KR20140085170A - Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27 - Google Patents

Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27 Download PDF

Info

Publication number
KR20140085170A
KR20140085170A KR1020120155445A KR20120155445A KR20140085170A KR 20140085170 A KR20140085170 A KR 20140085170A KR 1020120155445 A KR1020120155445 A KR 1020120155445A KR 20120155445 A KR20120155445 A KR 20120155445A KR 20140085170 A KR20140085170 A KR 20140085170A
Authority
KR
South Korea
Prior art keywords
tnmd
dusp27
gene
intramuscular fat
hanwoo
Prior art date
Application number
KR1020120155445A
Other languages
Korean (ko)
Other versions
KR101472025B1 (en
Inventor
이현정
이경태
장길원
김형철
장선식
조영무
장미
백광수
윤호백
손준규
Original Assignee
대한민국(농촌진흥청장)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국(농촌진흥청장) filed Critical 대한민국(농촌진흥청장)
Priority to KR1020120155445A priority Critical patent/KR101472025B1/en
Publication of KR20140085170A publication Critical patent/KR20140085170A/en
Application granted granted Critical
Publication of KR101472025B1 publication Critical patent/KR101472025B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00Nucleic acid detection characterised by assay method
    • C12Q2561/113Real time assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a kit for detecting intramuscular fat tissue of Korean native cattle using TNMD and DUSP27 which are specific expression genes for intramuscular fat tissue of the Korean native cattle and a detection method using the same and, more specifically, to a kit which can detect intramuscular fat tissue of the Korean native cattle by investigating expression amount of TNMD and DUSP27 genes in a subject, and to a detection method using the same. According to the present invention, commercialization of the kit for detecting intramuscular fat tissue of the Korean native cattle can be possible; production of high quality beef can be possible by inducing specific fat accumulation within longissimus muscle of the Korean native cattle; development of body composition control technique can be possible through fat content control of the Korean native cattle; and body fat control information through the same can be applied to other domestic animal species.

Description

한우의 근내지방조직 특이적 발현 유전자 TNMD 및 DUSP27을 이용한 한우의 근내지방조직 검출용 키트 및 이를 이용한 검출 방법{Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27}TECHNICAL FIELD The present invention relates to a kits for detecting intramuscular fat tissue of Korean beef cattle using TNMD and DUSP27 gene expressing intramuscular fat tissue of a Korean beef cattle and a method of detecting the intramuscular fat tissue using Hanwoo using TNMD and DUSP27,

한우의 근내지방조직 특이적 발현 유전자 TNMD 및 DUSP27을 이용한 한우의 근내지방조직 검출용 키트 및 이를 이용한 검출 방법에 관한 기술로서, 보다 상세하게는 피검체에서 TNMD 및 DUSP27 유전자의 발현량을 조사하여 한우의 근내지방조직을 검출할 수 있는 키트 및 이를 이용한 검출 방법에 관한 것이다.
The present invention relates to a kit for detecting intramuscular fat tissue of Korean beef cattle using the TNMD and DUSP27 gene expressing intramuscular fat tissue of Korean beef cattle and a method of detecting the same using TNMD and DUSP27 gene, And a detection method using the kit.

한우에서 복부, 피하, 등 불가식 지방의 함량을 감소시키고 등심 내 근내지방과 같은 가식지방의 함량을 증가시켜(하이 마아블링) 고품질 한우고기 생산을 유도하기 위한 연구가 활발히 진행되고 있다. 이의 일환으로 근내지방조직 특이적 차별발현 유전자 발굴을 통해 한우에서 지방조직 부위별 지방의 축적을 조절하기 위한 원천 소재 확보 및 이를 검출하기 위한 관련 기술이 요구되고 있다.Studies have been actively carried out to induce the production of high quality Hanwoo meat by reducing the content of abdominal, subcutaneous, and non-digestible fats in Hanwoo and increasing the content of edible fats such as intramuscular fat in sirloin (Hi Maabing). As a part of this, there is a demand for securing source materials for controlling the accumulation of fat in fat tissues in Korean beef cattle through the digestion of genes expressing differentially expressed adipose tissues and related technologies for detecting them.

유전적으로 우수한 형질을 가지고 있는 가축을 정확히 선발하기 위한 보조적 수단으로 개체의 DNA 정보를 이용하기 위한 많은 연구가 진행되고 있으며, 이를 한우 개량에도 적용하는 연구는 필요하다.Many studies have been carried out to utilize DNA information of individuals as an auxiliary means for accurately selecting livestock with genetically superior traits.

한우의 개량은 당대검정과 후대검정을 병행하여 보증씨수소를 선발하고 있는데, 당대 검정에서 개체의 성장능력을 평가하여 후보씨수소를 선발하고, 이 개체들의 자손들, 즉 거세우들의 성장과 도체성적을 검정하여, 후보씨수소들 중에서 보증씨수소를 선발하는 이원 검정체제가 수행되고 있다. 그러나, 당대검정시 개체의 유전능력을 평가하는 형질은 주로 성장만 평가할 뿐 육질 자료 측정이 불가능하여, 부모의 육종가에 근거하여 평가하기 때문에 해당 개체의 육질에 대한 정확한 평가가 어려운 실정이다. 따라서, 육질의 유전적 능력을 추정할 수 있는 유전자 마커를 적용하여 당대검정시에 선발한다면 한우개량의 속도와 정확성을 높일 수 있게 될 것이다. 최근 한미 FTA 협상 타결 이후 값싼 미국산 쇠고기 수입개방에 따른 한우고기의 육량증가 및 육질고급화가 매우 중요한 과제이다. 특히, 수입쇠고기와 품질 차별화 및 경쟁력 향상을 위하여, 고급육 한우육 생산을 위한 첨단 과학기술의 활용을 포함한 다각적인 방안이 모색되어야한다. 한우육의 도체가격은 육량 및 육질의 등급으로 평가하는데 육량은 도체중, 등지방두께, 및 배장근 단면적에 근거하여 등급을 판정하고 육질은 근내지방도, 육색, 지방색, 조직감 및 성숙도 등으로 판정한다(축산물등급판정소, 2004). 근내지방도는 쇠고기의 관능적 특성의 기준이 되는 연도, 다즙성 및 풍미 등과 깊이 관련되어 있어 고급육 생산을 위해서는 근내지방 함량을 높이는 것이 매우 중요하다고 할 수 있다. DNA 수준에서의 한우의 경제적 능력에 대한 유전적 정보는 생산자뿐만 아니라 육종가들에게 우수 한우개체를 조기 선발하는데 중요한 정보를 제공해준다. 이러한 DNA 정보는 육량 및 육질에 대하여 마커도움선발(marker-assisted selection, MAS) 방법을 적용하여 선발의 정확도를 높이고, 후대검정에 소요되는 적지 않은 경비와 시간(세대간격)을 절약하여 개량의 효율성을 높일 것으로 기대된다.The improvement of Korean beef cattle was selected by combining the current surveillance and the later surveys. In this test, the growth ability of the individual was assessed, and the candidate sows were selected. The growth and conductance of the offspring, , And a two - way test system is being conducted to select certified sushi from candidates. However, in the present test, the trait to evaluate the hereditary ability of an individual is mainly assessed only for growth, but the meat quality data can not be measured. Therefore, it is difficult to accurately evaluate the meat quality of the subject because it is evaluated based on the breeding value of the parents. Therefore, applying genetic markers which can estimate the genetic ability of meat quality will improve the speed and accuracy of Hanwoo supplementation if selected at the time of the test. Since the recent Korea-US Free Trade Agreement (FTA) has been concluded, it is very important to increase the meat weight and quality of Korean beef meat following the opening of cheap US beef imports. Especially, to diversify the quality of imported beef and improve its competitiveness, diverse measures should be sought including the use of advanced science and technology for the production of high quality meat. The carcass price of Hanwoo meat is evaluated by the grade of meat and meat quality. The meat quality is judged on the basis of the carcass, the thickness of the backfat, and the cross sectional area of the carcass, and meat quality is judged by the degree of muscle fat, meat color, local color, texture and maturity Livestock Classification Office, 2004). The degree of intramuscular fat is closely related to the year, juiciness and flavor, which are the criteria of sensory characteristics of beef, so it is very important to increase intramuscular fat content for high quality meat production. Genetic information on the economic performance of Hanwoo at the DNA level provides important information to early breeders as well as producers to select the best Hanwoo. Such DNA information can be used to improve the accuracy of selection by applying marker-assisted selection (MAS) method for meat and meat quality, saving the less expense and time (generation interval) .

