antibody capable of specifically recognizing or specifically or selectively binding to a peptide in which glutamic acid, which is the fifth amino acid residue, is substituted with a hydrophobic amino acid among the peptides consisting of the amino acid sequence of SEQ ID NO: 16. In the present invention, the term "antibody" refers to a substance produced by stimulation of a specific antigen in the immune system, and can specifically bind to the specific antigen to induce an antigen-antibody reaction, and not only the natural form produced by the immune system , And functional fragments of antibody molecules having an activity equivalent to that of the natural form. The natural type of antibody is generally a structure having two light chains and two heavy chains, and each light chain is connected to a heavy chain by a disulfide bond. The functional fragment of an antibody molecule refers to a fragment having an antigen-binding function, and includes Fab, F(ab'), F(ab')2, Fv, and the like. Among antibody fragments, Fab has a structure having a light chain and a heavy chain variable region, a light chain constant region, and a heavy chain first constant region (CH1), and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region containing at least one cysteine residue at the C-terminus of the heavy chain CH1 domain. F(ab')2 is generated when the cysteine residue of the hinge region of Fab' forms a disulfide bond. Fv is the smallest antibody fragment having only the variable region of the heavy chain and the variable region of the light chain, and the recombinant technology for generating the Fv fragment is disclosed in International Patent Publications WO 88/10649, WO 88/106630, WO 88/07085, WO 88/07086 and WO 88. /09344. The double-chain Fv (dsFv) is a disulfide bond to connect the heavy chain variable region and the light chain variable region, and the single chain Fv (scFv) is generally covalently linked to the variable region of the heavy chain and the variable region of the light chain through a peptide linker. have. Such antibody fragments can be obtained using proteolytic enzymes [for example, restriction digestion of the whole antibody with papain can yield Fab, and F(ab')2 fragment can be obtained by digestion with pepsin], preferably It can be produced through genetic recombination technology. For the purposes of the present invention, the antibody may be an antibody capable of specifically binding to the peptide tag of the present invention, preferably in the form of a Fab or a whole antibody, more preferably in the form of a monoclonal antibody. . In addition, the present invention provides a hybridoma cell line capable of producing a monoclonal antibody against the novel peptide tag described above. The hybridoma cell line was deposited with the Korea Research Institute of Bioscience and Biotechnology Life Resource Center (KCTC) on July 9, 2013, and the accession number is KCTC 12442BP.

A monoclonal antibody having specific binding to the novel peptide tag of the present invention can be prepared using the peptide tag or a polypeptide containing the same as an immunogen. More specifically, first, as an immunogen, the peptide tag is injected subcutaneously, intramuscularly, intravenously, or intraperitoneally in mammals other than humans once or more to sensitize the immune system. At this time, the peptide tag is used in a mixed form with Freund adjutant, if necessary. The mammals other than humans are preferably mice, rats, hamsters, molemots, rabbits, cats, dogs, pigs, goats, sheep, donkeys, horses, cows, etc., and transgenic mice that produce human antibodies Transgenic animals that have been engineered to produce antibodies derived from other animals such as, more preferably, mice, rats, hamsters, moles or rabbits. Immunization is performed 1 to 4 times every about 1 to 21 days from the first immunization, and about 1 to 10 days after the final immunization, antibody-producing cells can be obtained from immune-sensitized mammals. The number of times and time intervals for immunization can be appropriately changed depending on the characteristics of the immunogen to be used. Preparation of a hybridoma secreting a monoclonal antibody can be carried out according to a method such as Keira and Mirstein (Nature, 1975, Vol. 256, p. 495-497) and a method similar thereto. Any one selected from the group consisting of spleen, lymph node, bone marrow, and tonsils collected from animals other than humans that have been immune-sensitized as described above, preferably derived from cells that produce antibodies contained in the spleen and mammals that do not have the ability to produce autoantibodies. Hybridoma cells can be produced by fusion of myeloma cells of Myeloma cells used for the cell fusion include mouse-derived myeloma P3/X63-AG8. 653(653), P3/NSI/1-Ag4-1(NS-1), P3/X63-Ag8. U1 (P3U1), SP2/0-Ag14 (Sp2/O, Sp2), PAI, F0 or BW5147; Rat-derived myeloma 210 RCY3-Ag. 2.3; Alternatively, human myeloma U-266 AR1, GM1500-6TG-A1-2, UC729-6, CEM-AGR, D1R11 or CEM-T15 can be used. For cell fusion, for example, a method using a fusion promoter including polyethylene glycol or Sendai virus or an electric pulse is used. For example, antibody-producing cells and cells of mammalian origin capable of infinite proliferation in a fusion medium containing a fusion promoter. Is suspended in a ratio of about 1:1 to 1:10, and incubated for about 1 to 5 minutes at about 30 to 40°C in this state. As the fusion medium, for example, MEM medium, RPMI1640 medium, and Iscove's Modified Dulbecco's Medium may be used as usual, and it is preferable to exclude sera such as bovine serum. In the method of screening for hybridoma cell clones producing monoclonal antibodies, the obtained fusion cells are transferred to a selection medium such as HAT medium, and cultured at about 30 to 40° C. for about 3 days to 3 weeks to prevent hybridoma cells. Kills its cells. Subsequently, after culturing hybridoma cells on a microtiter plate, etc., the reactivity between the immunogen used for the immune response of animals other than humans described above and the culture supernatant was determined by using a radioactive substance-marked immuno antibody (RIA) or It is confirmed through an immunoassay method such as ELISA (Enzyme-Linked Immunosorbent Assay), and hybridoma cells with increased reactivity are found. Hybridoma cell clones producing the monoclonal antibodies found above show specific binding power to the immunogen. The monoclonal antibody of the present invention can be obtained by culturing a hybridoma cell line in vitro or in vitro. In the cultivation, a conventional method for culturing mammalian-derived cells is used, and in order to collect a monoclonal antibody from a culture or the like, a conventional method in this field for purifying the general antibody is used. As a method for purifying the antibody, for example, salting out, dialysis, filtration, concentration, centrifugation, fractional precipitation, gel filtration chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography, Gel electrophoresis, isoelectric point electrophoresis, and the like, and these are applied in combination as necessary. The purified monoclonal antibody is then concentrated, dried, and stored in a liquid or solid state depending on the intended use. In addition, the monoclonal antibody of the present invention connects the DNA encoding the heavy and light chain variable regions with known DNA (for example, Japanese Laid-Open Patent Publication No. 2007-252372) by PCR or chemical synthesis. After introducing the synthesized and synthesized gene into a known expression vector (for example, pcDNA 3.1 (sold by Invitrogen)), a transformant was prepared using the expression vector, and the transformed CHO cells or host cells such as E. coli Can be expressed by culturing, and can be obtained by purifying the expressed antibody from such a culture medium using a Protein A column or the like.

Another aspect of the present invention relates to the use of the above-described novel peptide tag, a polynucleotide encoding the peptide tag, or an antibody against the peptide tag.

For example, an example of the present invention provides a method of preparing the fusion protein described above. A method for producing a fusion protein according to an embodiment of the present invention includes the step of culturing a transformant into which a polynucleotide encoding the fusion protein is introduced to express the fusion protein. At this time, the polynucleotide encoding the fusion protein is preferably introduced into the transformant in a form contained in a recombinant vector. In addition, the recombinant vector includes a polynucleotide encoding a peptide tag and a target polynucleotide encoding a target protein linked thereto, wherein the two polynucleotides preferably include a site that can be cleaved by a proteolytic enzyme or the like. It is connected by the coding sequence of a peptide linker.

In addition, an example of the present invention provides a method for detecting the above-described fusion protein. A method for detecting a fusion protein according to an embodiment of the present invention includes the steps of contacting and binding a peptide tag and a fusion protein to which a target protein is linked to an antibody against the peptide tag; And confirming the presence or analyzing the amount of the fusion protein bound to the antibody. At this time, the method for detecting a fusion protein according to an embodiment of the present invention is specifically Western blot, ELISA (Enzyme-linked immunosorbent assay), immunoprecipitation, immunofluorescence, immunocytochemistry, or protein micro Arrays or the like can be used. In this case, the protein microarray is immobilized on a glass substrate or a silicon substrate with a specific antibody against the peptide tag of the present invention, and can be used for analysis of large-scale samples.

In addition, an example of the present invention provides a method for purifying the above-described fusion protein. A method for purifying a fusion protein according to an embodiment of the present invention includes the steps of contacting and binding a peptide tag and a fusion protein to which a target protein is linked to an antibody against the peptide tag; And recovering the fusion protein bound to the antibody. At this time, the antibody is immobilized on a support, preferably a solid support. Examples of the support for immobilizing the antibody include columns, beads, adsorbents, nitrocellulose paper, and the like, and the antibody may be immobilized on the support through various known immobilization methods. A specific example of the method for purifying a fusion protein according to the present invention includes a process of contacting a sample containing the tagged protein with a support to which an antibody is immobilized. At this time, the tagged protein is a protein in which a target protein is covalently linked to a peptide tag, the peptide tag has a specific binding activity for an antibody, and the contact is made under conditions in which the antibody binds to the peptide tag. Subsequently, the method for purifying a fusion protein according to the present invention may include removing components not bound to the antibody and separating the tagged protein from the support. At this time, the support and the antibody immobilized thereon are used as a medium for immunoaffinity chromatography. Immuno-affinity column chromatography may be performed using a column packed with the medium. By using the purification method of the present invention, a highly purified fusion protein can be obtained, and further, the target protein contained in the fusion protein can maintain its unique function.

