KR101298203B1 - Antibody for epitope tagging, hybridoma cell line and uses thereof - Google Patents

Abstract

PURPOSE: An epitope tagging system containing a novel peptide tag and an antibody thereof is provided to identify intracellular location and the function of a specific protein and to study the detection, purification, and interaction of the specific proteins. CONSTITUTION: A kit is used for detecting or purifying a fusion protein containing an antibody for a peptide tag or a hybridoma cell line which produces the antibody. The peptide tag has an amino acid sequence of sequence number 1 or 2. The fusion protein contains the peptide tag with an amino acid sequence of sequence number 1 or the peptide tag with an amino acid sequence of sequence number 2. A monoclonal antibody is produced by a hybridoma cell line (deposit number KCTC 12283BP).

Description

Antibodies for epitope tagging, hybridoma cell lines and uses thereof

The present invention relates to novel peptide tags that can be used in epitope tagging systems for the detection or purification of proteins of interest, antibodies to them and their use, and more particularly to light receiving proteins of Deinococcus radiodurans. It relates to a peptide tag derived from phosphorus phytochrome (BphP) and an antibody capable of specifically recognizing the peptide tags, to a hybridoma cell line capable of producing the same. In addition, the present invention relates to a polynucleotide encoding the peptide tag, a vector or transformant comprising the same, a fusion protein comprising the peptide tag, and a method or kit for preparing, detecting, or purifying the fusion protein. .

Useful proteins or polypeptides can be produced by synthesis or isolated from natural sources. However, such a method is disadvantageous in terms of cost, time, and production volume. Therefore, it is preferable to produce a target protein and a target polypeptide through culturing a transformant produced by recombination to over-express the target protein or the target polypeptide. However, polypeptides produced in the cellular environment (especially short polypeptides) may be sensitive to degradation due to the action of proteases present in the cell, and also antibodies against all the desired proteins may not be present. Purifying the desired protein without the antibody may be difficult.

Protein tagging or epitope tagging has been used to overcome this problem. Protein tagging or epitope tagging is performed by preparing a recombinant nucleic acid molecule in which a coding sequence of an epitope tag is linked to a coding sequence of a target protein and expressing it in a suitable host cell and then using an antibody against an epitope tag , Which is a recombinant DNA method used for detecting, quantifying, purifying a target protein, locating a target protein in a cell, or identifying a function. There are a number of commercially available epitope tags and ligand antibodies thereon, and when selecting the appropriate epitope tag and antibody thereto, Western blot analysis, immunoprecipitation, immunofluorescence, The target protein can be detected or purified by immunocytochemistry, immunoaffinity purification, or the like, thereby eliminating the need for antibody production to the target protein.

Epitope tags currently used for protein tagging or epitope tagging range from short peptide nags (e.g., 6xHis tags) to as large as six amino acid residues (e.g., 6xHis tags) to as large as 40kDa (e.g. MBP). Many unique tags are available (see Stevens, RC, (2000) Structure Fold Des 8: R177-85) and peptide tags are typically used consisting of 3 to 30 amino acids. His-tagged proteins are trapped specifically on Ni-NTA (nickel-nitrilotriacetic acid) resins, which can be eluted by EDTA or imidazole. Maltose-binding protein (MBP, 396 amino acids, 40 kDa), Staphylococcus protein A, calmodulin-binding peptide (CBP, 26 amino acids, 2.96 kDa), GFP (238 amino acids, 27 kDa) And glutathione-S-transferase (GST, 211 amino acids, 26 kDa) can also be used for both prokaryotic and eukaryotic proteins. In general, the most frequently used epitope tags include c-myc tags, HA tags, and FLAG tags. The c-myc tag is a 10 amino acid long epitope tag derived from human c-myc protein (Evans etal., (1985) Mol. Cell. Biol., 12: 3610-3616), and the HA tag is an influenza hemaggluti 9 amino acid long epitope tag derived from influenza hemagglutinin HA-1 protein (Field et al., (1988) Mol. Cell. Biol., 8: 2159-2165). The FLAG tag is an 8 amino acid long epitope tag derived from bacteriophage T7 (Hopp et al., (1988) Bio / Technology, 6: 1204-1210).

On the other hand, the epitope tag used in epitope tagging preferably minimally affects the three-dimensional structure and biological activity of the target protein when fused with the target protein. Generally, a long epitope tag (for example, a GST tag or MBP tag) have problems such as changing the function of a target protein. On the other hand, relatively short epitope tags such as the FLAG tag and the c-myc tag have very little effect on the characteristics of the target protein fused with it, In some cases it is currently used primarily because it does not need to be removed from the fusion protein. However, the amino acid sequences of the c-myc tag and the FLAG tag contain the same sequence in many of the proteins in the organism cells known to date, inducing a nonspecific response of the antibody that recognizes the tag, and this nonspecific antibody response is a specific purpose. There is a problem that interferes with the isolation and identification of proteins, which reduces the reliability of the experiment (Ksenija Gasic et al., (2005) Plant molecular biology reporter 23: 9-16). To overcome this nonspecific reaction problem, an affinity purification system has been developed that uses two different tag fusions consecutively at the N-terminus of a protein (Rigaut, G., et al. (1999) Nat Biotechnol 17: 1030 -2).

Thus, a novel peptide tag with a short amino acid sequence and paired with it detects a fusion protein expressed in a recombinant host cell while eliminating problematic nonspecific reactions in conventional epitope tagging and epitope tagging systems using antibodies thereto. There is a need for the development of antibodies that can be used for purification.

It is an object of the present invention to provide a novel peptide tag useful for the detection or purification of a target protein, its use, and the like.

In addition, another object of the present invention is to provide a novel antibody and its use and the like that can specifically recognize a new epitope tag or selectively bind to a new epitope tag.

The inventors of the present invention, while researching to develop a peptide tag useful for the detection or purification of the target protein and antibodies thereto, bacteriophytochrome, a light-receptor protein of the heterotrophic bacterium Deinococcus radiodurans (Bacteriophytochrome, BphP) or fragments thereof as a immunogen to obtain hybridomas producing monoclonal antibodies, and the produced antibodies were used to target Bacteriophytochrome (BphP) of Deinococcus radiodurans. The present invention was completed by performing epitope mapping with a peptide tag having 8 to 9 amino acids.

The present invention provides an antibody against a peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide tag consisting of the amino acid sequence of SEQ ID NO: 2 to solve the above object.

The present invention also provides a hybridoma cell line producing an antibody against a peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide tag consisting of the amino acid sequence of SEQ ID NO: 2.

The present invention also provides a kit comprising the peptide tag or hybridoma cell line.

The novel peptide tag according to the present invention has the advantage of completely eliminating the non-specific reactions of the conventional c-myc tag and the FLAG tag while having a short length. In addition, when using the novel peptide tag and the antibody to the present invention it is possible to detect or purify the fusion protein expressed in recombinant cells very efficiently. Therefore, the epitope tagging system including the novel peptide tag and the antibody thereto according to the present invention can be applied to various fields such as intracellular localization, functional identification, detection, purification, and study of interaction between proteins.

FIG. 1 shows the results of purifying DrBphP and DrBphN using His tag column chromatography. FIG. 1 (A) is a schematic diagram showing a gene construct used for expressing BphP protein and BphN protein of Deinococcus radiodurans. FL, full length (1-755 amino acids, BphP); ? PHY / HKD (1-321 amino acids, BphN); Figure 1 (B) shows the results of SDS-PAGE after purification of BphP apoprotein and BphN apoprotein of Deinococcus radiodurans using Ni ⁺ -NTA affinity chromatography and incubation with BV for 20 minutes , The result of detection of BV binding by zinc-induced fluorescence (right) and the result of staining with Coomassie Blue (left). 1: BphP crude extract, 2: purified BphP, 3: BphN crude extract, 4: purified BphN. Purification conditions - Binding & Washing: pH 8.0, 100 mM Tris, 200 mM NaCl, 10 mM imidazole / elution: pH 8.0, 100 mM Tris, 200 mM NaCl,
2 is a diagram showing the results of Western blot analysis of selected monoclonal antibodies using purified BphP and BphN. SDS-PAGE was performed on purified BphP and BphN and Western blot was performed using purified monoclonal antibodies (2B8, 2C11, 3B2, 3D2, 3H7) of Bphp. P; BphP, N; BphN. Western blot confirmed that the 2B8 antibody in the monoclonal antibody recognized the epitope present at the N-terminus of the BphP protein.
FIG. 3 shows the result of confirming whether the PCD structure constituting the N-terminal region reacts with 5 kinds of monoclonal antibodies of BphP, Oat PhyA, which is an otopicochrome protein similar to DrBphP.
4 shows the results of the primary epitope mapping for the 2B8 antibody via Western blot, and FIG. 5 shows the results of the secondary epitope mapping for the 2B8 antibody via Western blot. In FIG. 4 and FIG. 5, "a-GST" represents an anti-GST antibody.
FIG. 6 is a western blot showing that the fusion protein with the BRT tag attached to the N-terminus of the GST protein is normally expressed on E. coli and capable of detecting the fusion protein by the 2B8 antibody. In FIG. 5, "a-myc" represents an anti-myc antibody, and "a-GST" represents an anti-GST antibody.
7 is a Western blot showing that the fusion protein with the BRT tag attached to the N-terminus of the GFP is normally expressed in plant cells and the fusion protein can be detected by the 2B8 antibody. "Myc" in Figure 7 represents an anti-myc antibody.