본 발명과 관련된 선행기술로는 한국 공개특허 2012-0011728이 있다.
A prior art related to the present invention is Korean Patent Publication No. 2012-0011728.

상기와 같은 기술적 배경하에서 본 발명자들은 예의 노력한 결과 본 발명을 완성하기에 이르렀다.Under the above-mentioned technical background, the present inventors have made intensive efforts to complete the present invention.

본 발명의 목적은 한우의 근내지방조직 특이적 발현 유전자 TNMD 및 DUSP27을 이용한 한우의 근내지방조직 검출용 키트를 제공하는 것이다.It is an object of the present invention to provide a kit for the detection of intramuscular fat tissue of Korean beef cattle using TNMD and DUSP27 gene expressing intramuscular fat tissue of Korean cattle.

본 발명의 목적은 한우의 근내지방조직 특이적 발현 유전자 TNMD 및 DUSP27을 이용한 한우의 근내지방조직 검출 방법을 제공하는 것이다.
It is an object of the present invention to provide a method for detecting intramuscular fat tissue of Korean beef cattle using TNMD and DUSP27 gene expressing intramuscular fat tissue of Korean cattle.

본 발명의 일 측면에 따르면, 서열번호 1 내지 2의 염기서열을 갖는 프라이머 세트 및 서열번호 3 내지 4의 염기서열을 갖는 프라이머 세트를 포함하는 한우의 근내지방조직 검출용 키트가 제공될 수 있다.According to one aspect of the present invention, there can be provided a kits for detecting intramuscular fat tissue of a Hanwoo including a primer set having the nucleotide sequences of SEQ ID NOS: 1-2 and a primer set having the nucleotide sequences of SEQ ID NOS: 3-4.

본 발명의 다른 측면에 따르면,According to another aspect of the present invention,

(a) 한우에서 조직을 추출하여 준비하는 단계;(a) extracting and preparing tissues from Hanwoo;

(b) 제1항의 키트를 이용하여, 한우에서 추출된 조직에 존재하는 DUSP27 및 TNMD 유전자 중 적어도 하나의 전사체의 양을 증폭시키는 단계;(b) amplifying the amount of the transcript of at least one of the DUSP27 and TNMD genes present in the tissue extracted from the Hanwoo using the kit of claim 1;

(c) 상기 증폭된 전사체를 정량하는 단계; 및(c) quantifying the amplified transcript; And

(d) 상기 정량된 전사체를 대조구의 발현량과 비교하여 분석하는 단계;(d) comparing the quantified transcript with an amount of the control;

를 포함하는 한우의 근내지방조직 검출 방법이 제공될 수 있다.A method for detecting intramuscular fat tissue of a Hanwoo can be provided.

일 실시예에 따르면, 상기 전사체의 양을 증폭시키는 단계는 실시간 중합효소 연쇄반응(Real time PCR)을 통해 수행될 수 있다.According to one embodiment, the step of amplifying the amount of the transcript may be carried out by real-time PCR.

일 실시예에 따르면, 상기 대조구는 ACTB 유전자 또는 GAPDH 유전자일 수 있다.
According to one embodiment, the control may be an ACTB gene or a GAPDH gene.

본 발명에 따르면 근내지방 특이 유전자 검출용 키트의 상품화가 가능하고, 한우에서 등심근 내 특이적 지방축적 유도를 통한 고급육의 생산 및 한우의 지방의 함량조절을 통한 체조성 조절 기술의 개발이 가능하며, 이를 통한 체지방 조절 정보를 다른 축종에 적용할 수 있다.
According to the present invention, it is possible to commercialize a kit for detecting an intramuscular fat-specific gene, to produce high-quality meat through induction of specific fat accumulation in the rosacea of a Korean beef cattle, and to develop a technique of controlling body composition through controlling the fat content of Korean beef cattle, The information on body fat regulation through this can be applied to the other species.

도 1은 본 발명의 서열번호 1 내지 4의 프라이머를 이용하여 증폭된 TNMD와 DUSP27의 RT-PCR 결과를 나타낸다.
도 2는 상기 TNMD 유전자에 대한 그레디언트 PCR 결과를 나타낸다.
도 3은 상기 TNMD와 DUSP27 유전자에 대한 조직별 정량적 발현 양상 분석결과이다.
Figure 1 shows RT-PCR results of TNMD and DUSP27 amplified using the primers of SEQ ID NOS: 1 to 4 of the present invention.
Figure 2 shows the gradient PCR results for the TNMD gene.
FIG. 3 shows the results of quantitative expression analysis of the TNMD and DUSP27 genes by tissue.