In addition, an example of the present invention provides a kit for expression, detection or purification of a fusion protein. The kit for expression, detection or purification of a fusion protein according to the present invention includes the above-described novel peptide tag, a polynucleotide encoding the peptide tag, a primer pair for synthesizing the polynucleotide, a recombinant vector containing a polynucleotide, and the polynucleotide. It includes any one selected from a transformant transformed with a nucleotide or a recombinant vector. In addition, the kit for expression, detection or purification of a fusion protein according to the present invention may include any one selected from an antibody against the above-described novel peptide tag or a hybridoma cell line that produces the antibody. In addition, the kit for expressing the fusion protein according to the present invention preferably contains a recombinant vector comprising a polynucleotide encoding the novel peptide tag of the present invention. Further, the kit for detection or purification of a fusion protein according to the present invention preferably contains an antibody against the novel peptide of the present invention. At this time, the recombinant vector constituting the kit is preferably an expression vector containing a polynucleotide encoding a fusion protein, or provided in a form in which a user can easily prepare an expression vector. The fusion protein is a polypeptide to which a peptide tag and a protein of interest are linked. In addition, it is preferable that the antibody constituting the kit is provided in a fixed form on an appropriate support. In addition, it is preferable that the fusion protein detection kit further includes a means capable of detecting an antibody against the peptide tag. At this time, the means capable of detecting the antibody of the present invention is preferably a secondary antibody. In addition, the antibody or secondary antibody of the present invention constituting the kit for detecting the fusion protein may be preferably labeled with a labeling material such as an enzyme, a radioactive material, or a fluorescent material, and the labeling method is preferably conjugation. . In addition, the kit for purifying the fusion protein may further include a proteolytic enzyme for separating the peptide tag. In addition, the kit according to the present invention may further include instructions, restriction enzymes, ligase, and buffer solutions.

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are only intended to clearly illustrate the technical features of the present invention, and do not limit the scope of protection of the present invention.

Example One: Daynocaucus Of Deinococcus radiodurans BphP Genes and BphN Genetic Cloning

Deinococcus radiodurans bacteriophytochrome protein (BphP; SEQ ID NO: 1) A polypeptide consisting of a gene encoding the full length (SEQ ID NO: 2) and an amino acid at positions 1 to 321 based on the N-terminus of DrBphP The gene (SEQ ID NO: 4) encoding (BphN; SEQ ID NO: 3) was cloned using PCR. Specifically, the gene (SEQ ID NO: 2) encoding the entire length of Deinococcus radiodurans bacteriophytochrome protein (BphP) is used as a template, and a primer for cloning the BphP gene or a primer for cloning the BphN gene, and PCR was performed around 30 cycles using Ex-Taq (TAKARA) polymerase, and amplified BphP DNA products and BphN DNA products were obtained. Table 1 below shows the primers used to obtain the amplified BphP DNA product and the BphN DNA product. The primers shown in Table 1 and all primers described below were produced by requesting Bioneer co.(KR).

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 5 Forward primer for BphP cloning GCCATATGATGAGCCGGGACCCGTTGCCC Nde I 6 Reverse primer for BphP cloning GCCTCGAGTCAGGCATCGGCGGCTCCCGG Xho I 7 Forward primer for BphN cloning GCCATATGATGAGCCGGGACCCGTTGCCC Nde I 8 Reverse primer for BphN cloning GCCTCGAGCGCTTCCTTGACCTGAACTTG Xho I

The amplified PCR product was run on a 1% agarose gel (QA-Agarose gel TM, Q-BIO, CAT#AGAH0250), and the size of the amplified DNA was checked through an ultraviolet irradiator. After that, only the band on the gel corresponding to the DNA amplification product is cut out, and only the desired DNA is separated using a gel elution kit (FavorPrep GEL/PCR purification mini kit, FAVORGEN, CAT#FAGCK001-1), and then Easy T-vector (promega) Was bound to, and commissioned to Bioneer co. (KR) to measure the base sequence. As a result, it was confirmed that the DNA product generated through PCR had the desired target nucleotide sequences, BphP DNA and BphN DNA.

Thereafter, the BphP DNA product and BphN DNA product amplified using restriction enzymes Nde I and Xho I were inserted into pET28a(+) vector (manufacturer: Novagen), respectively, and BL21 competent cells (manufacturer: RBC, Taipei, etc.) Taiwan) was transformed by applying heat shock at 42° C. for 1 minute, and cultured on LB medium containing kanamycin to express BphP protein and BphN protein.

Example 2 : Daynocaucus Of Deinococcus radiodurans BphP Protein and BphN Protein expression

Colonies transformed into BL21 competent cells and grown on LB medium were inoculated into LB medium containing kanamycin, and seed cultured at 37° C. for about 8 hours or more. After inoculating the seeded cells in LB medium containing kanamycin and growing _{at the concentration until the value at OD 600} becomes 0.6, IPTG (isopropyl-1-thio-β-D-galactopyranoside) so that the total concentration becomes 0.5mM. ) Was added and protein expression was induced at 25° C. for 6 hours. Thereafter, the cells were centrifuged to discard the supernatant, and the pellet was resuspended in binding buffer (100mM Tris-Cl, 150mM NaCl, and 10mM imidazole, pH 8.0). Next, the pellet was resuspended to break the cells, centrifuged again to separate only the supernatant, and then the protein was purified using a ^{Ni + -NTA column (QIAGEN).} After that, the purified protein was stored at -70°C.

Since the BphP protein and the BphN protein contain all of the PAS and GAF domains and Cys-24 residues, which play an important role in the binding of BV, it is possible to bind to BV by itself. To obtain the holo-BphP protein, biliverdin (BV, 2 μg/ml, Frontier, Scientific, Carnforth, UK) was added to the purified Apo-BphP protein and Apo-BphN protein, and reacted at room temperature for 10 minutes. Subsequently, SDS-PAGE was performed on the reaction samples, and then reacted with zinc acetate solution (20 mM zinc acetate, 150 mM Tris-Cl, pH 7.0) for 20 minutes, and then the fluorescent signal of the protein was observed under UV. In addition, SDS-PAGE was performed on the reaction samples, followed by coomassie staining. The left of FIG. 1B shows the result of coomassie staining, and the right of FIG. 1B shows the result of zinc blot. As shown in (B) of FIG. 1, it was confirmed that the expression and purification of the BphP protein and the BphN protein were smoothly performed.

Example 3: Daynocaucus Of Deinococcus radiodurans BphP Protein and BphN Preparation of monoclonal antibody specifically binding to protein

3-1: Immunization

Purified BphP protein or BphN protein was used as an antigen, complete Freund's adjuvant was mixed therein, and then injected into the abdominal cavity of a 6-week-old female BALB/c mouse. Immersion was mixed for 1 hour with a vortexer, and then Incomplete Freund's adjuvant and antigen were mixed in the same manner and injected intraperitoneally. After 2 weeks, blood was collected from the tail of the mouse and used for cell fusion if the titer of the antibody was 1/1000 to 1.0 or higher after ELISA test. At 4 weeks from the secondary immunization treatment for cell fusion, the same amount of antigen was diluted in PBS and injected intraperitoneally. After 3 days, the mice were sacrificed to allow cell fusion.

3-2: Cell fusion for monoclonal antibody production

As a cell source for B lymphocytes, after abdominal incision, fat or other organs were separated as much as possible and the spleen was aseptically removed to prevent excessive bleeding, homogenized with a cell strainer, diluted with a basic medium, and washed by repeating centrifugation twice. B lymphocytes and myeloma cells are mixed at an appropriate ratio, centrifuged for 5 minutes to discard the supernatant, shake the remaining cell mixture lightly, add 10 ml of pre-warmed RBC lysis buffer, suspend, and incubate at 37°C for 20 minutes. FBS was added and centrifuged. Cell fusion was performed as follows. First, a PEG (polyethlyene glycerol) 1500 solution was slowly added to the centrifuged cell mixture while maintaining at 37°C, and the reaction was stopped by adding a basic medium again. Thereafter, the supernatant was discarded by rapid centrifugation, and the remaining cell mixture was carefully suspended in a macrophage medium, dispensed on a 96 well tissue culture plate, and cultured in a carbon dioxide incubator under conditions of 37°C.

3-3: Selection of fusion cells

Five days after the cell fusion was carried out, HAT medium, which is a selective medium for fusion cells, was added to each well. Thereafter, HAT medium was added in the same manner at intervals of 3 days, and after 11 days of cell fusion, the complete medium was replaced with HT medium supplemented with HT supplement, and the degree of growth of the fused cells was observed under a microscope every day. Take the supernatant of the well with the growth confirmed and confirm antibody production by ELISA, and once the fusion cell line that is determined to secrete the desired antibody is performed 1st, 2nd, and 3rd cloning with a limiting dilution method, the fusion cell population is one cell line. Was made to be a clone derived from.

