KR20190045957A - Single nucleotide polymorphism markers associated with daily weight gain trait in pig and use thereof - Google Patents

Abstract

The present invention relates to single nucleotide polymorphism (SNP) markers for determining average daily gain (ADG) to select high quality meat of pigs and uses thereof. Specifically, the present invention relates to a method of providing information, kits and SNP markers for determining ADG of pigs. The SNP markers associated with the ADG of pigs identified in the present invention can be effectively used for genetic improvement and selecting breeding pigs with the estimation of breeding values and detection of causative genes associated with growth of pigs, while the ADG is utilized as an important criterion for evaluating the growth of pigs, thereby having an effect of greatly contributing to the upbringing of excellent breeding pigs.

Description

(Single nucleotide polymorphism markers associated with daily weight gain trait in pig and use thereof)

The present invention relates to a single base polymorphic marker composition for discriminating the amount of daily gain for selection of a high quality meat of a pig, a kit and a method for determining the daily gain of a pig.

The livestock breeding has been repeatedly carried out a series of processes to select excellent individuals, to produce later generations using the selected livestock, and to test the ability of the later generations to select superior livestock. Therefore, various breeding techniques are carried out according to a defined breeding scheme in order to carry out the related continuous process. In the conventional case, the breeding value is estimated based on the phenotype information which is expressed in the breeding process of the livestock according to the statistical method, And the like.

Therefore, in order to obtain more efficient livestock for people, good breeding stock to be used to produce the next generation of livestock should be well selected. The quality of the livestock (milk production, weight, etc.) to be improved through selection is mostly a quantitative trait that is affected by a large number of genes. Quantitative traits are generally affected not only by a large number of genes but also by various environmental factors. Thus, in quantitative traits, it is extremely difficult to qualify traits such as individual gene actions or traits that affect them. Therefore, statistical methods have been used as a powerful tool to study quantitative traits and many scholars have attempted to estimate genetic factors that affect quantitative traits separately from various environmental factors.

In particular, the swine industry is a very important industry in the total output of animal husbandry. However, the pig farming industry in developed countries has a poor structure. In recent 10 years, the number of survivors has increased from 9.9 to 10.5, and it is urgent to improve the quality of varieties with high quality. In the case of Korea, the improvement is concentrated on the growth ability, and the rapid growth result is derived, but the meat quality is lowered and the mortality rate is increasing.

Therefore, it is necessary to develop a new technique for selecting and breeding excellent pig breeds by identifying specific markers related to high quality meat and breeding of pigs. However, among countless single nucleotide polymorphisms existing in whole genome of pigs, And a method for judging and analyzing whether or not there is a correlation with the data.

Korean Patent No. 10-1236298

Accordingly, the present inventors collected genotypes and genotypes of the genomes generated in the SNP Breadchip (60k) of the Yorkshire species, a representative breed of the mother line, and constructed a reference population for genome selection and estimated them based on the phenotype lineage We compared the accuracy of the estimated breeding value with the accuracy of the genomic estimated breeding value and found a single base polymorphism that was significantly related to the daily gain of Yorkshire breed, The present invention has been completed by ascertaining that the present invention can be utilized in the selection of a helping hand.

It is therefore an object of the present invention to provide a single base polymorphic marker composition for determining the amount of body weight gain of a pig.

Another object of the present invention is to provide a kit for confirming the daily gain of pigs using the single base polymorphism marker of the present invention.

Another object of the present invention is to provide an information providing method for confirming the daily gain of a pig using a single base polymorphism marker of the present invention.

Another object of the present invention is to provide a method of selecting a breed using the single base polymorphism marker of the present invention.

In order to accomplish the object of the present invention, the present invention provides a polynucleotide polymorphic marker composition for discriminating the body weight gain of a pig, comprising at least one polynucleotide selected from the group consisting of the nucleotide sequences of SEQ ID NOS: to provide.

In one embodiment of the present invention, the breed of pig may be Yorkshire.

