KR102615877B1 - Composition for discriminating Nanchukmacdon pork meat and use thereof - Google Patents

Abstract

The present invention relates to a composition for determining pork meat from recalcitrant pigs and its use, including UGT8, UBE2L6, MELK, ZGRF1, NCALD, FHL2, SERP2, GDPD5, NDUFA10, EBF3, and This relates to a method for predicting sirloin formation in low-quality pork and discriminating pork meat from low-quality pork using biomarkers containing the ELN gene. The present inventors selected gene groups that are differentially expressed in each breed based on naive pigs through RNA-Seq data analysis, and performed experimental verification through quantitative RT-PCR in the sirloin tissue of naive hogs. Genes that can predict loin muscle formation were selected, and a method for predicting loin muscle formation and distinguishing lean pork loin muscle using a composition containing an agent that amplifies the gene was established.

Description

Composition for discriminating Nanchukmacdon pork meat and use thereof}

The present invention relates to a composition for determining pork meat from recalcitrant pigs and its use, including UGT8, UBE2L6, MELK, ZGRF1, NCALD, FHL2, SERP2, GDPD5, NDUFA10, EBF3, and This relates to a method for discriminating pork meat from poorly stocked pigs using a biomarker containing the ELN gene.

Before the introduction of molecular genetic testing techniques, livestock breeding for breed improvement was conducted through a crossbreeding and selection process based on lineage data and the ability of the descendants. After the completion of the physical map of the human genome sequence (Human genome project) (IHGSC, 2004), gene sequence information became a turning point in the field of molecular genetics developing more rapidly, and has since been used in various living organisms such as bacteria, plants, and animals. Genomic information has been revealed (Church, 2006). The deciphering of genomic information and the introduction of various DNA markers have made it possible to detect candidate genes associated with quantitative trait loci (QTL) using reference families.

Research results from not only genomics, but also proteomics, transcriptomics, and bioinformatics also provide information on gene transcription, expression, function, and interaction, and serve as markers for candidate genes. The possibility of its use was presented at the molecular, cellular, and individual levels, making it applicable not only to medicine but also to livestock improvement. In particular, research on livestock genomes is aimed at exploring genes or mutation regions for the purpose of improving economic traits of livestock.

Most economic traits of livestock are quantitative traits, and in pigs, most economic traits such as carcass weight, body shape, and meat quality show quantitative inheritance patterns. Many methods have been developed to find QTL affecting these traits. Among them, genome-wide association study (GWAS) analyzes the correlation between genotype and phenotype of single nucleotide polymorphism (SNP) existing in a population at the genome level and detects the top related marker. This research method is being actively studied on livestock including pigs, chickens, dogs, and cows.

In the case of pigs, in most countries, lineage composition research to ensure uniformity has been promoted through traditional statistical breeding programs to improve existing pig breeds rather than develop new pig breeds. The purpose can be said to be to produce pigs that are more uniform than breeding pigs and to see the hybrid effect when crossing between different breeds. However, the goals of improvement were mostly focused on increasing growth speed, yield, and back fat thickness, which led to strong selection, resulting in side effects such as deterioration of meat quality.

Recently, several research methods that combine genotypes with traditional statistical breeding methods using genetic information have been attempted, an example of which is G-BLUB. In the field of genome research, Genomic selection is possible due to the efficiency of DNA Markers developed from specific reference livestock groups. Research is being promoted globally by adopting the method. In Korea, the Nanji Livestock Research Institute of the National Institute of Animal Science created the world's largest reference herd and reported the world's first genetic locus that determines pig meat quality traits. The developed meat quality genes were used to develop a new pig breed, and the gene used in this case was meat quality. In addition to the gene, it is the gene for full body black hair.

There are about 30 breeds of pigs raised for commercial use around the world, of which four breeds are frequently used in Korea: Landrace, Yorkshire, Duroc, and Berkshire. However, unlike the native black pig from Jeju Island in Korea, which has a high umami and chewy taste when grilled, pigs imported from overseas are often made into breeds suitable for making processed foods such as ham, so the taste is different from the taste pursued by Koreans. There are a lot. However, Jeju Island's native black pigs have excellent meat quality, but their growth is slow and their weight is only about 70% of that of foreign breeding pigs. Once a pig is born, it produces around 7 pigs, so its fertility is low compared to other breeds that give birth to more than 10 pigs, making it difficult to use as breeding pigs. There was a point. Therefore, there was a need to develop a new breed that could be used as breeding pigs by improving the disadvantages of native black pigs while retaining the advantages of native black pigs. Accordingly, native black pigs, Landrace, and Duroc were crossed. The developed breed is a low-livestock pig.

In order to improve economic efficiency, low-livestock pigs are a high-meat quality black pig breed developed through genetic selection by crossing Jeju Island's native pigs, which have excellent meat quality and black hair color, with highly productive improved breeds such as Landrace and Duroc. This is an improved breed that was developed by discovering the gene that affects the skin and the gene that makes the entire body black, and developing a method to fix the gene at the DNA level. This improved raw pork has a superior amount of intramuscular fat compared to regular pigs, and the intramuscular fat content of the sirloin, which is one of the parts with the least intramuscular fat in regular pigs, is high, so marbling is developed in the low-fat part, allowing the entire part to be used for grilling. Consumer preference in Korea, where grilling culture is developed, is high. In addition, the meat is red in color and has the unique taste of Jeju native pig, so it is said to have a superior taste compared to regular pork. In 2014, the pig itself (live livestock) was patented for the first time in Korea (registration number 10-1457942).

However, the control system for meat quality and hair color has only been completed, and the system has not yet been established for genetic factors that affect important economic traits such as meat color, body shape, and carcass weight, so molecular markers applicable in industrial settings are required. This is the situation. In addition, molecular diagnostic systems related to paternity verification, pedigree management, production history system, and variety certification for developed varieties have not been established. Accordingly, the identification of genes and key genetic mutations related to the main economic traits of low-livestock pigs were identified, and the establishment of a molecular diagnostic system necessary for certification and management of developed breeds based on the discovered genetic mutations was used to improve the productivity of low-livestock pig breeds. There is a need to establish a follow-up management system after farm sales.

In the case of Korean beef, traceability and breed certification are possible through individual-level breed identification and identity testing after slaughter. However, although it is possible to trace the production history of pigs at the farm level, there is no complete molecular diagnostic system applicable to individual tracking and breed certification of finishing pigs and breeding pigs. In particular, in the case of raw pigs, which are high-meat quality black pig herds, it is essential to secure data that can explain meat quality and color in production history tracking and breed certification, and a diagnostic system that can provide scientific basis for this must also be established. do. For this purpose, an analysis system that can quickly and accurately calculate genotype data is needed.

Currently, consumption is increasing as the number of stores selling raw pork is increasing, but there are some individuals that are not mixed with Jeju native pigs, which means that raw slaughter pork has not yet been fixed. In order to solve the problem of uniformity of these groups, research is actively underway to establish objective standards for judging the quality of pork from uncooked pigs. Therefore, through comparison of the genomes and transcriptomes of the Jeju native pigs, Landrace, and Duroc breeds used in the development of low-living pigs, we can determine how the excellent traits of each breed established the genetic composition of low-living pigs, and the genes and functions expressed. There is a need to develop biomarkers that are involved in the growth and development of loin muscles, which ultimately directly affect the meat quality and mass of low-quality pork.

As part of this research, a method was developed to analyze the genes of pork meat to determine whether it is a specific breed of pork meat. This method of analyzing genes is RAPD (random amplified polymorphic DNA) and SSCP (single strand conformation DNA) using PCR technology. Active research is being conducted to develop and advance methods for determining the breed of pork meat using various DNA analysis techniques such as polymorphisms.

For example, Publication Patent No. 2004-0039059 discloses a genetic testing method that can select pigs with excellent pig traits using specific DNA markers related to the pig's daily weight gain, back fat thickness, and loin cross-sectional area, Publication Patent No. 2011-0011443 discloses a technology for accurately distinguishing between Korean native pigs and other improved pigs by detecting DNA markers specific to Korean native pigs for the KIT gene, and Publication Patent No. 2011-0139011. discloses a method of evaluating meat quality using a single trait polymorphism biomarker for diagnosing intramuscular fat content in pigs, and Publication Patent No. 2012-0046968 discloses a method of selecting pigs with excellent shear force using pig genes. Publication No. 2012-0049624 discloses a method for selecting pigs with excellent meat color using pig genes, and Publication Patent No. 2012-0052796 discloses the PPARGC1A gene, which is involved in the meat quality characteristics of pigs. A DNA marker for checking whether the meat quality of pigs has increased using a new genetic mutation (SNP) site has been disclosed, and in Publication Patent No. 2012-0072871, a single nucleotide polymorphism (SNP) marker is used to check the unsaturated fatty acid content of pigs. A method for confirming high quality pork meat is disclosed. However, research on methods to accurately determine the quality of pork from uncooked pigs is still insufficient.

The present inventors conducted a population genome analysis (Re The analysis was performed by integrating sequencing and transcriptome analysis (RNA-sequencing). Through RNA-Seq data analysis, we selected gene groups that are differentially expressed in each breed based on naive pork, and experimentally verified them through quantitative RT-PCR in the sirloin tissue of naive pork. The present invention was completed by selecting a gene whose formation can be predicted and establishing a method for determining the quality of pig meat using a composition containing an agent that amplifies the gene.

The purpose of the present invention is to provide a method for determining pork meat from low-quality pigs using UGT8, UBE2L6, MELK, ZGRF1, NCALD, FHL2, SERP2, GDPD5, NDUFA10, EBF3, and ELN genes.

In order to achieve the above purpose,

The present invention relates to the UGT8 gene, shown in SEQ ID NO: 1, whose expression is relatively increased in the sirloin tissue of naive pigs; UBE2L6 gene represented by SEQ ID NO: 2; MELK gene represented by SEQ ID NO: 3; ZGRF1 gene represented by SEQ ID NO: 4; NCALD gene represented by SEQ ID NO: 5; FHL2 gene represented by SEQ ID NO: 6; SERP2 gene represented by SEQ ID NO: 7; GDPD5 gene represented by SEQ ID NO: 8; NDUFA10 gene represented by SEQ ID NO: 9; EBF3 gene represented by SEQ ID NO: 10; and an agent for amplifying the ELN gene shown in SEQ ID NO: 11.

The present invention relates to the UGT8 gene, shown in SEQ ID NO: 1, whose expression is relatively increased in the sirloin tissue of naive pigs; UBE2L6 gene represented by SEQ ID NO: 2; MELK gene represented by SEQ ID NO: 3; ZGRF1 gene represented by SEQ ID NO: 4; NCALD gene represented by SEQ ID NO: 5; FHL2 gene represented by SEQ ID NO: 6; SERP2 gene represented by SEQ ID NO: 7; GDPD5 gene represented by SEQ ID NO: 8; NDUFA10 gene represented by SEQ ID NO: 9; EBF3 gene represented by SEQ ID NO: 10; and an agent for amplifying the ELN gene shown in SEQ ID NO: 11.

In addition, the present invention provides a kit for determining poor quality pork meat, comprising a composition containing an agent that amplifies the gene.

In addition, the present invention includes the steps of 1) isolating total RNA from loin tissue of nanchukmatdon;

2) measuring the amount of RNA of step 1) using a composition containing an agent that amplifies the gene; and

3) It provides a method for determining the level of expression of raw pig meat by comparing the amount of RNA in step 2) with that of other breeds.

The biomarker for determining pig meat from recalcitrant pigs of the present invention identifies a region showing a strong positive selection signal in refractory porcines compared to other breeds, and among genes matching the region, expression is relatively increased in the loin muscle of reproducible porcines. By selecting genes, a composition containing an agent that amplifies the biomarker of the present invention can be usefully used to predict the growth and development of the loin muscle of low-quality pork and to identify pork from low-quality pork.

Figure 1 shows the results of population genome analysis (XP-EHH and XP-CLR) of farmed pigs and Jeju native pigs.
Figure 2 shows the results of population genome analysis (XP-EHH and XP-CLR) of oviparous pigs and landraces.
Figure 3 shows the results of population genome analysis (XP-EHH and XP-CLR) of oviparous pigs and Duroc.
Figure 4 is a diagram confirming the necrotide diversity of the positive selection signal (FHL2).
Figure 5 is a diagram confirming the necrotide diversity of the positive selection signal (MELK).
Figure 6 is a diagram confirming the necrotide diversity of the positive selection signal (UGT8).
Figure 7 is a diagram confirming the necrotide diversity of the positive selection signal (NDUFA10).
Figure 8 is a diagram confirming the necrotide diversity of the positive selection signal (ZGRF1).
Figure 9 is a diagram confirming the necrotide diversity of the positive selection signal (UGT8).
Figure 10 shows the results of correlation analysis between gene expression level and RNA-Seq analysis using Quantitative Real-time PCR.

Hereinafter, the present invention will be described in detail.

The present invention relates to the UGT8 gene, shown in SEQ ID NO: 1, whose expression is relatively increased in the sirloin tissue of naive pigs; UBE2L6 gene represented by SEQ ID NO: 2; MELK gene represented by SEQ ID NO: 3; ZGRF1 gene represented by SEQ ID NO: 4; NCALD gene represented by SEQ ID NO: 5; FHL2 gene represented by SEQ ID NO: 6; SERP2 gene represented by SEQ ID NO: 7; GDPD5 gene represented by SEQ ID NO: 8; NDUFA10 gene represented by SEQ ID NO: 9; EBF3 gene represented by SEQ ID NO: 10; and an agent for amplifying the ELN gene shown in SEQ ID NO: 11.

The UGT8 (UDP Glycosyltransferase 8) gene is a gene encoding ceramide galactosyltransferase, and the related pathway includes sphingolipid metabolism.

The UBE2L6 (Ubiquitin Conjugating Enzyme E2 L6) gene is known to be related to ligase activity and acid-amino acid ligase activity.

The MELK (Maternal Embryonic Leucine Zipper Kinase) gene is associated with diseases such as colon cancer and medulloblastoma, and is related to calcium ion binding and protein kinase activity.

The ZGRF1 (Zinc Finger GRF-Type Containing 1) gene is a gene found in several DNA-binding proteins, and alternative splicing produces several transcript variants encoding different isoforms. Create.

Among the related pathways, the NCALD (Neurocalcin Delta) gene has olfactory transmission and presynaptic functions of kainate receptors.

The FHL2 (Four And A Half LIM Domains 2) gene is a gene encoding LIM domain protein 2, and the LIM protein contains a highly conserved double zinc finger motif called the LIM domain.

The SERP2 (Stress Associated Endoplasmic Reticulum Protein Family Member 2) gene is related to malaria and B-Lymphoblastic Leukemia.

The GDPD5 (Glycerophosphodiester Phosphodiesterase Domain Containing 5) gene is associated with PI metabolism and glycerophospholipid (Glycerophospholipid) biosynthesis.

The NDUFA10 (Ubiquinone Oxidoreductase Subunit A10) gene is related to Mitochondrial Complex I Deficiency.

The EBF3 (early B-cell factor 3) gene is associated with diseases such as hypotension, ataxia, developmental delay syndrome, and ductal ureteral reflux, and the related pathway includes differentiation of white and brown adipocytes.

The ELN (Elastin) gene encodes a protein that is one of the two components of elastic fibers, which constitute part of the extracellular matrix and organs including the heart, skin, lungs, ligaments, and blood vessels. and gives elasticity to the organization.

The above-mentioned pig is a crossbreed pig produced by crossing Korean Native Pig, Landrace and Duroc breeds.

The present invention provides a composition for discriminating raw pork meat, comprising an agent that amplifies genes whose expression is relatively increased in the loin tissue of the raw pork.

The agent for amplifying the gene may be any one or more selected from the group consisting of forward and reverse primers and probes.

As an agent for amplifying the gene, any primer designed to amplify the genes shown in SEQ ID NOs: 1 to 11 can be used.

The primer is a short base sequence that has a short free 3' hydroxyl group, can form a base pair with a complementary template, and functions as a starting point for copying the template strand. It means sequence.

In the present invention, primers used for amplifying genetic markers, a template under appropriate conditions (e.g., four different nucleoside triphosphates and DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and an appropriate temperature. It can be a single-stranded oligonucleotide that can act as a starting point for directed DNA synthesis, and the appropriate length of the primer may vary depending on the purpose of use. The primer sequence does not need to be completely complementary to the polynucleotide containing the genetic marker or its complementary polynucleotide, and can be used as long as it is sufficiently complementary to hybridize.

The oligonucleotide used as the primer may include a nucleotide analog, for example, phosphorothioate, alkylphosphorothioate, or peptide nucleic acid.

Additionally, primers can be modified, specific examples of which include methylation, capping, substitution of nucleotides or modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, carbamates, etc.) or charged linkages (e.g. phosphorothioate, phosphorodithioate, etc.).

In one embodiment, the primers include a primer set including forward and reverse primers represented by SEQ ID NOs. 12 to 32, and the forward and reverse primer sets represented by SEQ ID NOs. 12 to 32 are expressed in the loin tissue of oval pigs. It includes a set of primers that specifically hybridize to the relatively increasing genes shown in SEQ ID NOs: 1 to 11.

Specifically, the forward and reverse primer sets represented by SEQ ID NOs: 12 and 13 specifically bind to the UGT8 gene,

Primer sets represented by SEQ ID NOs: 14 and 15 specifically bind to the UBE2L6 gene,

Primer sets represented by SEQ ID NOs: 16 and 17 specifically bind to the MELK gene,

Primer sets represented by SEQ ID NOs: 18 and 19 specifically bind to the ZGRF1 gene,

Primer sets represented by SEQ ID NOs: 20 and 21 specifically bind to the NCALD gene,

Primer sets represented by SEQ ID NOs: 22 and 23 specifically bind to the FHL2 gene,

Primer sets represented by SEQ ID NOs: 24 and 25 specifically bind to the SERP2 gene,

Primer sets represented by SEQ ID NOs: 26 and 27 specifically bind to the GDPD5 gene,

Primer sets represented by SEQ ID NOs: 28 and 29 specifically bind to the NDUFA10 gene,

The primer set shown in SEQ ID NOs: 30 and 31 specifically binds to the EBF3 gene,

The primer set represented by SEQ ID NOs: 32 and 33 includes a primer set that specifically binds to the ELN gene.

"Polymerase Chain Reaction (PCR)" of the present invention is a method widely known in the art to exponentially amplify the starting nucleic acid material by sequentially synthesizing nucleic acids using a polymerase. It is a concept that includes both qualitative PCR, which confirms the presence or absence of specific nucleic acids, quantitative PCR, which measures the amount of specific nucleic acids, and real-time PCR, which enables qualitative and quantitative analysis by tracking the PCR process in real time.

The probe is a nucleic acid fragment of a few to hundreds of bases long that can specifically bind to DNA or RNA, and can be used to confirm the presence or absence of specific DNA or RNA. The probe may be manufactured in the form of an oligonucleotide probe, single-stranded DNA probe, double-stranded DNA probe, RNA probe, etc., and may be labeled with biotin, FITC, rhodamine, DIG (digoxigenin), etc., or may be labeled with a radioisotope, etc. there is.

The composition for predicting the formation of nanchukmatdon sirloin may include distilled water or a buffer solution that maintains their structure stably in addition to agents that amplify genes as described above.

The composition may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg2+, dATP, dCTP, dGTP, and dTTP. To amplify reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerase. There are enzymes. The polymerase can be isolated from the bacteria themselves, purchased commercially, or obtained from cells expressing high levels of the cloned gene encoding the polymerase.

The present invention includes the following steps: 1) extracting total RNA from the loin tissue of an oval pig and synthesizing cDNA using reverse transcriptase;

2) measuring the expression level of the gene through an amplification reaction by polymerase chain reaction using a composition containing the cDNA as a template and an agent for amplifying the gene; and

3) It provides a method for determining the level of expression of the genes in step 2) by comparing them with other breeds.

In one embodiment, a method known in the art to which the present invention pertains may be used to extract total RNA from the loin tissue of an oval pork loin, and cDNA is synthesized from the extracted RNA, and the cDNA is used as a template. A target gene can be amplified by performing an amplification reaction using an oligonucleotide primer set according to an embodiment of the present invention. Target gene amplification methods may include polymerase chain reaction (PCR), including Realtime-PCR.

The present invention provides a kit for determining poor quality pork meat, comprising a composition containing an agent that amplifies the gene.

The composition may have the characteristics described above. For example, the composition may include an agent that amplifies the genes shown in SEQ ID NOs: 1 to 11.

The kit for predicting sirloin formation of oval chicken meat can be manufactured by a conventional manufacturing method known to those skilled in the art, and may include DNA polymerase, dNTPs, and a buffer solution for performing an amplification reaction, and optimal reaction performance conditions. A user manual listing may additionally be included.

The kit can identify pork meat from low-quality pigs by confirming the genetic marker of the present invention through amplification or checking the mRNA expression level of the genetic marker.

The kit may be a PCR kit or a DNA analysis kit, but is not limited thereto.

In a specific example of the present invention, the present inventors used the genomic information of four breeds of low-skilled pigs, Jeju native pigs, landrace, and Duroc to identify regions showing positive selection signals in low-skilled pigs compared to the other three breeds. After finding a gene matching the above region, transcriptome analysis was performed to confirm whether this gene directly affects expression in the tissue, and a 1:1 comparison was made between the loin tissue of the oval pig and each poomsom. Differentially expressed genes (DEGs) were selected (Figure 1), and experimental verification of gene expression was performed in the sirloin tissue of low-risk pigs through Quantitative Real-time RT-PCR, and the genes were genetically identified as strong positive selection in low-risk pigs. By confirming that the gene shows a signal and shows a relatively high expression level in gene expression compared to other breeds (Figure 10), it was demonstrated that the genes can be used as markers for distinguishing pig meat from low-quality pigs.

In the case of existing discriminative markers, only genomic information derived from SNP-Chip (including information about 5 to 6 SNPs) is used, or genes showing differences in expression levels between comparison targets are discovered as biomarkers using only transcriptome information. In most cases, it worked.

However, the present invention uses whole-genome information (including information on the entire genome, about 6 billion SNPs) to track selection signal regions between comparison targets, and adds transcriptome information to this to confirm differences in gene expression, which can be done in two ways. Because it is a method that combines information, it can be said to be a more accurate analysis method than the existing method of determining using only one piece of information.

The present inventors used a multi-omics analysis method with increased accuracy and more specific functions to discover biomarkers for distinguishing pork meat from low-quality pork.

Therefore, by using the genes according to the present invention as biomarkers for distinguishing pork meat from low-quality pork, it is possible to identify pork meat from low-quality pork and predict the degree of growth and development of loin muscles.

Hereinafter, the present invention will be described in detail through examples.

However, the following examples illustrate the present invention, and the scope of the present invention is not limited thereto, and various modifications and improvements made by those skilled in the art using the basic concept of the present invention defined in the claims are also included in the scope of the present invention. belongs to

<Example 1> Genome (Re-sequencing) analysis and transcriptome (RNA-Seq) analysis of loin tissue for each pig breed

To analyze the genome and transcriptome of naive pigs, 10 blood and 5 sirloin tissue samples were used, and the genomes and transcriptomes of Jeju native pigs, landrace and Duroc breeds were collected from data registered online (NCBI, GEO, SRA) were used.

Total RNA was extracted from the loin tissue using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. The amount and purity of the extracted RNA were analyzed using a bioanalyzer (Bioanalyzer 2100, Agilent, USA) and an RNA Nano LabChip Kit (RNA 6000 Nano LabChip Kit, Agilent), and the RIN (RNA integrity number) was maintained at a value of 0.8 or higher. did. Poly-A mRNA was isolated from approximately 10 μg of total RNA extracted from each sample using poly-T oligo-attached magnetic beads (Invitrogen). The mRNA was purified and cut into small pieces using divalent cations under high temperature conditions.

Afterwards, the cleaved RNA fragments were reverse transcribed using an mRNA-Seq Sample Preparation Kit (Illumina, USA) according to the manufacturer's instructions to create a final complementary DNA (cDNA) library. At this time, the average insert size of the paired-end library was 300 ± 50 bp.

Transcriptome data were produced from the sirloin tissue of naive pigs using the Illumina NovaSeq platform. Quality control of transcriptome data uses Trimmomatic (USADELLAB, version 036) software to ensure that the base quality at both ends of the sequence is 3 or lower, that the average quality score is 30 (Q30) or lower based on 4 bases using a sliding window, and that the length of the remaining reads is 30 or lower. Base sequences that did not exceed at least 36 bp were removed. The SGSC Sscrofa11.1/susScr11 version of the UCSC database was used as the reference sequence.

The transcriptome data produced using the Hisat2 (Daehwan Kim, version 2.2.1) program was mapped to the reference sequence Sscrofa11.1. Afterwards, the gene was converted to initial expression level using the Python package FetureCount (Yang Liao, version 2.0.1), and differentially expressed genes were extracted using DESeq2 (Michael Love, version 1.30.1).

DESeq2 software used the Negative binomial distribution method as the expression level normalization method. In addition, when the log2 fold change parameter was set in the function that derives statistical data on the expression level of reference genes for each sample, DEGs were extracted only as a result of independent filtering, which removes data exceeding this value.

In the present invention, after normalization, DESeq2 sets the log2 fold change parameter to -1, and in the result, genes with p-value (FDR) < 0.05 and log2 fold change -1 or less adjusted by the Benjamini-Hochberg method. were extracted as differentially expressed genes.

As a result of RNA-seq analysis, it was confirmed that the expression levels of UGT8, UBE2L6, MELK, ZGRF1, NCALD, FHL2, SERP2, GDPD5, NDUFA10, EBF3, and ELN genes were high in naive pigs compared to other breeds (Table 1).

ENS_ID Chr XP-CLR XP-EHH log2FC FDR Gene Symbol Compare ENSSSCG00000005344 One 50.31517901 -2.312935631 -2.18 0.000124034 MELK Nanchukmacdon
VS
Jeju Native Pig ENSSSCG00000040405 11 67.168271 -2.485311147 -2.15 0.008392278 SERP2 ENSSSCG00000014853 9 163.2458645 -2.364323658 -1.63 0.00000212 GDPD5 ENSSSCG00000008147 3 78.45288699 -2.696124665 -One 0.000516892 FHL2 ENSSSCG00000031904 8 44.70694034 -2.024535069 -3.64 0.003195103 UGT8 Nanchukmacdon
VS
Duroc ENSSSCG00000009120 8 56.23853217 -2.164609468 -1.52 0.003773682 ZGRF1 ENSSSCG00000016349 15 55.03739176 -2.714584707 -1.24 0.00000000000000181 NDUFA10 ENSSSCG00000010757 14 86.87865636 -2.505302829 -1.09 0.0000000000063 EBF3 ENSSSCG00000031904 8 57.77182778 -2.738613817 -2.34 0.000178915 UGT8 Nanchukmacdon
VS
Landrace ENSSSCG00000025858 3 85.97446047 -2.080438144 -1.94 0.0000000000000772 ELN ENSSSCG00000006059 4 58.25052636 -2.861748569 -1.05 0.0000000314 NCALD ENSSSCG00000023379 2 80.85200729 -2.939038774 -1.14 0.000000515 UBE2L6

To perform population genome analysis, the genome information of the four breeds was mapped to the reference sequence Sscrofa11.1 using the Burrows-wheeler aligner (Li H. and Durbin R, version 0.7.17) program, and the produced BAM file was stored in SAMTOOLS (Li Alignment was performed using the H, version 1.12) program. Additionally, GATK Toolkit (De Summa S, version 4.1.4.0) was used to extract single nucleotide variations (SNP, Indel). Additionally, BEAGLE (B L Browning and S R Browning, version 4.1) was used for filtering such as haploid phase and correction of missing loci.

XP-EHH (cross-population extended haplotype homozygosity method, Sabeti PC) and XP-CLR (cross-population composite likelihood ratio method, Chen H) were performed on all single nucleotide polymorphisms (SNPs) extracted in this way for each comparative breed group.

These methods were calculated using the selscan (ZA Szpiech and RD Hernandez, version 1.3.0) program, and the results are shown in Table 1. Three other breeds were compared based on low-livestock pigs, and genes showing strong positive selection signals (UGT8, UBE2L6, MELK, ZGRF1, NCALD, FHL2, SERP2, GDPD5, NDUFA10, EBF3, ELN) in low-livestock pigs were identified. Nucleotide Diversity was estimated using a BAM file using a house script and a graph was drawn in the R program.

As a result of comparative analysis of genes between low-quality pigs and other breeds (Jeju native pig, landrace, Durok) using population genome analysis (XP-EHH, XP-CLR, Nucleotide Diversity), UGT8, UBE2L6, MELK, ZGRF1, NCALD , FHL2, SERP2, GDPD5, NDUFA10, EBF3, and ELN genes were confirmed to show positive selection signals in egg-breeding pigs (Figures 1 to 3).

Specifically, the XP-EHH results in Figure 1 show the directionality between breeds, that is, a positive selection signal, when comparing low-livestock pigs and Jeju native pigs, with MELK, FHL2, GDPD5, and SERP2 genes being -2 or less (in low-livestock pigs). It can be confirmed that a positive selection signal exists.

In addition, the XP-CLR results also showed that the above genes showed values above 50 (a positive selection signal in low-livestock pigs), confirming that the MELK, FHL2, GDPD5, and SERP2 genes are in the region showing a strong positive selection signal in low-livestock pigs. did.

The XP-EHH results in Figure 2 show the directionality between breeds, that is, a positive selection signal, when comparing the low-living pig and Duroc breeds, and it can be confirmed that UGT8, ZGRF1, EBF3, and NDUFA10 genes are present at -2 or lower.

In addition, the XP-CLR results also showed that the above genes showed values above 50, confirming that the UGT8, ZGRF1, EBF3, and NDUFA10 genes were in the region showing a strong positive selection signal in oviparous pigs.

The XP-EHH results in Figure 3 show the directionality between breeds, that is, a positive selection signal, when comparing low-livestock pigs and landrace breeds, and it can be confirmed that UBE2L6, ELN, NCALD, and UGT8 genes are present at -2 or lower. .

In addition, the XP-CLR results also showed that the above genes showed values above 50, confirming that the UBE2L6, ELN, NCALD, and UGT8 genes were in the region showing a strong positive selection signal in egg-breeding pigs.

In addition, as a result of confirming the necleotide diversity of the selection signal, it was found that the graph (pink) of oviparous pigs was clearly separated (Figures 4 to 9).

The above results mean that the genes in the positive selection signal region that are strong in the pigs of the present invention clearly show differences among breeds.

<Experimental Example 1> Gene expression level experimental verification analysis using quantitative real-time PCR

Total RNA was extracted from the loin tissue of naive pigs using TRIzol (Invitrogene Life Technologies, Carlsbad, USA), purified using the RNeasy MiniElute cleanup kit (Qiagen, MD, USA), and used for cDNA synthesis. For cDNA synthesis, add 1μl of random primer (Promega, WI, USA) and 1μl of 2.5mM dNTP to 2μg of total RNA, and add DEPC-treated distilled water to make a total of 12μl. After denaturing at 65°C for 5 minutes, immediately cooling on ice, adding 4μl of 5X buffer, 2μl of 0.1M DTT, 0.5U of RNase inhibitor (Promega), and 1μl of reverse transcriptase (SuperScript Ⅱ Reverse Transcriptase, Invotrogene Life Technologies) at 42°C. After reacting for 60 minutes, reverse transcriptase was inactivated by reacting at 70°C for 15 minutes and used as a template for real-time PCR. 0.2 μg of synthesized cDNA was analyzed using the 7500 Real time PCR system (Applied Biosystems) using 2X Power SYBR Green PCR Master mix (Applied Biosystems, Warrington, UK) as a template and each primer [Table 2]. Gene expression levels were derived using the 2 ^-△Ct method.

gene name Primer sequence (5'-3') sequence number UGT8
(UDP Glycosyltransferase 8) forward
(Forward) ACACAAGGTGCAAGTGGCATGAAG 12 reverse
(Reverse) ACATGAGCCTTCTGTGAGCTGGATT 13 UBE2L6
(Ubiquitin Conjugating Enzyme E2 L6) forward
(Forward) ACATCGGCGCCATCTCATCAT 14 reverse
(Reverse) GCAGGATACCAAAGGCCAGT 15 MELK
(Maternal Embryonic Leucine Zipper Kinase) forward
(Forward) AAACCGCCCTACAACCTCAG 16 reverse
(Reverse) AGGGCTTCCAGTTCTCGTTG 17 ZGRF1
(Zinc Finger GRF-Type Containing 1) forward
(Forward) GCCCTCAGAGTCCACATCCTT 18 reverse
(Reverse) CGGAACACAACTCGGGTCTC 19 NCALD
(Neurocalcin Delta) forward
(Forward) GTAGATGCTTTTCAGGGCGC 20 reverse
(Reverse) TCCTTCCTCTGGTCAATGCA 21 FHL2
(Four And A Half LIM Domains 2) forward
(Forward) TGGTTTCTGTCTTGCTTGCAG 22 reverse
(Reverse) GTGCGCCACATGCAAGAGATT 23 SERP2
(Stress Associated Endoplasmic Reticulum Protein Family Member2) forward
(Forward) AATGAAGGTTGGTGTCAGG 24 reverse
(Reverse) CGGGTATTGGCTTGATGTG 25 GDPD5
(Glycerophosphodiester Phosphodiesterase Domain Containing 5) forward
(Forward) ACCATCTCCTCTCCCTGCAT 26 reverse
(Reverse) CAGGCGCCACTTCTGGAG 27 NDUFA10
(Ubiquinone Oxidoreductase Subunit A10) forward
(Forward) GTGGGGGACAAGTGGATTCTG 28 reverse
(Reverse) CTGTGCAGAAATGCAACGCT 29 EBF3
(early B-cell factor3) forward
(Forward) AGATCATCCTGAAGCGAGCG 30 reverse
(Reverse) GTAGCCGACTTATCACGCCA 31 ELN
(Elastine) forward
(Forward) TCCTATTTTCCCAGGTGGCG 32 reverse
(Reverse) CTTCTTCCGGCCACAGGATTT 33

The correlation between the expression levels of randomly selected genes (UGT8, UBE2L6, MELK, ZGRF1, NCALD, FHL2, SERP2) among the genes in Example 1 and the RNA-Seq analysis in Example 1 was analyzed.

Results of analyzing the correlation between the results of RNA-Seq analysis of UGT8, UBE2L6, MELK, ZGRF1, NCALD, FHL2, and SERP2 genes (Figure 10, Y-axis) and the results of analysis using Quantitative Real-time PCR (Figure 10, X-axis) , As a result of correlation analysis of UGT8, UBE2L6, MELK, ZGRF1, NCALD, FHL2, and SERP2 in loin tissue, the P-valure value was 0.00232 and the R value was 0.931, which are very significant values, indicating a significant difference between RNA-seq and Quantitative Real-time PCR. It was confirmed that the genes were expressed very similarly.

From the above results, positive selection signal genes for low-living pigs were identified through genome and transcriptome analysis of low-living pigs and other breeds of Jeju native pigs, landrace and duroc.

It was confirmed that the above genes were expressed significantly highly in the loin tissue of naive pigs compared to other breeds.

Accordingly, it was confirmed that the genes according to the present invention can be used as biomarkers for predicting loin formation in low-quality pork and for discriminating pork meat from low-risk pork.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for discriminating Nanchukmacdon pork meat and use thereof <130> 2021P-03-028 <160> 33 <170> KoPatentIn 3.0 <210> 1 <211> 1739 <212> RNA <213> Artificial Sequence <220> <223> UGT8 mRNA <400> 1 agctatgaag tcttacactc cgtatttcat gctcctgtgg agtgctgttg ggatagcaaa 60 ggctgccaaa atcatcatcg tgccgccaat tatgtttgaa agccatatgt acattttcaa 12 0 gacactagcc tcagccttgc atgagagggg ccaccacaca gtgttcctgc tctctgaagg 180 cagagacatc gcgccatctc atcattacag cctccagcgc tacccaggga tctttaacag 240 caccacctcg gatgctttcc tgcagtccaa aatgcggaat attttctctg ggagatgac 300 agcagtcgag ctgtttgaca tactggatca ctatactaag aactgcgata tgatggttgg 360 caaccgcgcc ctgattcagg gcctgaaaaa ggagaagttt gacctgctgc tggtggaccc 42 0 gaacgacatg tgtggatttg tgatagctca tcttttaggg gttaaatatg ctgtattttc 480 aactggcctt tggtatcctg ctgaagtggg tgctcctgcc ccgttagctt acgtcccaga 540 gtttaactca ctgctcacag accgcatgaa cctgctgcag aggatgaaaa ataccggcg t 600 ttacctcatt tccagattag cggtcagctt tctggttctt cccagatatg aaagaataat 660 gcagaagtac aacctgctgc cagagaagtc catgtatgac ttggtccacg ggtccagcct 720 gtggatgctg tgtacggatg tagcactgga gtttcccaga cccacgctgc ctaatgttgt 780 ttatgtagga ggaatcctaa ccaaaccggc cagcccacta cccgaagatc tgcaaaggtg 840 ggtcaatggt g ctaatgaac atggctttgt cctggtatct tttggagctg gtgtcaagta 900 tctatcagaa gacattgcta gcaagctggc cggagctctg gggagactgc cccaaaaagt 960 gatttggagg ttttctggaa ccaaaccaaa gaatctgggg aacaatacca agctcataga 1020 atggttaccg caaaatg act tgctcgggca ttcaaatatt aaagccttcc tgagccatgg 1080 tggtttgaat agtattttcg aaactatgta tcatggtgtc cctgtagtgg gcatcccact 1140 ctttggagac cattacgata ctatgacccg ggtacaggca aaaggcatgg ggatcctgct 1200 agagtggaag acagttactg aaggagaggt atatgaagca ctagtgaaag ttatcaataa 1260 tcccagctac cgtcagaggg ctcagaag ct ttcagaaatc cacaaggatc aacctggtca 1320 ccctgtcaat cggactgtct attggatcga ttatattctc cgtcacgatg gagcccatca 1380 cctccgtgcc gctgtccatc aaatctcatt ctgtcagtat tttttactgg atattgcctt 1440 tgtgcttctg cttggt gctg ccttgtttta cttcctcttg tcctgggtga caaaatttat 1500 ctacagaaaa atcaaaagtt tgtggtctag aaataagcat agcacagtta atggacatta 1560 ccctaatgga atcctcaatg gcaagtataa aagaaatggc catattaaac atgaaaagaa 1620 ggtgaaatga gccaacagcc cacctgatag tcaccaatct gttcagtcat tgaattttta 1680 ttgctataat ttaggctaac aactactaaa aggaaaacat cagtaaataa ttc taatac 1739 <210> 2 <211> 462 <212> RNA <213> Artificial Sequence <220> <223> UBE2L6 mRNA < 400> 2 atgacggcga gcaagcgggt ggcgaaggag ctggaggatc ttcagaagga gcttcccagg 60 tacctcggga agctgttcag cgatgatgcc aacgtgttgg tgtggcacgc gctcctcctg 120 cctgagaaac cgccctacaa cctcagggcc ttcaaccttc gcat cagctt cccggagaggag 180 tacccattca agcccccgac ggtgacgttt acaactagga tctaccaccc caacgtggac 240 agcgaaggcc aggtgtgtct gcccatcatc agcaacgaga actggaagcc ctgcaccaag 300 acctgccaag tcctggaggc cctcaacgtg ctggtgaata gacca gagcc ggggcagccc 360 cttcgggtgg agctcgccga ccagctgacc caggacccgg agctgttcaa caggaaggcc 420 gaagagttca ccctccagtt cggagtggac cggccctcct aa 462 <210> 3 <211> 2493 <212> RNA <213> Artificial Sequence <220> <223> MELK mRNA <400> 3 aggtttgatt tcattggcgg gcggaagcgg ccggagccag accat ccaaa agatacctag 60 gcgtccttct cactcgcctc ttcgcttagg actccaggcc ggagcgtgtg acctgtctgg 120 cccagtccct ctctgccctt gcgccctcag cttctttttg taattttgac taaacttcca 180 ggaggattat gaaagattat gatgaacttc tcaaatacta tgaattatat gaaactattg 240 ggacaggtgg ctttgcaaag gtcaaacttg cctgccatat cctcactgga gaaat ggtag 300 ctataaaaat catggataaa aatactctag ggagtgattt gccacgggtc aaaacagaaa 360 tcgatgcctt gaagaacctg aaacatcagc atatatgtca actctaccat gtgatagaga 420 cagcgaacaa aatattcatg gttctcgagt attgccctgg aggagagctg tttgactaca 480 taatctccca ggatcgcctg tcagaggggg agacccgagt tgtgttccgt cagatagtgt 540 ctgcagttgc ttacgtgcac agccagggct atgctcacag ggacctcaaa ccggaaaatt 600 tgttgtttga tgagtatcat aaattgaagc tgattgactt tggtctctgt gcaaaaccca 660 agggtaacaa ggattaccat ctacagacat gctgtgggag tcttgcttat gcagcacc tg 720 aattaataca aggcaaatca tatctgggat cagaggcaga tgtttggagc atgggcatac 780 tcttatatgt acttatgtgt ggctttctac catttgatga tgataacgtc atggctttgt 840 acaagaagat tatgagaggg aaatatgaag ttcctaagtg gctctctccc agtagcattc 900 tacttcttca acaaatgcta caggtggacc caaagaagcg gatttctatg aaaaatctcc 960 tgaaccatcc ctggatcatg caagattaca actgtcccgt tgagtggcaa agcaaaactc 1020 ctcttattca ccttgatgaa gattgtgtaa cggaactttc tgtacatcac agaaacaaca 1080 ggcaaacaat ggaggattta atttcactgt ggcagtatga tcacctcaca gctacttatc 1140 ttct gctcca agccaagaag gctcggggga aaccagttcg tttaaggctt ctttcttcct 1200 atggacaagc caacactact ccagtcacag acatcaagtc aaagaatctg agtctagaag 1260 atatgagcac cagtgatgaa aattatgtgg ctggattaat ggactatgaa tggtgtgaag 1320 at atttcatc aagaggtgtg gctactccac aaacaccaca gtttgccaag cattggacag 1380 aatcaaatgg tctggaatct aaatcattaa ctcccgtatt atgcagagca tctgccaata 1440 aattaaagaa caaagagaat gtatatactc ctaagtctgc tgtaaataat gaagagtgct 1500 ttgtatttcc tgaaccaagg actccagtta ataagaacca gcgtaaaaga gaaatactca 1560 ccacaccaaa tcatttcatt acaccctca a aagctagaaa ccagtgccta aaagaaactc 1620 caattaaaat gccagaaaat tcagcaggaa cagagaagtt agtaacaggt gtcataagcc 1680 ctgagaggcg gtgtcgctca gtggaactca atctcaacca agcacatgta gaggacactc 1740 caaaaaggaa gggaaccaaa gtgtttggga gcctt gagaa gggcttggat aaggtgatca 1800 ctgtgcttac caggagcaag aagaagggct ctgccagaga cgggccaaga agactaaagc 1860 ctcactataa tgtgactaca accagattag tgaatccaga tcaactcttg aatgaaataa 1920 tgtctattct tccaaagaag catgttgact ttgtacaaaa gggctataca ctgaagtgtc 1980 aaacccagtc agattttggc aaagtga caa tgcagtttga actagaagtg tgccagcttc 2040 aaaaacctga tgtggtgggt atcaggaggc agaggcttaa gggtgatgcc tgggtttaca 2100 agagattagt ggaagacatc ctatctagct gcaaggttta attgatagat ggtttccatc 2160 ttgcctgatg agcatggg tg cgatacagcc tacgtggagc ctggtgtgat tggtttgatt 2220 ttaaaagtcc actggaacta cactcgtttc taaagggcta tcctaaagac caatattttt 2280 tgcttgtttg tttttaaaca aaagatactt tttgtggatg aatctaagcc aagactatct 2340 gccgttatct gtaactgtct ttttaagtaa tatgctttgt ataataataa ccattgactt 2400 tcttagattc acttccatac atgaatgtaa gctctta act gtttctcctt ttatttgtaa 2460 tttctttctg aaataaaacc attcatgaat ata 2493 <210> 4 <211> 6850 <212> RNA <213> Artificial Sequence <220> < 223> ZGRF1 mRNA <400> 4 ggcagtggtg ggcgggctaa atagtgggtc ttgatttggt gtggtcgcga gttgatgacg 60 tcaagggctt ttcgcgggag agattcgaaa gtggattttg tgcaatggcc gggtgaaatg 120 agctgtttcc cggggtttct ggggagtaag aggcgagagg cggtgtcgct gattttggcg 180 cgactggacg aagaagtttg ctccgccaga agcggacgat aaggataccg tgtggaacag 240 gattggctca cagcttggtc gaacaacttg caataattgg tgccccgtct tcctcgcctt 300 ctccaatctc tg ctttgcag ttcccgcata catgtggtat aaatagttgt atgaccactg 360 attattctcc ggagacctga ctatatataa tttcagaaga aacaatggaa agccaggaat 420 ttattgtcct atatactcat caaaagatga agaagtcaaa agtatggcaa gatggaattc 480 tgaagatcac tcacgtagga aacaaagcca ttttatatga tgacaaagga cagtgtttgg 540 agagt ttaatt tcttaagtgc cttgaggtga aacctggaga tgatttagaa agtgatcgat 600 acttaatcac agttgaggag gttaaagttg ctggaagcat agctgttaaa caagatatca 660 ttaaaggagc acctccatta aattcaaaga gctttatacc ttctggccgg tcccttgggt 720 gtcaacctgc t ggtttaaaa aggaaattta ctggttttca aggaccacgg caagtgccaa 780 agaaaatggc tattacagaa aatagtgaat cagctgcttc acttgaggct aaggaagctg 840 gtcctgtttt tctttctcca gtctacagca cacctccttt gtttcctact gttggcaaaa 900 aagatataaa ttatatgcca acagaccctg acaaccagga cagagagaga aatggcatag 960 ctttttct tc ggttgtctct actccatcct tcaagattaa cccagaaatg ctatgtgaag 1020 aaaattattt ttgctctact gtcaattctg taaataagca ttcaggttct ttactgaccg 1080 atgagcttat gaaaagagat tgtttggtat ctcacaattc aggagtttca cagaacatta 1140 gaagtaa agc ccagatattg gctcttctga aatccaaatc cactggtaca tctaaagaac 1200 caaattctga gattacagga catttccctc tgatacaacc acaaggaagt ttaaaaattc 1260 ctgctaaact tgagtgctta attgaacagg aagaacacac tcaggtgaag agcacagaaa 1320 gtttatactg ccaacatcaa tcaaaaaata ccatgagaaa taaaagccgg tgggccatgt 1380 atttatcctc acagagttca cct acacatt cttctacagt agatggaaat aatacaggaa 1440 aaaatcctga ggccgaggga ggtaatataa atttaaattt gaaagacgct ttggtgcaaa 1500 aaagcatgcg gtttttagaa acatgtactg aagagggaaa aaagtataat gaagacaagc 1560 cagtagttga taatgatcaa tcct ggaatc aaaaagtaaa attagaattt ccttcattct 1620 gtgaaagcag tgccttacca gttacttgtg acaacgtaga aaacgacagc ttattatcag 1680 aaaatgacag cttattatca gaaaatgaca ttcaagaaaa taataaaaga ctttttaatc 1740 aaaatgacca gatgggcata aaaggatcaa ttctcattac agaaaaagct caggagataa 1800 ccatgtatgg aaccccagct aaggagtata aacatctg ca gattgaatct tcactaagta 1860 acgattttag ggtctctaat ggcattgctg acatgttttc taaaagtaat gctgataatg 1920 aaaatctgaa cagtattcat gaaccacttg tggagattac ttttaatctg aacaattttg 1980 aaaccagtga ctctgaggag gaatcacagg aaagcagca g aatttcccac gattcagagg 2040 gttgggtgaa ggaaacttta gttaaagaca attcaagctg tgagaatata aactgtgcag 2100 aagttggcag tgaccatttg cctctcttaa cgtctagtgg ggacagactt gcagagacat 2160 tttccatgaa agagactctg ctatcacaat tttgtgataa aacttctgta ggttttgaca 2220 caggaccttg gaaagctgga aacactagaa a agaaataga ggaggagtac ggtgacacct 2280 caaacaatct tgactcatct ttagagtgga ctgaagatgc aaatgtaggt agtaatgaag 2340 gcactaataa atctactcag gaagtcacag ttaactatga ttttgcttct ctcccaaatg 2400 aaagtataaa cacaaattta catatccctc actcttta aa cacagccact aatcaggatc 2460 ctgaaaacaa tccatggtca caacaggctc agcctcagcc ttttattatg ggaactgact 2520 tacacaaaaa tactgaacag gttttaccat taacttctag cagtggcaac ggcacccaac 2580 tattaaatgc cagtcagaat cactctgaag aatttcttgc acttgataaa tcacataccc 2640 aagtttccaa ttcttcgttt taccctctgg gagtaaaata tcctatatct aaagacacag 2700 aatcacatat tctggaatct gaagatttgg gaaggactag aagtttacct catgacaata 2760 ctgacataga aactgccaga gagagcaaac agtactggaa tactcctaaa aattcttcag 2820 aactttctgg attagaaaat agcatttccc tattaaaatc attgtctgaa cacagtactg 2880 ctttaga agg cttggaaata ttgaaaaaga aacatacctc ctttaagcaa caaggaactc 2940 tgcagacgta tgatccagaa agcagtcctg aagctagga accattgact acaatagttt 3000 cacaagctat accaaagtct catccgaacc aggatcctca acagatgata aaagaaaatg 3060 aagttaaacc aagtgaatcc ctcaccaagt tttttccctt gggcagtgaa gaagag actg 3120 actcccgagc tctcattcct aaacaaatgg agagaaaaac ctgtgaccct aagcctgttg 3180 agtttcaagg gcaccaagtg aaaggatcag ctgctagtgc tgtgatggtc agaggacaca 3240 gctcccagtt tgaatgcagt caatttccag atagcgtgta t gaaaactgc atgacaaata 3300 cttgtttttt gacacctaag ttgcctagca cttgtatgca gattgacttc ttgcagttgc 3360 cagatgaaga aaacttgata aaaggagatt ccagctttaa cactgaagac aattttcaag 3420 tgatagctga gcctaataag aattcagtta aaaatgatct aatgaaaaag tctctggaga 3480 ataagaacct tcaaaggctt tcattagtaa gtagaatccg agttccactt attactttgc 3540 cagctaccag tggg tcacct gacctagatt cttgttcgtg tgtgatcgac tgtgacaggc 3600 aagagtcttc tgattctccc atagtcaact tgtatgaaga gtcagagctt ccttctttca 3660 gctttggatc tgaggaccaa agtgaaactt ctttctctaa agaatctact gaaatgactc 3720 caagggatat ttcacttctc gataatacat ctactcaaag caagtggctg aaatatcaaa 3780 acataatcca atgcaagttg actacaccaa acagacttga tcagaaagta acagatggct 3840 tctttgctga ggctgtttcc aggatgcatt ttagtgacac aggtgaaaga cagagtgatg 3900 ctgtgaatga aagcttagac tctgagcatt tgcaaatgat aaaatgcatg cttcaacaac 3960 ag cggcagga ttttagcagt caagatttgg tttccagaca gaaagcactc tctttgaatt 4020 taaagcacac ttctaagact gaggaaatta aaaatgtgtt aggagagtct gcctgctaca 4080 cctgcagtgt aagaggagat ttacaggaga taagtgactg tgagctgtgc ttcccaagtg 41 40 gggagaaagt aaaatctgca tatcttcccc aaaggcaaat tcacatacca gctgtttttc 4200 agtctcctgc tcattataaa cagattttta catcttgtct catagaacat ctaaatatat 4260 tgctgtttgg gttggcacaa aggctgcaca aagctctttc aaaagttgac atatcatttt 4320 actcatcaaa cggagacaaa cggaaaaatg tagaaaataa tgtgccatca tgccatcatc 4380 atcaccctgc aaaacttgtc at ggttaaaa aggaaggtcc aaataagggt cgtctctttt 4440 atgcttgtga tggaccccaaa gctgaccaat gtaaattttt caagtggctt gatgaagtga 4500 ccccaggata tttaacacag gaagaatcac tacctagcat ggttttaagt gatataaaaa 4560 gtattggctt gtacttaaga agtcaaa tacccctcta tgaggaatgc caacttttgg 4620 tgagaaaagg atttgatttt caaagaaaac ggtatggtaa actaaagaag tttacaactg 4680 tagatcctga attttataac gaacctaaga gcagacttta tcttaagctg agtcgtaagg 4740 aaagttcatc tgcttatagt aaagatgatc tttgggtggt ttcaaaaacc ctagactttg 4800 aattggatac ttttaattgca tgtagtacat t ctttggacc gtcatctgtc aatgaggtag 4860 agctactacc tttgaaaggt tatttccctt ccaactggcc cactaacaca ttggtccatg 4920 cattattggt ttgtaatgct agcacggagc tgaccacttt gaaaaaatatt caggactact 4980 ttaatccagc tactctgcct ctaacacaga acctg ttaac aatgtcttca tcaactatag 5040 tgagcaacaa gagagtcaat aagagaaaat ttatcccacc agccttctca aatatcaata 5100 caaaatttga actgctcagt ataggagcaa cgctgcagtt agctggtgag ttaattcaca 5160 cacacaagtt aaacaaggat caagctacag ccctaattca gatagcgcaa atgatggcat 5220 cacaaggaag tgctgaagaa gtgaaggaac tgggaactca caccctcc ca atcacgatca 5280 tacatggtgt ttttggagca ggaaaaagtt atttgctggc agtggtgatt ttgttttttg 5340 ttcagctatt tgaaaagagt gaagctcttg cagttggaaa tggaagacct tggaaacttc 5400 tgatttcttc ttctactaat gtagctgttg a cagagtact tcttgggctt cttagtcttg 5460 ggtttgaaaa gtttgtcaga gttgggagtg tcaggaagat tgccaagcca attttacctt 5520 acagtttgca tgctggctca gaaaatgaaa atgaacaatt aaaagaactg catacactca 5580 tgaaggaaga cctgactcct gtggaaagag tctatgtgag aaaaagtatt gagcaacata 5640 aactggggac caataaaacc ctgctgaagc aggttcgagt agttggagtt acc tgtgcag 5700 cctgcccatt tccatgcatg aatgacctta aatttcctgt ggttgtactg gatgagtgta 5760 gccaaataac cgaaccagct tctctccttc ccattgcaag gtttgagtgt gaaaagctta 5820 ttcttgttgg agatcccaaa cagcttcctc ctactattca g ggttctgat gcagctcatg 5880 aaaatggact ggaacaaact ctttttgatc gactttgctt aatgggtcac aagccagttc 5940 ttttgcgaac ccagtaccgt tgtcacccta caatcagtgc tattgctaat gatctgtttt 6000 atgaaggaaa cctcgtgaat ggagtttcag aaacagagag gagcccttta ttggaatggc 6060 ttccaaccct gtgtttctat aacattcaag ggctggaaca gatcga aaga gataacagct 6120 ttcataacgt agcagaagct gcttttacac tcaagctgat tcaatcactg attgtgagtg 6180 gaatagcagg ctctatgatt ggggtgataa cattatacaa atcccagatg tacaagcttt 6240 gtcacttact cactgcactg gactttgacc atcctggtaa tgtgaa agct gtgcaggtgt 6300 ccacagtaga tgcttttcag ggcgctgaaa aggagatcat cattctgtcc tgtgtgagga 6360 caagacaagt aggatttatt gattcagaac aaagaatgaa tgttgcattg accagaggaa 6420 ggagacattt gttgattgtg ggaaatttgg cctgtttgag gaaaaaatcga ctatgggggc 6480 gtgtgatcca acactgtgaa ggcagggaag atggattgca acatgcaagc caatatgaac 6540 cacagctcaa ccatctcctt aaagattatt ttgaaaaaca agcagaagaa aaacaaaaga 6600 aaaagaatga aaaagataaa tccaaagata aatctcattt acaaaaagaa acagtatagt 6660 ttgtatttat ataaattcaa attaatttta tgctatacat ttttattacc cccaaaccct 6720 tgctactggg a aaaaaaaaa agttaaacat atataaaatt tgctctccaa aaaaactatg 6780 attacctata ttaagataga tgtagaaggt aatataaaat ctcagtaata aaagttaatt 6840 ttcttctgga 6850 <210> 5 <211> 3630 <212> RNA <213> Artificial Sequence <220> <223> NCALD mRNA <400> 5 tttggtttct gtcttgcttg cagcatattc ataattag ca acagtaggca cagcgggaaa 60 gaacgttata ctttgaaaca aaagttgggg tttttctagt gaataaagta ttctgaaaag 120 accaaggaaa actgtccaca gattcctatt tggaaaaaaaa tcatctggaa catgccaagg 180 tagttggggt ggaatctctt gcatgtgcgc acgcagttgc tttttggttg ttagagcaaa 240 gtgcagattt tcagtatctt cctctgaaaa ttcagctgtg aagagaagag catcggac gg 300 tcttcactac ggagtcgtct gaattcttgc tgtcaagatg ggaaaacaga acagcaagct 360 gcgcccagag gtcatgcagg acttgctgga aagcacagac tttacagagc acgagatcca 420 ggaatggtat aaaggcttct tgagagactg ccccagtgga catttgtcaa tgga agagtt 480 taagaaaatt tacgggaact ttttccctta tggggatgct tccaaatttg cagagcacgt 540 cttccgcacc ttcgatgcca atggagatgg aacaatagac tttagagaat ttatcatagc 600 cctgagtgta acatcgaggg ggaagctaga gcagaagctg aaatgggcct tcagcatgta 660 tgacctggat ggaaacggct acatcagcaa ggcagagatg ctcgagattg tgcaggcaat 720 ctataagatg gtttcctctg tgatgaaaat gcctgaagat gagtcaaccc cagagaagag 780 aacggaaaaaa atcttccgcc agatggacac caacagagat ggaaaactct ccctggaaga 840 gttcatccga ggggccaaga gcgacccgtc catagtgcgc ctgctgcagt gcgaccccag 900 cagc gccggc cagttctgag cccggcagcc cgcgaatggt agagctgctt gtgttctctt 960 tggatttttc tttttaacaa attttttttt tgttttgcca aacgatattg acggtgatgc 1020 tgttccccat gtggtcggac gcacctccct ccgtgccgcc ttcagcttct tttgtcgtgg 1080 acgcttcgtg ggaatgtcta gagccccccc cgcgcttgtg gagag catgg acagtgctgt 1140 cgtgcacaga ctttgtggtg ttcattgttc tgacgacttt tcatcgttat tattattttt 1200 tttcctttga ttggaaggtc tgtgttcgaa aactgaaaac ttggggaggc aagagaaggg 1260 aaaccaatcc agtccagcga tttt attgca agcttgagca gcttgtttga aaaacgaaac 1320 tccccacctg ggtcacacat gccctaaggt tgatggcacc agaagctgga ttccccaagg 1380 accaggaatc ctctggggcc aggctgttaa agggacctgg gggatccccc cagaggccca 1440 ccctaccctc ttccccagca ggctgtagtt actaagctgt gaacatttca aggtaaatta 1500 atagaggaga ggataaagat ggctaaagga tggctcagct gtttcttccc gggtttacat 1560 gagttgagct aagatgaatt tcttt ggaaa cttaatgcaa atgctaactt gtattccaaa 1620 accagaccca tcttgttgcc tattgtgatt taaaaaaaaa aaaaaaagat cattgtatat 1680 aaaatattgg gtattgcaga ccaaattaag tgttttgcct tgtttaaatg aaatgcatgt 1740 ttagtgagca ctaatacaat cttattacag aagactgttt ttagtagctt attgtgaagc 1800 aagccagcta taaggaatgt ctgtcttgtt ttaaagtcat atctgtctgc acaaatgcac 1860 caatcaacag atatatttta tatattccag aaaagtacaa agtaatcgtg accagggctc 192 0 aaccttcatt ttgaatgcat ttccagtggt agcacctatt ccagaagtgg ggcaggtaga 1980 gtgggatggg tcaactgcag caccagaagg ttcttgttta ttcgaaatgt gggtttgccc 2040 acccagccca gcagatcgtc gatagtatta gattggaagt gtggtgcttt tccga gcaga 2100 tcaataactc tgtagacgct ttcccccacc caacccccac cccccgaccc caaaaggcaa 2160 aaatcctcaa gacttcctaa tgttttaatc cacatgcatg gttaggcagc tgtaggctgg 2220 aatattgact ttcccatgcc cccagtggcc tttaagagag tcagagattg ggcagtcatc 2280 tggttcatct tgaagtcagc aagtcaggtg tgtctgtgat ttccaaggcc cgctatgggg 2340 acttgga agt cttttccatt tctacgtttt ctgaatgcag atttctattt ccagaagtga 2400 taacccaatt tgagtttctg tttggtctga tgacctcata caccctaatt tgaattggaa 2460 ggtaagagtg aaagttgccg atcgcaggtg agtcacatta gcacaagcaa taggcatggg 2520 gaagcccaaa cagttaaggc tggagatggg gagaatgtgc ctcaagaagg cagagaggtc 2580 cccttggctg tggccacact ccttgggtag accatgaacc acagagagac tcctaaccat 2640 gaggaagatg atgctgagcc tgcttaaacc tccagattcc tgtgtgttac tcgattccat 2700 tttaactgat aatgaacatc cgaattagca tcggattttt cagtggaccg aaatgaaaca 2760 actttgccgg gtgagatttt gag agttgga ctctgtaaaa tcatcttcct ctgtcagttg 2820 ttcatagtgg ttctataccg tgaaccttgc cgagttcctc cactggccaa gtggtaaaat 2880 ctggttttga caactaggga attattaacc caaagcgtgg catgcagagg ggcaggggac 2940 cacgccctct atagg caatg tcctggagct gcatcccact ttctctcccg cacttaattg 3000 aagatccagt tcctcctttt agtttttcct gagatggtgg agtcagttaa tgcttgagaa 3060 agcccgcctg agctctgccc tcagtcttga catcatactg agccagattc agtccctgga 3120 acctagagct gcagtgagaa gcccgaagag ctgttaagaa agaatccagc gttgccacag 3180 ctgtgatgat gtaggttg ca gctccggctc ggattcagtc cctggttcag caactccata 3240 tgccatggga tggccaaaaa agaaaaaaag aaagaaagaa aaggaaatag atcagactca 3300 tggctgatga atgctgacaa gctcgagatg gatgaagaat aatccctatc ctggcctgcc 3360 cgtgaccctg tctgtatttt gagggttgtt ttcctcatgc tccccctgcc tcacaaggcc 3420 tttgtacatc tgatgcagtg cccttgagtg tggccaaggg actcagtagc acccaaaagg 3480 ccgaatggct caaggcttac gtcactcctg tgtggggctg gtcagtgtcg ctgctgtgtg 3540 gcgggacctc tggaaatgga gtctgttctg tctgagatca agccggcctg tgatgttcaa 3600 gggacgggaa taaagtggct tgaaggatgc 3630 <210> 6 <211> 2607 <212> RNA <213> Artificial Sequence <220> <223> FHL2 