3-4: Selection of fusion cells by ELISA

After cell fusion for immunity to the immunized antigen and for the production of monoclonal antibodies, an antigen protein solution diluted with ELISA coating buffer was added to a 96 well tissue culture plate for selection of fusion cells, and reacted at 4°C. Then, the antigen protein solution was sucked and removed, a blocking solution was added to the remaining surface of each well, and reacted at 37° C. for 1 hour. After that, the blocking solution was removed and washed three times with PBST solution. The fusion cell culture supernatant was added to each well and reacted at 37°C, and the solution was removed and washed three times with PBST solution. Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG) was diluted in PBS to each well. OPD (orthophenylenediammine dihydrochloride) substrate solution was added to the well and reacted at room temperature for 10 minutes, and the reaction was stopped with a stop solution. At this time, the absorbance was measured at 492 nm with an ELISA reader in order to confirm the degree of reaction and color development, and a total of 24 candidate hybridoma cell line clones were selected based on the measured results.

3-5: Reconfirmation of binding degree with antigen and purification of antibody through Fusion plate ELISA test

A fusion plate ELISA test was performed with BphP protein and BphN protein injected as antigens for a total of 24 candidate hybridoma cell line clones to confirm the degree of binding, and the results are shown in Table 2 below. As shown in Table 2 below, the 2B8 clone and the 2C11 clone were presumed to recognize the N-terminal region of the BphP protein, as both the BphP protein and the BphN protein of Deinococcus radiodurans exhibited high color development. . However, the 3B2 clone and the 3D2 clone showed high levels in the BphP protein and close to zero in the BphN protein, so it was estimated that they recognized the C-terminal region of the BphP protein. Unlike these, the 3H7 clone showed a high level in the BphP protein and a certain low level in the BphN protein, so it was estimated that the N-terminal region was recognized to some extent in addition to the C-terminal side of the BphP protein.

Hybridoma cell line clone Degree of binding to antigenic protein (absorbance at 492 nm) BphN BphP(full) 1B6 0.0660 1.3190 1B11 0.1560 2.3700 1D6 0.0550 2.3180 2B8 2.3400 2.4200 2 C11 2.3480 2.4040 2D9 0.1430 2.2730 2E3 2.1720 1.8020 2F7 0.1220 2.4430 2H8 0.0650 1.3440 3A4 1.9180 2.3770 3B2 0.0980 2.2900 3B3 0.0700 2.1650 3C11 1.9730 2.2590 3 D2 0.0640 2.2830 3D10 0.1180 2.4280 3D11 1.6850 2.3130 3F10 0.0730 2.3570 3G2 0.0880 2.0510 3G9 0.0800 1.5580 3H1 1.7840 2.0950 3 H7 0.4640 2.3490 4B7 1.9730 2.2620 4E2 0.2050 2.3770 4E3 0.0550 2.2650

Thereafter, the 5 hybridoma cell line clones were subjected to a first cloning plate ELISA test and a second cloning plate ELISA test, and finally ascites were generated to purify the antibody. As a result, five monoclonal antibodies, 2B8 antibody, 2C11 antibody, 3B2 antibody, 3D2 antibody, and 3H7 antibody were obtained. The antibody was purified by the following method. After intraperitoneal injection of 0.5 ml of pristane into BALB/c mice of 8 weeks or more, hybridoma cells were cultured 1 to 10 days later, washed 3 times with PBS, and PBS to ^{a concentration of 5×10 6} cells/0.5 ml. After diluted with, it was injected into the abdominal cavity using a syringe. After 1 week to 10 days, ascites were observed to fill, and ascites were collected using a serum separation tube while sacrificing the mouse by cervical dislocation, making a small hole in the abdomen, and taking care not to flow ascites. It was allowed to stand at room temperature for about 1 hour and centrifuged to remove RBC. After adding an appropriate amount of PBS to the collected ascites, it was slowly mixed with ammonium sulfate at 4°C. After centrifugation at 4° C., it was passed through a filter. After adding an appropriate amount of beads mixed with Protein A and DFMF, the Tris buffer solution was washed with 10 times the volume of the bed. When the antibody was added and well mixed with protein A/G, a fraction was obtained, washed with Tris buffer, and then elution was performed several times with glycine. The thus-purified antibody was placed in a dialysis bag, dialyzed in PBS buffer for 3 hours, replaced with PBS buffer, dialyzed overnight, and the antibody after dialysis was quantified and stored.

Example 4: Analysis of the specificity of monoclonal antibodies

Western blot was performed to check whether the obtained antibodies showed the same results for the previously expressed and purified BphP protein and BphN protein. Each monoclonal antibody with a concentration of 1 mg/ml as a primary antibody against the purified BphP protein and 5 μg of BphN protein was used in a ratio of 1:1000 for 2% skim milk, and then HRP-mouse antibody as a secondary antibody ( SIGMA) was treated at a ratio of 1:10000 to perform Western blot. As a result, the 2B8 antibody and the 2C11 antibody bound to both the BphP protein and the BphN protein as a result of the ELISA test for the hybridoma cell line clone (FIG. 2). Therefore, both antibodies could be considered to bind to the N-terminal region of BphP. In addition, as the 3B2 antibody and the 3D2 antibody showed a band for the BphP protein, but no band for the BphN protein, it was possible to obtain a result that the 3B2 antibody and the 3D2 antibody would bind to the C-terminal region of the BphP protein. However, in the case of the 3H7 antibody, it was found that only the BphP protein was recognized, unlike the result in the ELISA test. In addition, as for the degree of binding of each antibody, the 2B8 antibody and the 2C11 antibody that bind to the N-terminal region were the most strongly bound, and the 3D2 antibody, which is thought to recognize the C-terminal region, showed a weaker recognition band. Next, a band that strongly binds in the order of 3H7 antibody and 3B2 antibody appeared.

On the other hand, DrBphP has a structure similar to that of plant phytochrome.In particular, since both PCDs constituting the N-terminal region have very similar structures including PAS, GAF, and PHY domains, the antibodies are oat phytochrome proteins. I checked whether it reacts with. However, all five monoclonal antibodies against the BphP protein of Deinococcus radiodurans did not bind to the oat phytochrome protein (Oat PhyA) (FIG. 3). Therefore, it was confirmed that the monoclonal antibodies against the BphP protein of Deinococcus radiodurans are new BphP-specific antibodies that recognize an epitope different from the existing antibodies against the Oat phytochrome protein.

The present inventors deposited 3H7 hybridoma cell line 3H7 of the 3H7 antibody among monoclonal antibodies against the BphP protein of Deinococcus radiodurans to the Korea Research Institute of Bioscience and Biotechnology Life Resources Center (KCTC) on July 9, 2013 And, the accession number of the hybridoma cell line 3H7 is KCTC 12442BP. Then, the isotype of the 3H7 antibody was determined by ELISA using a mouse antibody. The heavy chain isotype of the 3H7 antibody was IgG 2b, and the light chain isotype was κ(kappa).

Example 5: 3 H7 Of monoclonal antibodies Epitope For confirmation Epitope Mapping

5-1: primary epitope mapping

In order to identify the epitope of the 3H78 antibody, which is a monoclonal antibody against the BphP protein of Deinococcus radiodurans, a DrBphP recombinant partial peptide was prepared and epitope mapping was performed.

First, DNA encoding the amino acid sequence (SEQ ID NO: 9) at positions 485 to 500 (SEQ ID NO: 9) from the N-terminal of the entire amino acid sequence of DrBphP (SEQ ID NO: 1), encoding the amino acid sequence at positions 481 to 495 (SEQ ID NO: 10) DNA, the DNA encoding the amino acid sequence at positions 485 to 495 (SEQ ID NO: 11), the DNA encoding the amino acid sequence at positions 485 to 494 (SEQ ID NO: 12), the amino acid sequence at positions 485 to 493 (SEQ ID NO: 13) DNA encoding, DNA encoding the amino acid sequence at positions 485 to 492 (SEQ ID NO: 14), DNA encoding the amino acid sequence at positions 485 to 491 (SEQ ID NO: 15), and the amino acid sequence at positions 485 to 490 (SEQ ID NO: 16) In order to clone the DNA encoding the primers were prepared for each. Deinococcus radiodurans (Deinococcus radiodurans) bacteriophytochrome protein (BphP) gene encoding the entire length (SEQ ID NO: 2) as a template and using the prepared primer and PrimeSTAR HS (TAKARA, R040) polymerase PCR 30 It was carried out before and after the cycle, and an amplified DNA product was obtained. Table 3 below shows the primers used in PCR to obtain DNA amplification products encoding the eight DrBphP recombinant partial peptides.

