KR20160006348A - Single Nucleotide Polymorphism Markers for Detecting Black Pig Pork From Nonblack Pig Pork and Use of the Same - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphism (SNP) marker for distinguishing black pig pork and non-black pig pork, a kit for distinguishing black pig pork and non-black pig pork by using the SNP marker; and a method for distinguishing black pig pork and non-black pig pork. The SNP marker of the present invention is used in an accurate and simple distinction of pig pork produced from only a pure black pig species, from hybrid black pig pork of which only hair color is similar, produced by breeding pig species which is not a black pig; and used in a distinction of black pig pork from non-black pig pork, thereby contributing to consumer protection and development of black pig breeding farms and industries.

Description

(Single Nucleotide Polymorphism Markers for Detecting Black Pig Pork From Nonblack Pig Pork and Use of the Same)

The present invention relates to single base polymorphic markers useful for distinguishing between black pork and black pork and uses thereof.

Black pork meat is more juicy than normal 3 - way cross - breed pork and has a good flavor of taste, so consumers' preference is high and they are sold at a higher price than regular pork. However, black pig meat and ordinary pork are difficult to be judged by the naked eye, so that they use this point to sell ordinary pork to black pig meat. In fact, 10 out of 22 in 2009, 10 out of 24 in 38, and 6 out of 11 in 2013 have been sold to black pawns by TV press in 2009, and 8 out of 10 The fact that dogs are found to be common pigs and the fact that they sell them as black pigs is being revealed, it is negatively affecting the black pork meat industry and consumers.

So far, it has been known that black seeds can be distinguished by mutations in the MC1R gene and KIT1 gene, which dominate the motility. However, Durok, Yorkshire, and Landrace varieties use MC1R or KIT1 genotypes, It was difficult to distinguish it as black money. Therefore, it is necessary to develop a method that can overcome these disadvantages and discriminate black money by a simple and economical method.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

Korean Patent Publication No. 10-2012-0072871 Korean Patent Publication No. 10-2012-0072882 Korean Patent Publication No. 10-2012-0109069

The present inventors have made efforts to develop a method for accurately and easily discriminating domestic black pork and pork (pork pork). As a result, we have selected single nucleotide polymorphism (SNP) markers with a clear difference in frequency between black and non-black populations, and can identify black pork and black pork accurately using these single nucleotide polymorphic markers. The present invention has been completed.

Accordingly, it is an object of the present invention to provide a single base polymorphism (SNP) marker composition for discriminating black pork and black pork.

Another object of the present invention is to provide a kit for discriminating black pork and black pork.

It is still another object of the present invention to provide a method for distinguishing black pork and black pork.

The objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method for producing a protein having the amino acid sequence of SEQ ID NO: 1, the 561st position of SEQ ID NO: 2, the 500th position of SEQ ID NO: 3, the 561st position of SEQ ID NO: 4, (SNP) marker for use in discriminating between black pork and black pork containing a polynucleotide consisting of 8-100 consecutive DNA sequences containing a single nucleotide polymorphism (SNP) site of a polynucleotide or its complementary polynucleotide Lt; / RTI >

The present inventors sought to identify single-nucleotide polymorphism (SNP) markers specific to black-breed cultivars breeding in Korea. For this purpose, genomic DNA samples of Berkshire, Korean Native Pig and Duroc, Yorkshire, and Landrace varieties of Korean non-blackdon varieties were used for this purpose and Illumina Porcine A total of 33,854 single nucleotide polymorphisms except for sex chromosomes were scanned by 60K SNP BeadChip. The frequency of alleles was analyzed by breed, and finally the results were compared with those of black pig population (Korean native pig and Berkshire) Yorkshire and Landrace) were identified. The five polymorphic markers were identified.

As used herein, the term " single nucleotide polymorphism (SNP) " refers to the occurrence of a single nucleotide (A, T, C or G) in the genome that is different between members of a species or between individual chromosomes DNA sequence identity.

As used herein, the term " nucleotide " is a deoxyribonucleotide or ribonucleotide present in single-stranded or double-stranded form and includes analogs of natural nucleotides unless otherwise specifically mentioned (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

As shown in the following examples of the present invention, the SNP at position 561 of SEQ ID NO: 1 (ASGA0028139) is the R [A / G] base and in the case of the black seed, the frequency of the allelotype G: 1.00.

In addition, the SNP at position 561 of SEQ ID NO: 2 (H3GA0019664) is R [A / G] base, and the frequency of occurrence of allelotype G: G in this SNP is 1.00.

In addition, the SNP at position 500 of SEQ ID NO: 3 (ALGA0043547) is R [A / G] base, and in the case of black seed, the frequency of allelotype G: G in this SNP is 1.00.

In addition, the SNP at position 561 in SEQ ID NO: 4 (H3GA0041736) is M [A / C] base, and in the case of black seed, the frequency of allelotype C: C in the SNP is 1.00.

In addition, the SNP at position 500 of SEQ ID NO: 5 (ASGA0078202) is M [A / C] base and in the case of black seed, the frequency of occurrence of allelotype A: A in this SNP is 1.00.

Therefore, by confirming the base types in all five SNPs in pigs, it is possible to reliably discriminate between black and non-black.

According to a preferred embodiment of the present invention, in the marker composition of the present invention, the black seeds are a single variety of Korean native pig or Berkshire, and the non-black seeds are Duroc, Yorkshire, Or Landrace varieties, or hybrids produced by crossing these three varieties.