이하, 본 발명을 보다 상세하게 설명한다.Hereinafter, the present invention will be described in more detail.

본 발명에서 용어 “프라이머”란 상보적인 템플레이트와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다.As used herein, the term " primer " refers to a short nucleic acid sequence that can form a base pair with a complementary template and serves as a starting point for template strand copying.

본 발명에 기재된 유전자의 발현량은 해당 유전자의 게놈 DNA가 mRNA로 전사(transcription)된 양을 의미한다.
The expression amount of the gene described in the present invention means the amount of transcription of the genomic DNA of the gene into mRNA.

본 발명에서는 TNMD와 DUSP27 유전자에 대한 조직별 정량적 발현 양상을 분석하고 그 결과를 검증하여 이들 유전자의 발현량을 근내지방조직의 판별에 사용하고자 하는 것이다.In the present invention, quantitative expression patterns of TNMD and DUSP27 in tissues are analyzed, and the results are verified and the expression levels of these genes are used for discrimination of adipose tissue.

이를 위해, 우선 RNA 시퀀싱 방법을 사용하여 한우의 피하, 복부, 근내지방조직에서 부위 특이적으로 발현량 차이를 보여 주는 유전자들을 발굴 (FDR<0.01)하였다.For this purpose, genes that show site specific differences in the subcutaneous, abdominal, and intramuscular fat tissues of Korean cattle were identified (FDR <0.01) using RNA sequencing method.

상기 RNA 시퀀싱은 RNA의 염기배열을 결정하는 화학적 방법이다. tRNA나 5S RNA처럼 저분자인 동시에 분자 중에 수식뉴클레오티드를 많이 포함하는 RNA의 염기순서결정에는, 2차원 박층크로마토그래피를 병용한 포름아미드분해법을 사용하는 것이 최적이다. mRNA나 rRNA 같은 고분자 RNA의 경우에는, 먼저 말단영역의 염기순서를 다양한 리보핵산가수분해효소를 사용해 시행하는 도니스-켈러(Donis-Keller)법이나, 화학적으로 RNA를 분해하여 시행하는 피아티(Peattie)법 등을 사용하여 결정한다. 이어 그 순서를 토대로 제작한 올리고 뉴클레오티드 시발체를 사용하여 역전사 PCR을 시행하고, 목적으로 하는 RNA를 DNA로 치환한 후에 그 순서를 맥삼-길버트(Maxam-Gilbert)방법이나 생어(Sanger)법 등을 사용하여 결정한다.The RNA sequencing is a chemical method for determining the base sequence of RNA. For the sequencing of RNAs, such as tRNA and 5S RNA, which are low in molecular weight and contain a large number of modified nucleotides in the molecule, it is best to use the two-dimensional thin layer chromatography combined formamide degradation method. In the case of polymer RNA such as mRNA or rRNA, the Donis-Keller method in which the nucleotide sequence of the terminal region is first carried out using various ribonucleic acid hydrolases, or the method of chemically decomposing RNA, Peattie method). Next, reverse transcription PCR was performed using an oligonucleotide primer based on the sequence, and the target RNA was substituted with DNA, and the order was determined using the Maxam-Gilbert method or the Sanger method .

상기 RNA 시퀀싱을 통해 동정된 유전자들 중, 발현량의 차이가 logFC≥2 이상되는 유전자들을 선별하였다. 상기와 같이 선별된 유전자들은 사람이나 다른 동물들에서 지방조직 간의 부위 특이적인 발현차이가 보고되어 있지 않고, 특히 소에서는 관련 연구가 전혀 되어 있지 않은 유전자인 것으로 밝혀졌다.Among the genes identified through RNA sequencing, genes with a difference in expression level of logFC? 2 or more were selected. The above-selected genes have not been reported to have a site-specific difference in expression between adipose tissues in humans or other animals.

상기 선별된 유전자들을 용이하게 검출하기 위하여 각 유전자별로 프라이머를 디자인하였다. 상기 디자인된 프라이머를 이용하여, 상기 선별된 유전자에 대해 RT-PCR을 수행함으로써, 각각의 유전자에 대해 나타나는 발현산물이 근내지방에서 특이적 발현양상을 나타내는지를 확인하였다. 그 결과는 하기 표와 도면에 나타나 있다.
In order to easily detect the selected genes, a primer was designed for each gene. RT-PCR was performed on the selected genes using the designed primers, and it was confirmed whether expression products expressed for each gene showed specific expression patterns in the intramuscular fat. The results are shown in the following table and drawings.

본 발명에서는 상기 디자인된 각각의 프라이머 특성을 적용한 근내지방 특이적 유전자 검출을 위한 프라이머 세트 및 이를 이용한 검출 방법을 제시한다.In the present invention, a set of primers for detecting intramuscular fat-specific genes using each of the designed primer characteristics and a detection method using the same are presented.

본 발명의 일 측면에 따르면, 서열번호 1 내지 2의 염기서열을 갖는 프라이머 세트 및 서열번호 3 내지 4의 염기서열을 갖는 프라이머 세트를 포함하는 한우 근내지방조직 검출용 키트가 제공될 수 있다.According to an aspect of the present invention, there can be provided a kits for detecting Korean adductor muscle fat tissue comprising a primer set having the nucleotide sequences of SEQ ID NOS: 1-2 and a primer set having the nucleotide sequences of SEQ ID NOS: 3-4.

상기 키트는 통상적으로 당업계에 잘 알려진 바와 같이 피검체의 핵산을 증폭할 수 있는 시약 및 조성물을 더 포함할 수 있다. 일반적으로는 피검체의 핵산은 PCR을 통해 증폭되는 것이 일반적이므로, PCR에 사용되는 각종 완충액과 염, 기타 뉴클레오시드 및 중합효소 등이 포함될 수 있다. The kit may further comprise reagents and compositions that are capable of amplifying the nucleic acid of the subject, as is well known in the art. In general, since the nucleic acid of a subject is generally amplified by PCR, it may include various buffers and salts used for PCR, other nucleosides and polymerases, and the like.

일 실시예에 따르면, 상기 키트는 서열번호 1 내지 2, 또는 3 내지 4, 또는 1 내지 4의 프라이머를 갖는 프라이머 세트; Taq DNA 중합효소(polymerase); dNTP; MgCl2; 10 x 반응완충액; ddH2O; 및 DMSO를 포함하는 것일 수 있으며, 추가로 대상 시료인 판별 대상 한우의 전사체를 포함하는 것일 수 있다.According to one embodiment, the kit comprises a primer set having primers of SEQ ID NOS: 1 to 2, or 3 to 4, or 1 to 4; Taq DNA polymerase; dNTP; MgCl 2 ; 10 x reaction buffer; ddH 2 O; And DMSO, and may further include a transcript of the target Hanwoo which is a target sample.