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 17 BphP 485-800 a.a. Forward primer for cloning GCGGATCCATGCCCGGCGAAATCGAGGAGGCG BamH I 18 BphP 485-500 a.a. Reverse primer for cloning GCCTCGAGTCACCCGGTCAATGTGTCACGTAG Xho I 19 BphP 481-495 a.a. Forward primer for cloning GCGGATCCATGGAGCCCTGGCATCCCGGCGAA BamH I 20 BphP 481-495 a.a. Reverse primer for cloning GCGAATTCTCAACGTAGATCCTGCGCCTCCTC EcoR I 21 BphP 485-495 a.a. Forward primer for cloning GCGGATCCATGCCCGGCGAAATCGAGGAGGCG BamH I 22 BphP 485-495 a.a. Reverse primer for cloning GCGAATTCTCAACGTAGATCCTGCGCCTCCTC EcoR I 23 BphP 485-494 a.a. Forward primer for cloning GCGGATCCATGCCCGGCGAAATCGAGGAGGCG BamH I 24 BphP 485-494 a.a. Reverse primer for cloning GCGAATTCTCATAGATCCTGCGCCTCCTC EcoR I 25 BphP 485-493 a.a. Forward primer for cloning GCGGATCCATGCCCGGCGAAATCGAGGAGGCG BamH I 26 BphP 485-493 a.a. Reverse primer for cloning GCGAATTCTCAATCCTGCGCCTCCTCGAT EcoR I 27 BphP 485-492 a.a. Forward primer for cloning GCGGATCCATGCCCGGCGAAATCGAGGAGGCG BamH I 28 BphP 485-492 a.a. Reverse primer for cloning GCGAATTCTCACTGCGCCTCCTCGATTTCGCC EcoR I 29 BphP 485-491 a.a. Forward primer for cloning GCGGATCCATGCCCGGCGAAATCGAGGAGGCG BamH I 30 BphP 485-491 a.a. Reverse primer for cloning GCGAATTCTCACGCCTCCTCGATTTCGCCGGG EcoR I 31 BphP 485-490 a.a. Forward primer for cloning GCGGATCCATGCCCGGCGAAATCGAGGAG BamH I 32 BphP 485-490 a.a. Reverse primer for cloning GCGAATTCTCACTCCTCGATTTCGCCGGG EcoR I

The amplified PCR product was run on a 1% agarose gel (QA-Agarose gel TM, Q-BIO, CAT#AGAH0250), and the size of the amplified DNA was checked through an ultraviolet irradiator. After that, only the band on the gel corresponding to the DNA amplification product was cut out, and only the desired DNA was separated using a gel elution kit (FavorPrep GEL/PCR purification mini kit, FAVORGEN, CAT#FAGCK001-1), and then pJET (CloneJET PCR cloning kit, Fermentas, #K1232) was ligated to the vector. Thereafter, 30 to 50 µl of DH5 α competent cells (manufacturer: Invitrogen) were added to about 10 to 20 µl of binding vector, incubated on ice for 20 minutes, and then heat shocked at 42°C for 1 minute. shock), recovered on ice for another 20 minutes, spreading on an LB medium plate containing ampicillin, and incubated at 37° C. overnight to transform. Thereafter, when colonies grow, inoculate in LB medium containing ampicillin and culture at 37°C overnight to grow cells, and then plasmids using a plasmid extraction kit (FavorPrep Plasmid Extraction kit, FAVORGEN, cat#FAPDE300). Extracted. Thereafter, the extracted plasmid was entrusted to Bioneer co., KR to measure the base sequence. As a result, it was confirmed that the DNA product generated through PCR had the desired target nucleotide sequence.

In addition, after cutting the plasmid extracted using a restriction enzyme and the pGEX4T1 vector ((GE Healthcare, Piscataway, NJ, USA) with its own GST tag, N of the total amino acid sequence of DrBphP (SEQ ID NO: 1) as the target DNA. -DNA encoding the amino acid sequence at positions 485 to 500 (SEQ ID NO: 9) from the end, DNA encoding the amino acid sequence at positions 481 to 495 (SEQ ID NO: 10), the amino acid sequence at positions 485 to 495 (SEQ ID NO: 11) ) Encoding DNA, DNA encoding amino acid sequence at positions 485 to 494 (SEQ ID NO: 12), DNA encoding amino acid sequence at positions 485 to 493 (SEQ ID NO: 13), amino acid sequence at positions 485 to 492 (SEQ ID NO: 14), the DNA encoding the amino acid sequence at positions 485 to 491 (SEQ ID NO: 15) and the DNA encoding the amino acid sequence at positions 485 to 490 (SEQ ID NO: 16) are each bound to the protein expression vector pGEX4T1 vector. Thereafter, E. coli BL21 competent cells (manufacturer: RBC, Taipei, Taiwan) were transformed with pGEX4T1 vector containing the target DNA, and then cultured on LB medium containing ampicillin to induce protein expression. Thereafter, the cultured cells were crushed using sonication, and only the supernatant obtained by centrifugation was separated. GST resin (Glutathion Sepharose™) High Performance, GE Healthcare) was used to purify the protein. Western blot was performed on the purified protein and the BphP protein of Deinococcus radiodurans. At this time, 3H7 monoclonal antibody and anti-GST antibody were used as the primary antibody, and Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG; Sigma) was used as the secondary antibody. In addition, Amersham™ ECL™ is used to develop samples transferred to cellulose membranes after SDS-PGAE. Western Blotting Detection Reagents (GE Healthcare, RPN2106OL/AF) were used. 4 shows the results of primary epitope mapping for 3H7 antibody through Western blot and coomassie staining. As shown in Figure 4, the epitope of the 3H7 antibody is a peptide (SEQ ID NO: 15) consisting of 7 amino acid sequences corresponding to positions 485 to 491 based on the N-terminus among the entire amino acid sequence of DrBphP (SEQ ID NO: 1), and DrBphP It was confirmed that a peptide (SEQ ID NO: 16) consisting of 6 amino acid sequences corresponding to positions 485 to 490 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) can also be used as a peptide tag. In addition, a blast search was performed for the amino acid sequence of SEQ ID NO: 16, and it was confirmed that there was no overlapping amino acid sequence in general E. coli or plants except for some bacteria. From this, it can be seen that the possibility of nonspecific binding is very low when the peptide consisting of the amino acid sequence of SEQ ID NO: 15 or the peptide consisting of the amino acid sequence of SEQ ID NO: 16 is used as an epitope tag. Meanwhile, an example of the polynucleotide encoding the peptide of SEQ ID NO: 15 includes the nucleotide sequence of SEQ ID NO: 33, and an example of the polynucleotide encoding the peptide of SEQ ID NO: 16 includes the nucleotide sequence of SEQ ID NO: 34.

5-2: Secondary epitope mapping

Through the primary epitope mapping, it was confirmed that the peptide consisting of the amino acid sequence of SEQ ID NO: 16 is the minimum length epitope for the 3H7 antibody.

The present inventors substituted some of the amino acid residues with hydrophobic amino acids and performed epitope mapping in order to identify amino acid residues that play an important role in binding to the 3H7 antibody among the amino acid residues constituting the peptide of SEQ ID NO: 16. Specifically, one of the amino acid residues constituting SEQ ID NO: 16 was substituted with alanine to prepare a DrBphP modified partial peptide. Thereafter, secondary epitope mapping was performed to determine whether the 3H7 antibody recognizes the DrBphP modified partial peptide as well.

First, it encodes a peptide (represented as P485A) in which proline, which is the 485th amino acid residue, is substituted with alanine, including the amino acid sequence at positions 485-490 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 1). DNA, a peptide containing the amino acid sequence at positions 485-490 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 1), and at the same time, the 486th amino acid residue glycine is substituted with alanine (represented by G486A). A peptide containing the amino acid sequence at positions 485-490 based on the N-terminus of the encoding DNA and the entire amino acid sequence of DrBphP (SEQ ID NO: 1), and at the same time, glutamic acid, the 487th amino acid residue, is substituted with alanine (represented by E487A) DNA encoding the DNA, a peptide containing the amino acid sequence at positions 485-490 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) of DrBphP, and at the same time replacing isoleucine, the 488th amino acid residue, with alanine (shown as I488A DNA encoding), a peptide containing the amino acid sequence at positions 485-490 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) of DrBphP, and at the same time replacing glutamic acid, the 489th amino acid residue, with alanine (E489A) Mark; DNA encoding SEQ ID NO: 35) and the amino acid sequence at positions 485-490 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) of DrBphP, and at the same time, glutamic acid, which is the 490th amino acid residue, is substituted with alanine. In order to clone the DNA encoding the peptide (represented by E490A), primers for each were prepared. PCR was performed around 30 cycles using the prepared primer and PrimeSTAR HS (TAKARA, R040) polymerase, and an amplified DNA product was obtained. The PCR reaction for DNA cloning does not require a separate template, and a template for amplification can be obtained by combining a forward primer and a reverse primer during one cycle of PCR. Table 4 below shows the primers used in PCR to obtain DNA amplification products encoding the six DrBphP modified partial peptides. Since the process after obtaining the DNA amplification product by PCR is the same as that of the primary epitope mapping, the description will be omitted. In addition, a peptide (SEQ ID NO: 15) consisting of 7 amino acid sequences corresponding to positions 485 to 491 of the entire amino acid sequence (SEQ ID NO: 1) of DrBphP was expressed and used as a control.