According to another aspect of the present invention, there is provided a method for producing a protein having the amino acid sequence of SEQ ID NO: 1, the 561st position of SEQ ID NO: 2, the 500th position of SEQ ID NO: 3, the 561st position of SEQ ID NO: 4, Comprising a primer or a probe specifically binding to a polynucleotide consisting of 8-100 consecutive DNA sequences comprising a single nucleotide polymorphism (SNP) site of a polynucleotide or a complementary polynucleotide of the polynucleotide or its complementary polynucleotide Provide a kit for use.

As used herein, the term " primer " means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at suitable temperature and pH conditions. Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides.

As used herein, the term "probe" means a linear oligomer having a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

The primer or probe of the present invention specifically binds to a polynucleotide comprising a DNA sequence comprising the SNP or a complementary polynucleotide thereof. The specifically binding means that the primer or the probe can hybridize and bind to the target nucleic acid sequence under a predetermined annealing or hybridization condition. Preferably, the primer or probe has a sequence completely complementary to the target nucleic acid sequence, Or may include partially inconsistent sequences that are not fully complementary. That is, the sequence of the primer or the probe does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient that the primer or probe has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer or probe. Therefore, the primer or probe in the present invention does not need to have a perfectly complementary sequence to the above-mentioned polynucleotide sequence which is a template, and it is sufficient if it has sufficient complementarity within the range capable of hybridizing with this gene sequence and acting as a primer or a probe Do.

In the present invention, the primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerase. The suitable length of the primer is determined by a number of factors, such as the temperature, the application, and the source of the primer, but is typically 15-30 nucleotides.

According to a preferred embodiment of the present invention, in the kit of the present invention, the black seeds are a single variety of Korean native pig or Berkshire, and the non-black seeds are Duroc, Yorkshire, Or Landrace varieties, or hybrids produced by crossing these three varieties.

According to another aspect of the present invention, the present invention provides a primer pair comprising a primer having the sequence of SEQ ID NO: 6 and a primer having the sequence of SEQ ID NO: 7; A primer pair consisting of a primer having the sequence of SEQ ID NO: 8 and a primer having the sequence of SEQ ID NO: 9; A pair of primers consisting of a primer having the sequence of SEQ ID NO: 10 and a primer having the sequence of SEQ ID NO: 11; A pair of primers consisting of a primer having the sequence of SEQ ID NO: 12 and a primer having the sequence of SEQ ID NO: 13; And a primer pair comprising a primer having the sequence of SEQ ID NO: 14 and a primer having the sequence of SEQ ID NO: 15, and a kit for use in distinguishing black pork and black pork from each other.

The five pairs of primer pairs of the present invention are primer pairs that can be used for allele specific (AS) -PCR designed to identify the base types of the above-described five SNPs, respectively.

The primer pair consisting of the primer of SEQ ID NO: 6 and the primer of SEQ ID NO: 7 was designed to amplify only the allele of the A base in the SNP (ASGA0028139) R [A / G] base at position 561 of SEQ ID NO: In the case of an allele genotype of G: G.

The primer pair consisting of the primer of SEQ ID NO: 8 and the primer of SEQ ID NO: 9 was designed to amplify only the allele of the A base in the SNP (H3GA0019664) R [A / G] base at position 561 of SEQ ID NO: In the case of an allele genotype of G: G.

The primer pair consisting of the primer of SEQ ID NO: 10 and the primer of SEQ ID NO: 11 was designed to amplify only the allele of the A base in the SNP (ALGA0043547) R [A / G] base at the 500th position in SEQ ID NO: In the case of an allele of G: G.

The primer pair consisting of the primer of SEQ ID NO: 12 and the primer of SEQ ID NO: 13 was designed to amplify only the allele of the A base in the M [A / C] base of SNP (H3GA0041736) at the 561th position of SEQ ID NO: Is not amplified when the allelic genotype is C: C base.

The primer pair consisting of the primer of SEQ ID NO: 14 and the primer of SEQ ID NO: 15 was designed to amplify only the allele of C base at the 500th position SNP (ASGA0078202) M [A / C] base of SEQ ID NO: In the case of an allogenic genotype A: A base.

Therefore, if the target DNA sequence is not amplified in the sample gDNA by the 5 pairs of primer pairs, it is discriminated as black, and if it is amplified by one or more primer pairs in the 5 pairs of primers, it is discriminated as non-black.

Amplification techniques that may be used in the methods of the present invention include PCR amplification (Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822)), ligase chain reactions (LCR, Wu, DY Lac (WO 90/01069), the repair chain (GenBank, et al., Genomics 4: 560 (1989)), the polymerase ligase chain reaction (Barany, PCR Methods and Appl., 1: (EP 439,182), 3SR (Kwoh et al., PNAS, USA, 86: 1173 (1989)) and NASBA (US Pat. No. 5,130,238). Most preferably by PCR amplification step.

According to a preferred embodiment of the present invention, the kit of the present invention may further comprise a primer of SEQ. ID. NO. 16 capable of amplifying actin gene as an internal control and a primer pair of primer of SEQ ID NO.

According to a preferred embodiment of the present invention, in the kit of the present invention, the black seeds are Korean native pigs or Berkshire single cultivars, and the non-black seeds are Duroc, Yorkshire, Landrace varieties, or hybrids produced by crossing these three varieties.

When the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally comprise reagents necessary for PCR amplification, such as a buffer, a DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus filiformis, Thermisflavus, Thermococcus literalis, or Pyrococcus furiosus (Pfu)), DNA polymerase joins and dNTPs.

The kit of the present invention may be made from a number of separate packaging or compartments containing the above reagent components.

According to another aspect of the present invention, the present invention provides a method for distinguishing black pork and black pork, comprising the steps of: (a) separating a nucleic acid molecule from a sample of swine; And (b) from the isolated nucleic acid molecule, the nucleotide sequence at position 561 of SEQ ID NO: 1, position 561 of SEQ ID NO: 2, position 500 of SEQ ID NO: 3, position 561 of SEQ ID NO: 4, Identifying the base type of the single nucleotide polymorphism (SNP) region of the locus.

According to a preferred embodiment of the present invention, in the method of the present invention, the black seed is a Korean native pig or a single breed of Berkshire, and the non-black seed is Duroc, Yorkshire, Landrace varieties, or hybrids produced by crossing these three varieties.

As used herein, the term "nucleic acid molecule" has the meaning inclusive of DNA (gDNA and cDNA) and RNA molecules. In the nucleic acid molecule, the nucleotide which is a basic constituent unit is not only a natural nucleotide, Also included are analogues (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

In the method of the present invention, the nucleic acid molecule can be obtained from various sources of pigs, for example, from muscles, epidermis, blood, bones, organs, and most preferably from muscles or blood.

When the starting material in the method of the present invention is gDNA, the separation of gDNA can be carried out according to conventional methods known in the art (Rogers & Bendich (1994)). When the starting material is mRNA, the total RNA is isolated by a conventional method known in the art (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold

Spring Harbor Press (2001); Ausubel, F.M. et al., Current Protocols in Molecular Biology, John Willey & Sons (1987); And Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)). The isolated total RNA is synthesized by cDNA using reverse transcriptase. Because the total RNA is isolated from animal cells, it has a poly-A tail at the end of mRNA. CDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such a sequence characteristic (see PNAS USA, 85: 8998 (1988); Libert F, et al., Science, 244: 569 (1989); and Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press )).

In the method of the present invention, step (b) may be carried out by applying various methods known in the art used for identifying a specific sequence. For example, techniques that may be applied to the present invention include fluorescence in situ hybridization (FISH), direct DNA sequencing, PFGE analysis, Southern blot analysis, single-strand conformational analysis (SSCA, Orita et al., PNAS, USA 86: 2776 (1989)), RNase protection analysis (Finkelstein et al., Genomics, 7: 167 (1990)), dot blot analysis, denaturing gradient gel electrophoresis (DGGE, Wartell et al., Nucl. Acids Res. (Modrich, Ann. Rev. Genet., 25: 229-253 (1991)) using a protein recognizing a nucleotide mismatch (e.g., mutS protein of E. coli) But are not limited to, allele-specific PCR. Sequence changes result in differences in base-linkage within the single-stranded molecule, leading to the appearance of different bands of mobility, and SSCA detects this band. DGGE analysis uses a denaturing gradient gel to detect sequences that represent wild type sequences and other mobility. Other techniques generally use probes or primers complementary to sequences comprising the SNPs of the invention. In the analysis using a hybridization signal, a probe complementary to the sequence containing the SNP of the present invention is used. In this technique, a hybridization signal of the probe and the target sequence is detected to directly determine whether or not the SNP variant is present.

The present invention relates to a single base polymorphism (SNP) marker for discriminating black pork and black pork, a kit for discriminating black pork and black pork using the SNP marker, and a kit for discriminating black pork and black pork ≪ / RTI > Using the SNP markers of the present invention, it is possible to accurately and easily discriminate the pork produced by using only the pure black pig breed from the similar black pig meat produced only by the color of hair produced by crossing the pig varieties other than the black pig, Because it can distinguish from pork, it can contribute to the development of consumer protection and black market farming industry and industry.

Brief Description of the Drawings Fig. 1 is a diagram showing the results of analysis of five SNPs of the present invention (ASGA0028139, H3GA0019664, ALGA0043547, and ASA0043547) in black seeds using allele specific-PCR (AS-PCR) using primer pairs of SEQ ID NOS: H3GA0041736, ASGA0078202). ≪ / RTI >
2A-2E are graphs showing the effect of 5 SNPs (ASGA0028139, H3GA0019664, ALGA0043547, H3GA0041736, ASGA0078202) in non-black seeds using allele specific-PCR using primer pairs of SEQ ID NOS: 6 to 17 This is the result of confirming the base type. FIGS. 2A-2E show AS-PCR results for varieties of Duroc, Landrace, Yorkshire, commercial money, and ternary hybridization finishing 1, commercial money and ternary hybridization finishing 2, respectively.
FIG. 3 is consensus sequence information including the ASGA0028139_R [A / G] SNP used for distinguishing black and non-black seeds selected through the Illumina Porcine 60K SNP BeadChip. This sequence is described in SEQ ID NO: 1.
FIG. 4 is consensus sequence information including the H3GA0019664_R [A / G] SNP used for distinguishing black and non-black seeds selected through the Illumina Porcine 60K SNP BeadChip. This sequence is shown in SEQ ID NO: 2.
FIG. 5 is consensus sequence information including the ALGA0043547_R [A / G] SNP used for distinguishing black and non-black seeds selected through the Illumina Porcine 60K SNP BeadChip. This sequence is described in SEQ ID NO: 3.

FIG. 6 is consensus sequence information including the H3GA0041736_M [A / C] SNP used for distinguishing black and non-black seeds selected through the Illumina Porcine 60K SNP BeadChip. This sequence is shown in SEQ ID NO: 4.
FIG. 7 is consensus sequence information including the ASGA0078202_M [A / C] SNP used for distinguishing black and non-black seeds selected through the Illumina Porcine 60K SNP BeadChip. This sequence is shown in SEQ ID NO: 5.
FIG. 8 shows primer sequences and flanking sequences for the B_actin gene used as a control marker in AS-PCR primers included in the kit for detecting black seeds. The forward and reverse IC primer sequences are set forth in SEQ ID NO: 16 and SEQ ID NO: 17, respectively.

9 shows the IBPM-1 primer sequence and the flanking sequence for detecting the ASGA0028139_A / G SNP base type among the AS-PCR primers contained in the kit for detecting black seeds. The forward and reverse primer sequences of IBPM_1 are set forth in SEQ ID NO: 6 and SEQ ID NO: 7, respectively.
Fig. 10 shows the IBPM_2 primer sequence and the flanking sequence for detecting the H3GA0041736_A / C SNP base type among AS-PCR primers contained in the kit for detecting black seeds. The forward and reverse primer sequences of IBPM_2 are set forth in SEQ ID NO: 12 and SEQ ID NO: 13, respectively.
11 shows the IBPM_3 primer sequence and the flanking sequence for detecting the H3GA0019664_A / G SNP base type among AS-PCR primers included in the kit for detecting black seeds. The forward and reverse primer sequences of IBPM_3 are described in SEQ ID NO: 8 and SEQ ID NO: 9, respectively.
12 shows the IBPM_4 primer sequence and the flanking sequence for detecting the ASGA0078202_A / C base type among AS-PCR primers included in the kit for detecting black seeds. The forward and reverse primer sequences of IBPM_4 are set forth in SEQ ID NO: 14 and SEQ ID NO: 15, respectively.
13 shows an IBPM_5 primer sequence and a flanking sequence for detecting the ALGA0043547_A / G base type among the AS-PCR primers contained in the kit for detecting black seeds. The forward and reverse primer sequences of IBPM_5 are set forth in SEQ ID NO: 10 and SEQ ID NO: 11, respectively.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1: Analysis of Illumina Porcine 60K SNP BeadChip by Pig breeds

In order to develop a single nucleotide polymorphism (SNP) markers for discriminating black seeds, Korean traditional pigs and Berkshire varieties, which are a black group, and Duroc, Yorkshire, (Yorkshire) and Landrace varieties. Table 1 below summarizes the numbers used for the Illumina Porcine 60K SNP BeadChip analysis of black and non-black populations (Table 1).

kind Head Skin color Korean Native Pig 20 black Berkshire 30 black Yorkshire 18 White Landrace 8 White Duroc 30 Red color

Genomic analysis by Illumina Pocine 60K SNP BeadChip (62,074 SNPs) used to search for black seed specific single nucleotide polymorphism (SNP) markers revealed high purity quantified DNA (750 ng / ㎕) and Porcine 60K BeadChip analysis Kits (Illumina, USA ).

Example 2: Frequency analysis of alleles of full-length single nucleotide polymorphisms (SNPs)

Genotyping of large-scale single nucleotide polymorphisms (SNPs) was carried out by amplifying the DNA of the sample by genome wide amplification method, randomly chopping it with a chemical method, purifying it by 2-propanol precipitation method, and using Porcine SNP60 BeadChip Before the purified DNA sample was added, a DNA sample was injected by pretreatment with a buffer solution. After incubation for 16 hours, scanning was performed with Illumina BeadStation 500 through staining, allele specific primer extension, hybridization, target removal, and washing steps . A program auto-clustering system was applied to simultaneously call a large number of genotypes of the samples. Called SNP information was classified by SNP markers by Bead Studio version 3.1 (Illumina, USA), which was scanned by a reporting tool. Quality control for marker selection satisfies three conditions: (1) SNPs present in sex chromosomes, (2) Call rate> 90%, and (3) Hardy-Weinberg equilibrium> 0.0001. After removing single nucleotide polymorphism markers, a total of 33,854 SNP markers were used for the black and non - black population. Table 2 below shows the genotypic frequency of the SNP markers in order. The SNP markers are listed in order, and the alleles of the SNPs in Korean Black Pig, Berkshire and non-Black Durock, Yorkshire, Were compared.

Based on the results of the analysis of the frequency of alleles of single nucleotide polymorphisms (SNP), as shown in Table 2 above, the following results were obtained: i) the black population (Korean native pig, Berkshire) and non-black population (Duroc, Yorkshire, (Ⅱ) Black allele (Korean native pig, Berkshire) showed a large difference in allele frequency, and all 7 single nucleotide polymorphic markers were selected which were most effective in discriminating black seeds 3).

Example 3: Validation of the effects of the seven selected single nucleotide polymorphic markers for the discrimination of black pigments

In order to verify the seven selected SNP markers for black discoloration by the results of the experiment in Example 2, 48 specimens were collected from 48 blacks (Berkshire, Korean traditional pigs) and 48 non-blacks . Here, the non-black pig group, the 3-way hybrid pigeon, used PIC Korea, a slaughtering company for the experiment of the present invention, and Sodram Pork Nonghyup, a domestic pork production association. The flanking sequence of the selected 7 SNP markers was obtained by using the NCBI SNP database to obtain a nucleotide sequence of 1000 ± 100 bp containing the corresponding SNP (FIGS. 3 to 7).

Three primers were prepared by using Oligo 6 (Molecular Biology Insights, Cascade, CO, USA) program for amplification of the region containing seven single base mutations using the obtained flanking sequence (Table 3). Genotyping was performed using the PCR-RFLP method. Table 3 below shows the information of seven SNP markers selected through full-length single nucleotide polymorphism analysis and primer information and restriction enzyme information used in the PCR-RFLP verification experiment.

No. Marker
/ Position SSC SNP
code Primer PCR
you Anealing
TM Enzyme One ASGA0026641
/ 2,803,219 5 G AGGCCCCTAGAATGGACAGT
(Forward: SEQ ID NO: 18) 438 58.9 Hph I AGGGCTGGATTCGATGTTTA
(Reverse: SEQ ID NO: 19) 2 ASGA0028139
/ 8,780,046 6 G CAGATCCAGTGTTGCTGTGG
(Forward: SEQ ID NO: 20) 297 62.7 Bsr I CTAGTGACTGGTGGGGCAGT
(Reverse: SEQ ID NO: 21) 3 H3GA0019664
/ 4,838,862 7 G CCCTGGGATGATGAGAAAAC
(Forward: SEQ ID NO: 22) 173 53.5 Acid I TTTGCAGAGTGAGGTTCTGG
(Reverse: SEQ ID NO: 23) 4 ALGA0043547
/ 97,399,176 7 G TTCACCCTGACACTGCATTC
(Forward: SEQ ID NO: 24) 438 55.1 Pvu II AAATGGTATGGGGGTTCCTC
(Reverse: SEQ ID NO: 25) 5 H3GA0041736
/ 107, 241, 397 14 C CCTTTTCTAGGGCCACTTCC
(Forward: SEQ ID NO: 26) 408 62.7 Fat I AGCTCCGTTTCAACCCCTA
(Reverse: SEQ ID NO: 27) 6 ASGA0078202
/ 93,700,953 17 A GAGCTAGCACCTGCCTATCG
(Forward: SEQ ID NO: 28) 735 56.6 BceA I GGAATGCATCTAGGGGGTTT
(Reverse: SEQ ID NO: 29) 7 ALGA0097613
/ 14,032,732 18 C TGAAAAGCCCTTCTTTCCAA
(Forward: SEQ ID NO: 30) 316 54.2 Seal I TGGTGCCTTGAGTAATGTGG
(Reverse: SEQ ID NO: 31)

In order to examine the seven monoclonal polymorphic markers selected in Table 4 below, PCR-RFLPs were used in 48 populations of black population (Berkshire, Korean native pig) and 48 non-black population (3-way hybrid piglet: doram, PIC KOREA) Genotype and frequency analysis were summarized.

The results of Table 4 were verified by PCR-RFLP analysis. As a result, it was found that all of the 7 markers selected in the black population (Berkshire, Korean native pig) were allotted as one allele. Therefore, five SNP markers (ASGA0028139, H3GA0019664, ALGA0043547, H3GA0041736, and ASGA00778202) with the greatest difference in allele frequencies between the black and black non-black group Kit).

Example 4: Development of a kit for black seeds discrimination using an allele-specific PCR method

Allele Specific (AS) -PCR techniques were used to develop a kit for easy and easy discrimination of black seeds using five SNP markers selected from the results of Example 3 (Table 5). Primer sequences to be used for AS-PCR are shown in consensus sequences corresponding to each marker in FIGS. 8 to 13, and the primer and experimental information used for AS-PCR are shown in Table 5 below.

No. Marker SSC SNP
code Black pig
Allele Primer PCR
you One B_actin gene
(IC) control TGGGTGTATAGGTACTAACACTGGC
(Forward: SEQ ID NO: 16) 952 bp ACTCACCTTGATCTTCATCGTGCTG
(Reverse: SEQ ID NO: 17) 2 ASGA0028139
(IBPM_1) 6 R
(A / G) G ATCCAGCTAGGGGTCAAATCTAA
(Forward: SEQ ID NO: 6) 550bp AGGATCGTGAGAATGTGAGTGGG
(Reverse: SEQ ID NO: 7) 3 H3GA0041736
(IBPM_2) 14 M
(A / C) C GCTTGTACTGGTCCACAAGTCA
(Forward: SEQ ID NO: 12) 411bp TCAGGCAATGATGTTTCGACTATTTG
(Reverse: SEQ ID NO: 13) 4 H3GA0019664
(IBPM_3) 7 R
(A / G) G GCTGGGCCCTTGCATACA
(Forward: SEQ ID NO: 8) 300bp TGACGTCCTCAGGCACTGG
(Reverse: SEQ ID NO: 9) 5 ASGA0078202
(IBPM_4) 17 M
(A / C) A CCACCCCCTCAGCTACAC
(Forward: SEQ ID NO: 14) 248 bp GTCAGCTGCGGCATCCTTC
(Reverse: SEQ ID NO: 15) 6 ALGA0043547
(IBPM_5) 7 R
(A / G) G CTGCAAGTTCACCCAGGTAGATAA
(Forward: SEQ ID NO: 10) 150bp CCCAGAGCTCATGCTTTCAC
(Reverse: SEQ ID NO: 11)

(50 ng / μl) of Korean native pig, Berkshire, Duroc, Yorkshire, Landrace and commercial money (triplicate) were used for nucleic acid amplification Respectively. The PCR machine used for DNA amplification was PTC-200 themocycler (MJ Research, Watertown MA, USA) and the DNA polymerase was Multi HS Prime Taq Premix (2X) (GeNet Bio, Korea). 2 μl of template DNA (50 ng), 8 μl of primer mixture (20 pmol / μl) and 10 μl of Multi HS Prime Taq Premix (2X) were added to the PCR reaction mixture. The PCR reaction conditions were preliminarily heated at 95 ° C for 10 minutes, denatured at 95 ° C for 30 seconds, annealed at an annealing temperature of 63 ° C for 30 seconds corresponding to each primer mix, and 30 seconds at 72 ° C and DNA amplification was terminated by performing a final extension at 72 ° C for 5 minutes. 10 μl of the amplified products were subjected to electrophoresis for 30 minutes by applying a voltage of 100 mv in 2.5% agarose gel. Table 6 below shows the AS-PCR reaction conditions.

Example 5: Diagnosis results using a black seeding kit (kit)

Table 7 below shows the results of discrimination of black seeds kit (Kit) using AS-PCR method and discrimination method of black and non-black seeds. The bases in five SNP markers in the black pig population (Korean native pig, Berkshire) are fixed as follows: (i) ASGA0028139 SNP marker is fixed to G allele, (ii) H3GA0019664 SNP marker is G allele (Iii) the ALGA0043547 SNP marker is fixed to the G allele, (iv) the H3GA0041736 SNP marker is fixed to the C allele, and (v) the ASGA00778202 SNP marker is fixed to the A allele. The prepared AS-PCR primers were designed so that Target Amplicon could not be amplified when each SNP marker nucleotide in the above-mentioned black seeds was used. Therefore, in the case of the sample of the black seed group, no amplification product containing the 5 SNP markers is generated, and only 952 bp of the B_action gene (IC) control marker is amplified (FIG. 1).

On the other hand, non-black seeds show polymorphism in the five SNP markers as follows: (i) ASGA0028139 marker has A / G allele polymorphism; (Iii) A / G allele polymorphism; (iv) A / C allele polymorphism; (v) ASGA00778202 marker is an A / G allele gene polymorphism; Polymorphism. Therefore, when the AS-PCR kit using the primer prepared in the present invention is used, target amplicon amplification is observed even in one of the five SNP markers, Target Amplicon, and it is discriminated as non-black seeds (FIGS. 2A to 2E).

As demonstrated and explained in the above experimental results, using the five SNP markers of the present invention, black and non-black can be discriminated easily and accurately.