In one embodiment of the present invention, the polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1, 7 and 14 is characterized in that a single base mutation of C / T is present at the 26th position in the nucleotide sequence of each polynucleotide, The polynucleotide consisting of the nucleotide sequence of SEQ ID NOs: 3, 5, 9 to 11 and 13 has a single base mutation of A / G at position 26 in the nucleotide sequence of each polynucleotide, and the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: A polynucleotide having a base sequence of G / T at position 14 and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 has a C / T single base mutation at the 19th position in the nucleotide sequence of the polynucleotide And the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 has a single base mutation of A / G at the ninth position in the nucleotide sequence of the polynucleotide, The polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 may have the A / T single base mutation at the 26th position in the nucleotide sequence of the polynucleotide.

The present invention also relates to a method for detecting a base type of a polynucleotide, comprising the step of detecting the base type of the polynucleotide of any one or more of the polynucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14, A confirmation kit is provided.

In one embodiment of the present invention, the detection agent may be a primer or a probe capable of amplifying at least one polynucleotide selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14.

In one embodiment of the present invention, the breed of pig may be Yorkshire.

The present invention also relates to a method for isolating a nucleic acid molecule from a pig, And detecting the base type of the single base polymorphism present in any one or more polynucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14 in the separated nucleic acid molecule. Provide information providing method.

In one embodiment of the present invention, the breed of pig may be Yorkshire.

In one embodiment of the present invention, the step of detecting a base type comprises detecting a polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1, 7 and 14, wherein the base present at the 26th nucleotide sequence of each polynucleotide is C or T The polynucleotide comprising the nucleotide sequences of SEQ ID NOS: 2 to 3, 5, 9 to 11 and 13 was analyzed for the presence of the 26th nucleotide sequence of each polynucleotide as A or G, The polynucleotide consisting of the nucleotide sequence of the polynucleotide is analyzed to determine whether the 14th nucleotide sequence of the polynucleotide is G or T, The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6 has the nucleotide sequence at position 19 in the nucleotide sequence of the polynucleotide is C or T, and the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 8 is the nucleotide sequence of the polynucleotide And the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 can be analyzed to determine whether the base present at the 26th nucleotide sequence of the polynucleotide is A or T.

The present invention also relates to a method for isolating a nucleic acid molecule from a pig, And a base sequence of a single base polymorphism present in any one or more of the polynucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14, in the separated nucleic acid molecule.

The present invention provides a single base polymorphic marker composition, a kit and a method for determining the amount of daily gain of a pig for identification of a daily amount of body weight for selection of a high quality meat of a pig, wherein the single base polymorphism marker associated with the daily amount And the growth rate of the pigs. The growth rate of the pigs is used as an important criterion for assessing the growth of pigs. , It can contribute greatly to the domestic upbringing of excellent piglets.

The present invention is characterized by providing a single nucleotide polymorphic marker composition for discriminating the amount of body weight gain for a high-quality meat selection of pigs. Specifically, the present invention provides a polynucleotide comprising a polynucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: Characterized in that it provides a monoclonal polymorphic marker composition for the determination of the body weight gain of pigs, including nucleotides.

In the present invention, " single nucleotide polymorphism (SNP) " means that one of the nucleotide sequences consisting of A, T, C and G is changed to another nucleotide sequence on the genome.

In the present invention, the term " marker " means a substance capable of discriminating the breeding ability and the fine meat of the pig varieties, and specifically, a substance capable of discriminating the adg weight per pig of pigs.

The single nucleotide polymorphic marker according to the present invention is useful as a marker for discriminating the amount of body weight gain of a pig as a single marker, and the accuracy of discrimination can be enhanced as the number of markers is increased by combining the markers.

The single nucleotide polymorphic marker composition for identifying the germinal body weight gain of a swine comprising any one or more polynucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14 identified in the present invention can be used for the analysis of daily gain Lt; / RTI >

More specifically, the single nucleotide polymorphism marker for discriminating the body weight gain of a pig identified in the present invention is a polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1, 7 and 14, wherein the polynucleotide has a C / T Polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 2 to 3, 5, 9 to 11 and 13 exist in the base sequence of each polynucleotide, and a single base mutation of A / G is present at the 26th position in the nucleotide sequence of each polynucleotide , A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 has a G / T single base mutation at the 14th position in the nucleotide sequence of the polynucleotide, and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6 has the nucleotide sequence of the polynucleotide And a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 exists in the polynucleotide < RTI ID = 0.0 > The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 12 has a single base mutation of A / T at the 26th position in the nucleotide sequence of the polynucleotide The point is characterized.

Further, the present inventors confirmed that the polynucleotide comprising the nucleotide sequences of SEQ ID NOS: 1 to 14 including the single nucleotide polymorphic marker was significantly related to the adipose-reducing amount (adg) of the pig, and the 14 identified single bases The information of the polymorphic markers is shown in Table 3 below.

The specific nucleotide sequences of the single nucleotide polymorphism markers for discriminating the amount of body weight gain for distinguishing the fine meat of the pig breeds identified in the present invention are also shown in Table 4 of the following Examples. In the nucleotide sequences shown in Table 4 below, "N / M " means that the base present at that position may be N or M, and the N base is substituted with M base.

The polynucleotides for the single base polymorphism markers for the determination of the fourteen pig body weight gain according to the present invention are shown in SEQ ID NOS: 1 to 14, and the position of the single base polymorphism present in the respective polynucleotides represented by SEQ ID NOS: Are as shown in Table 1 below.

In the following Table 1, for example, the SNP of SEQ ID NO: 1 exists at a higher probability that the 26th base in the nucleotide sequence of SEQ ID NO: 1 is C or T and the 26th nucleotide is point mutated from C to T ( Major exists).

Furthermore, the present invention can provide an information providing method for confirming the daily gain of pigs using the single nucleotide polymorphic marker according to the present invention as described above.

Preferably, the method further comprises separating the nucleic acid molecule from the pig; And a nucleotide sequence of a single nucleotide polymorphism present in any one or more polynucleotides selected from the group consisting of nucleotide sequences of SEQ ID NOS: 1 to 14, in the separated nucleic acid molecule.

In the information providing method for confirming the daily gain of pigs according to the present invention, the detection of the base type means that the polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1, 7 and 14 is the 26th nucleotide in the nucleotide sequence of each polynucleotide Analyzing whether the present base is C or T; The polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 2 to 3, 5, 9 to 11 and 13 analyzes whether the base present at the 26th position in the nucleotide sequence of each polynucleotide is A or G; A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is analyzed by analyzing whether the 14th nucleotide sequence of the polynucleotide is G or T; The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6 is analyzed by analyzing whether the base at the 19th position in the nucleotide sequence of the polynucleotide is C or T; The polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 analyzes whether the 9th nucleotide sequence of the polynucleotide is A or G; Or the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 means to analyze whether the base present at the 26th position in the nucleotide sequence of the polynucleotide is A or T.  

In addition, the present invention provides a method for detecting a base type of a polynucleotide comprising a polynucleotide of any one or more of the polynucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14, A confirmation kit is provided.

The detection agent may be a primer or a probe capable of amplifying at least one polynucleotide selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14.

The " amplifiable primer " is a base sequence having a short free 3 'hydroxyl group and can form a base pair with a complementary template, and a starting point for template strand copying (E.g., four other nucleoside triphosphates and a polymerase such as DNA, RNA polymerase or reverse transcriptase) in a suitable buffer and a template-directed DNA Refers to a single stranded oligonucleotide that can serve as a starting point for synthesis. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

By "probe" is meant a linear oligomer with a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. The probe used in the present invention may be a perfectly complementary sequence to a sequence containing the SNP of the present invention, but a substantially complementary sequence may be used within a range that does not disturb the specific hybridization .

The kit may contain not only a primer capable of amplifying the marker of the present invention but also reagents necessary for the polymerization reaction, such as dNTP, various polymerase and coloring agents. Meanwhile, the kit of the present invention may be applied to a DNA chip, a microarray, or the like.

Further, the present invention can provide a method for determining the daily gain amount of a swine variety, the method comprising: separating a nucleic acid molecule from a pig; And a nucleotide sequence of a single nucleotide polymorphism present in any one or more polynucleotides selected from the group consisting of nucleotide sequences of SEQ ID NOS: 1 to 14, in the separated nucleic acid molecule.

More specifically, the detection of the base type of the single base polymorphism present in the polynucleotide is to identify a base corresponding to the SNP position of each polynucleotide in Table 1 above.

The site from which the nucleic acid molecule can be separated from the pig is not limited thereto, but it can be obtained from muscles, epidermis, blood, bone, organs, preferably from muscles or blood.

In one example of the present invention, when the starting material is gDNA, the separation of gDNA can be performed according to a conventional method known in the art (see Rogers & Bendich (1994), in the case where the starting material is mRNA, Can be synthesized with cDNA using an enzyme.

The present invention also relates to a method of isolating a nucleic acid molecule from a porcine, And a base sequence of a single base polymorphism present in any one or more of the polynucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14 in the isolated nucleic acid molecule. have.

By analyzing the single nucleotide polymorphic markers identified in the present invention described above and the bases of the point mutations at specific positions present in the marker, it is possible to select superior polynucleotides having an excellent daily gain.

In addition, the pigs according to the present invention may include all kinds of pigs known in the art, preferably Yorkshire.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

<Sample Preparation>

Conducting and breeding traits for 1,579 dogs were collected and used in the Nonghyup breed Yorkshire population as a sample for the analysis of the following examples.

< Example  1>

From Yorkshire pig breeds Daily gain and  Related single nucleotide polymorphisms Marker  excavation

A high density Illumina porcine 62,123 SNPs array assay was performed on the Yorkshire samples collected during the sample preparation. Four SNPs (Quality Control) were performed and SNPs with log (p-value) of less than 6 and Minor allele frequecny less than 0.05 were removed through the Hardy-Weinberg equilibrium (HWE) test. Finally, the call rate was reduced to 90% of the missing data for each individual and each SNPs. Through this process, a total of 1,579 individuals and 41,104 SNPs were finally used, and two-step total length association analysis (GWAS) was performed for each SNP.

First, for the phenotypic correction, we applied the Animal model using the G matrix based on the blood relation (IBS) using the genetic information with the covariance number as covariance and fixed termination parking, parity, obedience, Respectively. After that, the residuals, ie the corrected phenotypic values, were analyzed for each SNP using Plink version 4.0, and the samples were randomly selected and assumed that the genetic relationship was independent.

As a result of the association analysis for each trait, SNPs assigned rs number among the top 20 SNPs with P value of significance level of 1x10 ^{- 2} or less were judged to have a statistically significant relation with the traits and were selected.

The basic statistics for the 8 traits analysis are shown in Table 2 below.

Trait basic statistics characteristics N medium Standard Deviation Minimum value Maximum value C.V. ADG 1,627 0.66 0.05 0.49 0.85 0.08 ABF 1,627 1.47 0.25 0.83 2.31 0.17 90kg_days 1,627 141.86 9.28 116.00 178.00 0.07 PCL 1,627 56.15 3.09 43.20 63.60 0.06 tnb 1,580 13.02 2.24 5 23 0.17 nba 1,580 12.09 1.99 3 20 0.16 wen 1,580 11.34 0.76 6 14 0.07 w2e 1,580 5.96 2.70 2 21 0.45

According to the analysis according to the present invention, the daily gain (adg), the average backfloor thickness (abf), the day of arrival at 90 kg (90 kg_days), the percent of full body weight (PCL), the total number of the housewives (tnb) A total of 110 SNPs related to reproductive and carcass / high quality meat traits were identified and selected for 8 items of wen and w2e 2 weeks, and among them, there were significant correlations with daily gain (adg) Fourteen single nucleotide polymorphic markers in Table 3 were identified.

SNP associated with daily gain SNP_id SNP ( MinorA / MajorB) SSC bp estimate stderr -logP σ2 (SNP) / sigma 2 (trait) One ASGA0008667 [T / C] 2 5,885,232 -0.020 0.008 2.098 0.002 2 ASGA0013828 [N / A] 3 21,330,442 -0.022 0.008 2.391 0.003 3 ASGA0094123 [A / G] 3 22,794,781 0.030 0.010 2.558 0.003 4 ASGA0101172 [A / C] 6 18,635,892 -0.025 0.009 2.127 0.002 5 ASGA0095922 [A / G] 6 23,109,652 -0.042 0.014 2.407 0.002 6 ASGA0101934 [N / A] 8 142,689,289 0.022 0.008 2.151 0.002 7 ALGA0054619 [C / T] 9 121,227,707 0.021 0.008 2.174 0.002 8 ASGA0101790 [T / C] 10 29,579,876 -0.023 0.008 2.291 0.002 9 ALGA0062356 [T / C] 11 55,774,148 0.031 0.011 2.268 0.002 10 M1GA0025742 [A / G] 12 21,514,750 0.023 0.008 2.247 0.002 11 ASGA0105410 [A / G] 12 21,515,836 0.023 0.008 2.247 0.002 12 M1GA0020619 [A / T] 15 147,050,618 0.022 0.007 2.677 0.003 13 ALGA0093437 [N / A] 17 16,767,555 0.035 0.011 2.839 0.003 14 INRA0052780 [C / T] 17 17,104,467 0.023 0.008 2.203 0.002

The nucleotide sequences of the respective SNPs correlated with the daily gain amount of Yorkshire selected in the above Examples are as shown in Table 4 below. In the following table, [A / B] means that the base A is mutated pointwise with the base B SNP &lt; / RTI &gt;

SNP base sequence SNP rs_number Base sequence SEQ ID NO: ASGA0008667 rs81357857 CAAGGAGCTTTCCTGTGACCTCCCC [C / T] CCCCAGAACTCTCTCCCAGGACCCA One ASGA0013828 rs81378916 CTTGGGCTCAAACTGTGCACCACGC [A / G] CTGCACCCGGAGAGCTTAAAAAGGA 2 ASGA0094123 rs81313191 TCCAGCAAGGCGCTGGACACATACT [A / G] GTGCTAAGTAAAAGTTAGGTTGAG 3 ASGA0101172 rs81322216 CTACTAATCCCAC [G / T] GCGCCACAGCAGAAATGCCTGACCT 4 ASGA0095922 rs81315471 ATGGTGGCATGTGAAGCATATGGAA [A / G] TTCCCAAG 5 ASGA0101934 rs81323126 CTGTGACTTAGAGCAAAC [C / T] TCTAAGGCAAAGGCCAACTTCACAG 6 ALGA0054619 rs81415583 TTGTTGAGAGGTTCCAGCTTTTAGC [C / T] TCCAGTAAACTTTTAGCCTTAAGAG 7 ASGA0101790 rs81322957 CTGGAATC [A / G] TGTCAGCCCTGTCAAACCACAGAGA 8 ALGA0062356 rs80807255 CTCCTGAAACGTGATCCCTCCTCTA [A / G] TAGAGGGTATGCATCTGTTGGGGTT 9 M1GA0025742 rs81313027 ACAGTGGAATGAATGCCACACAGTG [A / G] CACTAACCGGCGCCCAAGGGCCCAC 10 ASGA0105410 rs81305514 TCCGAGATGGAATACAACTTACCCT [A / G] CAG 11 M1GA0020619 rs81456166 TTTGGCCACCCTACAGAACTTGGAG [A / T] TCCTGGGCCAGGGATCAGATCCAAG 12 ALGA0093437 rs80965549 AGTAGGGAACAGCTAAGGAAAGAGT [A / G] AAAGTAGGAGTGTTCTAGCAAAGGG 13 INRA0052780 rs333311249 TTCTATAACTTTCATCATCTTAGCT [C / T] TGGAGTTTATTGTATCTTTGTTTTC 14

The single nucleotide polymorphic markers identified above can be used to predict the degree of body weight gain and can be used as DNA markers for selection of body weight gain.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Jung P & C Institute, Inc. <120> Single nucleotide polymorphism markers associated with daily          weight gain trait in pig and use thereof <130> NPDC64487 <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> ASGA0008667 SNP <400> 1 caaggagctt tcctgtgacc tccccccccc agaactctct cccaggaccc a 51 <210> 2 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> ASGA0013828 SNP <400> 2 cttgggctca aactgtgcac cacgcactgc acccggagag cttaaaaagg a 51 <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> ASGA0094123 SNP <400> 3 tccagcaagg cgctggacac atactagtgc taagtaaaag ttaggttgag 50 <210> 4 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> ASGA0101172 SNP <400> 4 ctactaatcc cacggcgcca cagcagaaat gcctgacct 39 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> ASGA0095922 SNP <400> 5 atggtggcat gtgaagcata tggaaattcc caag 34 <210> 6 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> ASGA0101934 SNP <400> 6 ctgtgactta gagcaaacct ctaaggcaaa ggccaacttc acag 44 <210> 7 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> ALGA0054619 SNP <400> 7 ttgttgagag gttccagctt ttagcctcca gtaaactttt agccttaaga g 51 <210> 8 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> ASGA0101790 SNP <400> 8 ctggaatcat gtcagccctg tcaaaccaca gaga 34 <210> 9 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> ALGA0062356 SNP <400> 9 ctcctgaaac gtgatccctc ctctaataga gggtatgcat ctgttggggt t 51 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> M1GA0025742 SNP <400> 10 acagtggaat gaatgccaca cagtgacact aaccggcgcc caagggccca c 51 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> ASGA0105410 SNP <400> 11 tccgagatgg aatacaactt accctacag 29 <210> 12 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> M1GA0020619 SNP <400> 12 tttggccacc ctacagaact tggagatcct gggccaggga tcagatccaa g 51 <210> 13 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> ALGA0093437 SNP <400> 13 agtagggaac agctaaggaa agagtaaaag taggagtgtt ctagcaaagg g 51 <210> 14 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> INRA0052780 SNP <400> 14 ttctataact ttcatcatct tagctctgga gtttattgta tctttgtttt c 51

Claims (10)

Wherein the polynucleotide comprises at least one polynucleotide selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14. The method according to claim 1,
The single base polymorphism marker composition for the determination of the daily gain of pigs of pigs, wherein the variety of pigs is Yorkshire. The method according to claim 1,
A polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1, 7, and 14 has a C / T single base mutation at the 26th position in the nucleotide sequence of each polynucleotide,
A polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 2 to 3, 5, 9 to 11 and 13 has a single base mutation of A / G at the 26th position in the nucleotide sequence of each polynucleotide,
A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 has a single base mutation of G / T at the 14th position in the nucleotide sequence of the polynucleotide,
The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 6 has a single base mutation of C / T at the 19th position in the nucleotide sequence of the polynucleotide,
The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 8 has a single base mutation of A / G at the ninth position in the nucleotide sequence of the polynucleotide,
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 12 has a single base mutation of A / T at position 26 in the nucleotide sequence of the polynucleotide. Wherein the polynucleotide is a polynucleotide selected from the group consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOS: 1 to 14, or a base type polymorphism of an adenine nucleotide polymorphism present in the polynucleotide. 5. The method of claim 4,
Wherein the detection agent is a primer or a probe capable of amplifying at least one polynucleotide selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14. 5. The method of claim 4,
Wherein the breed of the pig is Yorkshire. Separating the nucleic acid molecule from the pig; And
Comprising the step of detecting in the isolated nucleic acid molecule a base type of a single base polymorphism present in any one or more of the polynucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOS:
An information providing method for checking the daily gain of a pig. 8. The method of claim 7,
Characterized in that the variety of pigs is Yorkshire. 8. The method of claim 7,
The step of detecting the base type comprises:
The polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1, 7 and 14 is analyzed by analyzing whether the base present at the 26th position in the nucleotide sequence of each polynucleotide is C or T,
A polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 2 to 3, 5, 9 to 11 and 13 is obtained by analyzing whether the base present at the 26th position in the nucleotide sequence of each polynucleotide is A or G,
A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is analyzed by analyzing whether the 14th nucleotide sequence of the polynucleotide is G or T,
The polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is analyzed by analyzing whether the base at the nineteenth position in the nucleotide sequence of the polynucleotide is C or T,
The polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 analyzes whether the base present at the ninth position in the nucleotide sequence of the polynucleotide is A or G, and
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 12 is characterized in that the 26th nucleotide sequence of the polynucleotide is A or T base. Separating the nucleic acid molecule from the pig; And
And detecting the base type of the single base polymorphism present in any one or more polynucleotides selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 14 in the separated nucleic acid molecule.