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 36 Forward primer for P485A cloning GCGGATCCATGGCGGGCGAAATCGAGGAG BamH I 37 Reverse primer for cloning P485A GCGAATTCTCACTCCTCGATTTCGCCCGC EcoR I 38 Forward primer for G486A cloning GCGGATCCATGCCCGCGGAAATCGAGGAG BamH I 39 Reverse primer for G486A cloning GCGAATTCTCACTCCTCGATTTCCGCGGG EcoR I 40 E487A forward primer for cloning GCGGATCCATGCCCGGCGCGATCGAGGAG BamH I 41 E487A reverse primer for cloning GCGAATTCTCACTCCTCGATCGCGCCGGG EcoR I 42 Forward primer for I488A cloning GCGGATCCATGCCCGGCGAAGCGGAGGAG BamH I 43 Reverse primer for I488A cloning GCGAATTCTCACTCCTCCGCTTCGCCGGG EcoR I 44 Forward primer for E489A cloning GCGGATCCATGCCCGGCGAAATCGCGGAG BamH I 45 E489A reverse primer for cloning GCGAATTCTCACTCCGCGATTTCGCCGGG EcoR I 46 Forward primer for E490A cloning GCGGATCCATGCCCGGCGAAATCGAGGCG BamH I 47 E490A cloning reverse primer GCGAATTCTCACGCCTCGATTTCGCCGGG EcoR I

5 shows the results of secondary epitope mapping for 3H7 antibody through Western blot and coomassie staining. As shown in Figure 5, another epitope of the 3H7 antibody includes the amino acid sequence at positions 485-490 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 1), and at the same time, glutamic acid, which is the 489th amino acid residue, is substituted with alanine. It was confirmed to be the peptide (represented by E489A, SEQ ID NO: 35). Meanwhile, an example of a polynucleotide encoding the peptide of SEQ ID NO: 35 includes the nucleotide sequence of SEQ ID NO: 48.

Example 6: 3 H7 Against monoclonal antibodies Epitopes Reactivity comparison

The epitope for the 3H7 antibody by the primary epitope mapping and the secondary epitope mapping is a peptide consisting of an amino acid sequence (SEQ ID NO: 15) at positions 485 to 491 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) of DrBphP. , Peptide consisting of the amino acid sequence (SEQ ID NO: 16) at positions 485 to 490 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 1) and 485 based on the N-terminus of the total amino acid sequence (SEQ ID NO: 1) of DrBphP It was confirmed that it was a peptide containing the amino acid sequence at position -490 and at the same time, glutamic acid, which is the 489th amino acid residue, was substituted with alanine (represented by E489A, SEQ ID NO: 35).

The DNA encoding the three peptides was cloned and ligated to a pGEX4T1 vector ((GE Healthcare, Piscataway, NJ, USA) having a GST tag, and the E. coli BL21 as a pGEX4T1 vector containing the target DNA. After transforming competent cells (manufacturer: RBC, Taipei, Taiwan), protein expression was induced, and the expressed protein was then used in GST resin (Glutathion Sepharose™). High Performance, GE Healthcare). Western blot was performed on the purified protein. 6 is a result of performing Western blot to compare the reactivity of three epitopes to 3H7 antibody. As shown in FIG. 6, based on reactivity, a peptide consisting of an amino acid sequence at positions 485 to 491 (SEQ ID NO: 15) based on the N-terminus of the total amino acid sequence of DrBphP (SEQ ID NO: 1) and the total amino acids of DrBphP A peptide containing the amino acid sequence at positions 485-490 based on the N-terminus of the sequence (SEQ ID NO: 1) and in which glutamic acid, which is the 489th amino acid residue, is substituted with alanine (represented by E489A, SEQ ID NO: 35) is in 3H7 antibody. It has been shown to be more suitable as an epitope tag for.

Example 6: 3 H7 Antibodies and their Epitope Preparation and detection of fusion proteins using tags

GST (Glutathion-S-Transferase) to confirm whether the fusion protein containing the epitope tag of the present invention is normally expressed on E. coli , and whether the expressed fusion protein can be detected with a 3H7 monoclonal antibody. ) A DNA construct encoding a fusion protein to which an epitope tag was linked in front of the protein was prepared. In order to clone the DNA encoding the peptide consisting of the amino acid sequence of SEQ ID NO: 15, which is an epitope tag of the present invention, and the peptide consisting of the amino acid sequence of SEQ ID NO: 35, primers for each were prepared. In addition, in order to clone DNA encoding the Flag tag, His tag, and Myc tag used as a commercial epitope tag, primers for each were prepared. PCR was performed around 30 cycles using the prepared primer and PrimeSTAR HS (TAKARA, R040) polymerase, and an amplified DNA product was obtained. The PCR reaction for DNA cloning does not require a separate template, and a template for amplification can be obtained by combining a forward primer and a reverse primer during one cycle of PCR. Table 5 below shows the primers used in PCR to obtain the five DNA amplification products. After separating only the desired DNA from the amplified PCR product, it was ligated to a pJET (CloneJET PCR cloning kit, Fermentas, #K1232) vector. Thereafter, the binding vector was entrusted to Bioneer co. (KR) to measure the base sequence. As a result, it was confirmed that the DNA product generated through PCR had the desired target nucleotide sequence.

Sequence number Primer type Base sequence (5'→3') Restriction enzyme recognition site included in the primer 29 BphP 485-491 a.a. Forward primer for cloning GCGGATCCATGCCCGGCGAAATCGAGGAGGCG BamH I 30 BphP 485-491 a.a. Reverse primer for cloning GCGAATTCTCACGCCTCCTCGATTTCGCCGGG EcoR I 44 Forward primer for E489A cloning GCGGATCCATGCCCGGCGAAATCGCGGAG BamH I 45 E489A reverse primer for cloning GCGAATTCTCACTCCGCGATTTCGCCGGG EcoR I 49 Forward primer for flag tag cloning GCGGATCCATGGATTACAAGGATGACGACGATAAG BamH I 50 Flag tag cloning reverse primer GCGAATTCTCACTTATCGTCGTCATCCTTGTAATC EcoR I 51 Forward prime for His tag cloning GCGGATCCATGCACCACCACCACCACCAC BamH I 52 Reverse primer for His tag cloning GCGAATTCTCAGTGGTGGTGGTGGTGGTG EcoR I 53 Forward prime for cloning myc tags GCGGATCCATGGAACAAAAATTAATTTCTGAAGAAGATTTA BamH I 54 Reverse primer for cloning Myc tags GCGAATTCTCATAAATCTTCTTCAGAAATTAATTTTTGTTC EcoR I

Subsequently, the isolated DNA product was bound to a pGEX4T1 vector ((GE Healthcare, Piscataway, NJ, USA) containing DNA encoding GST (Glutathion-S-Transferase) protein as an expression vector. The DNA product and the pGEX4T1 vector ((GE Healthcare, Piscataway, NJ, USA) were digested using restriction enzymes BamH I and EcoR I, and ligated using ligase. BL21 competent cells (manufacturer: RBC, Taipei, Taiwan) were transformed by applying heat shock at 42° C. for 1 minute, and cultured on LB medium containing ampicillin to sequence the N-terminus of GST protein. A fusion protein to which a peptide tag consisting of the amino acid sequence of No. 15 is linked (indicated by GST::7aa), a fusion protein to which a peptide tag consisting of the amino acid sequence of SEQ ID No. 35 is linked to the N-terminus of the GST protein (GST::E489A) Indication), a fusion protein with a Flag tag linked to the N-terminus of the GST protein (indicated by GST::Flag), a fusion protein with a His tag linked to the N-terminus of the GST protein (indicated by GST::His), A fusion protein (indicated by GST::Myc) linked to the N-terminus of the GST protein was expressed, respectively, specifically, colonies transformed into BL21 competent cells and grown on LB medium containing ampicillin. Inoculated in LB medium and seeded for at least 8 hours at 37° C. The seeded cells were inoculated into LB medium containing ampicillin and grown _{to a concentration until the value at OD 600} reached 0.6, and the total concentration was 0.5. Mm, IPTG was added and protein expression was induced for 6 hours at 25° C. After that, commercially available GST resin (Glutathion Sepharose™) was added. High Performance, GE Healthcare) was used to purify the protein. Western blot was performed on the purified protein. At this time, antibodies to each tag (eg 3H7 monoclonal antibody, anti-Flag antibody, anti-His antibody, anti-Myc antibody) were used as the primary antibody, and Horseradish peroxidase (HRP) conjugated anti -mouse immunoglobulin (anti-mouse IgG; Sigma) was used. In addition, Amersham™ ECL™ is used to develop samples transferred to cellulose membranes after SDS-PGAE. Western Blotting Detection Reagents (GE Healthcare, RPN2106OL/AF) were used. 7 is a Western blot result showing that the fusion protein with the peptide tag of the present invention attached to the N-terminus of the GST protein is normally expressed on E. coli and the fusion protein can be detected by the 3H7 antibody. As shown in Figure 7, the fusion protein with the peptide tag of the present invention attached to the N-terminus of the GST protein was smoothly expressed in E. coli , and the expressed fusion protein was detected at a satisfactory level by the 3H7 antibody. . In addition, the epitope tagging system using the peptide tag and the 3H7 antibody of the present invention showed almost the same level of effect as compared to the epitope tagging system using commonly used commercial tags such as His tag, Myc tag, and respective antibodies thereto. . Furthermore, when the peptide tag of the present invention was expressed on E. coli, non-specific binding was not observed.

As described above, the present invention has been described through the above embodiments, but the present invention is not necessarily limited thereto, and various modifications may be possible without departing from the scope and spirit of the present invention. Accordingly, the scope of protection of the present invention should be construed as including all embodiments falling within the scope of the claims appended to the present invention.