또한, 상기 검출키트는 추가로 PCR을 수행하기 위한 온도 조절 기능이 있는 통상적인 PCR용 기기를 더 포함할 수 있다.
In addition, the detection kit may further include a conventional PCR instrument having a temperature control function for further performing PCR.

본 발명에서 의미하는 유전자의 발현량은 여러 가지 방법을 통해 알 수 있으며, mRNA에 상보적인 올리고 뉴클레오티드를 이용하는 것일 수 있다. 본원발명에서는 DNA 올리고머, 즉 프라이머를 이용하여 리얼 타임 PCR을 수행함으로써 발현량을 검출하는 것을 일 예로 들고 있으나, 노던 블롯, 마이크로 어레이와 같이 프라이머의 단편을 이용하는 방법, 또는 대용량 정보처리기를 이용한 프로그램을 이용한 것일 수도 있다. The expression level of the gene of the present invention can be determined through various methods and may be the use of an oligonucleotide complementary to the mRNA. In the present invention, the expression amount is detected by performing real-time PCR using a DNA oligomer, that is, a primer. However, a method using a fragment of a primer such as a Northern blot, a microarray, or a program using a large- It may be used.

상기 키트에 포함된 프라이머를 이용하여 PCR이 아닌 다른 방법으로 한우의 근내지방조직을 검출하고자 하는 경우에는 그에 맞는 다른 시약을 포함할 수 있다. 핵산물질간의 상보성을 이용한 하이브리드 분석법을 이용하고자 할 경우에는 당업계에 잘 알려진 시약군을 포함할 수 있다.When the intramuscular fat tissue of the Korean native cattle is to be detected by a method other than PCR using the primer contained in the kit, other reagents may be included. When a hybrid assay using complementarity between nucleic acid materials is desired to be used, a group of reagents well known in the art can be included.

또한, 상기 프라이머는 상기 개시된 유전자의 발현량을 알 수 있는 서열정보를 포함하고 있는 것이라면, 뉴클레오티드 핵산에 국한되지 않으며, PNA나 LNA 등도 이용될 수 있다.
In addition, the primer is not limited to the nucleotide nucleic acid, and PNA, LNA and the like may also be used as long as the primer contains sequence information that can be used to determine the expression level of the disclosed gene.

본 발명의 다른 측면에 따르면, (a) 한우에서 조직을 추출하여 준비하는 단계; (b) 제1항의 키트를 이용하여, 한우에서 추출된 조직에 존재하는 DUSP27 및 TNMD 유전자 중 적어도 하나의 전사체의 양을 증폭시키는 단계; (c) 상기 증폭된 전사체를 정량하는 단계; 및 (d) 상기 정량된 전사체를 대조구의 발현량와 비교하여 분석 단계를 포함하는 한우 근내지방조직 검출 방법이 제공될 수 있다.According to another aspect of the present invention, there is provided a method for producing a protein, the method comprising: (a) extracting and preparing tissue from a Hanwoo; (b) amplifying the amount of the transcript of at least one of the DUSP27 and TNMD genes present in the tissue extracted from the Hanwoo using the kit of claim 1; (c) quantifying the amplified transcript; And (d) an analysis step of comparing the quantified transcript with the expression level of the control.

이 때, 상기 (a) 단계에서 한우의 조직을 추출하는 것은, 여러 종류의 조직이 혼합된 상태로 추출하는 것이 아닌, 단일 조직으로 추출되도록 하는 것이 바람직하다. 본 발명의 경우, 근내지방조직, 피하지방조직, 복부지방조직에 대한 판정이 이루어져야 하므로, 이들 조직 간의 혼합이 있을 경우 판정결과에 좋지 않은 영향을 미칠 수 있어 바람직하지 않다.At this time, in the step (a), it is preferable to extract the tissue of the cattle in a single tissue, not in a mixed state of various kinds of tissues. In the case of the present invention, determination of intra-muscular adipose tissue, subcutaneous adipose tissue, and abdominal adipose tissue should be made, and therefore, mixing of these tissues may adversely affect the judgment result.

상기 (a) 단계에서의 '준비'라 함은 자연상태로 얻어진 한우의 조직을 키트에 투입하여 분석하기 용이한 상태로 만드는 것을 의미한다. 이에는 한우 조직의 파쇄, 세포의 용혈, 핵산의 분리, RNA의 보존, 게놈 DNA의 제거, 분석에 필요하지 않은 세포 소기관과 생체물질의 제거 등의 생화학적 처리과정이 포함될 수 있다. 이에는 특별한 제한은 없으며, 당업계에서 일반적으로 사용되는, 조직을 추출하여 RT RCR을 수행할 수 있도록 검증된 프로토콜이면 무방하다.The 'preparation' in the step (a) means that the structure of the Korean beef cattle obtained in a natural state is put into a kit for easy analysis. This may include biochemical processing such as disruption of Hanwoo tissues, hemolysis of cells, separation of nucleic acids, preservation of RNA, removal of genomic DNA, and removal of cell organelles and biomaterials not required for analysis. There is no particular limitation thereon, and it may be a protocol that is commonly used in the art, and is a proven protocol capable of extracting tissues and performing RT RCR.

일 실시예에 따르면, 상기 전사체의 양을 증폭시키는 단계는 실시간 중합효소 연쇄반응(Real time PCR)을 통해 수행될 수 있다.According to one embodiment, the step of amplifying the amount of the transcript may be carried out by real-time PCR.

상기 전사체의 양을 증폭시키는 단계를 통해 증폭된 DNA는 한우의 근내지방조직의 판별에 사용될 수 있다. 그 방법은 여러가지가 있을 수 있는데, 상기 DNA의 크기 및 형광정도를 이용하여 분석하는 것일 수 있으며, 바람직하게는 상기 PAGE(Polyacrylamid Gel Electrophoresis)를 이용하는 방법이나, 상기 자동염기서열분석장치를 이용하는 방법으로 수행할 수 있다. 상기 자동염기서열분석장치를 이용하는 방법은 구체적으로는 ABI PRISM 3130XL Genetic analyzer(Applied Biosystems, Foster City, CA)를 이용하여 수행할 수 있으며, 상기 ABI PRISM 3130XL Genetic analyzer를 사용하는 경우에는 상기 프라이머의 5' 부위에 존재하는 첫 번째 염기에 형광물질(fluorescein)의 최대 흡광도 범위에서의 형광정도 및 DNA의 크기를 이용하여 분석할 수 있다.The DNA amplified through amplifying the amount of the transcript may be used for discrimination of intramuscular fat tissue of Hanwoo. The DNA may be analyzed by using the size and the degree of fluorescence of the DNA. Preferably, the method may be a method using PAGE (polyacrylamide gel electrophoresis) or a method using the automatic base sequence analyzer Can be performed. The ABI PRISM 3130XL Genetic Analyzer (Applied Biosystems, Foster City, Calif.) Can be used to perform the above-described method using the ABI PRISM 3130XL Genetic Analyzer. The fluorescence intensity of the first base present in the region of fluorescence and the size of the DNA in the maximum absorbance range of the fluorescence can be analyzed.