One aspect of the present invention relates to a novel peptide tag that can be used in epitope tagging for purification or detection of a desired protein. The novel peptide tag according to the invention consists of a peptide comprising the amino acid sequence of SEQ ID NO: 1 or a peptide comprising the amino acid sequence of SEQ ID NO: 2. In the context of the present invention, peptide tags can be used interchangeably with protein tags or epitope tags. The term "peptide tag" in the present invention means a peptide that can be fused to a target protein and used as a tag. The term "epitope" in the present invention means an antigen binding site recognized by a specific antibody, or a certain site of an antigen that reacts with B cells or T cells. In the present invention, when the peptide tag includes the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, the length thereof is not particularly limited, and for example, 8 to 30 considering the number of amino acid residues of the epitope tag that is commonly used. It is preferably a peptide having two amino acid residues, more preferably a peptide consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide consisting of the amino acid sequence of SEQ ID NO: 2. The peptide consisting of the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 is derived from Bacteriophytochrome (BphP), a light receiving protein of Deinococcus radiodurans. Specifically, the peptide consisting of the amino acid sequence of SEQ ID NO: 1 is based on the N-terminal end of the entire amino acid sequence (SEQ ID NO: 3) of the bacteriophytochrome (BphP), a light receiving protein of Deinococcus radiodurans (Deinococcus radiodurans) It is a peptide consisting of amino acid residues corresponding to the 3rd to 11th position. In addition, the peptide consisting of the amino acid sequence of SEQ ID NO: 2 is based on the N-terminal end of the entire amino acid sequence (SEQ ID NO: 3) of the bacteriophytochrome (BphP), a light receiving protein of Deinococcus radiodurans (Deinococcus radiodurans) It is a peptide consisting of amino acid residues from which amino acid residues corresponding to the 8th or 9th position of amino acid residues corresponding to the 3rd to 11th positions are deleted.

Peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or peptide tag consisting of the amino acid sequence of SEQ ID NO: 2 according to the present invention is a hybridoma cell line in a conventional manner using a bacteriophytochrome of Deinococcus radiodurans as an immunogen Was screened and purified by obtaining the antibody from the hybridoma cell line, and then determined by performing epitope mapping with the antibody. Hereinafter, bacteriophytochromes of Deinococcus radiodurans are expressed as "DrBphP". Deinococcus Radio Duchenne is an extreme microorganism that can grow in cryogenic, dry, hypoxic, and strong acid environments. Phytochrome is a photoreceptor protein capable of absorbing external light signals and transmitting a signal to the lower part. In the conventional theory, it is known that it exists only in higher plants. Recently, phytochrome, proteobacteria, actinobacteria, fungi and the like Several phytochrome-like photoreceptors have been found. In particular, phytochrome-like photoreceptors found in Daynococcus radiodurance and Pseudomonas aeruginosa were named BphP, of which DrBphP consists of 755 amino acids represented by the amino acid sequence of SEQ ID NO. Davids SJ, et al., (1999) Science 286, 2517-2520. BphP is composed of an N-terminal region structure similar to plant phytochrome, but has a histidine kinase domain (HKD) different from that of plant phytochrome [Karniol R, et al., (2005) Photosynth Res 392, 103-116; Giraud E et al., (2008) Photosynth Res 97, 141-153]. DrBphP binds to biliberdine (BV) without the help of other elements to form reversible Pr / Pfr isoforms [Vierstra RD et al., (2000) Semin Cell Dev Biol 11, 511-521 ; Bhoo SH, et al., (2001) Nature 414, 776-779; Rockwell NC, et al., (2006) Annu Rev Plant Biol 57, 837-858].

Hereinafter, the steps of epitope mapping for determining a novel peptide tag according to the present invention will be described in detail. First, a polypeptide consisting of a gene corresponding to the full length of BphP of Deinococcus radiodurans (SEQ ID NO: 4) and an amino acid at position 1-321 based on the N-terminus of DrBphP (hereinafter referred to as BphN) The corresponding gene (SEQ ID NO: 5) was constructed (see FIG. 1A), inserted into the pET28a (+) vector, and expressed using BL21 competent cells. Then, protein purification was performed by Ni ⁺ -NTA affinity chromatography (QIAGEN) using His tag contained in the pET28a (+) vector. Since the expressed BphP protein (SEQ ID NO: 3) and BphN protein (SEQ ID NO: 6) contain both PAS, GAF domain, and Cys-24 residues, which play an important role in the binding of BV, binding to BV by itself This is possible. Therefore, to confirm the expression and purification of BphP and BphN proteins, BV was added to purified BphP protein and BphN protein, incubated at room temperature for 10 minutes, followed by SDS-PAGE, followed by coomassie staining and zinc blot. As a result, the expression and purification of BphP protein and BphN protein could be confirmed (see FIG. 1B). Next, in order to prepare a monoclonal antibody against BphP, BphP protein or BphN protein of Deinococcus radiodurans was mixed with Complete Freund's adjuvant as an antigen in peritoneal cavity of 6-week old female BALB / c mice After intraperitoneal injection, mice were sacrificed to obtain B lymphocytes. Then, B lymphocytes and myeloma cells were mixed and cultured by cell fusion. Thereafter, HAT medium and HT medium were changed, and antibody production of fusion cells was confirmed by ELISA, and a total of 24 hybridoma cell line posterior clones were selected. A total of 24 candidate hybridoma cell line clones were subjected to Fusion plate ELISA test with BphP protein and BphN protein injected with antigen to confirm the degree of binding (Table 3). As a result, the 2B8 clone and 2C11 clone were found to recognize the N-terminal region of the BphP protein because the BphP protein and the BphN protein of Deinococcus radiodurans were both highly expressed. However, 3B2 and 3D2 clones were found to recognize the C-terminal region of the BphP protein, indicating that the BphP protein has a high level and the BphN protein has a value close to zero. Unlike these, 3H7 clones showed high levels in BphP protein and some low values in BphN protein. Then, the 5 clones of the hybridoma cell line were subjected to a primary cloning plate ELISA test and a secondary cloning plate ELISA test. Ultimately, ascites was purified to purify the antibody. As a result, five monoclonal antibodies, 2B8 antibody, 2C11 antibody, 3B2 antibody, 3D2 antibody and 3H7 antibody, were obtained. Next, Western blot was performed to confirm whether the purified antibodies showed the same results for the previously expressed and purified BphP protein and BphN protein. Each 5 μg of purified BphP protein and BphN protein was used as a primary antibody at a ratio of 1: 1000 to 2% skim milk. HRP-mouse antibody (SIGMA) was added at a ratio of 1: 10000 And subjected to Western blotting. As a result, 2B8 antibody and 2C11 antibody resulted in binding to BphP protein and BphN protein as a result of ELISA test on hybridoma cell line clone (FIG. 2). Therefore, all of the two antibodies could be considered to bind to the N-terminal region of BphP. The 3B2 antibody and the 3D2 antibody showed a band for the BphP protein but no band for the BphN protein, indicating that the antibody binds to the C-terminal region of the BphP protein. However, the 3H7 antibody only recognizes BphP protein, unlike the ELISA test. In addition, the degree of binding of each antibody was most strongly bound to 2B8 antibody and 2C11 antibody binding at the N-terminal site, and the 3D2 antibody thought to recognize the C-terminal site exhibited a weaker recognition band. Followed by 3H7 antibody and 3B2 antibody in that order. DrBphP, on the other hand, has a structure similar to that of plant phytochromes, especially since the PCDs that make up the N-terminal site both have very similar structures that include the PAS, GAF, and PHY domains. We checked whether it reacts with However, all five monoclonal antibodies against the BphP protein of Deinococcus radiodurans did not bind to oat phytochrome protein (Oat PhyA) (FIG. 3). Therefore, the monoclonal antibodies against the BphP protein of Deinococcus radiodurans were confirmed to be BphP-specific novel antibodies that recognize epitopes different from those against the conventional Oat phytochrome protein. By isolating recognized epitopes it has been found that it can be used as a specific peptide tag that is not included in any protein of a known organism. Specifically, in order to identify the epitope of the 2B8 antibody strongly bound among the monoclonal antibodies to the BphP protein of the Deinococcus radiodurans (Dinococcus radiodurans) was prepared a DrBphP recombinant partial peptide, epitope mapping It was. Specifically, the amino acid sequence of position 3-12, amino acid sequence of position 3-11 (SEQ ID NO: 1), amino acid sequence of position 3-10, 4- of the entire amino acid sequence of DrBphP (SEQ ID NO: 3) Peptide fragments each comprising an amino acid sequence at position 12 were prepared and confirmed for binding by Western blot. As a result, it was confirmed that the 2B8 antibody correctly recognizes and binds only 9 amino acids (SEQ ID NO: 1) corresponding to the 3-11 position based on the N-terminus among the entire amino acid sequence (SEQ ID NO: 3) of DrBphP. . From this it was confirmed that the epitope of the 2B8 antibody is a peptide having the amino acid sequence of SEQ ID NO: 1, it can be used as a peptide tag. In addition, peptide fragments each comprising an amino acid sequence in which one amino acid residue of the amino acid sequence of SEQ ID NO: 1 was deleted were prepared, and epitope mapping was performed using a 2B8 antibody. As a result, it was confirmed that another epitope of the 2B8 antibody was a peptide having the amino acid sequence of SEQ ID NO: 2.

In addition, the peptide tag of the present invention may be provided in a form combined with other epitope tags known to secure various functionalities in addition to the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2. For example, the peptide tag of the present invention may have HA tag, FLAG tag, His tag, BCCP (biotin) in the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 in order to improve the detection ability, purification ability, solubility, etc. of the target protein. It may be provided in the form of a double tag in which a carboxyl carrier protein (MBP) or a maltose binding protein (MBP) is bound (see US Patent Publication No. 20050221308, US Publication No. 20060099710, US Patent Publication No. 6462254). In addition, the peptide tag of the present invention is a triple tag or multiple in which two or more tags selected from an HA tag, a 6 × His tag, a c-myc tag, and a V5 tag are combined with the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 It may be provided in the form of a tag (see US Patent Publication No. 20100184612). In addition, the peptide tag of the present invention may be provided in a form in which the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 is repeated, or some amino acid residues of the repeated amino acid sequence are substituted with deletion, such as a 3 × FLAG tag. (See US Patent Publication No. 7135624).