Korea Research Institute of Bioscience and Biotechnology KCTC12442BP 20130709

<110> University-Industry Cooperation Group of Kyung Hee University Myongji University Industry and Academia Cooperation Foundation <120> Novel peptide tag, antibody for epitope tagging, hybridoma cell line and use thereof <130> DP-15-454 <160> 54 <170> KopatentIn 2.0 <210> 1 <211> 755 <212> PRT <213> Deinococcus radiodurans BphP <400> 1 Met Ser Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu Tyr Leu Gly Gly 1 5 10 15 Pro Glu Ile Thr Thr Glu Asn Cys Glu Arg Glu Pro Ile His Ile Pro 20 25 30 Gly Ser Ile Gln Pro His Gly Ala Leu Leu Thr Ala Asp Gly His Ser 35 40 45 Gly Glu Val Leu Gln Met Ser Leu Asn Ala Ala Thr Phe Leu Gly Gln 50 55 60 Glu Pro Thr Val Leu Arg Gly Gln Thr Leu Ala Ala Leu Leu Pro Glu 65 70 75 80 Gln Trp Pro Ala Leu Gln Ala Ala Leu Pro Pro Gly Cys Pro Asp Ala 85 90 95 Leu Gln Tyr Arg Ala Thr Leu Asp Trp Pro Ala Ala Gly His Leu Ser 100 105 110 Leu Thr Val His Arg Val Gly Glu Leu Leu Ile Leu Glu Phe Glu Pro 115 120 125 Thr Glu Ala Trp Asp Ser Thr Gly Pro His Ala Leu Arg Asn Ala Met 130 135 140 Phe Ala Leu Glu Ser Ala Pro Asn Leu Arg Ala Leu Ala Glu Val Ala 145 150 155 160 Thr Gln Thr Val Arg Glu Leu Thr Gly Phe Asp Arg Val Met Leu Tyr 165 170 175 Lys Phe Ala Pro Asp Ala Thr Gly Glu Val Ile Ala Glu Ala Arg Arg 180 185 190 Glu Gly Leu His Ala Phe Leu Gly His Arg Phe Pro Ala Ser Asp Ile 195 200 205 Pro Ala Gln Ala Arg Ala Leu Tyr Thr Arg His Leu Leu Arg Leu Thr 210 215 220 Ala Asp Thr Arg Ala Ala Ala Val Pro Leu Asp Pro Val Leu Asn Pro 225 230 235 240 Gln Thr Asn Ala Pro Thr Pro Leu Gly Gly Ala Val Leu Arg Ala Thr 245 250 255 Ser Pro Met His Met Gln Tyr Leu Arg Asn Met Gly Val Gly Ser Ser 260 265 270 Leu Ser Val Ser Val Val Val Gly Gly Gln Leu Trp Gly Leu Ile Ala 275 280 285 Cys His His Gln Thr Pro Tyr Val Leu Pro Pro Asp Leu Arg Thr Thr 290 295 300 Leu Glu Tyr Leu Gly Arg Leu Leu Ser Leu Gln Val Gln Val Lys Glu 305 310 315 320 Ala Ala Asp Val Ala Ala Phe Arg Gln Ser Leu Arg Glu His His Ala 325 330 335 Arg Val Ala Leu Ala Ala Ala His Ser Leu Ser Pro His Asp Thr Leu 340 345 350 Ser Asp Pro Ala Leu Asp Leu Leu Gly Leu Met Arg Ala Gly Gly Leu 355 360 365 Ile Leu Arg Phe Glu Gly Arg Trp Gln Thr Leu Gly Glu Val Pro Pro 370 375 380 Ala Pro Ala Val Asp Ala Leu Leu Ala Trp Leu Glu Thr Gln Pro Gly 385 390 395 400 Ala Leu Val Gln Thr Asp Ala Leu Gly Gln Leu Trp Pro Ala Gly Ala 405 410 415 Asp Leu Ala Pro Ser Ala Ala Gly Leu Leu Ala Ile Ser Val Gly Glu 420 425 430 Gly Trp Ser Glu Cys Leu Val Trp Leu Arg Pro Glu Leu Arg Leu Glu 435 440 445 Val Ala Trp Gly Gly Ala Thr Pro Asp Gln Ala Lys Asp Asp Leu Gly 450 455 460 Pro Arg His Ser Phe Asp Thr Tyr Leu Glu Glu Lys Arg Gly Tyr Ala 465 470 475 480 Glu Pro Trp His Pro Gly Glu Ile Glu Glu Ala Gln Asp Leu Arg Asp 485 490 495 Thr Leu Thr Gly Ala Leu Gly Glu Arg Leu Ser Val Ile Arg Asp Leu 500 505 510 Asn Arg Ala Leu Thr Gln Ser Asn Ala Glu Trp Arg Gln Tyr Gly Phe 515 520 525 Val Ile Ser His His Met Gln Glu Pro Val Arg Leu Ile Ser Gln Phe 530 535 540 Ala Glu Leu Leu Thr Arg Gln Pro Arg Ala Gln Asp Gly Ser Pro Asp 545 550 555 560 Ser Pro Gln Thr Glu Arg Ile Thr Gly Phe Leu Leu Arg Glu Thr Ser 565 570 575 Arg Leu Arg Ser Leu Thr Gln Asp Leu His Thr Tyr Thr Ala Leu Leu 580 585 590 Ser Ala Pro Pro Pro Val Arg Arg Pro Thr Pro Leu Gly Arg Val Val 595 600 605 Asp Asp Val Leu Gln Asp Leu Glu Pro Arg Ile Ala Asp Thr Gly Ala 610 615 620 Ser Ile Glu Val Ala Pro Glu Leu Pro Val Ile Ala Ala Asp Ala Gly 625 630 635 640 Leu Leu Arg Asp Leu Leu Leu His Leu Ile Gly Asn Ala Leu Thr Phe 645 650 655 Gly Gly Pro Glu Pro Arg Ile Ala Val Arg Thr Glu Arg Gln Gly Ala 660 665 670 Gly Trp Ser Ile Ala Val Ser Asp Gln Gly Ala Gly Ile Ala Pro Glu 675 680 685 Tyr Gln Glu Arg Ile Phe Leu Leu Phe Gln Arg Leu Gly Ser Leu Asp 690 695 700 Glu Ala Leu Gly Asn Gly Leu Gly Leu Pro Leu Cys Arg Lys Ile Ala 705 710 715 720 Glu Leu His Gly Gly Thr Leu Thr Val Glu Ser Ala Pro Gly Glu Gly 725 730 735 Ser Thr Phe Arg Cys Trp Leu Pro Asp Ala Gly Pro Leu Pro Gly Ala 740 745 750 Ala Asp Ala 755 <210> 2 <211> 2268 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP <400> 2 atgagccggg acccgttgcc cttttttcca ccgctttacc ttggtggccc ggaaattacc 60 accgagaact gcgagcgcga gccgattcat attcccggca gcatccagcc gcacggcgcc 120 ctgctcactg ccgacgggca cagcggcgag gtgctccaga tgagcctcaa cgcggccact 180 tttctgggac aggaacccac agtgctgcgc ggacagaccc tcgccgcact gctgcccgag 240 cagtggcccg cgctgcaagc ggccctgccc cccggctgcc ccgacgccct gcaataccgc 300 gcaacgctgg actggcctgc cgccgggcac ctttcgctga cggtgcaccg ggtcggcgag 360 ttgctgattc tggaattcga gccgacggag gcctgggaca gcaccgggcc gcacgcgctg 420 cgcaacgcga tgttcgcgct cgaaagtgcc cccaacctgc gggcgctggc cgaggtggcg 480 acccagacgg tccgcgagct gacgggcttt gaccgggtga tgctctacaa atttgccccc 540 gacgccaccg gcgaagtgat tgccgaggcc cgccgtgagg ggctgcacgc ctttctgggc 600 caccgttttc ccgcgtcgga cattccggcg caggcccgcg cgctctacac ccggcacctg 660 ctgcgcctga ccgccgacac ccgcgccgcc gccgtgccgc tcgatcccgt cctcaacccg 720 cagacgaatg cgcccacccc gctgggcggc gccgtgctgc gcgccacctc gcccatgcac 780 atgcagtacc tgcggaacat gggcgtcggg tcgagcctgt cggtgtcggt ggtggtcggc 840 ggccagctct ggggcctgat cgcctgccac caccagacgc cctacgtgtt gccgcccgac 900 ctgcgaacca cgctcgaata cctgggccgc ttgctgagcc tgcaagttca ggtcaaggaa 960 gcggcggacg tggcggcctt tcgccagagc ctgcgggagc accacgcgcg ggtggccctc 1020 gcggcggcgc actcgctctc gccgcacgac accctcagtg acccggcgct tgacctgctg 1080 ggcctgatgc gggccggggg cctgattctg cgtttcgagg gccgctggca gacgttgggt 1140 gaagtgccgc ctgccccggc ggtggacgcg ctgctggcgt ggctcgaaac ccagccgggc 1200 gccctggtcc agaccgacgc gctgggccaa ctgtggcccg ccggcgccga tctcgccccc 1260 agcgcagcgg gcctgctcgc catcagcgtg ggcgagggct ggtcggagtg cctcgtctgg 1320 ctgcggcccg aactgcggct ggaggtcgcc tggggcgggg ccactcctga ccaggcgaaa 1380 gacgacctcg ggccgcgcca ctcattcgac acctacctcg aagaaaaacg cggctacgcc 1440 gagccctggc atcccggcga aatcgaggag gcgcaggatc tacgtgacac attgaccggg 1500 gcgctgggcg agcgcctgag cgtgattcgt gacctcaacc gggcgctcac acagtcgaac 1560 gccgagtggc ggcagtacgg cttcgttatc agccaccaca tgcaggagcc ggtgcggctc 1620 atctcgcagt tcgccgagtt gctgacgcgc cagccccgcg cccaggacgg gtctccggac 1680 tctccgcaga ccgagcgcat caccggcttt ctgctgcgcg aaacgtcgcg cctgcgcagc 1740 ctgacgcaag acctccacac ctacaccgcg ctgctctcgg caccgccgcc ggtgcgccgc 1800 cccacgccgc tgggccgcgt ggtggacgat gtgctgcaag acctcgaacc ccgcattgcc 1860 gacaccggag cgagcatcga ggtggcgccc gagttgcccg tcatcgctgc cgacgctggc 1920 ctgctgcgcg acctgctgct gcatctgatc ggcaacgcgc tgacgtttgg tggcccggag 1980 ccgcgtattg ccgtaaggac cgaacggcaa ggcgcgggtt ggtctatcgc ggtcagtgac 2040 cagggcgctg gcatcgcgcc cgagtatcag gaacgaatct ttctgctgtt tcagcggctc 2100 ggttcgctcg atgaggcgct gggcaacggc ctgggcctgc cgctgtgccg caagatcgcc 2160 gaactgcatg gcggcaccct gaccgtggag tccgcgccag gcgagggcag caccttccgt 2220 tgctggctgc ccgatgctgg gcctcttccg ggagccgccg atgcctga 2268 <210> 3 <211> 321 <212> PRT <213> Deinococcus radiodurans BphP 1-321 a.a. <400> 3 Met Ser Arg Asp Pro Leu Pro Phe Phe Pro Pro Leu Tyr Leu Gly Gly 1 5 10 15 Pro Glu Ile Thr Thr Glu Asn Cys Glu Arg Glu Pro Ile His Ile Pro 20 25 30 Gly Ser Ile Gln Pro His Gly Ala Leu Leu Thr Ala Asp Gly His Ser 35 40 45 Gly Glu Val Leu Gln Met Ser Leu Asn Ala Ala Thr Phe Leu Gly Gln 50 55 60 Glu Pro Thr Val Leu Arg Gly Gln Thr Leu Ala Ala Leu Leu Pro Glu 65 70 75 80 Gln Trp Pro Ala Leu Gln Ala Ala Leu Pro Pro Gly Cys Pro Asp Ala 85 90 95 Leu Gln Tyr Arg Ala Thr Leu Asp Trp Pro Ala Ala Gly His Leu Ser 100 105 110 Leu Thr Val His Arg Val Gly Glu Leu Leu Ile Leu Glu Phe Glu Pro 115 120 125 Thr Glu Ala Trp Asp Ser Thr Gly Pro His Ala Leu Arg Asn Ala Met 130 135 140 Phe Ala Leu Glu Ser Ala Pro Asn Leu Arg Ala Leu Ala Glu Val Ala 145 150 155 160 Thr Gln Thr Val Arg Glu Leu Thr Gly Phe Asp Arg Val Met Leu Tyr 165 170 175 Lys Phe Ala Pro Asp Ala Thr Gly Glu Val Ile Ala Glu Ala Arg Arg 180 185 190 Glu Gly Leu His Ala Phe Leu Gly His Arg Phe Pro Ala Ser Asp Ile 195 200 205 Pro Ala Gln Ala Arg Ala Leu Tyr Thr Arg His Leu Leu Arg Leu Thr 210 215 220 Ala Asp Thr Arg Ala Ala Ala Val Pro Leu Asp Pro Val Leu Asn Pro 225 230 235 240 Gln Thr Asn Ala Pro Thr Pro Leu Gly Gly Ala Val Leu Arg Ala Thr 245 250 255 Ser Pro Met His Met Gln Tyr Leu Arg Asn Met Gly Val Gly Ser Ser 260 265 270 Leu Ser Val Ser Val Val Val