일 실시예에 따르면, 상기 대조구는 ACTB 유전자 또는 GAPDH 유전자일 수 있다.According to one embodiment, the control may be an ACTB gene or a GAPDH gene.

이 때, 상기 ACTB 유전자 또는 GAPDH 유전자의 발현량을 검출하기 위한 프라이머 등의 재료는 상기 키트에 포함될 수 있다.In this case, a material such as a primer for detecting the expression level of the ACTB gene or the GAPDH gene may be included in the kit.

하기 실시예의 데이터를 통해 잘 나타나 있지만, 본 발명에서 마커로 사용하는 TNMD 및 DUSP27 유전자의 발현량은 근내지방조직에서 유의적으로 높다. 이들 대조구의 발현량은 상기 피검출 유전자의 발현량을 보정하거나, 비교하는데 사용될 수 있다. 예를 들면, 상기 피검출 유전자의 발현량이 상기 대조구의 발현량에 비해 높을 경우, 피검출 유전자의 발현량을 '과발현'으로 판정할 수 있다.In the present invention, the expression levels of TNMD and DUSP27 genes used as markers are significantly higher in intramuscular adipose tissues than those of the present invention. The expression level of these control can be used to correct or compare the expression level of the gene to be detected. For example, when the expression level of the gene to be detected is higher than the expression level of the control, the expression level of the gene to be detected may be determined to be 'overexpression'.

또한, 상기 피검출 유전자의 발현량이 각각의 조직별로 다르게 나타나는 경우, 이들의 상이한 발현량을 상기 대조구의 발현량으로 보정(Normalize)함으로써, 실험상 발생하는 내재된 오차를 줄일 수 있다. 본 발명의 실시예에도 나타나 있는 바와 같이, 상기 TNMD 및 DUSP27 유전자의 발현량은 피하지방조직 및 복부지방조직에 비해 근내지방조직에서 유의적으로 높으므로, 이를 이용하여 피검체 조직이 근내지방조직인지의 여부를 판정할 수 있다.In addition, when the amount of expression of the gene to be detected appears different for each tissue, the different expression amounts thereof can be normalized to the expression amount of the control, thereby reducing the inherent errors in experiments. As shown in the examples of the present invention, the expression levels of TNMD and DUSP27 genes are significantly higher in subcutaneous adipose tissue and abdominal adipose tissue than in subcutaneous adipose tissue and abdominal adipose tissue. Therefore, Or not.

또한, 이들의 발현량의 비를 조사함으로써, 보다 우수한 형질을 갖는 한우 개체의 발현량의 비를 데이터로 축적할 수도 있다. 이 데이터를 활용할 경우, 근내지방함량이 우수한 한우 개체를 현장에서 용이하게 판정할 수도 있다. Furthermore, by examining the ratio of these expression amounts, it is possible to accumulate the ratio of expression amount of Hanwoo individuals having better traits as data. When this data is utilized, it is possible to easily judge the Hanwoo which is excellent in muscle fat content in the field.

예를 들면, 우수한 근내지방조직 함량을 갖는 한우 개체들을 조사하여 TNMD 유전자의 발현량과 DUSP23 발현량을 조사하여 이를 데이터베이스화 할 수 있으며, 이를 통해 우수한 근내지방조직을 갖는 개체들의 평균 발현량을 산출할 수 있다. 이후 근내지방조직의 판정이 필요한 피검체의 상기 유전자의 발현량을 조사하여 이들 우수 개체로 부터 산출된 상기 데이터베이스와 비교함으로써, 임의의 한우 개체의 근내지방우수도를 판정할 수 있다.
For example, Hanwoo individuals having excellent intramuscular fat content can be investigated to quantify the amount of expression of TNMD gene and the amount of DUSP23 expression, which can be used as a database to calculate an average expression amount of individuals having excellent intramuscular fat tissue . The intramuscular fat excellence of any Hanwoo can be determined by examining the expression level of the gene of the subject in need of judgment of adipose tissue and comparing it with the database calculated from these excellent individuals.

이하 본 발명의 실시예를 기재한다. 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명이 하기 실시예에 한정되는 것은 아니다.Hereinafter, examples of the present invention will be described. The following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

실험방법Experimental Method

30 개월된 한우 9두로부터 각각 근내, 피하, 복부지방을 분리해 낸 다음, 각각의 지방조직들로부터 RNA를 추출하였다. 추출된 지방의 RNA 들은 cDNA로 전환되어, Illumina HiSeq2000을 사용하여 RNA 시퀀싱 방법을 통해, 각 지방 조직의 유전자 발현 프로필(gene profile)을 생성하였다. 생성된 유전자들의 염기서열들로부터 조직에서 발현된 유전자들의 발현량을 측정할 수 있고, EdgeR을 이용하여 조직 간의 발현량을 서로 비교함으로써, 그 중에서 근내지방조직 특이적으로 발현량의 차이를 보이는 유전자들을 선별하였다.After isolating the intramuscular, subcutaneous, and abdominal fat from 9 - month old Korean noodles, RNA was extracted from each adipose tissue. The extracted fat RNAs were converted into cDNAs, and gene expression profile of each adipose tissue was generated by RNA sequencing method using Illumina HiSeq2000. The expression levels of the genes expressed in the tissues can be measured from the nucleotide sequences of the generated genes and the expression amounts of the tissues are compared with each other using EdgeR, Respectively.

해당 유전자의 발현 여부 확인을 위하여 각각의 유전자별 프라이머를 디자인하였으며 제작된 프라이머를 통한 PCR과정에서의 해당 DNA의 증폭 조건을 온도별 테스트를 통해 결정하였다. 최종적으로 Realtime PCR의 진행을 위한 조건을 gradient PCR을 통하여 확인하였고 이를 바탕으로 최적 조건을 결정하였다In order to confirm the expression of the gene, a primer for each gene was designed and the amplification conditions of the corresponding DNA in the PCR process through the prepared primers were determined through temperature-dependent tests. Finally, conditions for real-time PCR progression were confirmed by gradient PCR and optimal conditions were determined based on this

디자인된 프라이머를 이용한 Realtime-PCR을 통해 해당 유전자의 조직별 발현 양상의 차이를 규명하였다.
Real-time PCR using the designed primers revealed differences in the expression pattern of the corresponding genes.