When the peptide tag according to the present invention comprises the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2, it is possible to use antibodies corresponding thereto. For example, an antibody to a peptide tag comprising the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 includes the aforementioned 2B8 antibody. On the other hand, in the peptide tag according to the present invention, the amino acid sequence of SEQ ID NO: 1 or some amino acids constituting the amino acid sequence of SEQ ID NO: 2 are individually substituted, deleted, added, or modified, and at the same time have a predetermined level of binding activity to 2B8 antibody. Such as variants retaining at least 75% or more based on the original binding activity. Substitution of the amino acid is preferably made by conservative amino acid replacement, in which the properties of the peptide do not change. In addition, modification of the amino acid may be made by glycosylation, acetylation, phosphorylation and the like. In addition, the peptide tag according to the present invention may comprise a labeled amino acid. In addition, the peptide tag according to the present invention may include peptides having increased structural stability against heat, pH, etc., or increased activity against antibodies due to variations or modifications on amino acid sequences. Table 1 below shows amino acids that can replace amino acids in peptides by conservative amino acid substitutions.

Amino acid residues in peptides Conservative substituents Ala Ser Arg Lys Asn Gln, His Asp Glu Gln Asn Cys Ser Glu Asp Gly Pro His Asn, Gln Ile Leu, Val Leu Ile, Val Lys Arg, Gln Met Leu, Ile Phe Met, Leu, Tyr Ser Thr, Gly Thr Ser, Val Trp Tyr Tyr Trp, Phe Val Ile, Leu

Another aspect of the present invention relates to a polynucleotide encoding the novel peptide tag described above and a recombinant vector comprising the polynucleotide. The term "polynucleotide" as used herein means any non-modified or modified polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA). The polynucleotide is a single- or double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA, single- or double-stranded, which is a mixture of single- and double-stranded regions, Or hybrid molecules comprising DNA and RNA, which may be a mixture of single- and double-stranded regions. The polynucleotides of the invention also include primers used to synthesize the novel peptide tags described above as single stranded RNA or DNA. The polynucleotides of the present invention can also be used interchangeably with nucleic acid molecules or oligonucleotides.

Polynucleotides encoding peptides may or may not include untranslated sequences (eg, introns) (eg, cDNA). The information on which the peptide is encoded is specified using codons. Typically, the amino acid sequence is encoded by a polynucleotide using a universal genetic code. "Codon" refers to a triplet of nucleotides that determine the amino acid sequence in a polypeptide chain. Most organisms use 20 or 21 amino acids to produce their polypeptides, which are protein or protein precursors. Because there are four possible nucleotides, adenine (A), guanine (G), cytosine (C) and thymine (T) in DNA, there are 64 possible triplets capable of coding 20 amino acids and terminal signals. Because of this redundancy, most amino acids are coded by one or more triplets. This allows a change in the nucleotide sequence without affecting the amino acid sequence of the encoded polypeptide, which is referred to as "silent variation" by "codon degeneracy ". All silent variations of the polynucleotides encoding the novel peptide tags of the present invention are within the scope of the present invention. On the other hand, codons that embody a single amino acid can not be used at the same frequency, and each organism often exhibits a particular " codon-bias "for one of several codons encoding the same given amino acid. If the coding region contains a rare codon or a cluster of rare codons, recombination or mutagenesis of the gene can be used to increase the expression level by removing the rare codon. [J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001), at 15.12]. Thus, "codon selection" can be used to optimize expression in a selected host. The most preferred codons are codons found primarily in highly expressed genes. In " codon preference "in E. coli, Konigsberg, et al., Proc. Nat'l. Acad. Sci. U.S.A. 80: 687-91 (1983).

When the nucleotide sequence is prepared by chemically synthesizing, it is possible to use a method well known in the art, for example, a method described in Engels and Uhlmann, Angew Chem IntEd Engl., 37: 73-127, 1988 , Triesters, phosphites, phosphoramidites and H-phosphate methods, PCR and other auto primer methods, and oligonucleotide synthesis on solid supports.

Accordingly, the polynucleotide encoding the novel peptide tag of the present invention may be composed of various base sequences, for example, the polynucleotide encoding the peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 is preferably the base of SEQ ID NO: 7 The polynucleotide encoding the peptide tag consisting of the amino acid sequence of SEQ ID NO: 2 may be preferably composed of the nucleotide sequence of SEQ ID NO: 8.

The invention also provides a recombinant vector comprising a polynucleotide encoding a novel peptide tag. For example, the recombinant vector according to the present invention may include a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8. The recombinant vector may be provided in the form of a polynucleotide encoding a novel peptide tag inserted into a cloning vector or an expression vector using known standard methods. Can be provided in the form of a recombinant vector. As used herein, the term "vector" refers to any medium for cloning and / or transfer of a base into a host cell. The vector may be a replica, in which other DNA fragments can bind to result in replication of the bound fragment. Refers to any genetic unit (e.g., a plasmid, phage, cosmid, chromosome, or virus) that functions in vivo as an autologous unit of DNA replication, that is, . The term "vector" includes viral and non-viral mediators for introducing a base into a host cell in vitro, in vitro or in vivo. The term "vector" may also include mini-spherical DNA. For example, the vector may be a plasmid without a bacterial DNA sequence. Removal of abundant bacterial DNA sequences in the CpG region has been done to reduce transgene expression silencing and to bring about a more sustained expression from the plasmid DNA vector. The term “vector” may also include transposons (Szping, et al. J. MoI. Biol. 302: 93-102 (2000)), such as Sleeping Beauty, or artificial chromosomes. The term "cloning vector" in the present invention is defined as a substance capable of carrying a DNA fragment into a host cell and regenerating it. In the present invention, the cloning vector may further include a polyadenylation signal, a transcription termination sequence, and a multiple cloning site. Wherein the multiple cloning site comprises at least one restriction site of an endonuclease restriction enzyme. In addition, the cloning vector may further include a promoter. For example, in the present invention, the polynucleotide encoding the novel peptide tag may be located upstream of a polyadenylation signal and a transcription termination sequence, and may comprise at least one endonuclease an endonuclease restriction site may be located upstream of a polyadenylation signal and a transcription termination sequence. In addition, the term "expression vector" in the present invention is defined as a DNA sequence necessary for transcription and translation of the cloned DNA in an appropriate host. In addition, the term "expression vector" in the present invention means a gene construct comprising an essential regulatory element operably linked to an insert such that the insert is expressed when present in the cell of the individual. The expression vector can be prepared and purified using standard recombinant DNA techniques. The expression vector is not particularly limited as long as it expresses a desired gene in various host cells of prokaryotic and eukaryotic cells and produces a desired protein. However, the expression vector has a promoter that exhibits strong activity, A vector capable of producing a large amount of exogenous protein in a form similar to that of the wild type. The expression vector preferably contains at least a promoter, an initiation codon, a gene encoding a desired protein, and a termination codon terminator. In addition, DNA encoding the signal peptide, additional expression control sequences, non-translation regions on the 5 'side and the 3' side of the desired gene, a selectable marker region, or a replicable unit may be suitably contained. A "promoter" means a minimal sequence sufficient to direct transcription. Also, a promoter construct sufficient to allow expression of a regulatable, promoter-dependent gene that is induced by a cell type-specific or external signal or agent may be included, and such constructs may be located at the 5 ' or 3 ' . Both conservative promoters and inducible promoters are included. Promoter sequences may be derived from prokaryotes, eukaryotes or viruses. The term "operably linked" means that polynucleotide sequence associations on a single polynucleotide are modulated by one function. For example, if the promoter is capable of controlling the expression of the coding sequence (i. E., The coding sequence is under transcriptional control of the promoter), the promoter may be operatively linked to the coding sequence or the ribosomal binding site If present, the ribosomal binding site is operatively linked to the coding sequence. The coding sequence may be operatively linked to the regulatory sequence in the sense or antisense direction. As an example, the expression vector according to the present invention is a polynucleotide encoding a novel peptide tag, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 7 or a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 8 and a target polynucleotide encoding a target protein. Include.

Another aspect of the invention relates to a fusion protein comprising the novel peptide tag described above. The term "fusion protein" in the present invention means a polymer in which two or more peptides, oligopeptides, polypeptides or proteins having different functions are linked to each other. In the present invention, the fusion protein can be used interchangeably with a fusion polypeptide, a fusion oligopeptide, a recombinant polypeptide, a recombinant oligopeptide or a recombinant protein. The first portion of the fusion protein according to the invention comprises at least one of the novel peptide tags described above and the second portion of the fusion protein comprises at least one of the target proteins. In the present invention, a target protein can be used interchangeably with a target peptide, a target oligopeptide or a target polypeptide. Fusion proteins in which the novel peptide tag according to the invention is linked to the codon region of the protein of interest can be efficiently detected or purified using antibodies to the novel peptide tag. The peptide tag according to the present invention can be inserted anywhere within the protein, as long as it does not substantially affect the C-terminus of the target protein as well as the N-terminus or the functionality of the protein. Here, the fact that the protein does not substantially affect the functionality thereof means that the activity of the protein is retained by 80% or more, preferably 95% or more, before fusion of the peptide tag. As the target protein used in the present invention, any protein can be used. For example, a short-chain FV (ScFv) of humanized antibody AKA / HzK to TAG-72 which is a cancer-associated antigen, thrombopoietin (TPO), B - lymphocyte stimulator (B-lymphocyte stimulator), and the like. A fusion protein according to the present invention comprises a combination of two or more peptides, for example, a peptide tag and a combination of a target protein, wherein the two or more peptides may be linked by covalent bonds or noncovalent bonds. At this time, the peptide tag and the target protein may be directly connected to each other without any mediator, or may be indirectly connected by a mediator such as a peptide linker. In a preferred embodiment, the fusion protein may be designed such that it comprises at least one cleavable peptide linker such that the cleavable linker is then chemically and / or enzymatically cleaved so that the desired protein can be recovered from the fusion protein. Thus, a fusion protein according to the invention can preferably be designed to include one or more tags, a cleavable peptide linker and a target protein. Linkers generally do not have specific biological activity other than to associate proteins or to maintain a minimum spacing or other spatial relationship between these proteins, but the constituent amino acids of the peptide linker are not affected by the properties of the molecule, such as folding, net charge, or hydrophobicity May be selected to have some effect. The peptide linker may optionally include a site for the separation of the fused constituent polypeptide, for example, a site that can be cleaved by a protease. The cleavable peptide linker may be from 1 to about 50 amino acids in length, preferably from 1 to about 20 amino acids. An example of an enzyme cleavable peptide linker may include a caspase-3 cleavage sequence, and may include an aspartic acid-proline dipeptide (D-P) moiety cleavable by acid. A cleavable peptide linker can be incorporated into the fusion protein using a number of techniques well known in the art. In addition, a flexible peptide linker can be used, and peptide linkers having a GGSGGT amino acid sequence, a GGGGS amino acid sequence, and a GGGGSGGGGS amino acid sequence can be used, but are not limited thereto. A peptide linker can be operably linked in-frame between polynucleotides encoding each peptide of the fusion protein and the polynucleotide comprising the peptide linker and expressed through an expression vector.