Gly Gly Gln Leu Trp Gly Leu Ile Ala 275 280 285 Cys His His Gln Thr Pro Tyr Val Leu Pro Pro Asp Leu Arg Thr Thr 290 295 300 Leu Glu Tyr Leu Gly Arg Leu Leu Ser Leu Gln Val Gln Val Lys Glu 305 310 315 320 Ala <210> 4 <211> 963 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP 1-321 a.a. <400> 4 atgagccggg acccgttgcc cttttttcca ccgctttacc ttggtggccc ggaaattacc 60 accgagaact gcgagcgcga gccgattcat attcccggca gcatccagcc gcacggcgcc 120 ctgctcactg ccgacgggca cagcggcgag gtgctccaga tgagcctcaa cgcggccact 180 tttctgggac aggaacccac agtgctgcgc ggacagaccc tcgccgcact gctgcccgag 240 cagtggcccg cgctgcaagc ggccctgccc cccggctgcc ccgacgccct gcaataccgc 300 gcaacgctgg actggcctgc cgccgggcac ctttcgctga cggtgcaccg ggtcggcgag 360 ttgctgattc tggaattcga gccgacggag gcctgggaca gcaccgggcc gcacgcgctg 420 cgcaacgcga tgttcgcgct cgaaagtgcc cccaacctgc gggcgctggc cgaggtggcg 480 acccagacgg tccgcgagct gacgggcttt gaccgggtga tgctctacaa atttgccccc 540 gacgccaccg gcgaagtgat tgccgaggcc cgccgtgagg ggctgcacgc ctttctgggc 600 caccgttttc ccgcgtcgga cattccggcg caggcccgcg cgctctacac ccggcacctg 660 ctgcgcctga ccgccgacac ccgcgccgcc gccgtgccgc tcgatcccgt cctcaacccg 720 cagacgaatg cgcccacccc gctgggcggc gccgtgctgc gcgccacctc gcccatgcac 780 atgcagtacc tgcggaacat gggcgtcggg tcgagcctgt cggtgtcggt ggtggtcggc 840 ggccagctct ggggcctgat cgcctgccac caccagacgc cctacgtgtt gccgcccgac 900 ctgcgaacca cgctcgaata cctgggccgc ttgctgagcc tgcaagttca ggtcaaggaa 960 gcg 963 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP <400> 5 gccatatgat gagccgggac ccgttgccc 29 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP <400> 6 gcctcgagtc aggcatcggc ggctcccgg 29 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 1-321 a.a. <400> 7 gccatatgat gagccgggac ccgttgccc 29 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 1-321 a.a. <400> 8 gcctcgagcg cttccttgac ctgaacttg 29 <210> 9 <211> 16 <212> PRT <213> Deinococcus radiodurans BphP 485-500 a.a. <400> 9 Pro Gly Glu Ile Glu Glu Ala Gln Asp Leu Arg Asp Thr Leu Thr Gly 1 5 10 15 <210> 10 <211> 15 <212> PRT <213> Deinococcus radiodurans BphP 481-495 a.a. <400> 10 Glu Pro Trp His Pro Gly Glu Ile Glu Glu Ala Gln Asp Leu Arg 1 5 10 15 <210> 11 <211> 11 <212> PRT <213> Deinococcus radiodurans BphP 485-495 a.a. <400> 11 Pro Gly Glu Ile Glu Glu Ala Gln Asp Leu Arg 1 5 10 <210> 12 <211> 10 <212> PRT <213> Deinococcus radiodurans BphP 485-493 a.a. <400> 12 Pro Gly Glu Ile Glu Glu Ala Gln Asp Leu 1 5 10 <210> 13 <211> 9 <212> PRT <213> Deinococcus radiodurans BphP 485-493 a.a. <400> 13 Pro Gly Glu Ile Glu Glu Ala Gln Asp 1 5 <210> 14 <211> 8 <212> PRT <213> Deinococcus radiodurans BphP 485-492 a.a. <400> 14 Pro Gly Glu Ile Glu Glu Ala Gln 1 5 <210> 15 <211> 7 <212> PRT <213> Deinococcus radiodurans BphP 485-491 a.a. <400> 15 Pro Gly Glu Ile Glu Glu Ala 1 5 <210> 16 <211> 6 <212> PRT <213> Deinococcus radiodurans BphP 485-490 a.a. <400> 16 Pro Gly Glu Ile Glu Glu 1 5 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 485-800 a.a. <400> 17 gcggatccat gcccggcgaa atcgaggagg cg 32 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 485-800 a.a. <400> 18 gcctcgagtc acccggtcaa tgtgtcacgt ag 32 <210> 19 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 481-495 a.a. <400> 19 gcggatccat ggagccctgg catcccggcg aa 32 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 481-495 a.a. <400> 20 gcgaattctc aacgtagatc ctgcgcctcc tc 32 <210> 21 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 485-495 a.a. <400> 21 gcggatccat gcccggcgaa atcgaggagg cg 32 <210> 22 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 485-495 a.a. <400> 22 gcgaattctc aacgtagatc ctgcgcctcc tc 32 <210> 23 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 485-494 a.a. <400> 23 gcggatccat gcccggcgaa atcgaggagg cg 32 <210> 24 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 485-494 a.a. <400> 24 gcgaattctc atagatcctg cgcctcctc 29 <210> 25 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 485-493 a.a. <400> 25 gcggatccat gcccggcgaa atcgaggagg cg 32 <210> 26 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 485-493 a.a. <400> 26 gcgaattctc aatcctgcgc ctcctcgat 29 <210> 27 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 485-492 a.a. <400> 27 gcggatccat gcccggcgaa atcgaggagg cg 32 <210> 28 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 485-492 a.a. <400> 28 gcgaattctc actgcgcctc ctcgatttcg cc 32 <210> 29 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 485-491 a.a. <400> 29 gcggatccat gcccggcgaa atcgaggagg cg 32 <210> 30 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 485-491 a.a. <400> 30 gcgaattctc acgcctcctc gatttcgccg gg 32 <210> 31 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Deinococcus radiodurans BphP 485-490 a.a. <400> 31 gcggatccat gcccggcgaa atcgaggag 29 <210> 32 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Deinococcus radiodurans BphP 485-490 a.a. <400> 32 gcgaattctc actcctcgat ttcgccggg 29 <210> 33 <211> 21 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP 485-491 a.a. <400> 33 cccggcgaaa tcgaggaggc g 21 <210> 34 <211> 18 <212> DNA <213> nucleotides for Deinococcus radiodurans BphP 485-490 a.a. <400> 34 cccggcgaaa tcgaggag 18 <210> 35 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> 489th Glu-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 35 Pro Gly Glu Ile Ala Glu 1 5 <210> 36 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 485th Pro-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 36 gcggatccat ggcgggcgaa atcgaggag 29 <210> 37 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 485th Pro-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 37 gcgaattctc actcctcgat ttcgcccgc 29 <210> 38 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 486th Gly-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 38 gcggatccat gcccgcggaa atcgaggag 29 <210> 39 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 486th Gly-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 39 gcgaattctc actcctcgat ttccgcggg 29 <210> 40 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 487th Glu-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 40 gcggatccat gcccggcgcg atcgaggag 29 <210> 41 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 487th Glu-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 41 gcgaattctc actcctcgat cgcgccggg 29 <210> 42 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 488th Ile-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 42 gcggatccat gcccggcgaa gcggaggag 29 <210> 43 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 488th Ile-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 43 gcgaattctc actcctccgc ttcgccggg 29 <210> 44 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 489th Glu-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 44 gcggatccat gcccggcgaa atcgcggag 29 <210> 45 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 489th Glu-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 45 gcgaattctc actccgcgat ttcgccggg 29 <210> 46 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 490th Glu-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 46 gcggatccat gcccggcgaa atcgaggcg 29 <210> 47 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 490th Glu-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 47 gcgaattctc acgcctcgat ttcgccggg 29 <210> 48 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> nucleotides for 489th Glu-substituted Deinococcus radiodurans BphP 485-490 a.a. <400> 48 cccggcgaaa tcgcggag 18 <210> 49 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Flag Tag <400> 49 gcggatccat ggattacaag gatgacgacg ataag 35 <210> 50 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Flag Tag <400> 50 gcgaattctc acttatcgtc gtcatccttg taatc 35 <210> 51 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for His Tag <400> 51 gcggatccat gcaccaccac caccaccac 29 <210> 52 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for His Tag <400> 52 gcgaattctc agtggtggtg gtggtggtg 29 <210> 53 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Myc Tag <400> 53 gcggatccat ggaacaaaaa ttaatttctg aagaagattt a 41 <210> 54 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Myc Tag <400> 54 gcgaattctc ataaatcttc ttcagaaatt aatttttgtt c 41