<110> Chungbuk National University Industry Academic Cooperation Foundation <120> Single Nucleotide Polymorphism Markers for Detecting Black Pig          Pork From Nonblack Pig Pork and Use of the Same <130> PN140351 <160> 31 <170> Kopatentin 2.0 <210> 1 <211> 1121 <212> DNA <213> Pig <400> 1 attgcctgtt cacaaagcct ccccactgga ccctccaaaa tagccactcc catggccctc 60 ccagttcctc catgattgat gtcctgttcc acagagtccc caccacaaag tctctgttcc 120 attcattggt gactttagta ttctgcagcc tgcaagtgcc ccggggcgga gtacagtccc 180 cttgcttgtg acaggatccc caccgcctgg cacactggtc ctcactgggc tttgcccaag 240 tgagtgcatg gcaggagggt ggggactggg cccccagagg accagagcgg gattgtgctg 300 gacctgggat gggacagggg tgggcgggtg caagtaagac ttgagtcaaa gggcctgcct 360 gt; tcaatccctg gcctcgcttg gtgggttgag gatccggcaa tgtcgtgagc tgtgatgtag 480 gttgcagaca tggctcagat ccagtgttgc tgtggctgtg gtgtaggctg cggctcagat 540 ccagctaggg gtcaaatcca rttgtagctc caattggatc tctagcctgg gacttccata 600 ggctacaggt gcagccctaa aaagcaaaaa gggggggggg cccacctgga ggtgctggtg 660 ggaacccctc ccccctcccc acagcaggca tccggtcagg gaggggccag gtgggccagg 720 agttggtgcc actgccccac cagtcactag ctctgtcctc gatctgggtc tgtgtgggca 780 ggaggtgggg acaggtcggc ctccgtggag aatgtctcct cttgggccag gtgatgccac 840 cccatgggct aagcacagct agaggacgct cagatgcctt gacagaccag ggcgtgcccc 900 ttgcccgtgg agctctggcc cctcacccag ggcctttctt ctgtcctgtg ggctcttggt 960 gacacctagt ggccagcatt cctaatgcac tgtttccccc attccccgca ccctctcccc 1020 gggggatgtc ccccgccggc aagggcaccc cagccctggg tctcgcccac tcacattctc 1080 acgatcctca tcgccaggct gtacccacac gctcactctc a 1121 <210> 2 <211> 1121 <212> DNA <213> Pig <400> 2 aagagtgttc aataagctct gattaaaaaa aggaaaacgt taatccttca ttgtatcacg 60 tatgaagctc catcattaga ctttttcgat gtaatgcaaa gatttcaaag ggggggggga 120 gaaaaagggg ggagtctctg tgatggagca agtctgatta tttaaaaaca aaaacaaaaa 180 cactctccca gcctaatcag cacagacaac agctcccgca cccgactcag tgtgttcagg 240 ctctgctgat acacacacgt gggaattttc ggccagccca tgttcatgaa caggaaacca 300 acaagactgt caacacagga acagcaatca ccaaaggcag atgtttaagg ctggaagtta 360 cattctggac aaggtgaaag ggtaagtggc agcagcgtcc tagggcagct ccgggcagcg 420 atcaaagttc agctgggcac tgggcggccc aacggctgtg ccttgggtct gcggtgaagc 480 cacccgctcc tcccccctcg gagccctggg atgatgagaa aacaatctga acgtcaggcc 540 agcgctgggc ccttgcaggc rgaggacaag cccgacctat ctggcaggat cggcaaggca 600 gggcgtgtgc ccgtgaaccc ggggcaggaa ggctctcccc ctccgaacca gaacctcact 660 ctgcaaaaat gtttgatggg gagacttcaa ggcggaggtc tggggctgcg ttagaaataa 720 taaggccaca gggacgcatc aaggaatgac ctgaggcagt ttagatacca tctctattat 780 ggacgggtct ctttaataat ggacttggga agggcaggaa gagaccagtg cctgaggacg 840 tcagtggaac aatgccactc agagcaacat cgttttcaac acttcaactc gcttttggag 900 caggaaacaa ttctttaagg tcagtggtcc ttccacatac caaatgggga tatttataga 960 gatgcatagt tttttttttt tttttttcct tttctgaaag cagaggcgag aataccatgt 1020 gctctcctgc acgctccaga tgtgggctcc cacctctccc ccagggctgt gctctcccgt 1080 gcttctgtct ccaccccccc ccccattatc cattctcaag t 1121 <210> 3 <211> 1106 <212> DNA <213> Pig <400> 3 gt; agttatctgg gaatcttttt gaagcacaga ctttgattga gtaggttggg atggagcttg 120 ggccctatcc tgctgcagtg aggaccacat gctgagaagt tagtcatatc ctgcttgagc 180 cctggtcctc tttaatagaa gcctctccct tctttacatc ttcctgggat atcaagggat 240 attttgggtg accttagaag agatgggtgc cagggagtgt cactctaacc taagtgtttc 300 aaagtctctt tggcccagcc agcaggaatc ctttataggc tagaggcagc ttttgtcata 360 gcttcagatg gacacctggc cttcctctat ccccctttgc tgaagagacc cttacccaga 420 atgcagatag gtgtgaagaa gaaagacagt caaagaaata taccggcaga cttatgctgc 480 aagttcaccc aggtagaaar tgtgtatctg ttgggagttg ggcctcactg aagctgtaaa 540 gggtggggag tcaatgtgga aaagtaaagc tttccccttt ataagagaag tgtgttatag 600 catattgtga aagcatgagc tctgggctta aatgtggacc caaagcttta aataaaatag 660 cattcataaa ctggttacca cagtgcttgg aacttagtga gtgcttaatg tattatagct 720 atgactattt ttttaacagg atgtattaat tatagtcgaa tcagaatcca tatcaggagg 780 aagatgggca gcttgatagc ctataaaata aaacagtagg atttcttggc ccctgaactt 840 cctattctcc atctagctca gtgcctggtc catggagcac ctatttgttg aatggaagga 900 aagaattacc caagtctagg taaattagta gatggggatt tgtgcttatg aaaattgtcc 960 aaaggaaaag aattatggag actcctgaat tcttaaaagt gacaattttc aggccctgag 1020 taccattgtt cagtttctct gcttataaaa ttggtcactg ccactacttt acagggttat 1080 catgagaaac ttttgacaat gcatgc 1106 <210> 4 <211> 1121 <212> DNA <213> Pig <400> 4 aaaaagaaat taatgatcat aaatatatgg ttcaataaaa acatatatcc taccgagata 60 tagaattttt ccatcacccc agaaagtttt ctcctattca ttccccagaa acaattttat 120 tccccacccc aagccaaaag acaaccaata ttctgcattt ctatctccat agatcagctt 180 tgcctgtttt agagcttcta taaattgaag gctttttctt tttctttttt ttttttgcct 240 tttctagggc cacttccaca gcatatggag gttcccaggc tagaggtcta atcagagcta 300 tagccaccag cctacgccag ggccacagca acgcaggatc cgagccacgt ctgcaaccta 360 caccacagct cacagcaacg ccggatcctt aatccactga gcaaggccag ggatagaacc 420 ctcaacctta tggttcctag tcaggattcg ttaaccactg cgccacaccg ggagctccga 480 attgaaggct ttttcattca gcctgttttt gaaacttgtc cactggtgtg ctagaactgg 540 cttgtactgg tccacaagac mtgatggcca aatttgtttt gttttgtttt tagggcccca 600 ctcaaggcat atggaagttc ccaggctagg ggttgaaacg gagctgcagc tgctggccta 660 caccacagcc acagcaacac ggggatccga gcctcatgtg acgtacacca cagctcatgg 720 caatgcagaa tccttgaccc tctgagcaag gccaggaaat gaaaccacat cctcatggat 780 actagttgga gttgttttca ctgctccaca acaggaactc catgatggcc aaatttttag 840 gaattttgag aactggttct taaaaaaaaa aaactgctat ttaaaattaa attatgtaaa 900 tttatactta aataaatttt aaaacaaata gtcgaaacat cattgcctga tattttacat 960 tttactatta tctattctct tgaggttatt tatttttctg ccacactcac agcatatgga 1020 ggttccctgg cagggatcaa atcaaagcca ctactgcaac ctatggcata gctgtggcaa 1080 tgtcacatct ttaatccacc aggacagacc aaggatcaaa c 1121 <210> 5 <211> 1211 <212> DNA <213> Pig <400> 5 agaagaagaa ggagaaaggg aaggagaaag gagaaggttt cccacgctgg ctgctggtac 60 ccaaaacctg acttggagat gcttttgcgt ctttaagtga ggggacgatg taattattga 120 tgtcaagtga gttttttttt ttttttttct ttcttttcct gaaaggaaga cccatggact 180 tggaggggtt ggtgggggaa gggtgcaggt cccacgtccc cggcgttctg ctggaaacca 240 ttcctgcaga atccagctgc agcaagactc cggatgagtc agttggaggg aatcctcctc 300 gctcccaaaa tccgatcact tggatgtcct atttggtccc ccccccccac cgcctccgcc 360 ccgtccccgg gcgatatctg gtcacgctgg cctgccttca gcaagaatcc tggggggtta 420 gttcagccag aacccctcac cctgaggctt cctcgcagta aggttccatc ctctgaacgc 480 ccccaccccc tcagctacam atccccactc atccttgtgg ttggcaccga ccccagttct 540 ttatgaggtc tcccctcccc tacgacaaga gttcttagta aataaaatct ttttttgttt 600 gtttttacca ctttaaccgt atcttggcat cttgaaggtt ttaacatctt tgggaaccct 660 cagtagaaac gtatcctctc acgagctgag tttctggtcc taccctttgg cgaaggatgc 720 cgcagctgac ccccatcccg ggaactcgcg aaggcccctc tcgctcttct ctgttgagtt 780 tgcacactcc cagacctgca ggctgtgcca acatcaggct gaggccggca gccggaaccg 840 tgaaactcac aggagagatg aagcaggcgt ggcgcagagc cgagccagtg ggatgctcta 900 caggtctcgg gggaggggcc cggcgggcag ccgcccgttg tcaccttcca ttgtcaggga 960 cgctgagtca cccaaaacag gaatgttacc ttgtttgagc agacctgtgc caacggtgcc 1020 tgatcagagg tgccaccaca ctgcatgggt gtgtccccaa agaaaacgtg gacttagaaa 1080 gaggagctct ggtcagcact gtcggctgtt taagccagac gagggtatca gacgctccag 1140 tcagggcaag gtgcgtggct ggcagaggaa gcttccagac ctgggcccgg cggggcagaa 1200 ggcagaggcg g 1211 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 6 atccagctag gggtcaaatc taa 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 7 aggatcgtga gaatgtgagt ggg 23 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 8 gctgggccct tgcataca 18 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 9 tgacgtcctc aggcactgg 19 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 10 ctgcaagttc acccaggtag ataa 24 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 11 cccagagctc atgctttcac 20 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 12 gcttgtactg gtccacaagt ca 22 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 13 tcaggcaatg atgtttcgac tatttg 26 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 14 ccaccccctc agctacac 18 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 15 gtcagctgcg gcatccttc 19 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 16 tgggtgtata ggtactaaca ctggc 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 17 actcaccttg atcttcatcg tgctg 25 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 18 aggcccctag aatggacagt 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 19 agggctggat tcgatgttta 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 20 cagatccagt gttgctgtgg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 21 ctagtgactg gtggggcagt 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 22 ccctgggatg atgagaaaac 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 23 tttgcagagt gaggttctgg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 24 ttcaccctga cactgcattc 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 25 aaatggtatg ggggttcctc 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 26 ccttttctag ggccacttcc 20 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 27 agctccgttt caaccccta 19 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 28 gagctagcac ctgcctatcg 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 29 ggaatgcatc tagggggttt 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 30 tgaaaagccc ttctttccaa 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 31 tggtgccttg agtaatgtgg 20

