KR20160086178A - Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller - Google Patents

Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller Download PDF

Info

Publication number
KR20160086178A
KR20160086178A KR1020150003589A KR20150003589A KR20160086178A KR 20160086178 A KR20160086178 A KR 20160086178A KR 1020150003589 A KR1020150003589 A KR 1020150003589A KR 20150003589 A KR20150003589 A KR 20150003589A KR 20160086178 A KR20160086178 A KR 20160086178A
Authority
KR
South Korea
Prior art keywords
jujube
species
jujubes
seq
primer
Prior art date
Application number
KR1020150003589A
Other languages
Korean (ko)
Other versions
KR101693410B1 (en
Inventor
유제민
조남수
곽견미
변영훈
엄유리
정재훈
이이
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Priority to KR1020150003589A priority Critical patent/KR101693410B1/en
Publication of KR20160086178A publication Critical patent/KR20160086178A/en
Application granted granted Critical
Publication of KR101693410B1 publication Critical patent/KR101693410B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/139Random amplification polymorphism detection [RAPD]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a method for discriminating the species of jujubes through a random amplified polymorphic DNA (RAPD) analysis, and a primer used for the same. More specifically, the present invention relates to an RAPD primer having a particular base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3; a method for detecting DNA polymorphism of jujubes, wherein the method comprises performing a PCR by using the same; and a method for discriminating the of jujubes. According to the present invention, an RAPD marker for discriminating the species of jujubes effectively detects DNA polymorphism of jujubes and can be very useful in writing a DNA profile of jujubes. Accordingly, a genetic source of jujubes is effectively evaluated, so doubleness of an introduced novel genetic source with a conventional retained resource can be effectively analyzed and novelty can be effectively established. Also, the species of jujubes can be discriminated. Moreover, domestically distributed native species can be clearly separated, and species which do not have titles can be registered as novel species. Accordingly, precious genetic resources can be protected, and domestic species and imported species can be identified. Thus, order in distribution can be established in the domestic jujube market.

Description

대추 품종 판별용 RAPD 프라이머{Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller}Random Amplified Polymorphic DNA Primer for Discrimination of Jujube Varieties for Discrimination of Zizyphus jujuba Miller}

본 발명은 RAPD(Random Amplified Polymorphic DNA) 분석에 의한 대추의 품종 판별 방법 및 그 방법에 사용되는 프라이머에 관한 것으로, 보다 구체적으로는 서열번호 1 내지 서열번호 3로 이루어진 군으로부터 선택되는 특정 염기서열을 갖는 RAPD 프라이머 및 이를 이용하여 PCR을 수행하는 것을 포함하는 대추의 DNA 다형성 검출 방법 및 대추의 품종 판별 방법에 관한 것이다.The present invention relates to a method for discriminating the variety of jujubes by RAPD (Random Amplified Polymorphic DNA) analysis and a primer used in the method. More specifically, the present invention relates to a method for identifying a variety of jujubes by using a specific base sequence selected from the group consisting of SEQ ID NOS: The present invention relates to a method for detecting DNA polymorphism of jujubes and a method for discriminating jujubes from rice cultivars including PCR using the RAPD primers.

대추나무(Zizyphus jujuba Miller)는 갈매나무과 식물로서 약 40여종이 북반구의 열대에서 온대지역까지 분포하며 우리나라와 일본, 중국 및 소련 등지에는 주로 중국대추 계통인 낙엽교목의 Z. jujuba를, 인도와 파키스탄 및 이란, 이라크 등지에는 인도대추 계통인 상록성의 Z. mauritiana 등 생태형이 전혀 다른 2종이 재배되고 있다. 과실인 대추는 예로부터 자양강장과 위와 간을 보호하는 작용 등이 뛰어나 한약재와 식용 등의 용도로 널리 이용되어 왔을 뿐만 아니라 최근에는 암세포 증식억제 작용이 있다는 보고와 함께 건강식품으로서도 각광을 받고 있다. 이와같이 다양한 쓰임새가 있음에도 불구하고 우리나라에서의 대추나무 품종육성에 관한 연구는 1970년대까지 부진하여 정식으로 명명된 품종이 아닌 단순히 생산지의 명칭을 붙이거나, 대추나무의 형태적 특성에 근거하여 분류하였다. 그러나 표현형적인 특성은 환경의 영향 받아 정확한 품종 식별에 문제가 있는 실정이다.The jujube ( Zizyphus jujuba Miller ) is a species of the family Seagrass, about 40 species ranging from tropical to temperate regions in the northern hemisphere. In Korea, Japan, China and the Soviet Union, Z. jujuba, And Iran, Iraq, etc. There are two completely different ecologically grown species such as Z. mauritiana, an evergreen dairy plant of the Indian jujube species. Fruit jujube has been widely used for medicinal materials and edible use since it has excellent function to protect nourishment gland and stomach and liver from olden days, and recently it has been spotlighted as a health food as well as reporting the inhibition of cancer cell proliferation. In spite of these various uses, studies on the cultivation of jujube cultivars in Korea were poorly classified until the 1970s, and they were named not simply formally named varieties, but were classified based on the morphological characteristics of jujubes. However, phenotypic characteristics are affected by the environment and there is a problem in identifying the correct breed.