Claims (18)

The amino acid sequence of SEQ ID NO: 15, the amino acid sequence of SEQ ID NO: 16, the amino acid sequence in which glutamic acid, which is the fifth amino acid residue in the amino acid sequence of SEQ ID NO: 15, is substituted with the hydrophobic amino acid or glutamic acid which is the fifth amino acid residue in the amino acid sequence of SEQ ID NO: A peptide tag consisting of an amino acid sequence substituted with a hydrophobic amino acid.
The peptide tag of claim 1, wherein the hydrophobic amino acid is any one selected from methionine, alanine, and leucine.
A polynucleotide encoding a peptide tag,
The peptide tag comprises an amino acid sequence of SEQ ID NO: 15, an amino acid sequence of SEQ ID NO: 16, an amino acid sequence in which glutamic acid which is a fifth amino acid residue in the amino acid sequence of SEQ ID NO: 15 is substituted with a hydrophobic amino acid, Wherein the glutamic acid residue is an amino acid sequence substituted with a hydrophobic amino acid.
4. The polynucleotide according to claim 3, wherein the polynucleotide encoding the peptide tag comprises the nucleotide sequence of SEQ ID NO: 33, the nucleotide sequence of SEQ ID NO: 34 or the nucleotide sequence of SEQ ID NO: 48.
4. The polynucleotide according to claim 3, wherein the polynucleotide encoding the peptide tag is a primer pair consisting of a forward primer having a nucleotide sequence of SEQ ID NO: 29 and a reverse primer having a nucleotide sequence of SEQ ID NO: 30, A forward primer having a base sequence of SEQ ID NO: 44 or a pair of reverse primers having a base sequence of SEQ ID NO: 32 or a forward primer having a base sequence of SEQ ID NO: 44 and a reverse primer having a nucleotide sequence of SEQ ID NO: Lt; / RTI &gt; polynucleotide.
A primer pair for synthesizing a polynucleotide encoding a peptide tag,
The peptide tag comprises an amino acid sequence of SEQ ID NO: 15, an amino acid sequence of SEQ ID NO: 16, an amino acid sequence in which glutamic acid which is a fifth amino acid residue in the amino acid sequence of SEQ ID NO: 15 is substituted with a hydrophobic amino acid, Wherein the glutamic acid residue is an amino acid sequence substituted with a hydrophobic amino acid.
7. The method of claim 6, wherein the primer pair comprises a forward primer having a nucleotide sequence of SEQ ID NO: 29 and a reverse primer having a nucleotide sequence of SEQ ID NO: 30; A forward primer having a nucleotide sequence of SEQ ID NO: 31 and a reverse primer having a nucleotide sequence of SEQ ID NO: 32; Or a forward primer having the nucleotide sequence of SEQ ID NO: 44 and a reverse primer having the nucleotide sequence of SEQ ID NO: 45.
As a recombinant vector comprising a polynucleotide encoding a peptide tag,
The peptide tag comprises an amino acid sequence of SEQ ID NO: 15, an amino acid sequence of SEQ ID NO: 16, an amino acid sequence in which glutamic acid which is a fifth amino acid residue in the amino acid sequence of SEQ ID NO: 15 is substituted with a hydrophobic amino acid, Wherein the glutamic acid residue is an amino acid sequence substituted with a hydrophobic amino acid.
9. The recombinant vector according to claim 8, wherein the recombinant vector further comprises a polynucleotide encoding a target protein,
Wherein said polynucleotide of interest is linked to a polynucleotide encoding a peptide tag.
A fusion protein comprising a target protein and a peptide tag linked thereto,
The peptide tag comprises an amino acid sequence of SEQ ID NO: 15, an amino acid sequence of SEQ ID NO: 16, an amino acid sequence in which glutamic acid which is a fifth amino acid residue in the amino acid sequence of SEQ ID NO: 15 is substituted with a hydrophobic amino acid, Wherein the glutamic acid residue is an amino acid sequence substituted with a hydrophobic amino acid.
A polynucleotide encoding a fusion protein comprising a target protein and a peptide tag linked thereto,
The peptide tag comprises an amino acid sequence of SEQ ID NO: 15, an amino acid sequence of SEQ ID NO: 16, an amino acid sequence in which glutamic acid which is a fifth amino acid residue in the amino acid sequence of SEQ ID NO: 15 is substituted with a hydrophobic amino acid, Wherein the glutamic acid residue is an amino acid sequence substituted with a hydrophobic amino acid.
A method for producing a transformant, which comprises introducing any one selected from the group consisting of the polynucleotide of any one of claims 3 to 5, the recombinant vector of any one of claims 8 to 9, and the polynucleotide of claim 11, .
Binding the fusion protein of claim 10 in contact with an antibody for a peptide tag; And
And detecting the presence or amount of the fusion protein bound to the antibody.
14. The method of claim 13, wherein the antibody is a monoclonal antibody produced by a hybridoma cell line having a deposit number of KCTC 12442BP.
Binding the fusion protein of claim 11 with an antibody for a peptide tag; And
And recovering the fusion protein bound to the antibody.
16. The method of claim 15, wherein the antibody is a monoclonal antibody produced by a hybridoma cell line having a deposit number of KCTC 12442BP.
A polynucleotide according to any one of claims 3 to 5, a primer pair according to any one of claims 6 to 7, a recombinant vector according to any one of claims 8 to 9 and a polynucleotide according to claim 11 &Lt; / RTI &gt; And
A peptide tag consisting of the amino acid sequence of SEQ ID NO: 15, a peptide tag consisting of the amino acid sequence of SEQ ID NO: 15, a peptide tag consisting of the amino acid sequence in which glutamate, the fifth amino acid residue in the amino acid sequence of SEQ ID NO: A fusion protein comprising any one selected from the group consisting of an antibody that specifically binds to a peptide tag consisting of an amino acid sequence in which glutamate, which is the fifth amino acid residue in the amino acid sequence of SEQ ID NO: 16, is substituted with a hydrophobic amino acid, or a hybridoma cell line that produces the antibody; Kit for detection or purification.
18. The kit for detecting or purifying a fusion protein according to claim 17, wherein the antibody is a monoclonal antibody produced by a hybridoma cell line having a deposit number of KCTC 12442BP.

Images