Means for preparing peptides (peptide tags, cleavable peptide linkers, target peptides, and / or fusion peptides) in the present invention are well known in the art (see, e.g., Stewart et al., Solid Phase Peptide Synthesis, Pierce Chemical Co., Rockford, IL, 1984; Bodanszky, Principles of Peptide Synthesis, Springer-Verlag, New York, 1984; and Pennington et al., Peptide Synthesis Protocols, Humana Press, Totowa, NJ, 1994 Reference). The various components of the fusion peptides described herein (tag peptides, target peptides, and cleavable linker etc./cleavage sequences) can be prepared by known chemical synthesis methods (see, eg, Hermanson, Greg T. , Bioconjugate Techniques, Academic Press, New York (1996)), chemical synthesis is often limited to peptides less than about 50 amino acids in length because of cost and / or impurities. Peptides described herein can preferably be prepared using standard recombinant DNA and molecular cloning techniques. [Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Silhavy, TJ, et al., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Cold Press Spring Harbor, NY (1984); And in Ausubel, FM et. al., < / RTI > Short Protocols in Molecular Biology, 5th Ed. Current Protocols and John Wiley and Sons, Inc., NY, 2002]

Another aspect of the invention relates to a transformant comprising the above-described expression vector. In the present invention, the term "transformant" means a cell transformed by introduction of an expression vector having a polynucleotide encoding at least one target protein into a host cell. Methods for preparing the transformant by introducing the expression vector into a host cell include transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome mediated transfection liposemmediated transfection, DEAE dextran-mediated transfection, polybrene-mediated transfection, electroporation, electroinjection, PEG, and the like A chemical treatment method, a method using a gene gun or the like, but the present invention is not limited thereto. When the transformant expressing the expression vector is cultured in a nutrient medium, a large amount of the fusion protein can be prepared and can be isolated. The culture medium and culture conditions can be appropriately selected and used depending on the host cell. The conditions such as temperature, medium pH and incubation time should be appropriately adjusted so as to be suitable for cell growth and mass production of the protein during culturing. The host cell that can be transformed with the expression vector according to the present invention is not limited in its kind as long as it is known in the art such as prokaryotic cells, plant cells, insect cells, animal cells, etc. Preferably, A host having high expression efficiency of introduced DNA is usually used. For example, as host cells, well-known prokaryotic hosts such as Escherichia, Pseudomonas, Bacillus, Streptomyces can be used, and Escherichia coli can be preferably used. Expression of the protein by the host cell can be induced using IPTG (isopropyl-1-thio-β-D-galactopyranoside), and the induction time can be controlled to maximize the amount of protein. In the present invention, the recombinantly produced protein can be recovered from the medium or cell lysate. If membrane bound, it may be liberated from the membrane using a suitable surfactant solution (eg Triton-X 100) or by enzymatic cleavage. Cells used for protein expression can be disrupted by various physical or chemical means such as freeze-thaw cycles, sonication, mechanical disruption or cell disruption, and can be isolated or purified by conventional biochemical separation techniques (Sambrook Inc., San Diego, Calif., USA), < RTI ID = 0.0 > Molecular Cloning: A laborarory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989. Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 1990). For example, a method of separating or purifying a protein expressed by a host cell includes electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion-exchange chromatography, affinity chromatography, immuno- adsorption affinity chromatography, , Gel permeation HPLC), isoelectric focusing, and various variations or combinations thereof. On the other hand, the fusion protein comprising a peptide tag according to the present invention can be isolated and purified using immunosorbent affinity chromatography using the antibody to the peptide tag.

Another aspect of the present invention relates to an antibody against the novel peptide tag described above and a hybridoma cell line capable of producing the antibody. The antibody according to the present invention is an antibody capable of specifically recognizing, specifically or selectively binding to a peptide tag consisting of an amino acid sequence of SEQ ID NO: 1 or a peptide tag consisting of an amino acid sequence of SEQ ID NO: 2. The term "antibody" in the present invention refers to a substance produced by stimulation of a specific antigen in the immune system, which can specifically bind to the specific antigen to cause an antigen-antibody reaction, , And functional fragments of antibody molecules having an activity equivalent to that of the native form. The natural type antibody generally has a structure having two light chains and two heavy chains, and each light chain is linked to a heavy chain by a disulfide bond. A functional fragment of an antibody molecule refers to a fragment having an antigen binding function and includes Fab, F (ab ') 2, F (ab') 2, Fv and the like. Fabs in the antibody fragment have one antigen-binding site in a structure having a variable region of a light chain and a heavy chain, a constant region of a light chain, and a first constant region (CH1) of a heavy chain. Fab 'differs from Fab in that it has a hinge region that contains at least one cysteine residue at the C-terminus of the heavy chain CH1 domain. F (ab ') 2 is produced by disulfide bonding of cysteine residues in the hinge region of Fab'. Recombinant techniques for generating Fv fragments with minimal antibody fragments having only a heavy chain variable region and a light chain variable region are disclosed in WO 88/10649, WO 88/106630, WO 88/07085, WO 88/07086 and WO 88 / 09344. Double-chain Fv (dsFv) is a disulfide bond, which is linked to a heavy chain variable region and a light chain variable region, and short-chain Fv (scFv) is generally covalently linked to a variable region of the heavy chain and the light chain variable region through a peptide linker. . Such an antibody fragment can be obtained using a protein hydrolyzing enzyme (for example, an F (ab ') 2 fragment can be obtained by cutting a whole antibody into papain and obtaining a Fab and digesting with pepsin) Can be produced through recombinant DNA technology. For the purpose of the present invention, the antibody may be an antibody capable of specifically binding to the peptide tag of the present invention, preferably in the form of a Fab or whole antibody, more preferably in the form of a monoclonal antibody . The present invention also provides a hybridoma cell line capable of producing a monoclonal antibody to the above-mentioned novel peptide tag. The hybridoma cell line was deposited with the Korea Institute of Bioscience and Biotechnology (KCTC) on September 24, 2012, and the accession number is KCTC 12283BP.

Monoclonal antibodies having specific binding to the peptide tag of the present invention can be prepared using the peptide tag or a polypeptide comprising the same as an immunogen. More specifically, the peptide tag is first injected into the subcutaneous, muscular, intravenous, or abdominal cavity of a mammal other than a human by one or more injections as an immunogen. At this time, the peptide tag is used in a mixed form with a Freund adjutant as necessary. Mammals other than humans are preferably mice, rats, hamsters, malmots, rabbits, cats, dogs, pigs, goats, sheep, donkeys, horses or cattle (transgenic mice that produce human antibodies). And transgenic animals engineered to produce antibodies from other animals), more preferably mice, rats, hamsters, malmots or rabbits. Immunization can be performed 1 to 4 times every 1 to 21 days from the first immunization to obtain cells producing the antibody from the immune sensitized mammal about 1 to 10 days after the final immunization. The number of times of immunization and the time interval may be appropriately changed depending on the characteristics of the immunogen used. Hybridomas secreting monoclonal antibodies can be prepared according to the methods of Keira and Mirtstein et al. (Nature, 1975, Vol. 256, p. 495-497) and the equivalent method. Any one selected from the group consisting of spleen, lymph node, bone marrow, or tonsils taken from animals other than humans sensitized as described above, preferably from an antibody-producing cell contained in the spleen and from a mammal having no ability to produce autoantibodies Hybridoma cells can be prepared by cell fusion of myeloma cells. Myeloma cells (myeloma cells) used for cell fusion are mouse-derived myeloma P3 / X63-AG8. 653 (653), P3 / NSI / 1-Ag4-1 (NS-1), P3 / X63-Ag8. U1 (P3U1), SP2 / 0-Ag14 (Sp2 / O, Sp2), PAI, F0 or BW5147; Rat-derived myeloma 210 RCY3-Ag. 2.3; Or human derived myeloma U-266 AR1, GM1500-6TG-A1-2, UC729-6, CEM-AGR, D1R11 or CEM-T15. The cell fusion is carried out, for example, by a fusion promoter such as polyethylene glycol or Sendai virus or a method using an electric pulse. For example, in a fusion medium containing a fusion promoter, an antibody-producing cell and a mammalian- Is suspended at a ratio of about 1: 1 to 1:10, and in this state, it is cultured at about 30 to 40 DEG C for about 1 to 5 minutes. As the fusion medium, for example, MEM medium, RPMI1640 medium, and Iscove's modified Dulbecco's medium may be used, and serum components such as bovine serum are preferably excluded. A method for screening a hybridoma cell clone producing a monoclonal antibody is characterized in that the obtained fusion cell is transferred to a selection medium such as HAT medium and cultured at about 30 to 40 DEG C for about 3 to 3 weeks to prepare a hybridoma cell Of cells. Subsequently, the hybridoma cells were cultured in a microtiter plate or the like, and then the reactivity between the immunogen used in the immune response of the animals other than humans described above and the culture supernatant was measured by RIA (radioactive substance-marked immuno antibody) or It is confirmed through immunoassay methods such as ELISA (Enzyme-Linked Immunosorbent Assay) and finds hybridoma cells with increased reactivity. Hybridoma cell clones producing the monoclonal antibodies found above exhibit specific binding ability to the immunogen. The monoclonal antibody of the present invention can be obtained by culturing a hybridoma cell line in vitro or in vivo. For culturing, a conventional method for culturing cells derived from mammals is used, and in order to collect a monoclonal antibody from a culture or the like, an ordinary method in this field for purifying an antibody in general is used. Methods for purifying antibodies include, for example, salting out, dialysis, filtration, concentration, centrifugation, fractional precipitation, gel filtration chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography, Gel electrophoresis and isoelectric point electrophoresis, and they are applied in combination as needed. The purified monoclonal antibody is then concentrated, dried, and stored in a liquid or solid phase depending on the application. In addition, the monoclonal antibody of the present invention is composed of DNAs encoding heavy and light chain variable regions, respectively, with known DNAs encoding normal regions of heavy and light chains (for example, Japanese Patent Application Laid-Open No. 2007-252372). Each of the linked genes was synthesized by PCR or chemical synthesis, and the synthesized genes were introduced into a known expression vector (for example, pcDNA 3.1 (available from Invitrogen)), and then a transformant was prepared using the expression vector. The host cells, such as transformed CHO cells and Escherichia coli, can be cultured and expressed, and these can be obtained by purifying the expressed antibodies using a Protein A column or the like.