최근 들어 분자생물학 분야의 급진적인 발전과 더불어 식물의 속, 종간 또는 종내 품종간 분류에 분자생물학적인 방법들이 다양하게 사용되고 있다. 이를 위하여 핵산(DNA) 수준에서 유전자원의 다양성(genetic diversity) 연구를 가능케 하는 핵산 지문 분석 방법 및 다양한 DNA 마커들이 개발되고 있다. 분자생물학 수준에서의 DNA 분석에 의한 변종의 감별은 그 변종의 양적수준과 더불어 다수의 특성을 파악하여 알 수 있으며 환경의 영향을 배제할 수 있는 장점이 있다. 그 중에서 RFLP(제한효소 단편 장다형, Restriction Fragment Length Polymorphism)는 일련의 DNA 사슬을 제한효소로 처리했을 때 생기는 DNA 단편들이 개체간의 유전적 조성의 차이 즉, 염기 서열상의 차이에 따라서 그 수나 길이가 서로 다르게 나타난다는 사실에 기초한 것으로써 다양하게 이용되고 있다. 하지만 RFLP는 순도가 높은 DNA가 다량으로 필요하며 시간과 노력과 비용이 많이 소요될 뿐 아니라 시험과정이 복잡하고 방사성 동위원소를 이용해야 하는 단점이 있다.In recent years, along with the radical development of molecular biology, molecular biology methods have been widely used to classify plants as genus, species or species. To this end, nucleic acid fingerprint analysis methods and various DNA markers have been developed that enable genetic diversity studies at the DNA level. The discrimination of strains by DNA analysis at the level of molecular biology has the advantage of being able to grasp many characteristics along with the quantitative level of the strains and to exclude the influence of the environment. Among them, RFLP (Restriction Fragment Length Polymorphism) is a technique in which DNA fragments generated when a series of DNA chains are treated with a restriction enzyme have a number or length depending on the difference in genetic composition between individuals, that is, It is based on the fact that it appears differently and is being used variously. However, RFLP requires large amounts of high-purity DNA, is time-consuming, labor-intensive and costly, has a complex test procedure, and has a disadvantage of using radioactive isotopes.

이러한 문제점을 극복하기 위한 방법으로 기술적으로 단순하고 다형상성(Polymorphism)의 추적이 용이한 RAPD(Random Amplified Polymorphic DNA) 방법이 개발되었다. RAPD 방법은 신속하게 결과를 도출하며 적용하기 쉽고 사전에 염기 서열 정보를 가질 필요가 없다. 이를 이용한 기술로서, 대한민국 등록특허 제10-0264743호에 “marker RAPD를 이용한 벼의 유묘 내냉성에 관여하는 양적 형질 유전자 지도(QTL)와 저온저항성 벼품종 선발 방법”이 개시되어 있고, 대한민국 등록특허 제10-0215084호에 “RAPD 표식에 의한 고려인삼의 산지 판별방법 및 그 방법에 사용되는 프라이머”가 개시되어 있으며, 대한민국 등록특허 제10-0764561호에 “RAPD 표지인자를 이용한 양파의 웅성불임회복 유전자판별 방법”이 개시되어 있다.To overcome these problems, RAPD (Random Amplified Polymorphic DNA) method, which is technically simple and easy to track polymorphism, has been developed. The RAPD method provides quick results and is easy to apply and does not need to have sequence information in advance. As a technique using this, Korean Patent No. 10-0264743 discloses "quantitative trait gene map (QTL) and low temperature resistant rice varieties selection method involving rice cold seedling resistance using marker RAPD" 10-0215084 discloses " a method for discriminating the origin of Korean ginseng by RAPD marking and a primer used in the method ", and Korean Patent No. 10-0764561 discloses " a male sterile restorative gene Discrimination method "

하지만 대추 품종에 대한 RAPD 마커는 아직 국내에서 전혀 개발된 바 없으며, 특히 국내 재래종 대추 품종 유전자원이 포함된 연구는 외국에서도 전혀 다루어지지 않은 실정이다However, RAPD markers for dairy cultivars have not yet been developed in Korea. In particular, studies involving genetic resources of domesticated domestic varieties have not been studied in any other countries

이에 본 발명자들은 분자생물학적인 접근 중 분자마커를 활용하여 RAPD분석을 통해 대추의 품종간의 차이를 비교 분석하고자 수행하고자, 총 60개의 RAPD 프라이머 세트를 제작하였으며, 이 중 특정 프라이머를 이용한 PCR 증폭 결과 국내에서 재배되는 서로 다른 4개의 대추 품종(국광, 미조, 상왕, 보은)에서 특이적인 밴드가 형성되는 것을 통해, 국내 재배하는 다양한 대추 품종을 판별할 수 있음을 확인함으로써 본 발명을 완성하였다.Therefore, the present inventors made a total of 60 RAPD primer sets for comparative analysis of jujube varieties using RAPD analysis using molecular markers during molecular biology approach. Among them, The present inventors completed the present invention by confirming that a variety of jujube varieties cultivated domestically can be identified through the formation of specific bands in four different jujube cultivars (Kwangwang, Mizo, Sangwang, Boeun) cultivated in Korea.

한국등록특허 제10-0215084호Korean Patent No. 10-0215084 한국등록특허 제10-2012-0001870호Korean Patent No. 10-2012-0001870 한국등록특허 제10-2011-0135835호Korea Patent No. 10-2011-0135835

따라서 본 발명의 목적은 국내에서 재배되는 대추의 품종을 효과적으로 판별할 수 있는 RAPD 프라이머를 제공하는 것이다.Accordingly, an object of the present invention is to provide a RAPD primer capable of effectively discriminating the cultivars of jujube cultivated in Korea.

또한 본 발명의 다른 목적은 상기 RAPD 프라이머를 포함하는 대추 품종 판별용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for discriminating jujube cultivars comprising the RAPD primer.

또한 상기 조성물을 포함하는 대추 품종 판별용 키트를 제공하는 것이다.And a kit for discriminating the variety of jujube including the composition.

또한 본 발명의 다른 목적은 상기 RAPD 프라이머를 이용하여 PCR을 수행함으로써 대추 품종을 효과적으로 판별하는 방법을 제공하는 것이다.It is another object of the present invention to provide a method for efficiently discriminating jujube cultivars by performing PCR using the RAPD primer.