mRNA <400> 6 gcttgcaaga gcgagggctg ggttcttatc tcctgagctc tggacctgcc ttatttatag 60 cccagcttgc cggcagctgc atacaagttg ggacggttgg ctcagcagcc actgtcccct 120 ccagtcaggc tgaaaccagc caggtggcag aagtccagca ccaagatgac tgagcgct tc 180 gactgtcacc actgtgagaa ctccctcttc ggccggaagt atgtcctgcg ggaggagcag 240 ccctactgcg tgggctgctt tgaggccctc ttcgccagca catgcgagga gtgtgggaag 300 ctgattggat gcgactgcaa ggacttatcc tacaaggacc ggcactggca c gaggcctgc 360 ttccactgct cgcgatgcag gagctccctc gtggacaagc catttgctgc caaggaggac 420 caggtgctct gcactgactg ctactcgcag gagtactcat cccgctgcca ggagtgcagg 480 aaggccatca tgccaggcac ccgcaagatg gaatacaagg gcagcagctg gcacgagacc 540 tgcttcacct gccaccgctg ccagcagccc attgggacca agagcttcat ccctaaggac 600 ggccaga act tctgtgtgcc ctgctatgag aagcagcacg ccttgcagtg cattcagtgc 660 aaaaagccca tcaccagcgg gggcgtcacg taccgtgagc agccctggca cagggagtgc 720 ttcgtgtgca ccgcctgcaa gaagccactg tccggccagc gcttcacgtc cc gtgacgag 780 ttcgcctact gcctgggctg cttctgcgac ctgtacgcca agaagtgtac aggctgcgcc 840 aaccccatca gtggactggg cggcaccaag tacatctcct tcgaggagcg gcagtggcac 900 aacgactgct tcaactgcaa gaagtgctcg ctgtcgctgg tggggcgagg cttcgtcacc 960 gagagagacg acatcctgtg ccccgactgc gggaaggaca tctgagccgc tagagggcct 1020 gctcgcgctg ctttccccct gtgcgccccg ccccgccgcg ccccgccccg ccccgccgcg 1080 ccccgccccg ccccgccccg ccgcgccccg cccccaggtg gtgccgcggc ccccggcccc 1140 gcctgctacc tgtgccgccc acacctgttt acagccttgc tccg cgcttg tgcctgaggc 1200 ctagggaagg aggtcctgga gcccgaagtg ggaggtggtt gtgcattcgt ggaatcacgc 1260 aaggacaatc cgagtggaaa catccttttg aatgctatct ttatagaccg acctttcttt 1320 cactgtgtct ttaattatta agtgcaatta ccgcgagtta atgaagggtt ggtgtcaggg 1380 cgttgaccgg tggcctagtg cttggctttt ggcgctttcg cggctacagc caggggcagt 1440 aatccctggc ctgg gacctg agatctcaca tcaagccaat acccgccaaa gccaaaaaaa 1500 tggtatttcc aaggccgtaa ctttgtcacg tggagcccaa agcaaggtga gccggctcac 1560 gataaagtga tccgggagga aatcttatgt caagtgcagt gggtcaaata tgaaacgtta 1620 agg gtctcag cataaacaac acttgactgc agcttccact agggctctga cggactgaaa 1680 ttgcatcagg ccttttatcg aaaaggaagc cgcagtcagc accagggcag ctgccttcct 1740 ctctgaccct ttcccagact ccctgggaat ttaatgctca gcctaggatg tggtgacata 1800 agcgacagca cgtgagctga tggacgtgcg ggcagcactg ggtcactttt ctggacagag 1860 ctcgatgctc tcctgtgctc ccggccaagc cctcacacct gcctgccttc tcctccgtga 1920 gtggaggctt acaggaggca caggtgactc cagaccagag ttgatgtcct gcgcacctgt 1980 attttgtcaa cacctgggca actgaggcca cctgggagcc ttctgtgagt gtttctgaag 2040 gataaga agg gaaatcacag ctctaaatag aacactcctt ttcaggtagg ctcctgagct 2100 gacttctaaa ggttcgctat gccctagacc cagaaaaccc caaaaaatca ctgcacatca 2160 agaggttaag gtttttgtgc tcaccttttt ttggccacgc ccttggcatg tggaatttat 2220 gccaacttac caggtagggc atggcatggt tctttttggg ataacaactg tgattttttt 2280 gtccttagct ttctaagata atgcagtatg atacaatga t cggctatgca gcagaaaaat 2340 ctggttgaac tcaagtccca cctacgcaga gcatctgtga agccagtttc ttaatctgag 2400 tgctggtcac tgtgagaagt gcttgattgt ggctgaaacg ggcctctggc tgtatggtct 2460 gttggctgga ggctttgctc a aaaaaaata accaccaccc ccctccacct tgttagttgc 2520 tttgctggct cttactttat gatataaagg taaatgcatt cttgcaaatg tgctttttaa 2580 aataaaaata gcaaaattca aaaaaaa 2607 <210> 7 <211> 642 <212> RNA <213> Artificial Sequence <220> <223> SERP2 mRNA <400> 7 acccagaggg agtcacagcc ccgagactgg caagtgtgag gaactgagca gcccgggaga 60 aaccctt ctg tgtcaccaca aagggaagac ggaggacctg catctgctct ggacctcctg 120 cctcaggatc ggagatggcc aatctggaaa aagatgtctc ctcggccact ggcgcccgca 180 agctatcttc cagatcattc agagcataag gatgggcatg tgagccggct gggctttaag 240 cccaccctcc ccccgacccc cggagggcgg aggaccattt cagctcgtgg ccaggtagct 300 gcgggaagcc gaccagccgc ccc ggagaga aaaaaaggct ccctccagtg tcccccctgc 360 cccgatccct gcatcgtgga tgtcagacca aattgccttc tcagaggaca tctcggcccc 420 tccgagttct ccagcggaaa ggacgtttgg ctttgctctt ggcaggattg gtccttcccg 480 gattggtgtc t gcggcgggc cctgtctgtc cgggtgtggc cctgggtttc cgtgatgtct 540 gcatgtgggc ctcggaatga tcaccgcttt actttctacg gatacaattt ctgctccatt 600 gggaattgct tttacaaata aatgtctttg ttcaacctta aa 642 <210> 8 <211> 3578 <212> RNA <213> Artificial Sequence <220> <223> GDPD5 mRNA <400> 8 ggtgaccccg ccccaattcg ggcgg ggccg cgttggccgg cgctccggcg ctgggcggcg 60 ctgcctcggc tctgctcgac tccggctcag gctcctgcgg cagctcctgt gggggtgggc 120 ggcggggctg acagcggcgg tggcagcggc tgcggctcga ggctgagcga gcggcgggcc 180 agccgggaga agaggaggaa gtggagccgc ggctgtgagc tctggagtca gctgccacgc 240 cgaggaccgc cccattttgc aga gcgagcc gagtccggac ctaggaagac ttctctaccg 300 ggctccagcc gccgcggctc cgcgtcttct cgcccgcgcc ctgccttgcc ccgccaaccc 360 cagcccggtt ctgcgctccg cggtccgggg cgtgtggccg ggacgcctca aacccctgac 420 cctgatcc ag tgcaccaggg cgggacgctc ctggcccacc acacggctct gggattaccg 480 gctccttccc agcctttctc tagtgtgtgc cgaagcccct agccctccgc ccgggattaa 540 ggcagggtgc ccccacccct ccgtctgagt gcaaaggagc ccggaccttc agctgcctct 600 gccccggtgc ttcggatttg gtgcggtgct aacgtccagg aagccccgac ccgggcccag 660 agccctatga ggggtcccag gcgggctggc cc gtcggact gaaccggact gggctggtgc 720 tgtgagacga agcagccacc ttcctgccgc cccgggcgag gggctgagcg cttgccccga 780 agaaaacaca ggggagagcc gagtgctgca gctctcccag tgaagccaca tcgccacctc 840 cgtggacagg acgcccccgg gag cccagct cacagccact ggtacctgct tccaggacca 900 gccggggcct ccatgggcgc ctgagggcgg ggtgccaggc cggcagcgcg agcatggtga 960 gacaccagcc cctgcagtac tacgagccgc agctctgcct ctcctgcctc actggcatct 1020 acggctgccg ctggaagcgc taccagcgct ctcacgatga caccacgccg tggggagcgcc 1080 tctggttcct gctcctcacc ctcacctttg gcctcacgct cacct ggctc tacttctggt 1140 gggaggtcca caatgactac gacgaattca actggtacct ctacaaccgc ttgggctact 1200 ggagtgactg gtctgtgccc attctcatgg ccacagctgc cgctttcacg tacgtcgcgg 1260 gcctgcaggt cctggcactg tgtcacatcg ccg tgggaca gcagatgaac ctgcactggc 1320 tgcacaagat agggctggtg gccatcctgg tggccacggt ggtggccatg tcggccgtgg 1380 cccagctgtg ggaggacgag tgggaggtgc tgctcatctc cctgcagggc acagcgccat 1440 tcctgcacgt gggggccctg gccgccgtca ccgcgctctc ctggatcgtg gcaggacagt 1500 ttgcccgcgc cgagcggtcc tcctcccagg tggccatcct cagta ccttc ctcgccgtgg 1560 tgtttgccct ctacctggcc cctctcacca tctcctctcc ctgcatcatg gagaaaaagg 1620 acctgggccc caagcctgcc ctcatcggcc accgcggggc ccccatgctg gccccggagc 1680 acacgctgat gtccttcagg aaggccctgg agcaga agct gtacggactg caggctgacg 1740 tcaccatcag cctggacggc gtgcccttcc tcatgcacga cgccaccctg cggcgcacca 1800 ccaacgtgga ggagctgttc ccggagctcg ctcgcaggcc cgcctccatg ctcaactgga 1860 ccatcctgca gaggctcaac gctggccagt ggttcctgaa gacggacccc ttctggacgg 1920 ccagctccct gtcaccctct gaccagagag aggcccaaaa ccagtccatc tgcagcctca 1980 cggagctctt ggagttggcc aagggcaacg ccacactgct gctcaacctg cgcgacccgc 2040 cgcgggagca cccctaccgg ggcagcttcg tcaacgtcac gctggaggcc ctgctgcgct 2100 caggcttccc ccagcaccag gtcctgtggc tgcccaacag gcagaggccc tt ggtgcgga 2160 aggtggctcc tggcttccag cagacgtccg gctccaagga ggcagctgcc acccttcgga 2220 aaggccacat ccagggcctg aacctgcgct acacgcaggt gtcccgccag gagctcaggg 2280 actacgcctc ctggaacctg agcgtgaacc tctacacagt caatgccccc tggctcttct 2340 ccctgctgtg gtgcgccggc gtcccctccg tcacctctga caactcccac accctgtcgc 2400 agg tgcctgt ccccctctgg atcatgcccc cagacgaata ctgcctcatg tgggtcaccg 2460 ccgacctgat ctccttcgcc ctcatcgtgg gcatcttcgt gctccagaac tatcacttga 2520 tcaggtggcg cctgggtggc atacgtagct acaaccctga gcagatcatg ctgagcgctg 2580 cggtgcaccg gaccagccgg gacgtcagca tcatgaagga gaagctcatc ttctcagaga 2640 tcagtgacgg catggaggtc tccgacgagc tctctgtgtg ctcagatcac agttacgaca 2700 cgtatgccaa cagcaccact gcccctgtgg ccccccgagg gagtagcagc cgcaccaaga 2760 ccctcacagg ccggggtggg cattagctga agacctgtct gtccagcctg tacctcgcgt 2820 ggagaccagg gaagcccaga gagctag cag gagtgcgctg ggagctggct ccatggcctt 2880 ctcattggct ccagcccctt gtcagccacg gcctctctcg gagggagctc ccttctccag 2940 cctcttgggt acccctgcag gcctggggtg ccttcttctg ggaagtctga ggcctggtcc 3000 tctcctccca tcctga cctg gaagctctga ggggtcaatg ggcgatgccg tgccccatgg 3060 caatgaggga aatgaagcct gagtgcgccc ctgagcgtct gtccttctgt gctgcaaaga 3120 aacgacttcc tgtttctccc acctcaaggg cgttggctga gcctctgccc cagcagctct 3180 gctcacctgt caggtgaaag cgcaaggaag ctcggcccag gaggaacctg ctgcgtggga 3240 agacactcct cctccctggc cagcct ccgc caccattggc cctgccccag gagagggcct 3300 gagccatgtc cccaggagca gctggaggtg gccagaagag cagactcagg gctgctggat 3360 ctcacaccca agtgtccagc aggcctctgg gacaaactgg cctggaggcc caggaggtcc 3420 acagactgac acgacctcag gtttc cacat cagtggccaa gggcaggagc ccccagggaa 3480 gaggttcagg catggtcaag ggtgggcgta cggccagagg cccacagtga agggcgtctg 3540 aggagccttg gccaaggtga ttaaagctgc caccttga 3578 <210> 9 <211> 1451 <212> RNA <213> Artificial Sequence <220> <223> NDUFA10 mRNA <400> 9 ggccgtgacg tcacgacggc gcgacggccg cgg gagagga ccccggcgcg accgcgtccc 60 ctcgggtcct tgagccggcg cagaccgcgg agccatggcc ttgaggctgc tgagactggc 120 ccccgcgtcc gcgtccgcgg tcccgcgggg cctcggggcg gtcgcccagc gcgtgggcgg 180 aatccacacg ggcgccccgt gcaggctgca gtatggccct ctggccttcg tccttgggga 240 aagaacgacc aggaagctga cggaaaccag caaagtgata actgtggacg g caacatatg 300 ttccggaaag ggcaggctgg cgagagaaat agccgagaag ctaggcctga ggcacttccc 360 cgaggccggg atccactacg ccgacagcac caccggcgac gggaagcccc tggacgtaca 420 gctcagcggc aactgcagtt tggagaagtt ctatgacgac ccgaaaagta ac gacggcaa 480 cagctaccgc ctgcagtcct ggctgtacgc cagccgcctc ctgcagtacg cggacgccct 540 ggagcacctg ctgagcacag gacaaggcgt ggtgctggag cgctccatct acagtgactt 600 tgtgttcttg gaggccatgt acagacaggg cttcatccgg aagcagtgcg tggagcacta 660 caacgaggtg aagaaggtca ccgcctgcga gtacctgccc ccgcacgtgg tcgtct acgt 720 ggacgtgccc gtccccgaga tccagagccg catccagaag aagggcaacc cgcacgagat 780 gaagatcacc gccgcctacc tgcaggacat cgagaacgcc tacaagaaga ccttcctgcc 840 tgagatgagc gaaaaaatgtg aggtgttaca gtacagtgcg agggaagccg aagat gcaga 900 aaaggtggtc gaggacatcg agtacctgaa gtgcgacaag ggcccgtggc cggaccagga 960 cgaccgcacc ttccacaggc tgaggatgct ggttcagaat aagctggagg tgctgaatta 1020 cacgaccatt cccgtctatc tcccggaaat caccatcggc gcgcaccaga gcgaccgggt 1080 cttccagaaa ttcacagagc tgccaggccg caagtacagc ccgggctaca acgaggacgt 1140 gg gggacaag tgg atctggc tgaagtgacc ggtgcctccg acccagctgc ccgaggacga 1200 cactgccccc cggccacccc gctcccctgg gctccctctg gcttagaagc agcggggtgg 1260 gggcagagca cgcggtgcgg ggggcgcctt ctggccttgt gggggcgctc agtgcttggc 1 320 tcgggggaag agtcgccccg gagagcgagt gtcacgggag cgttgcattt ctgcacagcg 1380 cgcgccaccc gcggcaggcg acttgggcgg gctttcttca gacgtcgaga aataaaaccg 1440 ttcctctggc a 1451 <210> 10 <211> 3040 <212> RNA <213> Artificial Sequence <220> <223> EBF3 mRNA <400> 10 cggccagggc agccgcctgc cgccgagccc cgagcgccgc tgctcgcgga agcgctgtcg 60 gccgggagct gcggccgccg ccaccagttt tcatgtttgg gattcaggag aatattccgc 120 gcggggggac gaccatgaag gaggagccgc tgggcagcgg catgaacccg gtgcgctcgt 180 ggatgcacac ggcgggggtg gtggacgcca acacggccgc ccagagcggc gtggggctgg 240 cgcgggcgca cttcgagaag cagccgcctt ccaacctccg gaaatccaat t tcttccact 300 tcgtgctggc gctctacgac aggcaggggc agccggtgga gattgaaagg accgcttttg 360 tggactttgt ggagaaagag aaagagccca acaacgagaa aaccaacaac ggcatccact 420 ataaactcca gctgctgtac agcaacggag tcagaacgga gcaggatctg tatg ttcggc 480 tcatagattc aatgaccaaa caggccatcg tctacgaggg ccagggacaag aacccggaga 540 tgtgccgcgt gctgctgacc cacgagatca tgtgcagccg gtgctgtgac aagaagagtt 600 gtggcaatag aaatgaaaca ccctcagacc ctgtgatcat tgacagatc tttctaaagt 660 ttttcctcaa gtgcaatcag aactgtttga agaatgcagg caaccctcgg gacatgcgga 72 0 gattccaggt tgtcgtctcg acaacggtca acgtggacgg ccacgtgctg gccgtgtccg 780 acaacatgtt tgtacacaac aactccaaac acgggcggcg ggcccgccgc ctggacccgt 840 cagaaggtac ggccccttct tatctggaca atgccacccc gtgcatcaag gccatcagtc 900 ccagcgaagg ctggaccacg ggcggagcaa ctgtgatcat cattggcgac aacttctttg 960 acgggctcca ggttgtgttc gggacgatgc tggtgtggag cgagctgata actccgcacg 1020 ccatccgcgt ccagaccccg ccaaggcaca ttcctggagt ggtcgaagtc accctctcct 1080 ataaatccaa gcagttctgt aaaggcgctc cagggcggtt tgtctacacc gcccttaatg 1140 aaccaacca t agattacggc tttcagaggt tgcagaaagt gatcccaaga catccgggtg 1200 atcccgaaag gttacccaag gaagtgttac ttaagagggc agcggacctg gtggaggcct 1260 tgtacgggat gccccacaac aaccaggaga tcatcctgaa gcgagcggcc gacatcgcgg 1320 aggc gttgta cagcgtccct cgcaaccaca accagatccc cgccctgggc aacactcccg 1380 cgcacacggg catgatgggc gtgaactcct tcagcagcca gctagccgtc aacgtctcag 1440 agacgtcaca agccaacgac caagtcggct acagtcgcaa tacaagcagc gtgtccccgc 1500 gaggctacgt ccccagcagc actccccagc agtccaatta caacacagtc agcactagca 1560 tgaatggata tggaagt ggc gccatggcca atctaggggt cccgggctcg cctggatttc 1620 ttaatggctc ctccgctaac tctccctacg gcatagtgcc gtccagcccc accatggcag 1680 cctcttcggt caccctccct tcaaactgta gcagtacaca cggcattttc tcattctcac 1740 ctgccaatgt cat ctctgca gtgaaacaaa agagcgcctt cgcgcccgtg gtccggcccc 1800 aagcctcccc tcctccttcc tgcaccagcg ccaatgggaa cggactgcaa ggctctctgc 1860 tgggtgctga ggacgctacc gtggagaaga caaactggcc cttttgtgaa gtcggtggca 1920 tatttcactt tgatgaacta atgctcaaaa aaggaactgg aaaggtatca gtgatttgca 1980 ataattgtct gcacaacacc tgttagccca tga gagggac gcccagcccc gaggggccgc 2040 cgactggcct gggagccggc agcggtcacc agaccacagt tgcttcagcg gcagggggcc 2100 aggtgccacg gccctgcccg ccgtccgtcc gtccatccgt ccgtccacgc ggtgccgagg 2160 cccgttgcga gtc ggcgccg tgtgtacaca acaggtctcc caaaccataa cgttgtaacg 2220 gtgagtcgga ggtaaattaa tattgttgca attaatgacc tgagaaattg aagctcccgt 2280 cacgacatga acagacgtat taatgctcat acataaatta atgagctcca ccactctgac 2340 caaagttaaa caacacgaaa gttaagagat tttaaattgc atttgcacca ggagttcact 2400 gggaagctct gccgcccttg gcatttgagt gcaagtttcc tgcttgcttc cgagaaggga 2460 cacgctccct aaggtggagc tgtggctcgt gtctctgcgg ggccctgggc cctgagcttg 2520 caaaccaggt gggctgtgag tggctttgac cttggcgagc ccgcgactca ccattacgat 2580 acagagcgaa tggcaggagg gccagggcca gggct gagag cagaggggaa accaggcatg 2640 tccagtttga ccgagggggc ccgagcggtg cccgggtgcc cctggcccga gagccggcct 2700 tggctggtgt cacggaagtg accgggttgg ttcacgtctg tcgacggagg tggcctctag 2760 ggagtctggg cctccgcctg ctctgagcca gccaccgaga ggtgcgggca gtggcccctg 2820 cgcacacaaa aggccagcag cctttccctc ggccccgt ga ggcctctgag gagggccgcc 2880 gtaggagagg actcgggggg ctgtccccac aggcaccccc gtcccatgca gtaggtgccc 2940 ttgaccgagc ccacggctgg tcagcggaga acactgttga ccgaagccca gggaggccgg 3000 cccgccgcgg tgagaggcac ccctgacctg ccccc ctctc 3040 <210> 11 <211> 2313 < 212> RNA <213> Artificial Sequence <220> <223> ELN mRNA <400> 11 atggcgggtc tgacagctgc agccctgcgg cccggagtcc tcctgctcct gctgtccatc 60 atccacccct cgcagcctgg aggggtccca ggggctgttc ctgggggagt tcccggaggc 1 20 gtctttttcc caggggctgg tctcggaggc ctgggaggag gagcactggg ccctggaggc 180 aagccaccca agccaggtgt cggagggctc gcaggcgctg gccttggggc agggctcggg 240 gcctttcctg caggcgcctt cccaggggct ctggtgcccg gcggcgtggc tgacgcggcc 300 gcagcctata aagctgctgc caaggctggt gccgggcttg gcggcg ttgg tggtgtcggc 360 ggcttaggag tgtctacagg tgcagtggta cctcaactcg gagcaggagt tggagctggc 420 gcgaagccag ggaaagtacc aggtgtgggg ctcccaggtg tctaccctgg tggagtgctc 480 ccgggcacag gagctcggtt cccaggtgta ggggtgct cc ctggcgttcc cactggaaca 540 ggagtcaagg ccaaggcccc aggtggaggt ggagcttttg ctggaatccc aggagttgga 600 ccctttggag gtcagcagcc tggagtcccc ctagggtacc ccatcaaggc acccaagctg 660 ccaggtggct acggactgcc ctacagcact gggaaactgc cctacggctt tgggcctgga 720 ggagtggctg gcgccgcggg caaggctggg tacccaacgg ggacgggggt tggtacacaa 780 gccgcag cag cagcagcagc agctaaagca gcagctaaat atggtgcccc gggagccggc 840 gttctccctg gcgtcggcgt cggaggtgtc ggcgttcctg gcggggccgg cgcgattcct 900 ggcatcggag gcattgcagg ggccggagct ccagctgcag cggctgctgc tgcaaaggc g 960 gccaaatacg gagctgccgg aggcttagtg cctggtgcgc caggcttcgg cccaggagtt 1020 ggagtccccg gtgtaggcgt gcctggtgtt ggagtcccag gtgttggcgt gccaggcgtt 1080 ggggtcccag gtgttggcgt gccaggtgtt ggggtcccag gtgttggcgt gccaggcgtt 1140 ggggtcccag gtgttggagt gccaggtgtt ggggtcccag gggccg tgtc tccagctgca 1200 gctgctaaag cagcagccaa ggcagccaag tacggggcca gaggtggtgt gggagttggc 1260 ggcattccca ctttcggagt gggtgccggg ggctttcctg gctttggtgt cggagtcgga 1320 ggtgttcctg gagctgccct ttcc cctgca gctcaggcag ccgccgctgc caaggcagcc 1380 aagctcggtg ctgcaggagc aggagccctg ggtgggctgg tgccaggtgc cgaaggagca 1440 gtaccaggtg tgcccggtgc tggagcagtg ccaggggtag gagccccagc agctgcagcc 1500 gccaaagcag ccgccaaagc cgcccagttc ggcttaggcc ctggcattgg tgtggctccc 1560 ggcgtcggtg tggctcccgg cgtcggtgtg gctcccggcg tcggtgtggc tcccggcgtc 1620 ggtgt ggctc ccggcattgg cattggccct ggcggtgtta taggagcagg ggccccggct 1680 gcagccaaat ctgctgctaa ggcagccgcc aaagcccagt tccaggctgc tgctgggctt 1740 cctgccggcg ttcccggatt tggagttggt gccggcgttc ctggatttgg agttggtgct 1800 ggtgttcctg gctttggggc aggtgcagta cctggacccc tggccgcagc taaagcagcc 1860 aaatatgggg cggccggggc ccttggaggg gttggagatc ttggcggagc tggtatccca 1920 ggtggtgtgg caggagtcgg acctgctgcc gccaaagccg ctgccaaagc tgcccagttt 1980 ggcgtcgggg gagtcggagg actgggagtt gggggccttg gagctgttcc aggggctgga 2040 gcctttggag gtgtgtcccc ggctgccgct gctaaagcag ccaaatatgg tgccgctggc 2100 ctcggaggtg tcctaggagt caccaggcca ttcccacttg gaggagtcgc accaaggcct 2160 ggctttggac tgtctcctat tttcccaggt ggcggcgctg ggggcctggg aattggtggc 2220 aaac ctccca agcccttcgg aggggccctg ggagccctgg gataccaagg tggggcctgc 2280 ctggggaaat cctgtggccg gaagagaaag tga 2313 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> UGT8 F primer <400> 12 acacaaggtg caagtggcat gaag 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> UGT8 R primer <400> 13 acatgagcct ctgtgagctg gatt 24 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UBE2L6 F primer <400> 14 acatcgcgcc atctcatcat 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> UBE2L6 R primer <400> 15 gcaggatacc aaaggccagt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MELK F primer <400> 16 aaaccgccct acaacctcag 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MELK R primer <400> 17 agggcttcca gttctcgttg 20 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ZGRF1 F primer <400> 18 gccctcagag tccacatcct t 21 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ZGRF1 R primer <400> 19 cggaacacaa ctcgggtctc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NCALD F primer <400> 20 gtagatgctt ttcagggcgc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NCALD R primer <400> 21 tccttcctct ggtcaatgca 20 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FHL2 F primer <400> 22 tggtttctgt cttgcttgca g 21 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FHL2 R primer <400> 23 gtgcgcacat gcaagagatt 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SERP2 F primer <400> 24 aatgaagggt tggtgtcagg 20 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SERP2 R primer <400> 25 cgggtattgg cttgatgtg 19 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GDPD5 F primer <400> 26 accatctcct ctccctgcat 20 < 210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GDPD5 R primer <400> 27 caggcgccac ttctggag 18 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence < 220> <223> NDUFA10 F primer <400> 28 gtgggggaca agtggatctg 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NDUFA10 R primer <400> 29 ctgtgcagaa atgcaacgct 20 <210 > 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EBF3 F primer <400> 30 agatcatcct gaagcgagcg 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220 > <223> EBF3 R primer <400> 31 gtagccgact tatcacgcca 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ELN F primer <400> 32 tcctattttc ccaggtggcg 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ELN R primer<400> 33 ctcttccggc cacaggattt 20

Claims (9)

UGT8 gene represented by SEQ ID NO: 1; UBE2L6 gene represented by SEQ ID NO: 2; MELK gene represented by SEQ ID NO: 3; ZGRF1 gene represented by SEQ ID NO: 4; NCALD gene represented by SEQ ID NO: 5; FHL2 gene represented by SEQ ID NO: 6; SERP2 gene represented by SEQ ID NO: 7; GDPD5 gene represented by SEQ ID NO: 8; NDUFA10 gene represented by SEQ ID NO: 9; EBF3 gene represented by SEQ ID NO: 10; and an ELN gene shown in SEQ ID NO: 11.
According to paragraph 1,
A biomarker composition for determining pig meat, characterized in that the pig is a crossbreed produced by crossing Korean Native Pig, Landrace and Duroc breeds.
A composition for determining pork meat from poor quality pigs, characterized in that it contains an agent that amplifies one or more genes in the biomarker composition of claim 1.
According to paragraph 3,
The agent for amplifying the gene is characterized in that at least one selected from the group consisting of primers and probes that specifically bind to the gene.
According to paragraph 4,
The primers include a primer pair that specifically binds to the UGT8 gene shown in SEQ ID NOs: 12 and 13, a primer pair that specifically binds to the UBE2L6 gene shown in SEQ ID NOS: 14 and 15, and MELK shown in SEQ ID NOs: 16 and 17. A primer pair that specifically binds to a gene, a primer pair that specifically binds to the ZGRF1 gene shown in SEQ ID NOs: 18 and 19, a primer pair that specifically binds to the NCALD gene shown in SEQ ID NOS: 20 and 21, SEQ ID NO: A composition for determining lean pork pork, comprising a primer pair that specifically binds to the FHL2 gene represented by SEQ ID NOs. 22 and 23, and a primer pair that specifically binds to the SERP2 gene represented by SEQ ID NOs. 24 and 25. .
According to clause 4,
The primers include a primer pair that specifically binds to the GDPD5 gene shown in SEQ ID NOs: 26 and 27, a primer pair that specifically binds to the NDUFA10 gene shown in SEQ ID NOS: 28 and 29, and EBF3 shown in SEQ ID NOs: 30 and 31. A composition for discriminating indigestible pig meat, characterized in that it further comprises a primer pair that specifically binds to the gene, and a primer pair that specifically binds to the ELN gene shown in SEQ ID NOs: 32 and 33.
1) isolating total RNA from the loin tissue of naive pork;
2) measuring the amount of RNA of step 1) using a composition containing an agent that amplifies one or more genes in the biomarker composition of claim 1; and
3) A method for determining the level of expression of unsalted pig meat by comparing the amount of RNA in step 2) with that of other breeds.
According to clause 7,
In step 3), if the gene expression level increases compared to other breeds, it is determined that the pork is from unskilled pork.
UGT8 gene represented by SEQ ID NO: 1; UBE2L6 gene represented by SEQ ID NO: 2; MELK gene represented by SEQ ID NO: 3; ZGRF1 gene represented by SEQ ID NO: 4; NCALD gene represented by SEQ ID NO: 5; FHL2 gene represented by SEQ ID NO: 6; SERP2 gene represented by SEQ ID NO: 7; GDPD5 gene represented by SEQ ID NO: 8; NDUFA10 gene represented by SEQ ID NO: 9; EBF3 gene represented by SEQ ID NO: 10; And a biomarker composition for determining pig meat from poorly stocked pigs, characterized in that it contains the ELN gene shown in SEQ ID NO: 11, or a composition for determining pork meat from poorly stocked pork containing an agent that amplifies one or more genes in the biomarker composition. A kit for determining uncooked pork meat, characterized in that it contains a composition.