실험결과Experiment result

한우 근내지방 조직의 부위 특이적 발현 유전자 중 발현이 감소하는 것은 다음 표 1과 같다.The decrease in the expression of site-specific expression genes in the adipose tissue of Hanwoo is shown in Table 1 below.

서열번호SEQ ID NO: 특이조직A specific tissue 유전자gene 발현량Expression level 프라이머 방향
Primer direction
염기서열
Base sequence
1One 근내지방
Intramuscular fat
DUSP27DUSP27 UpUp ForwardForward ggtcaaggaagatgaggatgaggggtcaaggaagatgaggatgagg
22 ReverseReverse cagggaggagaaggtgtctgtttcagggaggagaaggtgtctgttt 33 근내지방Intramuscular fat TNMDTNMD UpUp ForwardForward ctcttattgtcctgttttgggggctcttattgtcctgttttggggg 44 ReverseReverse tcttcttcttctctccattgctgttcttcttcttctctccattgctgt

상기 유전자의 정량적 발현 양상 분석을 위한 Realtime PCR 조건의 RT-PCR 결과가 도 1에 나타나 있다. RT-PCR results of Realtime PCR conditions for quantitative expression analysis of the genes are shown in FIG.

도 1은 해당 유전자의 프라이머에 대한 테스트 결과를 나타낸다. TNMD와 DUSP27 프라이머가 RT-PCR을 통하여 확인되었으며, M은 DNA 마커를 의미한다. Asterik(*, **)은 각각 200bp, 100bp의 크기를 의미한다. PCR 조건은 다음과 같다. 95℃ 5분(1 cycle) ; 95℃ 30초, 58℃ 30초, 72℃ 30초 (40 cycles) ; 72℃ 10분 (1 cycle).Figure 1 shows the test results for the primers of the gene. TNMD and DUSP27 primers were identified by RT-PCR, and M is a DNA marker. Asterik (*, **) means size of 200bp, 100bp respectively. The PCR conditions were as follows. 95 ° C for 5 minutes (1 cycle); 95 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 30 seconds (40 cycles); 72 ° C for 10 minutes (1 cycle).

Tm 계산기(calculator)를 통하여 확인된 각 프라이머의 Tm 값을 바탕으로 RT-PCR을 진행하였다. 전기영동 결과 위와 같은 결과를 확인할 수 있었다. 각 유전자의 프라이머를 통한 증폭 결과 TNMD, CCL2 및 CD136의 경우 해당 조건에서 실시간(real time) PCR을 수행하기에 부적합한 조건임을 판단. 해당 유전자의 최적 조건을 찾기 위해 그레디언트(gradient) PCR을 수행하여 최적의 조건을 확립하였다.RT-PCR was performed based on the Tm value of each primer identified through a Tm calculator. As a result of electrophoresis, the above results were confirmed. The primers of each gene showed that TNMD, CCL2 and CD136 were inadequate to perform real-time PCR under the corresponding conditions. Gradient PCR was performed to find the optimal conditions for the gene and optimal conditions were established.

도 1에는 상기 서열번호 1 및 2에 의한 산물인 DUSP27 유전자의 PCR 산물의 전기영동 사진과, 상기 서열번호 3 및 4에 의한 TNMD 유전자의 PCR 산물의 전기영동 사진이 나타나 있다. 1 shows an electrophoresis photograph of the PCR product of the DUSP27 gene, which is the product of SEQ ID NOs: 1 and 2, and an electrophoresis photograph of the PCR product of the TNMD gene according to SEQ ID NOS: 3 and 4, respectively.

도 2는 그레디언트 PCR 결과를 통해 TNMD 유전자에 대한 상기 프라이머가 56℃의 어닐링 온도에서 PCR 효율이 가장 높음을 나타낸다.Figure 2 shows that the primer against the TNMD gene showed the highest PCR efficiency at an annealing temperature of 56 [deg.] C through a gradient PCR result.

상기 서열번호 1 및 2에 의한 DUSP27 유전자에 대한 실시간(Realtime) PCR 산물의 크기는 133bp이고, 서열번호 3 및 4에 의한 TNMD 유전자 산물의 크기는 105bp이다. 시퀀싱이나 RFRP를 이용할 경우 상기 유전자로부터 증폭된 산물인지의 여부를 보다 정확하게 확인할 수 있다.
The size of the real-time PCR product for the DUSP27 gene according to SEQ ID NOS: 1 and 2 is 133 bp, and the size of the TNMD gene product according to SEQ ID NOS: 3 and 4 is 105 bp. When sequencing or RFRP is used, it can be more accurately confirmed whether or not it is an amplified product from the gene.

하기 표 2 및 표 3은 상기 TNMD와 DUSP27 유전자의 조직별 정량적 발현 양상의 분석결과이다. 이는 실시간(Realtime) PCR을 통하여 확인된 것이다. 레퍼런스(reference) 유전자로는 ACTB와 GAPDH가 이용되었다. 즉, ACTB의 발현양 및 GAPDH의 발현량을 1로 보았을 때의 각 유전자의 상대적 발현양을 계산하여 나타낸 것이다.Tables 2 and 3 below are the results of quantitative expression analysis of the TNMD and DUSP27 genes by tissue. This was confirmed by real-time PCR. ACTB and GAPDH were used as reference genes. That is, the expression level of ACTB and the expression level of GAPDH are shown as 1, and the expression level of each gene is calculated.

상기 각 유전자의 발현량의 차이를 보다 정확하게 산출하기 위하여, 암소 한우 3두, 거세우 3두 및 수소 한우 3두로 부터 피하지방조직, 근내지방조직, 복부지방조직을 추출하여 상기 기재된 프라이머를 이용하여 실시간 PCR을 수행하였다. Subcutaneous adipose tissue, intramuscular adipose tissue and abdominal adipose tissue were extracted from three cows, three cows, three cows, and three cows, respectively, in order to accurately calculate the difference in the expression amounts of the respective genes. Using the primers described above, PCR was performed.

하기 표 2에서 '보정'은 통계학상의 노멀라이즈(Normalize) 처리를 의미한다. In Table 2 below, 'correction' refers to statistical normalize processing.