Another aspect of the invention relates to the use of a novel peptide tag, a polynucleotide encoding said peptide tag, or an antibody against said peptide tag described above.

For example, one example of the present invention provides a method for producing the aforementioned fusion protein. A method for producing a fusion protein according to an embodiment of the present invention includes culturing a transformant into which a polynucleotide encoding a fusion protein has been introduced to express a fusion protein. At this time, the polynucleotide encoding the fusion protein is preferably introduced into the transformant in a form contained in the recombinant vector. In addition, the method for producing a fusion protein according to the present invention may further comprise the step of recovering the expressed fusion protein. In addition, the recombinant vector includes a polynucleotide encoding a peptide tag and a polynucleotide encoding a target protein linked thereto, wherein the two polynucleotides preferably include a site that can be cleaved by a protease or the like Lt; RTI ID = 0.0 > linker. ≪ / RTI >

In addition, one example of the present invention provides a method for detecting the aforementioned fusion protein. A method of detecting a fusion protein according to an exemplary embodiment of the present invention includes: binding a fusion protein to which a peptide tag and a target protein are linked by contacting the antibody against the peptide tag; And identifying or quantitating the presence of the fusion protein bound to the antibody. Herein, the method of detecting a fusion protein according to an exemplary embodiment of the present invention may be performed by Western blotting, enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, immunofluorescence, immunocytochemistry, An array or the like can be used. The protein microarray can be used for analysis of large samples by immobilizing specific antibodies against the peptide tag of the present invention on a glass or silicon substrate.

In addition, one example of the present invention provides a method for purifying the fusion protein described above. A method for purifying a fusion protein according to an exemplary embodiment of the present invention includes: binding a fusion protein to which a peptide tag and a target protein are linked by contacting the antibody against the peptide tag; And recovering the fusion protein bound to the antibody. At this time, the antibody is immobilized on a support, preferably a solid support. Examples of the support for immobilizing the antibody include a column, a bead, an adsorbent, a nitrocellulose paper and the like, and the antibody can be immobilized on the support through various known immobilization methods. Specific examples of the method for purifying a fusion protein according to the present invention include contacting a sample containing a tagged protein to a support on which an antibody is immobilized, wherein the tagged protein is covalently linked to a peptide tag. Wherein the peptide tag has specific binding activity to the antibody, and the contacting is made under conditions that the antibody binds to the peptide tag, the removal of the unbound components and the separation of the tagged protein from the support. Can be. In this case, the support and the antibody immobilized thereon are used as a medium for immunoaffinity chromatography, and the immunoaffinity column chromatography may be performed using a column packed with the medium. By the purification method of the present invention, a fused protein purified with high purity can be obtained, and further, the function of the target protein is not affected at all.

In addition, one example of the present invention provides a kit for expression, detection, or purification of a fusion protein. The kit for expression, detection or purification of the fusion protein according to the present invention comprises the above-mentioned novel peptide tag, a polynucleotide encoding the peptide tag, a primer pair for synthesizing the polynucleotide, a recombinant vector containing the polynucleotide, Or a transformant transformed with a nucleotide or a recombinant vector. In addition, the kit for expression, detection or purification of the fusion protein according to the present invention may include any one selected from the above-mentioned antibody against the novel peptide tag or hybridoma cell line producing the antibody. In addition, the kit for expression of the fusion protein according to the present invention preferably comprises a recombinant vector comprising a polynucleotide encoding the novel peptide tag of the present invention, the kit for detection or purification of the fusion protein according to the present invention is preferred. Preferably antibodies against novel peptides of the invention. In this case, the recombinant vector constituting the kit is preferably provided in a form in which a user can prepare an expression vector including a polynucleotide encoding a fusion protein. The fusion protein is a polypeptide to which a peptide tag and a target protein are linked. In addition, the antibodies constituting the kit are preferably provided in a fixed form on a suitable support. In addition, the kit for detecting a fusion protein preferably further comprises means for detecting an antibody against a peptide tag. Here, the means capable of detecting the antibody of the present invention is preferably a secondary antibody. In addition, the antibody or secondary antibody of the present invention constituting the kit for detecting a fusion protein may be labeled with a labeling substance such as enzyme, radioactive substance, fluorescent substance, etc., and the labeling method is preferably conjugation . In addition, the fusion protein purification kit may further comprise a protease for separation of the peptide tag. In addition, the kit according to the present invention may further include instructions, restriction enzymes, ligases, buffer solutions and the like.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are only for clearly illustrating the present invention, and do not limit the protection scope of the present invention.

Example 1 Cloning of BphP and BphN Genes of Deinococcus radiodurans

Deinococcus radiodurans bacteriophytochrome protein (BphP) gene encoding the full length (SEQ ID NO: 4) and the polypeptide (BphN) consisting of amino acids 1-321 position based on the N-terminus of DrBphP The coding gene (SEQ ID NO: 5) was cloned using PCR. Specifically, Deinococcus radiodurans bacteriophytochrome protein (BphP) gene encoding the full length (SEQ ID NO: 4) as a template, a primer for cloning the BphP gene or a primer for cloning the BphN gene and PCR was performed around 30 cycles using Ex-Taq (TAKARA) polymerase to obtain amplified BphP DNA products and BphN DNA products. Table 2 below shows the primers used to obtain amplified BphP DNA products and BphN DNA products. The primers shown in Table 2 and all the primers to be described later were prepared by Bioneer co., KR.

SEQ ID NO: Type of primer The base sequence (5 '- > 3') The restriction enzyme recognition site contained in the primer 9 Forward primer for BphP cloning GCCATATGATGAGCCGGGACCCGTTGCCC Nde I 10 Reverse primer for BphP cloning GCCTCGAGTCAGGCATCGGCGGCTCCCGG Xho I 11 Forward primer for BphN cloning GCCATATGATGAGCCGGGACCCGTTGCCC Nde I 12 Reverse primer for BphN cloning GCCTCGAGCGCTTCCTTGACCTGAACTTG Xho I

The amplified PCR product was run on 1% agarose gel (QA-Agarose gel, Q-BIO, CAT # AGAH0250) and the size of amplified DNA was confirmed by ultraviolet irradiation. After that, only the band on the gel corresponding to the DNA amplification product is cut out, and only the desired DNA is isolated using a gel elution kit (FavorPrep GEL / PCR purification mini kit, FAVORGEN, CAT # FAGCK001-1), and then Easy T-vector (promega) And bound to Bioneer co., KR to determine the base sequence. As a result, it was confirmed that the DNA product generated through PCR had BphP DNA and BphN DNA as desired target sequences.

Then, BphP DNA product and BphN DNA product amplified using restriction enzymes Nde I and Xho I were inserted into pET28a (+) vector (manufacturer: Novagen), and BL21 competent cells (manufactured by RBC, Taipei, Taiwan) was transformed by heat shock at 42 ° C for 1 minute and then cultured on LB medium containing kanamycin to express BphP protein and BphN protein.

Example  2 : Deinococus Of the radioactive deurans (Deinococcus radiodurans) BphP  Protein and BphN  Expression of protein

Colony colonies transformed into BL21 competent cells and grown on LB medium were inoculated on LB medium containing kanamycin and seed culture was carried out at 37 ° C for about 8 hours or more. The cultured cells were inoculated in LB medium containing kanamycin, grown to a concentration until the value at OD ₆₀₀ was 0.6, IPTG was added so that the total concentration was 0.5 mM, and protein expression was maintained at 25 ° C. for 6 hours. Induced. The cells were then centrifuged to discard the supernatant and the pellet resuspended in binding buffer (100 mM Tris-Cl, 150 mM NaCl, and 10 mM imidazole, pH 8.0). Next, the pellet resuspension was sonicated, the cells were disrupted, and the supernatant was separated by centrifugation again. The protein was purified using a Ni ⁺ -NTA column (QIAGEN). The purified protein was then stored at -70 < 0 > C.

The BphP protein and the BphN protein are capable of binding to BV alone, as they contain both the PAS, the GAF domain, and the Cys-24 residue, which play an important role in BV binding. Virilverdin (BV, 2 μg / ml, Frontier, Scientific, Carnforth, UK) was added to purified Apo-BphP protein and Apo-BphN protein to obtain holo-BphP protein and reacted for 10 minutes at room temperature. Subsequently, the reaction samples were subjected to SDS-PAGE, followed by reaction with zinc acetate solution (20 mM zinc acetate, 150 mM Tris-Cl, pH 7.0) for 20 minutes. In addition, the reaction samples were subjected to SDS-PAGE followed by coomassie staining. The left side of FIG. 1 (B) shows the result of coomassie staining, and the right side of FIG. 1 (B) shows the result of the zinc blot. As shown in FIG. 1 (B), it was confirmed that the expression and purification of BphP protein and BphN protein were smooth.

Example  3: Deinococus Of the radioactive deurans (Deinococcus radiodurans) BphP  Protein and BphN  Preparation of monoclonal antibodies that specifically bind to proteins

3-1: Immunization

The purified BphP protein or BphN protein was used as an antigen, and complete Freund's adjuvant was mixed therein, and injected into the abdominal cavity of female BALB / c mice at 6 weeks of age. Immersion was mixed with vortexer for 1 hour and then injected intraperitoneally with Incomplete Freund's adjuvant and antigen in the same manner. After 2 weeks, blood was drawn from the tail of the mouse and used for cell fusion when the antibody titer after 1/1000 to 1.0 was measured after the ELISA test. At 4 weeks after the second immunization for cell fusion, the same amount of antigen was diluted in PBS and injected intraperitoneally. Three days later, mice were sacrificed and cell fusion was performed.

3-2: Cell fusion for monoclonal antibody production

As a B lymphocyte cell source, the abdominal incision was made to remove the fat and other organs as much as possible, and the spleen was aseptically removed to prevent excessive bleeding. The cells were homogenized with a cell strainer, diluted with the basic medium, and centrifuged twice. B lymphocytes and myeloma cells were mixed at an appropriate ratio, centrifuged for 5 minutes, the supernatant was discarded, and the remaining cell mixture was gently shaken. 10 ml of prewarmed RBC lysis buffer was added and suspended, followed by incubation at 37 ° C for 20 minutes FBS was added and centrifuged. Cell fusion was performed as follows. First, PEG (polyethlyene glycerol) 1500 solution was slowly added to the centrifuged cell mixture while maintaining the temperature at 37 ° C, and then the reaction was stopped by adding the basic medium again. Then, the cells were quickly centrifuged, the supernatant was discarded, and the remaining cell mixture was carefully suspended in a macrophage culture medium, and the cells were placed in a 96-well tissue culture plate and cultured in a carbon dioxide incubator at 37 ° C.

3-3: Selection of fusion cell

Five days after the cell fusion, HAT medium, a selective medium for fused cells, was added to each well. Then, the HAT medium was added at the intervals of 3 days in the same manner. After 11 days of cell fusion, HT medium supplemented with HT supplement was added to the complete medium and observed with a microscope every day for confirming the growth of the fusion cells. The supernatant of the wells in which the growth has been confirmed is taken and the antibody production is confirmed by ELISA. The fusion cell line once determined to secrete the desired antibody is subjected to 1, 2 and 3 cloning by limiting dilution, ≪ / RTI >

3-4: Selection of fusion cells by ELISA

The antigen protein solution diluted with ELISA coating buffer was added to a 96 well tissue culture plate for cell fusion after immunization with the immunized antigen and for the production of monoclonal antibodies. Subsequently, the antigen protein solution was inhaled and removed, and the blocking solution was added to the remaining surface of each well, followed by reaction at 37 ° C for 1 hour. The blocking solution was then removed and washed three times with PBST solution. The fusion cell culture supernatant was added to each well, reacted at 37 ° C, and the solution was removed and washed three times with PBST solution. A solution of Horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG) diluted in PBS was added to each well. OPD (orthophenylenediamine dihydrochloride) substrate solution was added to the wells, reacted at room temperature for 10 minutes, and the reaction was stopped with stop solution. At this time, the absorbance was measured with an ELISA reader at 492 nm in order to confirm the degree of the reaction, and a total of 24 candidate hybridoma cell clones were selected based on the measured results.

3-5: Fusion plate ELISA test to confirm the binding with the antigen and purification of the antibody

A total of 24 candidate hybridoma cell line clones were subjected to a fusion plate ELISA test with BphP protein and BphN protein injected with antigen to confirm the degree of binding, and the results are shown in Table 3 below. As shown in Table 3 below, 2B8 and 2C11 clones were estimated to recognize high levels of both BphP protein and BphN protein of Deinococcus radiodurans, thus recognizing the N-terminal region of the BphP protein. . However, 3B2 and 3D2 clones were found to recognize the C-terminal region of the BphP protein, indicating that the BphP protein has a high level and the BphN protein has a value close to zero. In contrast, the 3H7 clone exhibited a high level of BphP protein and a low level of BphN protein, suggesting that the N-terminal region of the BphP protein was also recognized to some extent.

Hybridoma cell line clone The degree of binding with the antigen protein (absorbance at 492 nm) BphN BphP (full) 1B6 0.0660 1.3190 1B11 0.1560 2.3700 1D6 0.0550 2.3180 2B8 2.3400 2.4200 2 C11 2.3480 2.4040 2D9 0.1430 2.2730 2E3 2.1720 1.8020 2F7 0.1220 2.4430 2H8 0.0650 1.3440 3A4 1.9180 2.3770 3B2 0.0980 2.2900 3B3 0.0700 2.1650 3C11 1.9730 2.2590 3 D2 0.0640 2.2830 3D10 0.1180 2.4280 3D11 1.6850 2.3130 3F10 0.0730 2.3570 3G2 0.0880 2.0510 3G9 0.0800 1.5580 3H1 1.7840 2.0950 3 H7 0.4640 2.3490 4B7 1.9730 2.2620 4E2 0.2050 2.3770 4E3 0.0550 2.2650

Then, the 5 clones of the hybridoma cell line were subjected to a primary cloning plate ELISA test and a secondary cloning plate ELISA test. Ultimately, ascites was purified to purify the antibody. As a result, five monoclonal antibodies, 2B8 antibody, 2C11 antibody, 3B2 antibody, 3D2 antibody and 3H7 antibody, were obtained. Purification of the antibody was carried out in the following manner. After 0.5 ml of pristane was injected intraperitoneally into BALB / c mice over 8 weeks, hybridoma cells were cultured after 1 to 10 days, washed three times with PBS, and then washed with PBS (5 × 10 ⁶ cells / And injected into the abdominal cavity using a syringe. After 1 to 10 days of ascites, the mice were sacrificed by cervical dislocations and a small hole was made in the abdomen. The ascites was collected using a serum separation tube while avoiding the flow of ascites. The mixture was allowed to stand at room temperature for about 1 hour and centrifuged to remove RBC. An appropriate amount of PBS was added to the collected samples, and the mixture was slowly mixed with ammonium sulfate at 4 ° C. After centrifugation at 4 ° C, the solution was passed through a filter. An appropriate amount of Protein A and DFMF mixed beads was added, and then Tris buffer solution was washed with 10 times of the bed volume. After adding the antibody and mixing well with the protein A / G, the fraction was collected, washed with Tris buffer, and then eluted several times with glycine. The purified antibody was dialyzed in PBS buffer for 3 hours, replaced with PBS buffer overnight, dialyzed overnight, and dialyzed.

Example  4: specificity analysis of monoclonal antibodies

Western blotting was performed to confirm whether the obtained antibodies exhibited the same results for the pre-expressed and purified BphP protein and BphN protein. Each of the monoclonal antibodies having a concentration of 1 mg / ml as the primary antibody was used at a ratio of 1: 1000 to 2% skim milk, and HRP-mouse antibody ( SIGMA) at a ratio of 1: 10000 to perform Western blotting. As a result, 2B8 antibody and 2C11 antibody resulted in binding to BphP protein and BphN protein as a result of ELISA test on hybridoma cell line clone (FIG. 2). Therefore, all of the two antibodies could be considered to bind to the N-terminal region of BphP. The 3B2 antibody and the 3D2 antibody showed a band for the BphP protein but no band for the BphN protein, indicating that the antibody binds to the C-terminal region of the BphP protein. However, in the case of the 3H7 antibody, only the BphP protein was recognized, unlike the results in the ELISA test. In addition, the degree of binding of each antibody was most strongly bound to 2B8 antibody and 2C11 antibody binding at the N-terminal site, and the 3D2 antibody thought to recognize the C-terminal site exhibited a weaker recognition band. Followed by 3H7 antibody and 3B2 antibody in that order.

On the other hand, DrBphP has a structure similar to that of phytochrome. Especially, PCDs constituting N-terminal region have very similar structures including PAS, GAF and PHY domains. Therefore, And whether or not they responded. However, all five monoclonal antibodies against the BphP protein of Deinococcus radiodurans did not bind to the Ophtocrome protein (Oat PhyA) (FIG. 3). Therefore, it was confirmed that the monoclonal antibodies against the BphP protein of Deinococcus radiodurans are BphP-specific novel antibodies that recognize epitopes different from those against the conventional Oat phytochrome protein.

The inventors of the present inventors of the hybridoma cell line 2B8 of 2B8 antibody, the most strongly bound monoclonal antibody against BphP protein of Deinococcus radiodurans (KCTC) on September 24, 2012 ), The accession number of the hybridoma cell line 2B8 is KCTC 12283BP. And the isotype of 2B8 antibody was determined by the ELISA method using a mouse antibody. The heavy chain isotype of the 2B8 antibody was IgG 2a and the light chain isotype was κ (kappa).

Example  5: 2B8 monoclonal antibody Epitope  For confirmation Epitope Mapping

5-1: Primary epitope mapping

In order to identify the epitope of the 2B8 antibody strongly bound among the monoclonal antibodies against the BphP protein of the Deinococcus radiodurans (Dinococcus radiodurans), a DrBphP recombinant partial peptide (recombinant partial peptide) was prepared and epitope mapping was performed.

First, the DNA encoding the amino acid sequence at position 3-12 (SEQ ID NO: 13) based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 3) of DrBphP, and the amino acid sequence at position 3-11 (SEQ ID NO: 1) Primers were prepared for cloning the DNA, the DNA encoding the amino acid sequence at positions 3-10, and the DNA encoding the amino acid sequence at positions 4-12. PCR was performed using primers and PrimeSTAR HS (TAKARA, R040) polymerase that were prepared for about 30 cycles to obtain amplified DNA products. The PCR reaction for DNA cloning does not require a separate template, and in one cycle of PCR, a template for amplification can be obtained by combining a forward primer and a reverse primer. Table 4 below shows the primers used in PCR to obtain DNA amplification products encoding the four DrBphP recombinant partial peptides.

SEQ ID NO: Type of primer The base sequence (5 '- > 3') The restriction enzyme recognition site contained in the primer 14 BphP 3-12 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 15 BphP 3-12 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA AAGCGGTGGAAAAAAGGGCAA EcoR I 16 BphP 3-11 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 17 BphP 3-11 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA CGGTGGAAAAAAGGGCAACGG EcoR I 18 BphP 3-10 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG CGGGACCCGTTGCCCTTTTTT BamH I 19 BphP 3-10 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA TGGAAAAAAGGGCAACGGGTC EcoR I 20 BphP 4-12 a.a. Forward primer for cloning GC CTCGAG GGATCC ATG GACCCGTTGCCCTTTTTTCCA BamH I 21 BphP 4-12 a.a. Reverse primer for cloning GC GAGCTC GAATTC TCA AAGCGGTGGAAAAAAGGGCAA EcoR I

The amplified PCR product was run on 1% agarose gel (QA-Agarose gel, Q-BIO, CAT # AGAH0250) and the size of amplified DNA was confirmed by ultraviolet irradiation. Then, only the DNA band corresponding to the DNA amplification product was cut out, and only the desired DNA was isolated using a gel elution kit (FavorPrep GEL / PCR purification kit, FAVORGEN, CAT # FAGCK001-1). Then, pJET (CloneJET PCR cloning kit, Fermentas, # K1232) vector. Then, DH5 α competent cells (manufacturer: Invitrogen), which are 30 to 50 μl of E. coli, were added to the binding vector of about 10 to 20 μl, incubated on ice for 20 minutes, and then heat shock at 42 ° C. for 1 minute. After the shock) was recovered again on ice for 20 minutes, and spread on the LB medium plate containing ampicillin (sreading) and then transformed by incubation at 37 ℃ overnight incubation. Then, when the colonies grew, the cells were inoculated on LB medium containing ampicillin and cultured overnight at 37 ° C. Then, plasmids were grown using the FavorPrep plasmid extraction kit (FAVORGEN, cat # FAPDE300) And extracted. Then, the extracted plasmid was consigned to Bioneer co., KR and the nucleotide sequence thereof was measured. As a result, it was confirmed that the DNA product generated through PCR had a desired base sequence.

In addition, the plasmid extracted using restriction enzymes BamH I and EcoR I and the pGEX4T1 vector ((GE Healthcare, Piscataway, NJ, USA)) were cleaved and the N-terminus of the entire amino acid sequence (SEQ ID NO: 3) of DrBphP, the target DNA. DNA encoding an amino acid sequence of position 3-12 (SEQ ID NO: 13), DNA encoding an amino acid sequence of position 3-11 (SEQ ID NO: 1), DNA encoding an amino acid sequence of position 3-10, 4 DNAs encoding the amino acid sequence at position -12 were respectively linked to the pGEX4T1 vector, which is a protein expression vector, and then BL21 competent cells (e.g., RBC, Taipei, Taiwan) that were Escherichia coli with the pGEX4T1 vector containing the target DNA. After transformation, the cells were cultured on LB medium containing ampicillin to induce protein expression.Then, the cultured cells were separated using only sonication, disrupted, and separated only from the supernatant obtained by centrifugation, followed by GST resin (Glutathion S). epharose ™ High Performance, GE Healthcare). Western blotting was performed on the purified protein and the BphP protein of Deinococcus radiodurans. At this time, 2B8 monoclonal antibody and anti-GST antibody were used as the primary antibody, and horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG; Sigma) was used as the secondary antibody. Further, in order to develop a sample transferred to the cellulose membrane after SDS-PGAE, Amersham ™ ECL ™ Western Blotting Detection Reagents (GE Healthcare, RPN2106OL / AF) were used. 4 shows the results of primary epitope mapping for 2B8 antibodies via Western blot. As shown in FIG. 4, the epitope of the 2B8 antibody is 9 amino acids (SEQ ID NO: 1) corresponding to positions 3-11 based on the N-terminus of the entire amino acid sequence (SEQ ID NO: 3) of DrBphP, and used as a peptide tag. Confirmed that it can. In addition, the peptide tag which consists of the amino acid sequence of sequence number 1 was named "BRT tag".

5-2: Secondary epitope mapping

The primary epitope mapping confirmed that the BRT tag consisting of the amino acid sequence of SEQ ID NO: 1 is an epitope of the 2B8 antibody. The inventors performed secondary epitope mapping to see if the 2B8 antibody recognizes the modified partial peptide DrBphP, which is a peptide in which one of the amino acid sequences of SEQ ID NO: 1 constituting the BRT tag is deleted.

First, a peptide containing an amino acid sequence at position 3-11 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 3) and at the same time deleting the fourth amino acid residue aspartic acid (denoted 3-11-Δ4D) Is a peptide containing an amino acid sequence at position 3-11 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 3) and a deletion of the proline, the fifth amino acid residue (3-11-Δ5P). Peptide encoding the leucine, which is the 6th amino acid residue at the same time, containing the amino acid sequence at position 3-11 based on the N-terminus among the entire amino acid sequence of the DNA encoding DrBphP (SEQ ID NO: 3) A peptide comprising an amino acid sequence at positions 3-11 based on the N-terminus of the entire amino acid sequence of the DNA coding for the DNA, DrBphP (SEQ ID NO: 3), and a proline-deleted 7th amino acid residue ( 3-11-Δ7P) DNA encoding the amino acid sequence of position 3-11 based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 3), and at the same time the peptide with the 8th amino acid residue phenylalanine (3-11-Δ8F) Primers were prepared for each of the DNAs encoding the genes. PCR was performed using primers and PrimeSTAR HS (TAKARA, R040) polymerase that were prepared for about 30 cycles to obtain amplified DNA products. The PCR reaction for DNA cloning does not require a separate template, and in one cycle of PCR, a template for amplification can be obtained by combining a forward primer and a reverse primer. Table 5 below shows the primers used in PCR to obtain DNA amplification products encoding the five DrBphP modified partial peptides. The procedure after obtaining the DNA amplification product by PCR is the same as the first-order epitope mapping, so the explanation is omitted.

SEQ ID NO: Type of primer The base sequence (5 '- > 3') The restriction enzyme recognition site contained in the primer 22 Forward primer for 3-11-Δ4D cloning GCGGATCCATGCGGCCGTTGCCCTTTTTTCCACCG BamH I 23 Reverse primer for 3-11-Δ4D cloning GCGAATTCTCACGGTGGAAAAAAGGGCAACGGCCG EcoR I 24 Forward primer for 3-11-Δ5P cloning GCGGATCCATGCGGGACTTGCCCTTTTTTCCACCG BamH I 25 Reverse primer for 3-11-Δ5P cloning GCGAATTCTCACGGTGGAAAAAAGGGCAAGTCCCG EcoR I 26 Forward primer for 3-11-Δ6L cloning GCGGATCCATGCGGGACCCGCCCTTTTTTCCACCG BamH I 27 Reverse primer for 3-11-Δ6L cloning GCGAATTCTCACGGTGGAAAAAAGGGCGGGTCCCG EcoR I 28 Forward primer for 3-11-Δ7P cloning GCGGATCCATGCGGGACCCGTTGTTTTTTCCACCG BamH I 29 Reverse primer for 3-11-Δ7P cloning GCGAATTCTCACGGTGGAAAAAACAACGGGTCCCG EcoR I 30 Forward primer for 3-11-Δ8F cloning GCGGATCCATGCGGGACCCGTTGCCCTTTCCACCG BamH I 31 Reverse primer for 3-11-Δ8F cloning GCGAATTCTCACGGTGGAAAGGGCAACGGGTCCCG EcoR I

5 shows via Western blot the results of secondary epitope mapping for 2B8 antibodies. As shown in FIG. 5, another epitope of the 2B8 antibody is located at the 8th or 9th position at amino acid residues corresponding to 3rd to 11th positions based on the N-terminus of the entire amino acid sequence of DrBphP (SEQ ID NO: 3). One amino acid residue corresponding to phenylalanine was identified as the deleted peptide (SEQ ID NO: 2), and other epitopes of the 2B8 antibody can also be used as peptide tags. The peptide tag consisting of the amino acid sequence of SEQ ID NO: 2 was named "BRT-ΔF tag".

Example  6: BRT  Preparation of a fusion protein using a tag, and BRT  Detection of Fusion Proteins with Antibodies to Tags

A fusion protein was prepared using the BRT tag of the present invention, and the fusion protein was detected using a B28 antibody which is a monoclonal antibody against the BRT tag.

6-1: Fusion Protein Expression and Detection in E. coli

GST (Glutathion-S-Transferase) to confirm whether the fusion protein including the BRT tag of the present invention is normally expressed on E. coli , and whether the expressed fusion protein can be detected by a 2B8 monoclonal antibody. A DNA construct encoding a fusion protein linked to the BRT tag in front of the protein was prepared. Primers for each were constructed to clone the DNA encoding the BRT tag of the present invention and the DNA encoding the c-myc tag. PCR was performed using primers and PrimeSTAR HS (TAKARA, R040) polymerase that were prepared for about 30 cycles to obtain amplified DNA products. The PCR reaction for DNA cloning does not require a separate template, and in one cycle of PCR, a template for amplification can be obtained by combining a forward primer and a reverse primer. Table 6 below shows the primers used in PCR to obtain the two DNA amplification products. The desired DNA was isolated from the amplified PCR product and ligated to pJET (CloneJET PCR cloning kit, Fermentas, # K1232) vector. Then, the binding vector was entrusted to Bioneer co., KR to measure the base sequence. As a result, it was confirmed that the DNA product generated through PCR had a desired base sequence.

SEQ ID NO: Type of primer The base sequence (5 '- > 3') The restriction enzyme recognition site contained in the primer 32 Forward primer for cloning BRT tags GCCTCGAGGGATCCATGCGGGACCCGTTGCCCTTTTTT BamH I 33 Reverse primer for cloning BRT tags GCGAGCTCGAATTCTCACGGTGGAAAAAAGGGCAACGG EcoR I 34 forward primer for c-myc tag cloning GCGGATCCATGGAACAAAAATTAATTTCTGAAGAAGATTTA BamH I 35 reverse primer for c-myc tag cloning GCGAATTCTCATAAATCTTCTTCAGAAATTAATTTTTGTTC EcoR I

The isolated DNA product was then bound to the pGEX4T1 vector (GE Healthcare, Piscataway, NJ, USA), which contains DNA encoding the Glutathion-S-Transferase (GST) protein as an expression vector. The DNA product and the pGEX4T1 vector (GE Healthcare, Piscataway, NJ, USA) were cleaved using restriction enzymes BamH I and EcoR I and linked using ligase. Then, the pGEX4T1 vector containing the target DNA was isolated from E. coli. BL21 competent cells (manufactured by RBC, Taipei, Taiwan) were transformed by applying a heat shock at 42 ° C. for 1 minute, and cultured on LB medium containing ampicillin to fused with a BRT tag to GST protein. Protein (labeled 3-11 :: GST) and fusion protein (labeled Myc :: GST) with c-myc tag attached to the GST protein, respectively, specifically transformed into BL21 competent cells to express LB medium. Colo grown on (colony) of cultured ampicillin containing the LB inoculated to the medium and at least about 8 hours at 37 ℃ species inoculated species cultured cells in LB medium with ampicillin containing and until the value at OD ₆₀₀ become 0.6 After raising to concentration, IPTG was added to a total concentration of 0.5 mM and protein expression was induced for 6 hours at 25 ° C. The commercially available GST resin (Glutathion Sepharose ™ High Performance, GE Healthcare). Western blotting was performed on the purified protein and the BphP protein of Deinococcus radiodurans. At this time, 2B8 monoclonal antibody and anti-myc antibody were used as primary antibodies, and horseradish peroxidase (HRP) conjugated anti-mouse immunoglobulin (anti-mouse IgG; Sigma) was used as secondary antibody. Further, in order to develop a sample transferred to the cellulose membrane after SDS-PGAE, Amersham ™ ECL ™ Western Blotting Detection Reagents (GE Healthcare, RPN2106OL / AF) were used. FIG. 6 is a western blot showing that the fusion protein with the BRT tag attached to the N-terminus of the GST protein is normally expressed on E. coli and capable of detecting the fusion protein by the 2B8 antibody. As shown in FIG. 6, the BRT-tagged fusion protein was smoothly expressed in E. coli at the N-terminus of the GST protein, and the expressed protein was well detected without the nonspecific binding by the 2B8 antibody. In addition, the epitope tagging system using the BRT tag and 2B8 antibody showed almost the same level of effect as compared to the c-myc tag, which is a commonly used tag, and the epitope tagging system using the antibody.

6-2: Expression and Detection of Fusion Proteins in Plant Cells

In order to confirm whether the fusion protein including the BRT tag of the present invention is normally expressed on plant cells, and to confirm whether the expressed fusion protein can be detected with a 2B8 monoclonal antibody, a BRT tag is connected to the front of a GFP (Green Fluorescent Protein). DNA constructs encoding fusion proteins were prepared. Cloning the DNA encoding the fusion protein (labeled BRT :: GFP) linked to GFP of the present invention to GFP and the DNA encoding the fusion protein (labeled Myc :: GFP) linked with c-myc tag to GFP In order to prepare a primer for each. PCR was performed about 30 cycles using the prepared primers and PrimeSTAR HS (TAKARA, R040) polymerase, and DNA (SEQ ID NO: 36) encoding GFP was used as a template for PCR. Table 7 below shows the primers used in PCR to obtain the two DNA amplification products. Only the desired DNA was isolated from the amplified PCR product and then bound to the pJET (CloneJET PCR cloning kit, Fermentas, # K1232) vector. Then, the binding vector was entrusted to Bioneer co., KR to measure the base sequence. As a result, it was confirmed that the DNA product generated through PCR had a desired base sequence.

SEQ ID NO: Type of primer The base sequence (5 '- > 3') The restriction enzyme recognition site contained in the primer 37 Forward primer for BRT :: GFP cloning GCCTCGAGATGAGGGATCCACTTCCATTCTTCCCTCCAATGGTGAGCAAGGGCGAG Xho Ⅰ 38 Reverse primer for BRT :: GFP cloning GCGAGCTCTTACTTGTACAGCTCGTCCAT Sac Ⅰ 39 Forward primer for Myc :: GFP cloning GGAGAGGACCTCGAGATGGAACAAAAGCTTATTTCTGAAGAAGATCTTATGGTGAGCAAGGGCGAG Xho Ⅰ 40 Reverse primer for Myc :: GFP cloning GCGAGCTCTTACTTGTACAGCTCGTCCAT Sac Ⅰ

The isolated DNA product was then bound to the expression vector, pBY030.2R vector, and Agrobacterium LBA4404 cells were transformed using the vector. Afterwards, letting Nicotiana benthamiana (tobacco) Agrobacterium LBA4404 is infiltrated into the underside of the leaf with a syringe, and the fusion protein (labeled BRT :: GFP) with the BRT tag and the c-myc tag with the GFP (Myc :: displays with GFP) each transient expression in tobacco plants (was a transient expression. detailed experimental methods Imogen et al (NATURE PROTOCOL, 2006, Vol. 1, NO. 4, 2019-2025). Agrobacterium was grown to a concentration until the value at OD ₆₀₀ became 0.7 and then injected into the plant, and the sample was harvested after maintaining the plant in the culture room for 5 days. The presence or absence of the transformation was confirmed by plants with GFP fluorescence by treatment with ultraviolet (UV). Harvested samples were flash frozen in liquid nitrogen and stored at -80 ° C. Thereafter, the tobacco leaf sample was pulverized with TissueLyser (QIAGEN), and an extraction buffer (125 mM Tris-HCL pH 8.8, 1% SDS, 10% Glycerol, and 50 mM Na ₂ S ₂ O ₅ ) was added, followed by centrifugation. Only supernatant was separated and used for western blot analysis. 7 is a Western blot showing that the fusion protein with the BRT tag attached to the N-terminus of the GFP is normally expressed in plant cells and the fusion protein can be detected by the 2B8 antibody. As shown in FIG. 7, the BRT-tagged fusion protein at the N-terminus of GFP was smoothly expressed regardless of leaf growth in plant cells, and the expressed protein was well detected without nonspecific binding by the 2B8 antibody. In addition, the epitope tagging system using the BRT tag and 2B8 antibody showed almost the same level of effect as compared to the c-myc tag, which is a commonly used tag, and the epitope tagging system using the antibody.

Although the present invention has been described through the above embodiments as described above, the present invention is not necessarily limited thereto, and various modifications can be made without departing from the scope and spirit of the present invention. Therefore, the protection scope of the present invention should be construed as including all embodiments falling within the scope of the claims appended to the present invention.

Korea Biotechnology Research Institute KCTC12283BP 20120924

Attach an electronic file to a sequence list

Claims (12)

A kit for detecting or purifying a fusion protein comprising an antibody to a peptide tag or a hybridoma cell line producing an antibody to the peptide tag,
The peptide tag consists of the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2,
The fusion protein kit comprising a peptide tag consisting of the amino acid sequence of SEQ ID NO: 1 or a peptide tag consisting of the amino acid sequence of SEQ ID NO: 2.
The kit of claim 1, wherein the antibody against the peptide tag is a monoclonal antibody.
3. The kit of claim 2, wherein said monoclonal antibody is produced by a hybridoma cell line with an accession number of KCTC 12283BP.
3. The kit of claim 2, wherein the heavy chain isotype of the monoclonal antibody is IgG 2a.
The kit of claim 2, wherein the light chain isotype of the monoclonal antibody is κ (kappa).
The kit of claim 1, wherein the hybridoma cell line has an accession number of KCTC 12283BP.
The kit according to any one of claims 1 to 6, further comprising a means for detecting an antibody against said peptide tag.
8. The kit of claim 7, wherein the means for detecting the antibody against the peptide tag is a secondary antibody.
The kit of claim 8, wherein the secondary antibody is conjugated with a labeling material selected from enzymes, radioactive materials, or fluorescent materials.
The kit according to any one of claims 1 to 6, wherein the antibody against the peptide tag is immobilized on a support.
The kit according to any one of claims 1 to 6, wherein the peptide tag included in the fusion protein is linked to the N-terminus or C-terminus of the target protein. delete

Images