상기와 같은 본 발명의 목적을 달성하기 위해서, 본 발명은 서열번호 1 내지 서열번호 3으로 구성된 군으로부터 선택된 염기서열을 갖는 대추 품종 판별용 RAPD(Random Amplified Polymorphic DNA) 프라이머를 제공한다.In order to accomplish the object of the present invention, the present invention provides a RAPD (Random Amplified Polymorphic DNA) primer for distinguishing a variety of jujube having a base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3.

본 발명의 일실시예에서, 상기 대추 품종은 국광, 미조, 상왕 및 보은으로 이루어진 군으로부터 선택된 1종일 수 있다.In one embodiment of the present invention, the jujube cultivar may be one selected from the group consisting of ginseng, fine grains, sweet potatoes and sweet potatoes.

본 발명의 일실시예에서, 상기 서열번호 1은 대추 품종 중 국광을 판별할 수 있다.In one embodiment of the present invention, SEQ ID NO: 1 can discriminate the local light among the jujube cultivars.

본 발명의 일실시예에서, 상기 서열번호 2는 대추 품종 중 미조을 판별할 수 있다.In one embodiment of the present invention, SEQ ID NO: 2 is capable of discriminating mizuna among the dairy varieties.

본 발명의 일실시예에서, 상기 서열번호 2 또는 3은 대추 품종 중 상왕을 판별할 수 있다.In one embodiment of the present invention, SEQ ID NO: 2 or 3 is capable of discriminating a female of a jujube variety.

본 발명의 일실시예에서, 상기 서열번호 3은 대추 품종 중 보은을 판별할 수 있다.In one embodiment of the present invention, SEQ ID NO: 3 can discriminate complement among the jujube cultivars.

또한, 본 발명은 상기 프라이머를 포함하는 대추 품종 판별용 조성물을 제공한다.In addition, the present invention provides a composition for discriminating jujube cultivars comprising the primer.

또한, 본 발명은 상기 조성물을 포함하는 대추 품종 판별용 키트를 제공한다.In addition, the present invention provides a kit for discriminating jujube cultivars comprising the above composition.

또한, 본 발명은 개체로부터 얻어진 핵산 시료를 상기 프라이머를 이용하여 PCR을 수행하는 단계를 포함하는, 대추 품종 판별 방법을 제공한다.In addition, the present invention provides a method for discriminating jujube cultivars, comprising the step of performing PCR using a nucleic acid sample obtained from an individual using the primer.

본 발명에 따른 대추의 DNA 프로파일을 작성하는데 매우 유용하게 이용될 수 있으며, 이를 통해 대추의 유전자원을 효율적으로 평가함으로써 신규 유전자원 도입 시 기존 보유자원과의 중복성 분석 및 신규성 확립을 효과적으로 수행할 수 있으며, 대추의 품종을 판별할 수 있는 효과가 있다. 또한, 국내에 산재해 있는 토종 품종(계통)간의 구분을 명확히 할 수 있을 뿐만 아니라 이름 없는 품종들의 신품종 등록이 가능하여 우리의 소중한 유전자원을 보호할 수 있으며, 국내산과 수입산의 식별이 가능해져 국내 대추 시장의 유통질서를 확립하는데 기여할 수 있다. It can be used very useful for preparing the DNA profile of jujube according to the present invention. Thus, by efficiently evaluating the genetic resources of jujube, it is possible to effectively perform duplication analysis and novelty establishment , And there is an effect that the variety of jujube can be discriminated. In addition, it is possible to clarify the distinction between native varieties (strains) scattered in Korea, and also to register new varieties of unnamed varieties, thereby protecting our valuable genetic resources and enabling identification of domestic and imported varieties It can contribute to establishing the circulation order of the jujube market.

도 1은 본 발명의 프라이머 A08(서열번호 1)을 이용하여 10개의 대추 품종에서 분리된 DNA를 주형으로 PCR 증폭 후 반응산물의 전기영동 사진을 나타낸 것이다.
도 2는 본 발명의 프라이머 A09(서열번호 2)를 이용하여 10개의 대추 품종에서 분리된 DNA를 주형으로 PCR 증폭 후 반응산물의 전기영동 사진을 나타낸 것이다.
도 3은 본 발명의 프라이머 C08(서열번호 3)를 이용하여 10개의 대추 품종에서 분리된 DNA를 주형으로 PCR 증폭 후 반응산물의 전기영동 사진을 나타낸 것이다.
FIG. 1 is an electrophoresis photograph of a reaction product after PCR amplification using DNA isolated from 10 dairy varieties using primer A08 (SEQ ID NO: 1) of the present invention.
FIG. 2 is an electrophoresis photograph of a reaction product after PCR amplification using DNA isolated from 10 dairy varieties using primer A09 (SEQ ID NO: 2) of the present invention as a template.
FIG. 3 is an electrophoresis image of the reaction product after PCR amplification using DNA isolated from 10 dairy varieties using primer C08 (SEQ ID NO: 3) of the present invention as a template.

하나의 양태로서, 본 발명은 서열번호 1 내지 서열번호 3으로 구성된 군으로부터 선택된 염기서열을 갖는 대추 품종 판별용 RAPD(Random Amplified Polymorphic DNA) 프라이머를 제공함에 그 특징이 있다.In one aspect, the present invention provides a Random Amplified Polymorphic DNA (RAPD) primer for discriminating jujube varieties having a base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3.

본 발명에 있어서, 상기 대추 품종은 국광, 미조, 상왕 및 보은으로 이루어진 군으로부터 선택된 1종일 수 있다.In the present invention, the jujube cultivars may be one species selected from the group consisting of kwangwol, mizuho, king kyo, and boehm.

본 발명에서 상기 ‘국광’은 최대 과중이 90g 이상인 초우량 신품종으로 토양 적응력과 병해충 내한성이 강해 재배가 쉬우며 열매의 결실률이 좋으며, 당도가 높고 맛이 우수하여 생과용으로 이용된다.In the present invention, the 'Kwangwol' is a new product with a maximum weight of 90g or more. It is easy to cultivate because of its high adaptability to soil and low pest resistance. It has good fruit yield, high sugar content and excellent taste.

본 발명에서 상기 ‘미조’는 재래종으로 숙기가 되면 껍질 표면이 갈라지는 대추가 많으며 과실이 썩는 것이 많고, 당도는 적은 편이며 육질은 다른 품종보다 낮으며 수확기는 9월 30일부터 10월 초순으로서 일반에게 널리 알려지지 않은 품종이다.In the present invention, the 'Mizo' is a native species and has many jujube cracked on the surface of the husk. Many of the fruits are rotten, the sugar content is low and the meat quality is lower than other varieties. The harvest period is from September 30 to October, Is a widely unknown variety.

본 발명에서 상기 '상왕'은 최대 과중이 90g 이상인 초우량 신품종으로 장원형의 과형을 가지며 토양 적응력이 우수해 전국에서 재배가 가능하며, 과육이 치밀하고 당도가 높아 생과용으로 이용된다.In the present invention, the 'Sangwang' is a new product with a maximum weight of 90g or more, and has an overgrowth type overgrowth. It has excellent adaptability to soil and can be cultivated all over the country. It is used as a biomass because it is dense and has high sugar content.

본 발명에서 상기 ‘보은'은 충청남북도 지역에서 재배되던 재래종으로 자람새는 직립성으로 오전개화성이며 조생종이다. 대추는 소과중으로 작은 편이고 당도는 보통이며 핵속에 종자가 없는 특징을 나타낸다.In the present invention, the 'Boeun' is a native species grown in Chungcheongnam-do province. Jujube is small in the bovine, has a sugar content of normal, and has no seed in the nucleus.

본 발명에서 용어, ‘프라이머 ’란 상보적인 주형과 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 본 발명의 구체적인 실시에서는, 서열번호 1 내지 서열번호 3으로 구성된 군으로부터 선택된 1종의 염기서열을 갖는 프라이머를 사용하였다. In the present invention, the term 'primer' refers to a short nucleic acid sequence capable of forming a base pair with a complementary template and functioning as a starting point for template strand copying. In a specific embodiment of the present invention, a primer having one base sequence selected from the group consisting of SEQ ID NOS: 1 to 3 was used.

본 발명의 일 구체예에서, 상기 서열번호 1은 대추 품종 중 국광을 판별할 수 있으며; 상기 서열번호 2는 대추 품종 중 미조를 판별할 수 있고; 상기 서열번호 2 또는 3은 대추 품종 중 상왕을 판별할 수 있으며; 상기 서열번호 3은 대추 품종 중 보은을 판별할 수 있다.In one embodiment of the present invention, SEQ ID NO: 1 can discriminate the local light among the jujube cultivars; Wherein SEQ ID NO: 2 is capable of discriminating flavor among the diest cultivars; The above SEQ ID NO: 2 or 3 is capable of discriminating the female of the jujube cultivars; SEQ ID NO: 3 can discriminate complement among jujube cultivars.

또 다른 양태로서, 상기 프라이머(서열번호 1 내지 서열번호 3으로 구성된 군으로부터 선택된 염기서열을 갖는 대추 품종 판별용 RAPD 프라이머)를 포함하는 대추 품종 판별용 조성물을 제공한다.In another aspect, the present invention provides a composition for distinguishing jujube varieties comprising the above primer (RAPD primer for discriminating jujube varieties having a base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3).

또 다른 양태로서, 본 발명은 상기 조성물을 포함하는 대추 품종 판별용 키트를 제공한다.In another aspect, the present invention provides a kit for distinguishing a jujube cultivar comprising the composition.

본 발명에 따른 대추 품종 판별용 키트는 상기 RAPD 프라이머 외에도 시료 내에서 대추 품종을 검출하기 위하여 필요한 반응완충용액, 중합효소, dNTP, 안정화제 및 모든 생물학적 또는 화학적 시약, 사용설명서 등을 포함할 수 있다. 이러한 키트의 다른 구성은 당업자에 의하여 적절히 선택될 수 있다.In addition to the RAPD primer, the kit for discriminating jujube cultivars according to the present invention may further include a reaction buffer solution, a polymerase, a dNTP, a stabilizer, and all biological or chemical reagents and instructions for detecting jujube cultivars in a sample . Other configurations of such kits may be suitably selected by those skilled in the art.

또 다른 양태로서, 본 발명은 개체로부터 얻어진 핵산 시료를 RAPD 프라이머를 이용하여 PCR을 수행하는 단계를 포함하는, 대추 품종 판별 방법을 제공한다.In another aspect, the present invention provides a method for discriminating jujube cultivars, which comprises performing PCR using a RAPD primer with a nucleic acid sample obtained from an individual.

본 발명의 상기 개체는 판별하고자 하는 대상 대추 품종 식물이다.The subject of the present invention is a target jujube variety to be discriminated.

본 발명의 PCR 수행은, 개체로부터 얻어진 핵산 시료를 서열번호 1 내지 서열번호 3으로 구성된 군으로부터 선택된 염기서열을 갖는 대추 품종 판별용 RAPD 프라이머를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. In the PCR of the present invention, the target sequence can be amplified by amplifying the nucleic acid sample obtained from the individual using the RAPD primer for discriminating the jujube variety having the nucleotide sequence selected from the group consisting of SEQ ID NOS: 1 to 3 .

본 발명의 일실시예에 있어서, PCR 수행은 94℃에서 15분간 초기 denaturation 과정을 거친 후, 94℃에서 1분(denaturation), 35℃에서 1분(annealing), 72℃에서 2분(extension)간의 반응을 45회 실시하고, 최종 extension 과정으로 72℃에서 10분간 반응시키는 과정을 통해 이루어질 수 있다.In one embodiment of the present invention, the PCR is performed at 94 ° C for 15 minutes, followed by denaturation at 94 ° C for 1 minute, annealing at 35 ° C for 1 minute, extension at 72 ° C for 2 minutes, And the reaction is carried out at 72 ° C for 10 minutes in the final extension step.

상기 PCR 수행을 통해 증폭된 표적 서열은 검출 가능한 표지 물질로 표지될 수 있다. 하나의 구체적 예로서, 상기 표지 물질은 형광, 인광 또는 방사선을 발하는 물질일 수 있으나, 이로 제한되지 않는다. 바람직하게는 상기 표지 물질은 에티디움브로마이드(Ethidium Bromide: EtBr), Cy-5 또는 Cy-3이다. 표적 서열의 증폭 시 프라이머의 5′-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사선 물질을 이용한 표지는 PCR 수행 시 32P 또는 35S 등과 같은 방사선 동위원소를 PCT 반응액에 첨가하면 증폭 산물이 합성되면서 방사선이 증폭 산물에 혼입되어 증폭 산물이 방사선으로 표지될 수 있다. The target sequence amplified by the PCR may be labeled with a detectable labeling substance. In one specific example, the labeling material can be, but is not limited to, a material that emits fluorescence, phosphorescence, or radiation. Preferably, the labeling substance is Ethidium Bromide (EtBr), Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. In addition, if the radioactive isotope such as 32 P or 35 S is added to the PCT reaction solution during the PCR, the amplified product may be synthesized and the radiation may be incorporated into the amplification product and the amplification product may be labeled with the radiation.

상기 증폭된 산물의 검출은 DNA 칩, 겔 전기영동, 방사선 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이로 제한되는 것은 아니다. 증폭 산물을 검출하는 방법 중의 하나로서, 겔 전기영동을 수행할 수 있다. 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5′-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사선 측정 방법은 PCR 수행시 32P 또는 35S 등과 같은 방사선 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사선 측정기구, 예를 들면, 가이어 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사선을 측정할 수 있다.
Detection of the amplified product can be performed through DNA chip, gel electrophoresis, radiation measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as 32 P or 35 S is added to the PCR reaction solution to mark the amplification product, and then the radioactivity is measured by a radiation measuring device such as a Geiger counter or liquid scintillation counter The radiation can be measured using a liquid scintillation counter.

이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

<< 실시예Example 1> 1>

대추 품종 식별을 위한 For the identification of jujube varieties 프라이머primer 제작 making

RAPD 분석에 이용한 primer는 Operon 사의 10-mer로 구성된 Universal primer A, B, C 각각 20개씩, 총 60개의 RAPD primer를 사용하였다.
A total of 60 RAPD primers were used for the RAPD analysis, 20 of which were Universal primers A, B and C, each consisting of 10-mers of Operon.

대추 검출용 프라이머 Jujube detection primer 프라이머primer 뉴클레오티드 서열(5'-3')The nucleotide sequence (5'-3 ') 프라이머primer 뉴클레오티드 서열(5'-3')The nucleotide sequence (5'-3 ') 프라이머primer 뉴클레오티드 서열(5'-3')The nucleotide sequence (5'-3 ') A01A01 CAGGCCCTTCCAGGCCCTTC B01B01 GTTTCGCTCCGTTTCGCTCC C01C01 TTCGAGCCAGTTCGAGCCAG A02A02 TGCCGAGCTGTGCCGAGCTG B02B02 TGATCCCTGGTGATCCCTGG C02CO2 GTGAGGCGTCGTGAGGCGTC A03A03 AGTCAGCCACAGTCAGCCAC B03B03 CATCCCCCTGCATCCCCCTG C03C03 GGGGGTCTTTGGGGGTCTTT A04A04 AATCGGGCTGAATCGGGCTG B04B04 GGACTGGAGTGGACTGGAGT C04C04 CCGCATCTACCCGCATCTAC A05A05 AGGGGTCTTGAGGGGTCTTG B05B05 TGCGCCCTTCTGCGCCCTTC C05C05 GATGACCGCCGATGACCGCC A06A06 GGTCCCTGACGGTCCCTGAC B06B06 TGCTCTGCCCTGCTCTGCCC C06C06 GAACGGACTCGAACGGACTC A07A07 GAAACGGGTGGAAACGGGTG B07B07 GGTGACGCAGGGTGACGCAG C07C07 GTCCCGACGAGTCCCGACGA A08A08 GTGACGTAGGGTGACGTAGG B08B08 GTCCACACGGGTCCACACGG C08C08 TGGACCGGTGTGGACCGGTG A09A09 GGGTAACGCCGGGTAACGCC B09B09 TGGGGGACTCTGGGGGACTC C09C09 CTCACCGTCCCTCACCGTCC A10A10 GTGATCGCAGGTGATCGCAG B10B10 CTGCTGGGACCTGCTGGGAC C10C10 TGTCTGGGTGTGTCTGGGTG A11A11 CAATCGCCGTCAATCGCCGT B11B11 GTAGACCCGTGTAGACCCGT C11C11 AAAGCTGCGGAAAGCTGCGG A12A12 TCGGCGATAGTCGGCGATAG B12B12 CCTTGACGCACCTTGACGCA C12C12 TGTCATCCCCTGTCATCCCC A13A13 CAGCACCCACCAGCACCCAC B13B13 TTCCCCCGCTTTCCCCCGCT C13C13 AAGCCTCGTCAAGCCTCGTC A14A14 TCTGTGCTGGTCTGTGCTGG B14B14 TCCGCTCTGGTCCGCTCTGG C14C14 TGCGTGCTTGTGCGTGCTTG A15A15 TTCCGAACCCTTCCGAACCC B15B15 GGAGGGTGTTGGAGGGTGTT C15C15 GACGGATCAGGACGGATCAG A16A16 AGCCAGCGAAAGCCAGCGAA B16B16 TTTGCCCGGATTTGCCCGGA C16C16 CACACTCCAGCACACTCCAG A17A17 GACCGCTTGTGACCGCTTGT B17B17 AGGGAACGAGAGGGAACGAG C17C17 TTCCCCCCAGTTCCCCCCAG A18A18 AGGTGACCGTAGGTGACCGT B18B18 CCACAGCAGTCCACAGCAGT C18C18 TGAGTGGGTGTGAGTGGGTG A19A19 CAAACGTCGGCAAACGTCGG B19B19 ACCCCCGAAGACCCCCGAAG C19C19 GTTGCCAGCCGTTGCCAGCC A20A20 GTTGCGATCCGTTGCGATCC B20B20 GGACCCTTACGGACCCTTAC C20C20 ACTTCGCCACACTTCGCCAC

<< 실시예Example 2> 2>

본 발명의 대추 품종 식별에 적합한 Suitable for identification of jujube varieties of the present invention 프라이머primer 선별 Selection

<2-1> 대추 품종 샘플 준비<2-1> Preparation of jujube variety sample

실제 대추 품종 식별에 적합한 RAPD용 프라이머를 확인하기 위하여 서로 다른 10개의 대추 품종으로 보은, 월출, 무등, 금성, 추석, 미조, 복조, 국광, 찬황 및 상왕을 보은 대추 연구소에서 잎의 형태로 제공받은 뒤, 본 발명의 시료(재료)로 이용하였다(표 2 참조).
In order to identify the primer for RAPD suitable for identification of the actual jujube variety, 10 different jujube varieties were provided in the form of leaves in the jujube research institute, which showed a variety of jujube varieties, such as wolves, moochul, Venus, Chuseok, Was used as a sample (material) of the present invention (see Table 2).

No.No. 품종kind 기원(origin)Origin 수득처(또는 구입처)The place of acquisition (or place of purchase) 특징Characteristic 1One 보은Bo 재래종Native species 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 소과중으로 보통의 당도를 가짐
핵속에 종자(仁)가 전혀 없음
Have normal sugar content in bovine
There is no seed in the nucleus.
22 월출Wake 개량종Improved species 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 대과중으로 높은 당도를 가짐
생과및 건과로 이용함
High sugar content in the flesh
Used as raw and dried fruits
33 무등Mud 개량종Improved species 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 대과중으로 높은 당도를 가지며 수량이 우수함High sugar content and good yield 44 금성Venus 개량종Improved species 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 중과중으로 높은 당도를 가지며 주로 건과로 이용함It has a high sugar content in the middle and middle, mainly used as dry matter. 55 추석Thanksgiving 개량종Improved species 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 1995년 육성된 개량종으로 그 정확한 특징은 기술되어 있지 않음It was developed in 1995 and its exact characteristics are not described. 66 미조manicure 재래종Native species 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 숙기가 되면 껍질 표면이 갈라지며 당도와 육질이 다른 품종보다 낮은 편임When mature, the surface of the skin is cracked and the sugar content and meat quality are lower than those of other varieties. 77 복조Demodulation 재래종Native species 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 과실은 큰편이고 높은 당도를 나타내지만 과실이 고르지 못함Fruit is large, high sugar content, but uneven fruit 88 국광Ginkgo 신품종New variety 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 초우량과중으로 높은 당도를 나타냄High and medium sugar content 99 찬황Good 신품종New variety 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 초우량과중으로 높은 당도를 나타냄High and medium sugar content 1010 상왕King 신품종New variety 충청북도 농업기술원 대추연구소Chungcheongbuk-do Agricultural Research Institute 초우량과중으로 높은 당도를 나타냄High and medium sugar content

<2-2> DNA 추출<2-2> DNA extraction

상기 실시예<2-1>을 통해 준비한 대추 품종별 샘플을 액체질소를 이용하여 얼린 뒤 막자사발로 분쇄하여 동량을 준비한 후 DNeasy Plant Mini Kit(QIAgen, USA)를 이용하여 진행하였다. DNA를 추출한 뒤, QubitTM fluorometer(Invitrogen, USA)로 각각의 DNA를 10μg/ml로 정량하였다.
The samples of each of the jujube cultivars prepared in Example <2-1> were frozen using liquid nitrogen, ground in a mortar and equally prepared, and then processed using DNeasy Plant Mini Kit (QIAgen, USA). DNA was extracted and quantified with 10 μg / ml of each DNA with Qubit fluorometer (Invitrogen, USA).

<2-3> RAPD 프라이머를 이용한 PCR 수행<2-3> PCR using RAPD primer

본 실험에서는 먼저 상기 표 1에서 나타낸 대추 품종 판별용 프라이머 A, B, C 각각 20개씩, 총 60개의 RAPD 프라이머 세트를 사용하여 PCR 분석을 실시하였다. PCR 조건은 94℃에서 15 분간 pre-denaturation, 94℃에서 1 분간 denaturation, 35℃에서 1 분간 annealing, 72℃에서 2 분간 extension 조건으로 45 cycle 증폭한 후 72℃에서 10 분간 final extension을 수행하였다.In this experiment, PCR analysis was carried out using a total of 60 RAPD primer sets, each of 20 primers A, B and C for discriminating juvenile variety shown in Table 1 above. The PCR conditions were pre-denaturation at 94 ° C for 15 min, denaturation at 94 ° C for 1 min, annealing at 35 ° C for 1 min, extension at 72 ° C for 2 min and amplification for 45 cycles followed by final extension at 72 ° C for 10 min.

증폭된 PCR 산물을 확인하기 위해 PCR 결과물에 Gel loading buffer 6X(바이오닉스, 한국)를 4ul씩 넣어 섞이게 한 후, 100V로 30분 동안 1.5% 아가로스젤 전기영동을 실시하고, UVP Biospectrum imaging system(UVP, USA)을 이용하여 품종 특이 밴드를 확인하였다.To confirm the amplified PCR product, 4ul of Gel loading buffer 6X (Bionix, Korea) was added to the PCR product, and the mixture was subjected to 1.5% agarose gel electrophoresis at 100 V for 30 minutes. Then, a UVP Biospectrum imaging system (UVP , USA) were used to identify the strain-specific bands.

그 결과 도 1에서 나타낸 바와 같이, 총 60개의 RAPD 프라이머 세트에서 3개의 프라이머만이 대추 품종에 따른 특이적인 밴드가 확인되었다. 자세하게는, 국왕은 프라이머 A08에서 특이적 밴드가 확인되었으며, 미조와 상왕은 프라이머 A09에서 특이적 밴드가 확인되었고, 보은과 상왕은 프라이머 C08에서 특이적 밴드가 확인되었다. 한편, B 프라이머 세트에서는 품종별 특이적인 밴드가 확인되지 않았다.
As a result, as shown in Fig. 1, only three primers in a total of 60 sets of RAPD primers showed specific bands according to the cultivars. In detail, a specific band was identified in the primer A08 of the king, a specific band in the primer A09 was confirmed in the Mizogawa king, and a specific band was identified in the primer C08 in the bosom and kingpin. On the other hand, in the B primer set, no specific band was found for each kind.

대추 품종별 샘플의 RAPD 분석을 통한 특이적 분자 마커 리스트Specific molecular marker list by RAPD analysis of samples of jujube varieties 샘플Sample 프라이머 primer 국광Ginkgo A08A08 미조manicure A09A09 상왕King A09, C08A09, C08 보은Bo C08C08

따라서 상기와 같은 결과를 통해, 총 60개의 RAPD 프라이머 세트에서 실제로 대추 품종의 판별에 적합한 RAPD용 프라이머는 3개임을 실험을 통해 입증하였으며, 본 발명에서는 이들 3개의 RAPD용 프라이머를 하기 표 4에서와 같이 서열번호 1 내지 3으로 나타내었다.
Therefore, through the above-mentioned results, it was proved through experiments that three RAPD primers suitable for discrimination of the jujube cultivar in a total of 60 RAPD primer sets were proved through experiments. In the present invention, these three RAPD primers are shown in Table 4 As shown in SEQ ID NOS: 1 to 3.

본 발명의 대추 품종 판별을 위한 RAPD용 프라이머The primer for RAPD for the identification of the jujube variety of the present invention 프라이머primer 뉴클레오티드 서열(5'-3')The nucleotide sequence (5'-3 ') 서열번호SEQ ID NO: A08A08 GTGACGTAGGGTGACGTAGG 서열번호 1SEQ ID NO: 1 A09A09 GGGTAACGCCGGGTAACGCC 서열번호 2SEQ ID NO: 2 C08C08 TGGACCGGTGTGGACCGGTG 서열번호 3SEQ ID NO: 3

이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller <130> PN1412-366 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> A08 <400> 1 gtgacgtagg 10 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> A09 <400> 2 gggtaacgcc 10 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> C08 <400> 3 tggaccggtg 10 <110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Random Amplified Polymorphic DNA primer for discrimination of          Zizyphus jujuba Miller <130> PN1412-366 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> A08 <400> 1 gtgacgtagg 10 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> A09 <400> 2 gggtaacgcc 10 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> C08 <400> 3 tggaccggtg 10

Claims (9)

서열번호 1 내지 서열번호 3으로 구성된 군으로부터 선택된 염기서열을 갖는 대추 품종 판별용 RAPD(Random Amplified Polymorphic DNA) 프라이머.A Random Amplified Polymorphic DNA (RAPD) primer for discriminating jujube varieties having a base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 3. 제1항에 있어서,
상기 대추 품종은 보은, 월출, 무등, 금성, 추석, 미조, 복조, 국광, 찬황 및 상왕으로 이루어진 군으로부터 선택된 1종인 것을 특징으로 하는 프라이머.
The method according to claim 1,
Wherein the jujube cultivar is one selected from the group consisting of Boeun, Moonrise, Maeil, Venus, Chuseok, Mizo, Demodulation, Kwangwol,
제1항에 있어서,
상기 서열번호 1은 대추 품종 중 국광을 판별하는 것을 특징으로 하는 프라이머.
The method according to claim 1,
The primer set forth in SEQ ID NO: 1 identifies the local light among the jujube cultivars.
제1항에 있어서,
상기 서열번호 2는 대추 품종 중 미조를 판별하는 것을 특징으로 하는 프라이머.
The method according to claim 1,
Wherein the sequence number of SEQ ID NO: 2 identifies the taste of the jujube cultivars.
제1항에 있어서,
상기 서열번호 2 또는 3은 대추 품종 중 상왕을 판별하는 것을 특징으로 하는 프라이머.
The method according to claim 1,
Wherein the sequence number of SEQ ID NO: 2 or SEQ ID NO: 3 identifies the major of the jujube varieties.
제1항에 있어서,
상기 서열번호 3은 대추 품종 중 보은을 판별하는 것을 특징으로 하는 프라이머.
The method according to claim 1,
Wherein the sequence number of SEQ ID NO: 3 identifies the consensus among the varieties.
제1항에 따른 프라이머를 포함하는 대추 품종 판별용 조성물.A composition for discriminating jujube cultivars comprising the primer according to claim 1. 제7항의 조성물을 포함하는 대추 품종 판별용 키트.A kit for judging a variety of jujube, comprising the composition of claim 7. 개체로부터 얻어진 핵산 시료를 제1항에 따른 프라이머를 이용하여 PCR을 수행하는 단계를 포함하는, 대추 품종 판별 방법.
A method for identifying a variety of jujube cultivars, comprising the step of performing PCR using a primer according to claim 1 for a nucleic acid sample obtained from an individual.
KR1020150003589A 2015-01-09 2015-01-09 Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller KR101693410B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150003589A KR101693410B1 (en) 2015-01-09 2015-01-09 Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150003589A KR101693410B1 (en) 2015-01-09 2015-01-09 Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller

Publications (2)

Publication Number Publication Date
KR20160086178A true KR20160086178A (en) 2016-07-19
KR101693410B1 KR101693410B1 (en) 2017-01-17

Family

ID=56616330

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150003589A KR101693410B1 (en) 2015-01-09 2015-01-09 Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller

Country Status (1)

Country Link
KR (1) KR101693410B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102009712B1 (en) * 2018-10-29 2019-08-12 충북대학교 산학협력단 Primer set for discriminating Zizyphus jujuba 'Bokjo' cultivar and uses thereof
KR102174274B1 (en) * 2019-09-23 2020-11-04 충북대학교 산학협력단 Molecular marker for discriminating Zizyphus jujuba 'Boeun' and 'Chuseok' cultivar and uses thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108531643B (en) * 2018-07-02 2020-09-08 江苏省农业科学院 RAPD primer for identifying purity of watermelon variety Sumi No. 6 seeds and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100215084B1 (en) 1996-11-27 1999-08-16 임용표 Classification of the korean ginseng by radp analysis
KR20110135835A (en) 2010-06-11 2011-12-19 주식회사 향토유전자원연구소 A method of classifying maesil by random amplified polymorphic dna analysis and its primers
KR20120001870A (en) 2010-06-30 2012-01-05 전남대학교산학협력단 Related rapd marker to peronospora parasitica(downy mildew) resistance, and selection method of a resistance variety in chinese cabbage

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100215084B1 (en) 1996-11-27 1999-08-16 임용표 Classification of the korean ginseng by radp analysis
KR20110135835A (en) 2010-06-11 2011-12-19 주식회사 향토유전자원연구소 A method of classifying maesil by random amplified polymorphic dna analysis and its primers
KR20120001870A (en) 2010-06-30 2012-01-05 전남대학교산학협력단 Related rapd marker to peronospora parasitica(downy mildew) resistance, and selection method of a resistance variety in chinese cabbage

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
RAPD 10mer KITS (2014.10.02.)* *
S. K. Singh et al., Agric. Res., Vol.3, Issue 3, pp218-228, 2014(2014.06.03.)* *
남재익 등., 2011 산림과학 공동학술대회,I-SSR 표지자분석을 이용한 대추나무 품종간 유연관계 분석 (2011.02.17) *
樊新萍1., 華北 農 學 報·20 07 , 22(5):1 72-17 5, Use of Random Amplified Polymorphic DNA(RAPD) Analysis to Detect Jujube Witches' Broom Phytoplasmas (2007.03.12.) *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102009712B1 (en) * 2018-10-29 2019-08-12 충북대학교 산학협력단 Primer set for discriminating Zizyphus jujuba 'Bokjo' cultivar and uses thereof
KR102174274B1 (en) * 2019-09-23 2020-11-04 충북대학교 산학협력단 Molecular marker for discriminating Zizyphus jujuba 'Boeun' and 'Chuseok' cultivar and uses thereof

Also Published As

Publication number Publication date
KR101693410B1 (en) 2017-01-17

Similar Documents

Publication Publication Date Title
KR101693410B1 (en) Random Amplified Polymorphic DNA primer for discrimination of Zizyphus jujuba Miller
KR101642702B1 (en) A method for identifying pear varieties using microsatellites markers
KR101605530B1 (en) A method for identifying strawberry varieties using microsatellites markers
KR101650986B1 (en) Universal primer set for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR101650987B1 (en) Universal primer set COS0566 for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR101959732B1 (en) Primers for detecting SSR markers specific to allotetraploid mandarin orange and uses thereof
KR102283638B1 (en) Random Amplified Polymorphic DNA primer for discrimination of tobacco cultivars
KR101748566B1 (en) A method for identifying chrysanthemum varieties using microsatellites markers
CN113637791B (en) Molecular marker for simultaneously identifying restorability and authenticity of pepper male sterile three-line hybrid and identification method thereof
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
KR101219546B1 (en) Development of grain weevils resistive molecular markers in mung beans and uses thereof
KorehKhosravi et al. A comparative analysis of RAPD and ISSR markers for assessing genetic diversity in Iranian populations of Nigella sativa L.
KR101766274B1 (en) A method for identifying blueberry varieties using microsatellites markers
KR101444178B1 (en) A method for identifying hot pepper varieties using microsatellites markers
KR101531303B1 (en) A method for identifying soybean varieties using microsatellites markers
KR101301863B1 (en) A method for identifying lettuce varieties using microsatellite primer set
JP2016002005A (en) Purity detection method of strawberry f1 seeds by using crude extraction liquid of dna of strawberry seeds
KR20150050062A (en) Specific primers for detection of greenhouse whitefly and uses thereof
KR101636110B1 (en) Universal primer set COS0420 for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR101636111B1 (en) Universal primer set COS0084 for discrimination of Brassicaceae sp. and molecular marker comprising the same
KR101546504B1 (en) Primer sets for discriminating varieties of ginseng and uses thereof
KR20140106816A (en) Universal primer set COS0842 for discrimination of Brassicaceae sp. and molecular marker comprising the same
JP5656210B2 (en) Groundnut variety identification method using microsatellite markers
Afrasiab et al. A MOLECULAR CHARACTERIZATION OF SIX GARLIC CULTIVARS FROM PAKISTAN BY USING ISSR METHOD
KR100974264B1 (en) Primer combination for discrimination of rice cultivar and method for discrimination of rice cultivar using same

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
AMND Amendment
X701 Decision to grant (after re-examination)