TNMDTNMD DUSP27DUSP27
ACTB로 보정시 When calibrating with ACTB GAPDH로 보정시When calibrating with GAPDH ACTB로 보정시  When calibrating with ACTB GAPDH로 보정시When calibrating with GAPDH 복부지방Abdominal fat 5.8E-055.8E-05 0.000760.00076 0.000680.00068 0.012280.01228 피하지방Subcutaneous fat 6.1E-056.1E-05 0.001690.00169 0.000210.00021 0.001950.00195 근내지방Intramuscular fat 0.007190.00719 0.155420.15542 0.000680.00068 0.007840.00784

상기 표 2를 참조하면, TNMD 및 DUSP27 유전자의 발현량을 레퍼런스 유전자인 ACTB 및 DUSP27으로 보정한 2가지 경우에 있어서, 타 지방조직에 비해 근내지방에서 그 발현량이 높음을 알 수 있다. DUSP27의 경우에는 일 개체에 있어서의 측정값이 극히 높아 평균치 상으로는 근내지방의 값이 가장 높게 나타나고 있지는 않다.Referring to Table 2, it can be seen that the expression levels of TNMD and DUSP27 genes were higher in the intramuscular fat than the other adipose tissues in the two cases where the expression levels of the TNMD and DUSP27 genes were corrected by the reference genes ACTB and DUSP27. In the case of DUSP27, the measurement value in one individual is extremely high, so that the value of the intramuscular fat is not the highest in the mean value.


TNMDTNMD DUSP27DUSP27
ACTB로 보정시 When calibrating with ACTB GAPDH로 보정시 When calibrating with GAPDH ACTB로 보정시 When calibrating with ACTB GAPDH로 보정시 When calibrating with GAPDH 근내지방 / 복부지방  Intramuscular / abdominal fat 165.605165.605 251.814251.814 27.0727.07 29.9029.90 근내지방 / 피하지방Intramuscular / subcutaneous fat 429.139429.139 723.695723.695 34.3134.31 137.93137.93

표 3을 참조하면, 상기 표 2에서 나타난 결과에 대하여, 오차를 고려하여 상기 레퍼런스 유전자로 보정한 결과를 알 수있다. TNMD 유전자의 근내지방조직에서의 발현량이 복부지방조직 및 피하지방조직에 비해 165%~723% 수준에 이름을 알 알 수 있다.Referring to Table 3, it can be seen that the result of the correction shown in Table 2 is corrected by the reference gene in consideration of the error. The expression level of the TNMD gene in the intramuscular adipose tissue is known to be 165% ~ 723% as compared to the abdominal adipose tissue and subcutaneous adipose tissue.

상기 결과를 종합하면, TNMD 유전자의 발현은 복부지방과 피하지방의 경우에 비하여 근내지방에서 각각 166~429배, 251~723배로 고발현되었고, DUSP27의 경우 27~34배, 29~137배 고발현되는 것을 확인할 수 있었다. 이를 통해 본 발명에 따른 프라이머를 이용한 실시간(realtime) PCR의 분석 방법이 근내지방 특이적 마커 확립 분석에 적용될 수 있음을 확인할 수 있다.Expression of TNMD gene was 166 ~ 429 times and 251 ~ 723 times higher in intramuscular fat than in abdominal fat and subcutaneous fat, 27 ~ 34 times, 29 ~ 137 times higher in DUSP27 . Thus, it can be confirmed that the real-time PCR analysis method using the primer according to the present invention can be applied to analysis of establishment of muscle-specific marker.

상기 표 3은 도 3에 그래프로도 나타나 있는데, 도 3의 그래프에서 세로축은 복부 및 피하지방을 기준으로 하였을 경우 근내지방에서의 상대적 발현양을 의미한다.3 shows the graph of FIG. 3. In the graph of FIG. 3, the vertical axis indicates the relative expression amount in the intramuscular fat when the abdomen and subcutaneous fat are used as a standard.

상기와 같은 결과를 참고할 때, 본 발명은 한우의 근내지방조직 특이적 발현 유전자 TNMD 및 DUSP27을 이용한 한우의 근내지방조직 검출용 키트 및 검출 방법을 제공함을 알 수 있다. 본 발명에 따르면 근내지방 특이 유전자 검출용 키트의 상품화가 가능하고, 한우에서 등심근 내 특이적 지방축적 유도를 통한 고급육의 생산 및 한우의 지방의 함량조절을 통한 체조성 조절 기술의 개발이 가능하며, 이를 통한 체지방 조절 정보를 다른 축종에 적용할 수 있다.
The present invention provides kits and detection methods for intramuscular fat tissue detection of Korean beef cattle using TNMD and DUSP27 gene expressing intramuscular fat tissue of Korean cattle. According to the present invention, it is possible to commercialize a kit for detecting an intramuscular fat-specific gene, to produce high-quality meat through induction of specific fat accumulation in the rosacea of a Korean beef cattle, and to develop a technique of controlling body composition through controlling the fat content of Korean beef cattle, The information on body fat regulation through this can be applied to the other species.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항 들과 그것들의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

SEQUENCE LISTING <110> RURAL DEVELOPMENT ADMINISTRATION <120> Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27 <130> NPF22805 <160> 4 <170> PatentIn version 3.2 <210> 1 <211> 23 <212> DNA <213> Bos taurus coreanae <400> 1 ggtcaaggaa gatgaggatg agg 23 <210> 2 <211> 23 <212> DNA <213> Bos taurus coreanae <400> 2 cagggaggag aaggtgtctg ttt 23 <210> 3 <211> 23 <212> DNA <213> Bos taurus coreanae <400> 3 ctcttattgt cctgttttgg ggg 23 <210> 4 <211> 24 <212> DNA <213> Bos taurus coreanae <400> 4 tcttcttctt ctctccattg ctgt 24                          SEQUENCE LISTING <110> RURAL DEVELOPMENT ADMINISTRATION   <120> Kits and methods for detecting intramuscular fat tissue of Hanwoo         using TNMD and DUSP27 <130> NPF22805 <160> 4 <170> PatentIn version 3.2 <210> 1 <211> 23 <212> DNA <213> Bos taurus coreanae <400> 1 ggtcaaggaa gatgaggatg agg 23 <210> 2 <211> 23 <212> DNA <213> Bos taurus coreanae <400> 2 cagggaggag aaggtgtctg ttt 23 <210> 3 <211> 23 <212> DNA <213> Bos taurus coreanae <400> 3 ctcttattgt cctgttttgg ggg 23 <210> 4 <211> 24 <212> DNA <213> Bos taurus coreanae <400> 4 tcttcttctt ctctccattg ctgt 24

Claims (4)