Claims (7)

(SNP) site at position 561 of SEQ ID NO: 1, position 561 of SEQ ID NO: 2, position 500 of SEQ ID NO: 3, position 561 of SEQ ID NO: 4, and position 500 of SEQ ID NO: 5 (SNP) marker composition for identifying black pork and black pork containing a polynucleotide consisting of 8-100 consecutive DNA sequences or a complementary polynucleotide thereof.
The method according to claim 1, wherein the black seed is a Korean native pig or a single breed of Berkshire, the non-black seed is a Duroc, Yorkshire or Landrace variety, Wherein the hybrid is produced by crossing three cultivars with each other.
(SNP) site at position 561 of SEQ ID NO: 1, position 561 of SEQ ID NO: 2, position 500 of SEQ ID NO: 3, position 561 of SEQ ID NO: 4, and position 500 of SEQ ID NO: 5 Comprising a primer or a probe that specifically binds to a polynucleotide consisting of 8-100 consecutive DNA sequences or a complementary polynucleotide thereof.
A pair of primers consisting of a primer having the sequence of SEQ ID NO: 6 and a primer having the sequence of SEQ ID NO: 7; A primer pair consisting of a primer having the sequence of SEQ ID NO: 8 and a primer having the sequence of SEQ ID NO: 9; A pair of primers consisting of a primer having the sequence of SEQ ID NO: 10 and a primer having the sequence of SEQ ID NO: 11; A pair of primers consisting of a primer having the sequence of SEQ ID NO: 12 and a primer having the sequence of SEQ ID NO: 13; And a primer pair consisting of a primer having the sequence of SEQ ID NO: 14 and a primer having the sequence of SEQ ID NO: 15, and a kit for discriminating between black pork and black pork.
5. The method of claim 3 or 4, wherein the black seed is a single variety of Korean native pig or Berkshire, the non-black seed is selected from the group consisting of Duroc, Yorkshire or Landrace, Or a hybrid of the three varieties produced by crossing each other.
How to determine black pork and black pork containing the following steps:
(a) separating a nucleic acid molecule from a sample of a swine; And
(b) From the isolated nucleic acid molecule, the 5'-th position in SEQ ID NO: 1, the 561-th position in SEQ ID NO: 2, the 500-th position in SEQ ID NO: 3, the 561-th position in SEQ ID NO: Identifying the base type of the single nucleotide polymorphism (SNP) region of the &lt; RTI ID = 0.0 &gt;
7. The method of claim 6, wherein the black is a single variety of Korean Native Pig or Berkshire, the non-black variety is Duroc, Yorkshire or Landrace varieties, Characterized in that the three varieties are hybrids produced by crossing each other.

Images