서열번호 1 내지 2의 염기서열을 갖는 프라이머 세트 및 서열번호 3 내지 4의 염기서열을 갖는 프라이머 세트를 포함하는 한우의 근내지방조직 검출용 키트.
A kit for detecting an intramuscular fat tissue of a Hanwoo comprising a primer set having a nucleotide sequence of SEQ ID NO: 1 to 2 and a primer set having a nucleotide sequence of SEQ ID NO: 3 to 4.
(a) 한우에서 조직을 추출하여 준비하는 단계;
(b) 제1항의 키트를 이용하여, 한우에서 추출된 조직에 존재하는 DUSP27 및 TNMD 유전자 중 적어도 하나의 전사체의 양을 증폭시키는 단계;
(c) 상기 증폭된 전사체를 정량하는 단계; 및
(d) 상기 정량된 전사체를 대조구의 발현량과 비교하여 분석하는 단계;
를 포함하는 한우의 근내지방조직 검출 방법.
(a) extracting and preparing tissues from Hanwoo;
(b) amplifying the amount of the transcript of at least one of the DUSP27 and TNMD genes present in the tissue extracted from the Hanwoo using the kit of claim 1;
(c) quantifying the amplified transcript; And
(d) comparing the quantified transcript with an amount of the control;
Wherein the method comprises the steps of:
제2항에 있어서, 상기 전사체의 양을 증폭시키는 단계는 실시간 중합효소 연쇄반응(Real time PCR)을 통해 수행되는 것을 특징으로 하는 한우의 근내지방조직검출 방법.3. The method according to claim 2, wherein the step of amplifying the amount of the transcription product is performed by real-time PCR. 제2항에 있어서, 상기 대조구는 ACTB 유전자 또는 GAPDH 유전자인 것을 특징으로 하는 한우의 근내지방조직 검출 방법.3. The method according to claim 2, wherein the control is an ACTB gene or a GAPDH gene.
KR1020120155445A 2012-12-27 2012-12-27 Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27 KR101472025B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120155445A KR101472025B1 (en) 2012-12-27 2012-12-27 Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120155445A KR101472025B1 (en) 2012-12-27 2012-12-27 Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27

Publications (2)

Publication Number Publication Date
KR20140085170A true KR20140085170A (en) 2014-07-07
KR101472025B1 KR101472025B1 (en) 2014-12-11

Family

ID=51734900

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120155445A KR101472025B1 (en) 2012-12-27 2012-12-27 Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27

Country Status (1)

Country Link
KR (1) KR101472025B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160059099A (en) * 2014-11-17 2016-05-26 대한민국(농촌진흥청장) A composition for prediction of carcass weight in cow and predicting method using the same
KR20220086054A (en) * 2020-12-16 2022-06-23 대한민국(농촌진흥청장) Composition for determining the growth stage of fetal bovine and use thereof
KR20220086042A (en) * 2020-12-16 2022-06-23 대한민국(농촌진흥청장) Composition for determining the growth stage of fetal bovine and use thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101083213B1 (en) * 2010-02-04 2011-11-11 상지대학교산학협력단 Diagnosis method of meat quality using DNA marker associated with marbling score in Hanwoo

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160059099A (en) * 2014-11-17 2016-05-26 대한민국(농촌진흥청장) A composition for prediction of carcass weight in cow and predicting method using the same
KR20220086054A (en) * 2020-12-16 2022-06-23 대한민국(농촌진흥청장) Composition for determining the growth stage of fetal bovine and use thereof
KR20220086042A (en) * 2020-12-16 2022-06-23 대한민국(농촌진흥청장) Composition for determining the growth stage of fetal bovine and use thereof

Also Published As

Publication number Publication date
KR101472025B1 (en) 2014-12-11

Similar Documents

Publication Publication Date Title
KR101213217B1 (en) SNP Markers Associated with Meat Quantity and Beef Quality in Hanwoo
KR101929391B1 (en) Novel SNP marker for discriminating increasedthe number of nipples of pigs and use thereof
KR101418402B1 (en) Novel SNP marker for discriminating level of loinmuscle area of Pig and use thereof
KR101472025B1 (en) Kits and methods for detecting intramuscular fat tissue of Hanwoo using TNMD and DUSP27
KR101890350B1 (en) SNP maker for predicting meat quality of pig and use thereof
KR101312480B1 (en) Novel snp marker for discriminating number of rib of pig and use thereof
KR101796158B1 (en) SNP markers of NAT9 gene for prediction of pigs litter size and methods for selection of fecund pigs using the same
KR20190045957A (en) Single nucleotide polymorphism markers associated with daily weight gain trait in pig and use thereof
CN110885889B (en) Method for identifying pig backfat thickness based on rs81469622 locus genotype and application
KR101330398B1 (en) DNA fragment markers for detecting improvement of porcine meat quality using SNPs in region of muscle specific microRNA-1
KR101784163B1 (en) Novel SNP marker for discriminating reduction of backfat thickness and use thereof
KR102439855B1 (en) SNP marker composition for discriminating Korean native chicken or new breed chicken and uses thereof
KR101444406B1 (en) Kits and methods for detecting intramuscular fat tissue of Hanwoo using ISL1 and MMP9
KR101402771B1 (en) Kits and methods for detecting intramuscular fat tissue of hanwoo using tbx5 and cyp17a2
KR101533633B1 (en) Kits and methods for detecting intramuscular fat tissue of Hanwoo using DGAT2 and FASN
KR101395339B1 (en) Kits and methods for detecting subcutaneous fat tissue of hanwoo using erbb2 and igf2bp
KR101402769B1 (en) Kits and methods for detecting intramuscular fat tissue of hanwoo using tbx152 and zic1
KR102001528B1 (en) Gene marker for discrimination of Korean Native pig and use thereof
KR101816605B1 (en) Method for selecting pigs with excellent meat color trait
US20190203272A1 (en) Use of brca1 and/or jaml genes in predicting intramuscular fat content of pork and in selective breeding of pigs
EP1660675B1 (en) Polymorphism of the igf2 gene and improving production characteristics of cattle
KR101663404B1 (en) Single nucleotide polymorphism marker in TDRKH gene for diagnosis of meat quality in Hanwoo and method for diagnosis of meat quality in Hanwoo using same marker
KR102615877B1 (en) Composition for discriminating Nanchukmacdon pork meat and use thereof
KR101623238B1 (en) Single nucleotide polymorphism marker composition for determination of meat quality in pig and method for determination of meat quality in pig using same marker
KR102182740B1 (en) Composition for identifying a bovine backfat thickness comprising an agent capable of detecting or amplifying a haplotype

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant