KR20140020346A - Identifying method of diatoms in southern sea of korea, polynucleotide probe, dna chip and kit for identifying the same - Google Patents

Identifying method of diatoms in southern sea of korea, polynucleotide probe, dna chip and kit for identifying the same Download PDF

Info

Publication number
KR20140020346A
KR20140020346A KR1020140012242A KR20140012242A KR20140020346A KR 20140020346 A KR20140020346 A KR 20140020346A KR 1020140012242 A KR1020140012242 A KR 1020140012242A KR 20140012242 A KR20140012242 A KR 20140012242A KR 20140020346 A KR20140020346 A KR 20140020346A
Authority
KR
South Korea
Prior art keywords
seq
dna
species
diatoms
probe
Prior art date
Application number
KR1020140012242A
Other languages
Korean (ko)
Other versions
KR101403352B1 (en
Inventor
이택견
박소윤
황진익
이윤호
Original Assignee
한국해양과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=50267356&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=KR20140020346(A) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by 한국해양과학기술원 filed Critical 한국해양과학기술원
Priority to KR1020140012242A priority Critical patent/KR101403352B1/en
Publication of KR20140020346A publication Critical patent/KR20140020346A/en
Application granted granted Critical
Publication of KR101403352B1 publication Critical patent/KR101403352B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to an identification method of species of diatoms inhabiting the coast of Korea, and a polynucleotide probe, a DNA chip and a kit for identification for species of diatoms for the method. The identification method comprises the following steps: carrying out polymerase chain reaction (PCR) of the DNA extracted from diatoms to obtain a PCR product; binding the PCR product to each probe comprising a base sequence identical or complementary to one or more DNA sequences of sequence numbers 3-51; and identifying the species of the diatoms according to whether the PCR product binds or not. The present invention can analyze the genotype of diatoms inhabiting the coast of Korea and can simply, rapidly and accurately identify the species thereof on the basis of single nucleotide polymorphism (SNPs) of various species of diatoms.

Description

대한한국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트{Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same}Identification Method of Diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same}

본 발명은 대한민국 연안에 서식하는 36종의 주요 규조류의 종(species)을 판별하기 위한 것으로, 특히 다양한 규조류 종의 단염기다형성(single nucleotide polymorphism, SNPs)을 기반으로, 대한민국 연안에 서식하는 규조류에 대한 유전자형을 분석하고, 간단하고 신속, 정확하게 그것의 종을 판별할 수 있는 규조류의 종 판별 방법과 이에 따른 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트에 대한 것이다.
The present invention is to determine the species (species) of 36 major diatoms living off the coast of Korea, and in particular, based on single nucleotide polymorphism (SNPs) of various diatom species, The present invention relates to a method for determining the species of diatoms that can analyze the genotype of Korea, simply, quickly and accurately determine its species, and a polynucleotide probe, a DNA chip, and a kit for species identification according to the method.

국내외 종래의 생물종 분류연구는 형태의 계측형질, 계수형질을 바탕으로 하고 있다. Conventional research on species classification at home and abroad is based on the measurement trait and counting trait of the shape.

그러나, 해양 미세조류는 환경 조건에 따라 형태적 특징이 변화하여 형태학적 분류의 한계점이 보고되고 있으며, 연구자들에 따라 해양 미세 조류의 분류 체계도 일부 차이를 보이고 있어 생태계 다양성 모니터링에 있어 일부 문제점이 제시되고 있다. 이러한 문제점을 해결하기 위해 분자마커를 이용한 DNA 바코드 정보 분석 및 DNA 칩 개발을 이용한 정확한 동정이 필요하다. DNA 바코드 정보 분석 및 DNA 칩을 통한 해양 생물 다양성 분석 등은 향후 해양 환경 모니터링 및 보전 연구에 활용할 수 있다. However, marine microalgae change their morphological characteristics according to environmental conditions, and the limitations of morphological classification are reported, and the classification system of marine microalgae shows some differences depending on the researchers.Therefore, there are some problems in monitoring ecosystem diversity. Is being presented. In order to solve these problems, it is necessary to analyze DNA barcode information using molecular markers and to accurately identify them using DNA chip development. Analysis of DNA barcode information and analysis of marine biodiversity through DNA chips can be used for future marine environment monitoring and conservation research.

하지만, 우리나라 생물다양성과 관련하여 중요 어장으로 꼽히는 대한민국 연안의 다양한 규조류에 대하여, 생물다양성 조사를 위한 다양한 생물종을 한번에, 그리고 신속 정확하게 판별할 수 있는 분자 생물학적인 연구는 국내외에서 그 사례를 찾기 어려운 실정이다.
However, for various diatoms off the coast of the Republic of Korea, which are considered as important fishing grounds for biodiversity in Korea, molecular biological studies that can quickly and accurately identify various species for biodiversity investigation are difficult to find cases at home and abroad. Actually.

본 발명은 대한민국 연안에 서식하는 주요 규조류에 대하여 유전자형을 분석하여, 간단하고 신속, 정확하게 상기 규조류의 종을 판별할 수 있는 방법을 제공하는 것이 목적이다. It is an object of the present invention to provide a method for simply, quickly and accurately discriminating the species of diatoms by analyzing the genotype of major diatoms living on the coast of the Republic of Korea.

해당하는 종을 구분하는 데 있어서, 염기서열의 차이가 밝혀졌다고 하더라도 이를 신속 정확하게 분석할 수 있는 표준화된 방법이 있으면 많은 시간과 인적 자원, 비용이 줄어들 수 있다. 본 발명에서는 대한민국 연안에 서식하는 규조류의 주요 어종 36종 염기서열의 차이를 정확히 파악하고, 이를 근거로 하여 각 종마다 차이가 나도록 폴리뉴클레오티드 프로브를 제작하기 위한 것이며, 이를 포함하는 DNA칩 또는 키트를 이용하여 해당 종에 따른 염기서열 차이를 신속, 정확하게 분석할 수 있는 방법을 제공하고자 한다.In classifying the corresponding species, even if the difference in base sequence is revealed, if there is a standardized method that can quickly and accurately analyze it, a lot of time, human resources, and cost can be saved. In the present invention, the difference between the base sequences of 36 major fish species of diatoms living in the coast of Korea is accurately identified, and based on this, a polynucleotide probe is manufactured to make a difference for each species, and a DNA chip or kit including the same is used. We intend to provide a method to quickly and accurately analyze the nucleotide sequence difference according to the species.

또한, 본 발명의 다른 목적은 종간에 염기서열 차이가 있는 부위를 포함하는 15개 내지 30개의 연속적인 뉴클레오티드로 구성된 프로브와, 이것으로 구성된 DNA칩 그리고 이것들을 포함하는 키트를 제공하는 것이다. 이러한 본 발명에 의해, 하나의 슬라이드 위에서 다수의 해당 생물종에 대한 유전자형 분석을 간단하고 신속, 정확하게 검사하는 방법을 제공하기 위한 것이다. In addition, another object of the present invention is to provide a probe composed of 15 to 30 consecutive nucleotides including a site having a nucleotide sequence difference between species, a DNA chip composed of the probe, and a kit including the same. According to the present invention, it is intended to provide a simple, rapid, and accurate method for genotyping a plurality of species on a single slide.

본 발명자들은 다양한 종의 미토콘드리아 DNA 중 COI유전자의 단염기다형성(single nucleotide polymorphism, SNPs) 부위를 근거로 하여, 각 종 마다 특이적으로 결합할 수 있는 최적의 폴리뉴클레오티드 프로브를 제작하고자 한다.
The present inventors aim to construct an optimal polynucleotide probe capable of specifically binding for each species based on the single nucleotide polymorphism (SNPs) site of the COI gene among various species of mitochondrial DNA.

상기한 목적을 달성하기 위한 본 발명에 따른 규조류의 종(species) 판별 방법은, 규조류에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계; 상기 PCR 산물을, 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및, 상기 결합 여부에 따라 상기 규조류의 종(species)을 판별하는 단계;를 포함하여 이루어지는 것이 특징이다.The method for determining the species of diatoms according to the present invention for achieving the above object comprises: obtaining a PCR product by performing a polymerase chain reaction (PCR) on DNA extracted from the diatoms; Binding the PCR product to a probe each comprising a nucleotide sequence identical to or complementary to each of one or more DNA sequences of SEQ ID NO: 3 to SEQ ID NO: 51; And determining the species of the diatoms according to whether or not they are combined.

그리고, 본 발명의 다른 실시형태는, 서열번호 3 내지 서열번호 51 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 폴리뉴클레오티드로 이루어진 규조류의 종(species) 판별용 프로브일 수 있다. In addition, another embodiment of the present invention is a species of diatoms consisting of at least one polynucleotide each comprising a nucleotide sequence identical to or complementary to at least one DNA sequence selected from SEQ ID NO: 3 to SEQ ID NO: 51 It may be a probe for (species) determination.

또한, 본 발명의 또 다른 실시형태는 서열번호 3 내지 서열번호 51 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 프로브를 포함하는 규조류의 종(species) 판별용 DNA 칩인 것도 가능하다. In addition, another embodiment of the present invention is a species of diatoms including at least one probe each comprising a base sequence identical to or complementary to at least one or more of each DNA sequence selected from SEQ ID NO: 3 to SEQ ID NO: 51 It is also possible to use a DNA chip for identification of (species).

이와 함께, 본 발명의 또 다른 실시형태는 규조류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열과 결합하는 것으로, 서열번호 3 내지 서열번호 51 중 어느 하나의 DNA 서열과 동일하거나 상보적인(complementary) 15-30개의 연속 염기서열로 이루어진 것을 특징으로 하는 폴리뉴클레오티드 프로브와; 상기 규조류의 미토콘드리아 DNA를 중합효소연쇄반응(PCR)으로 증폭시키기 위한 프라이머를 포함하는 것을 특징으로 하는 규조류의 종(species) 판별용 키트일 수도 있다.
In addition, another embodiment of the present invention is to bind to the DNA sequence of the mononucleotide polymorphism (SNP) site of the COI gene in the mitochondrial DNA of diatoms, the same as or complementary to the DNA sequence of any one of SEQ ID NO: 3 to SEQ ID NO: 51 A polynucleotide probe, characterized in that consisting of a complementary 15-30 consecutive nucleotide sequences; It may be a kit for discriminating the species of diatoms, characterized in that it includes a primer for amplifying the mitochondrial DNA of the diatoms by polymerase chain reaction (PCR).

기타 본 발명의 다른 실시형태는 후술하는 본 발명의 실시를 위한 구체적인 내용 및 첨부된 도면에 널리 기재되어 있다.
Other embodiments of the present invention are widely described in the detailed description and the accompanying drawings for the implementation of the present invention to be described later.

상기한 본 발명은 대한민국 연안에 서식하는 규조류의 다양한 종에 대한 유전자형을 분석하여, 상기 규조류의 단염기다형성(single nucleotide polymorphism, SNPs)을 기반으로, 간단하고 신속, 정확하게 종을 판별할 수 있는 효과가 있다. The present invention analyzes the genotype of various species of diatoms living on the coast of the Republic of Korea, and based on the single nucleotide polymorphism (SNPs) of the diatoms, the effect of being able to identify the species simply, quickly and accurately. There is.

즉, 본 발명은 규조류의 유전자형으로 구별하기에 가장 적합한 유전자군으로서, 미토콘드리아 DNA 중 COI 유전자를 선택하였고, 거기에 존재하는 특정한 단염기다형성(SNPs) 부위를 찾아내었으며, 이를 바탕으로 다양한 규조류의 종 간에 구별되는 DNA 서열을 임의의 만들어, 규조류의 종 판별을 간단하고 용이하게 하였다. That is, the present invention is the most suitable gene group for distinguishing by genotype of diatoms, the COI gene was selected among mitochondrial DNA, and specific mononucleotide polymorphisms (SNPs) sites present therein were found, and based on this, various diatoms DNA sequences that are distinguished between species were made random, making the species identification of diatoms simple and easy.

또한, 본 발명은 규조류 종 판별용 프로브, 또는 상기 프로브를 포함하는 DNA 칩이나 키트로 제작되어, 육안으로는 종을 분별하기 힘든 유생, 조미 가공물 또는 분말가루 등에 대해서도, 하나의 슬라이드 위에 시료를 올려놓는 것만으로도 그 종을 판별할 수 있는 것이다. In addition, the present invention is made of a probe for diatom species identification, or a DNA chip or kit containing the probe, so that a sample is placed on a single slide for larvae, seasoned products, or powder that are difficult to distinguish with the naked eye. The species can be identified just by placing it.

또한, 본 발명에 따른 프로브를 사용하여 마이크로어레이 방법을 활용하면, 종래의 방법에 비해 시료를 분석하는 시간이 크게 단축되어, 다량의 시료를 짧은 시간 내에 검사할 수 있다.
In addition, when the microarray method using the probe according to the present invention is used, the time to analyze a sample is significantly shortened compared to the conventional method, and a large amount of samples can be inspected within a short time.

도 1 내지 도 36은 각각 본 발명의 바람직한 실시예에 따른 규조류의 미토콘드리아 DNA 중 COI(Cytochrome oxidase subunit I)유전자의 단일염기다형성 부위가 포함된 염기서열을 연속적으로 도시한 모식도이고,
도 37은 상기 도 1 내지 36에 나타난 단염기다형성에 근거하여 제작된 올리고뉴클레오티드 프로브를 포함하는, 본 발명의 일 실시예에 따른 규조류 종 판별용 DNA칩의 구조를 도식화한 모식도이고,
도 38 내지 도 54는 각각 상기 도 37의 DNA칩을 이용하여 본 발명에 따른 올리고뉴클레오티드 프로브와 Achanathes longipes 를 비롯한 특정 규조류의 PCR 증폭산물을 결합시킨 후의 반응 결과를 나타내는 사진이다.1 to 36 are schematic diagrams sequentially showing a nucleotide sequence including a single nucleotide polymorphism site of a COI (Cytochrome oxidase subunit I) gene in the mitochondrial DNA of a diatom according to a preferred embodiment of the present invention, respectively,
37 is a schematic diagram showing the structure of a DNA chip for diatom species identification according to an embodiment of the present invention, including an oligonucleotide probe prepared based on monobasic polymorphism shown in FIGS. 1 to 36,
38 to 54 show the oligonucleotide probe and Achanathes according to the present invention using the DNA chip of FIG. 37, respectively. This is a photograph showing the reaction result after combining the PCR amplification products of certain diatoms including longipes.

이하에서는 본 발명의 바람직한 하나의 실시형태를 첨부된 도면을 참조하여 상세하게 설명하기로 한다.
Hereinafter, a preferred embodiment of the present invention will be described in detail with reference to the accompanying drawings.

본 발명에 따른 규조류의 종(species) 판별 방법은, 먼저 규조류에 속하는 다양한 해양생물 시료에서 DNA를 추출하고, 이렇게 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계를 거친다. In the method for determining the species of diatoms according to the present invention, first, DNA is extracted from various marine organisms belonging to the diatoms, and then polymerase chain reaction (PCR) is performed on the extracted DNA to obtain a PCR product. .

상기 시료에서 DNA를 추출하는 것은 시료의 각 조직 혹은 다양한 가공물 등으로부터 다양한 방법에 의해 DNA를 추출할 수 있고, 이는 추출된 DNA를 분석하여 종을 판별하기 위한 것이기 때문에, 상기 시료의 어느 부위에서 DNA를 추출하는지 또는 어떠한 방법으로 추출하는지는 특별히 제한되지 않는다. Extracting DNA from the sample can extract DNA from each tissue or various processed products of the sample by various methods, and this is to determine the species by analyzing the extracted DNA. It is not particularly limited whether to extract or by what method.

그리고, 이렇게 추출한 DNA를 PCR로 증폭하는 것 또한 검사 표본을 늘이기 위한 것으로, 증폭산물을 얻는 방법은 특별히 제한되지 않는다. 본 발명이 속하는 기술분야의 당업자에게 알려진 다른 DNA 추출방법이나 증폭방법 또한 본 발명의 범주에 속한다는 것은 명백하다.In addition, the amplification of the DNA thus extracted by PCR is also intended to increase the number of test samples, and the method of obtaining the amplified product is not particularly limited. It is clear that other methods of extracting or amplifying DNA known to those skilled in the art to which the present invention belongs are also within the scope of the present invention.

본 발명자들은 규조류의 유전자형으로 구별하기에 가장 적합한 유전자군으로서, 미토콘드리아 DNA 중 COI 유전자를 선택하였고, 거기에 존재하는 특정한 단염기다형성(single nucleotide polymorphism, SNPs) 부위를 찾아내었으며, 이를 바탕으로 해당 종마다 특이적으로 결합할 수 있는 폴리뉴클레오티드 프로브를 제작할 수 있게 되었다. 이러한 폴리뉴클레오티드 프로브는 해당 생물종의 단염기다형성(SNP) 부위를 근거로 제작되었기 때문에, 의도한 종의 DNA와는 결합하지만 이외에 다른 종에는 결합하지 않는 것이 특징이다.The present inventors selected the COI gene among mitochondrial DNA as the most suitable gene group for distinguishing by genotype of diatoms, and found specific single nucleotide polymorphism (SNPs) sites present there, and based on this Polynucleotide probes that can specifically bind to each species have been made possible. Since such a polynucleotide probe was produced based on the mononucleotide polymorphism (SNP) site of the species, it binds to the DNA of the intended species, but does not bind to other species.

특히, 본 발명자들은 수많은 연구와 노력 끝에, 대한민국 연안에 서식하는 주요 해양생물 36종의 미토콘드리아 DNA 중 COI 유전자에서 서열번호 3 내지 서열번호 51에 해당하는 DNA서열이 각 생물종을 구별하기에 최적으로 적합하다는 것을 확인하였고, 상기 서열번호 3 내지 서열번호 51의 DNA서열과 동일하거나 상보적인 염기서열을 가진 폴리뉴클레오티드 프로브를 사용하면, 종래의 다른 어떤 방법보다 현저히 우수하게 각 해당 생물종을 판별할 수 있음을 알 수 있었다.In particular, the present inventors, after numerous studies and efforts, the DNA sequence corresponding to SEQ ID NO: 3 to SEQ ID NO: 51 in the COI gene among the mitochondrial DNA of 36 major marine organisms living on the coast of Korea is optimal for distinguishing each species. It was confirmed that it was suitable, and if a polynucleotide probe having a base sequence identical or complementary to the DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 51 is used, it is possible to discriminate each corresponding species significantly better than any other conventional method. I could see that there was.

이에 따라, 본 발명의 대상이 되는 규조류는 특별히 제한되는 것은 아니지만, 대한민국 연안에 서식하는 어종인 것이 바람직하고, 더욱 바람직하게는 대한민국의 남해 해역을 포함하는 것이 적합하다. 본 명세서에 있어서, "대한민국" 또는 "대한민국 연안"이라 함은 대한민국 국토에 인접한 바다로서, 대체로 수륙의 경계를 이루고 선(해안선이나 호안선 등)을 기준으로 일반적으로 여겨지는 정도의 근접한 바다를 포함한다. 또한, "남해" 또는 "남해 해역"이라 함은 한국 남쪽에 있는 바다로서, 대체로 동쪽은 쓰시마섬[對馬島], 서쪽은 흑산도, 남쪽은 제주도를 연결하는 해역을 뜻한다.
Accordingly, although the diatoms subject to the present invention are not particularly limited, it is preferable to be a fish species inhabiting the coast of the Republic of Korea, and more preferably, it is suitable to include the South Sea of Korea. In this specification, the term "Korea" or "the coast of the Republic of Korea" refers to the sea adjacent to the territory of the Republic of Korea. do. In addition, "Namhae" or "Namhae Area" refers to the sea in the south of Korea, which generally connects Tsushima Island [對馬島] in the east, Heuksan Island in the west, and Jeju Island in the south.

본 발명은 특별히 미토콘드리아 DNA상의 COI 유전자 부위에 존재하는 단염기다형성(SNPs) 부위를 이용한 것이며, 이에 따라 상기 규조류에서 추출한 DNA는 규조류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성(SNPs)을 포함하는 것이 바람직하다. The present invention specifically uses mononucleotide polymorphism (SNPs) sites present in the COI gene site on mitochondrial DNA, and accordingly, the DNA extracted from the diatoms includes mononucleotide polymorphisms (SNPs) at the COI gene site in the mitochondrial DNA of diatoms. It is desirable.

본 명세서에서 '다형성(polymorphism)'이란 유전학적으로 결정된 집단 내에서 2 이상의 대체적 서열 또는 대립형질의 발생을 의미한다. 다형 마커 또는 부위는 발산이 일어나는 위치(locus)이다. 바람직한 마커는 선택된 집단에서 1% 이상, 더욱 바람직하기로는 10% 또는 20% 이상의 발생 빈도를 나타내는 두개 이상의 대립 형질을 가진다. 다형성 부위는 단일 염기쌍일 수도 있다.In the present specification, "polymorphism" refers to the occurrence of two or more alternative sequences or alleles within a genetically determined population. The polymorphic marker or site is the locus at which divergence occurs. Preferred markers have two or more alleles representing a frequency of occurrence of at least 1%, more preferably at least 10% or 20% in the selected population. The polymorphic site may be a single base pair.

도 1 내지 도 36은 각각 본 발명의 바람직한 실시예에 따른 대한민국 연안에 서식하는 주요 규조류 36종의 미토콘드리아 DNA 중 COI(Cytochrome oxidase subunit I)유전자의 단일염기다형성 부위가 포함된 염기서열을 연속적으로 도시한 모식도이다.1 to 36 are each successively showing a nucleotide sequence containing a single nucleotide polymorphic site of a COI (Cytochrome oxidase subunit I) gene among the 36 mitochondrial DNAs of major diatoms living on the coast of Korea according to a preferred embodiment of the present invention. This is a schematic diagram.

본 발명자들은 수많은 연구와 노력 끝에 갈치 DNA의 COI 유전자 중에서, 상기 단염기다형성(SNPs) 부위에 속하는 염기서열을 프로브로 이용하면, 상기 규조류의 종을 구별하기에 가장 적합하다는 것을 확인하였다. After numerous studies and efforts, the present inventors have confirmed that among the COI genes of hairtail DNA, when a nucleotide sequence belonging to the mononucleotide polymorphism (SNPs) site is used as a probe, it is most suitable for distinguishing the species of diatoms.

이에 따라, 본 발명은 상기 단염기다형성(SNPs) 부위에 속하는 염기서열, 즉 후술하는 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 프로브로 이용한 것이다. 이러한 프로브는 규조류가 속하는 종에 따라 다른 단염기다형성(SNP) 부위를 근거로 제작되었기 때문에, 의도한 규조류에 속하는 PCR 시료 산물과는 결합하지만 이외에 다른 종에 속하는 규조류의 그것과는 결합하지 않는 것이 바람직하다.
Accordingly, the present invention uses a nucleotide sequence belonging to the mononucleotide polymorphism (SNPs) site, that is, a nucleotide sequence identical to or complementary to each of at least one DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 51 to be described later as a probe. will be. Since these probes were produced based on different monobasic polymorphism (SNP) sites depending on the species to which the diatoms belong, it is suggested that they bind to the PCR sample product belonging to the intended diatoms, but not to those of diatoms belonging to other species. desirable.

본 발명에 따른 서열번호 3 내지 서열번호 51의 DNA 서열은 하기의 표 1에 나타낸 바와 같다.The DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 51 according to the present invention is as shown in Table 1 below.

[대한민국 연안에 서식하는 주요 규조류의 종 판별을 위한 DNA 서열][DNA sequence for identification of major diatom species living on the coast of Korea] 프로브 명칭Probe name DNA서열DNA sequence 반응 미세조류 종명Reactive microalgae species name DNA
서열 위치DNA
Sequence position B1(서열번호3)B1 (SEQ ID NO: 3) CACTGCAAAAATCAGATAGAGCGCACTGCAAAAATCAGATAGAGCG AchnanthesAchnanthes longipeslongipes 26-4926-49 B2(B2( 서열번호4SEQ ID NO:4 )) GCTCCAGGCTTTTTTATGCATAAGCTCCAGGCTTTTTTATGCATAA AmphoraAmphora spsp .. 544-567544-567 B3(B3( 서열번호5SEQ ID NO: 5 )) GAAACTACAGTTCCAATAACACCGAAACTACAGTTCCAATAACACC AmphoraAmphora spsp .. 55-7855-78 B4(B4( 서열번호6SEQ ID NO: 6 )) GATCCTGTCTTATACCAGCATTTGATCCTGTCTTATACCAGCATTT AsterionellaAsterionella glacialisglacialis 706-729706-729 B5(B5( 서열번호7SEQ ID NO: 7 )) CTGGTGCTTCATCAATATTAGGTCTGGTGCTTCATCAATATTAGGT AsterionellaAsterionella glacialisglacialis 485-508485-508 B6(B6( 서열번호8SEQ ID NO: 8 )) AAAGATAGAGCAGTCCCAGCTACAAAGATAGAGCAGTCCCAGCTAC ChaetocerosChaetoceros atlanticusatlanticus 58-8158-81 B7(B7( 서열번호9SEQ ID NO: 9 )) CTACTCCAGATATTGCACCAAAACTACTCCAGATATTGCACCAAAA ChaetocerosChaetoceros atlanticusatlanticus 39-6239-62 B8(B8( 서열번호10SEQ ID NO: 10 )) TTTTTGACCCTGCAGGGGGTGGATTTTTGACCCTGCAGGGGGTGGA ChaetocerosChaetoceros didymusdidymus 638-706638-706 B9(B9( 서열번호11SEQ ID NO: 11 )) CCAGTGCTTGCGGGAGCTATTACCCAGTGCTTGCGGGAGCTATTAC ChaetocerosChaetoceros didymusdidymus 625-648625-648 B10(B10( 서열번호12SEQ ID NO: 12 )) GGCAATTACCATGCTTTTAACTGGGCAATTACCATGCTTTTAACTG ChaetocerosChaetoceros septentrionalisseptentrionalis 639-662639-662 B11(B11( 서열번호13SEQ ID NO: 13 )) GGCTGTCTTAATAACAGCTTTCTGGCTGTCTTAATAACAGCTTTCT ChaetocerosChaetoceros vistulaevistulae 585-608585-608 B12(B12( 서열번호14SEQ ID NO: 14 )) TGGCGCAGTGGATTTAGCTATTTTGGCGCAGTGGATTTAGCTATTT ChaetocerosChaetoceros vistulaevistulae 447-470447-470 B13(B13( 서열번호15SEQ ID NO: 15 )) GATCCCGTATTGTACCAACATTTGATCCCGTATTGTACCAACATTT ChlorellaChlorella ellipsoideaellipsoidea , C. , C. schroeterischroeteri 706-729706-729 B14(B14( 서열번호16SEQ ID NO: 16 )) GTATGAGTATGCATAGACTACCTGTATGAGTATGCATAGACTACCT ChlorellaChlorella ellipsoideaellipsoidea , C. , C. schroeterischroeteri 551-574551-574 B15(B15( 서열번호17SEQ ID NO: 17 )) CCCAGTCTTGTTCCAGCACATCCCAGTCTTGTTCCAGCACAT ChlorophytaChlorophyta UFUF 709-730709-730 B16(B16( 서열번호18SEQ ID NO:18 )) TGCTGATGGACATCCACTTCGTGCTGATGGACATCCACTTCG ChlorophytaChlorophyta UFUF 654-675654-675 B17(B17( 서열번호19SEQ ID NO: 19 )) CAGGTGCTATCACAATGCTTTTACAGGTGCTATCACAATGCTTTTA CoscinodiscusCoscinodiscus perforatusperforatus , C. , C. rothiirothii 635-658635-658 B18(B18( 서열번호20SEQ ID NO: 20 )) TATCGGGAGCTGCTTCTATTTTATATCGGGAGCTGCTTCTATTTTA CoscinodiscusCoscinodiscus perforatusperforatus , C. , C. rothiirothii 482-505482-505 B19(B19( 서열번호21SEQ ID NO: 21 )) CCAGAAATGGCTTGGCATAAATTCCAGAAATGGCTTGGCATAAATT CylindrothecaCylindrotheca closteriumclosterium 547-570547-570 B20(B20( 서열번호22SEQ ID NO:22 )) AAATATGCGAAGTCCAGAAATGGAAATATGCGAAGTCCAGAAATGG CylindrothecaCylindrotheca closteriumclosterium 534-557534-557 B21(B21( 서열번호23SEQ ID NO: 23 )) GGAGGTGATCCAATACTTTATCAGGAGGTGATCCAATACTTTATCA CylindrothecaCylindrotheca fusiformifusiformi 700-723700-723 B22(B22( 서열번호24SEQ ID NO: 24 )) CTTTAGTGCAACGGGTGGTGGTGCTTTAGTGCAACGGGTGGTGGTG CymatosiraCymatosira lorenzianalorenziana 684-704684-704 B23(B23( 서열번호25SEQ ID NO: 25 )) GCTTTTGACAGATCGTTTTTACGGCTTTTGACAGATCGTTTTTACG CymatosiraCymatosira lorenzianalorenziana 651-674651-674 B24(B24( 서열번호26SEQ ID NO: 26 )) CATCTTTCTGGTGCTTCTTCTATCATCTTTCTGGTGCTTCTTCTAT DitylumDitylum brightwelliibrightwellii 478-501478-501 B25(B25( 서열번호27SEQ ID NO: 27 )) GAGAGCAATAGGAATGACATTTCGAGAGCAATAGGAATGACATTTC GloeocystisGloeocystis gigasgigas 540-563540-563 B26(B26( 서열번호28SEQ ID NO:28 )) CTACCTTTTACGATCCGGCAGGACTACCTTTTACGATCCGGCAGGA GyrodimiumGyrodimium impudicumimpudicum 677-700677-700 B27(B27( 서열번호29SEQ ID NO:29 )) TCCTTGGGCTATCCTTATCACTCCTTGGGCTATCCTTATCAC HeterosigmaHeterosigma akashiwoakashiwo 580-601580-601 B28(B28( 서열번호30SEQ ID NO: 30 )) GATCCCGTTCTTTATCAACATCTGATCCCGTTCTTTATCAACATCT MelosiraMelosira nummuloidesnummuloides 707-729707-729 B29(B29( 서열번호31SEQ ID NO: 31 )) TTTTTTTGACCCCGCAGGAGGCGTTTTTTTGACCCCGCAGGAGGCG MelosiraMelosira nummuloidesnummuloides 681-704681-704 B30(B30( 서열번호32SEQ ID NO: 32 )) CTGTTCTTGCTGGAGCTATTACTCTGTTCTTGCTGGAGCTATTACT MelosiraMelosira nummuloidesnummuloides 626-649626-649 B31(B31( 서열번호33SEQ ID NO:33 )) GATCCAGTTTTATACCAGCACTTGATCCAGTTTTATACCAGCACTT NaviculaNavicula spsp .. 706-729706-729 B32(B32( 서열번호34SEQ ID NO:34 )) GTGTGGTCAGTATTTTTAACAGCGTGTGGTCAGTATTTTTAACAGC NaviculaNavicula spsp .. 580-603580-603 B33(B33( 서열번호35SEQ ID NO:35 )) GGAGGAGACCCTATATTATATCAGGAGGAGACCCTATATTATATCA NitzschiaNitzschia pungenspungens 100-723100-723 B34(B34( 서열번호36SEQ ID NO: 36 )) GCAGCAGGTATAACTATGTTGTTGCAGCAGGTATAACTATGTTGTT NitzschiaNitzschia pungenspungens 634-657634-657 B35(B35( 서열번호37SEQ ID NO: 37 )) CTGTGTTATTCCAGCACTTATTCCTGTGTTATTCCAGCACTTATTC NitzschiaNitzschia subpacificasubpacifica 710-733710-733 B36(B36( 서열번호38SEQ ID NO: 38 )) CAAAAATGAGATAAAGCGTGCCACAAAAATGAGATAAAGCGTGCCA ProrocentrumProrocentrum minimumminimum 21-4421-44 B37(B37( 서열번호39SEQ ID NO: 39 )) GTCTTGTTTCAGCATCTTTTCTGGTCTTGTTTCAGCATCTTTTCTG SkeletonemaSkeletonema costatumcostatum 712-734712-734 B38(B38( 서열번호40SEQ ID NO:40 )) CTGTTTTAGCTGGAGCTATTACACTGTTTTAGCTGGAGCTATTACA SkeletonemaSkeletonema costatumcostatum 626-649626-649 B39(B39( 서열번호41SEQ ID NO: 41 )) CCTTTATTTGCCTGGTCAGTTTTCCTTTATTTGCCTGGTCAGTTTT StephanopyxisStephanopyxis turristurris 571-594571-594 B40(B40( 서열번호42SEQ ID NO:42 )) CAGCGTTCTTTAATGCTGCTGCAGCGTTCTTTAATGCTGCTG ThalassiosiraThalassiosira alleniiallenii 678-699678-699 B41(B41( 서열번호43SEQ ID NO:43 )) GTTGATTACTGATCGTCACTTTGGTTGATTACTGATCGTCACTTTG ThalassiosiraThalassiosira alleniiallenii 651-674651-674 B42(B42( 서열번호44SEQ ID NO: 44 )) CATCTTCTRTTCTAGGTGCTATTCATCTTCTRTTCTAGGTGCTATT ThalassiosiraThalassiosira balticabaltica . T. . T. decepiensdecepiens , T. , T. puntigerapuntigera 491-514491-514 B43(B43( 서열번호45SEQ ID NO: 45 )) GGAGCGATTACAATGCTATTAACGGAGCGATTACAATGCTATTAAC ThalassiosiraThalassiosira confertaconferta 637-660637-660 B44(B44( 서열번호46SEQ ID NO: 46 )) CTTCTTCTATTCTAGGGGCAATCCTTCTTCTATTCTAGGGGCAATC ThalassiosiraThalassiosira nordenskioldinordenskioldi , T. , T. weissflogiiweissflogii 491-514491-514 B45(B45( 서열번호47SEQ ID NO:47 )) CTATCTTTAGTTTGCACGTGTCTCTATCTTTAGTTTGCACGTGTCT ThalassiosiraThalassiosira nordenskioldinordenskioldi , T. , T. weissflogiiweissflogii 464-487464-487 B46(B46( 서열번호48SEQ ID NO: 48 )) CTTCTTCTATTCTAGGGGCAATCCTTCTTCTATTCTAGGGGCAATC ThalassiosiraThalassiosira nordenskioldinordenskioldi , T. , T. weissflogiiweissflogii 491-514491-514 B47(B47( 서열번호49SEQ ID NO: 49 )) GGGCAACATTAATTACAGCATTCGGGCAACATTAATTACAGCATTC ThalassiosiraThalassiosira ostupiiostupii 584-607584-607 B48(B48( 서열번호50SEQ ID NO:50 )) TTAACGGGACAAATCAGTTACCATTAACGGGACAAATCAGTTACCA ThalassiosiraThalassiosira rotularotula 242-265242-265 B49(B49( 서열번호51SEQ ID NO: 51 )) GGTTCTGTAGACTTAGCGATATTGGTTCTGTAGACTTAGCGATATT ThalassiosiraThalassiosira rotularotula 448-471448-471

본 발명은 상기 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하도록 다수의 프로브를 제작할 수 있고, 이러한 프로브 중 적어도 하나 이상을 상기에서 얻은 PCR 산물과 결합시킴으로서, 그 결합 여부에 따라 규조류의 종을 판별할 수 있는 것이다. In the present invention, a plurality of probes can be prepared to each include a nucleotide sequence identical to or complementary to each of one or more DNA sequences of SEQ ID NO: 3 to SEQ ID NO: 51, and at least one or more of these probes are obtained from the above. By binding to the PCR product, the species of diatoms can be identified depending on whether or not they are bound.

본 발명에 있어서, 상기 상기 규조류는 Achnanthes longipes, Amphora sp ., Asterionella glacialis, Chaetoceros atlanticus, Chaetoceros didymus, Chaetoceros septentrionalis , Chaetoceros vistulae, Chlorella ellipsoidea , C. schroeteri, Chlorella ellipsoidea , C. schroeteri, Chlorophyta UF, Coscinodiscus perforatus , C. rothii, Cylindrotheca closterium , Cylindrotheca fusiformi, Cymatosira lorenziana, Ditylum brightwellii , Gloeocystis gigas, Gyrodimium impudicum, Heterosigma akashiwo, Melosira nummuloides, Navicula sp., Nitzschia pungens , Nitzschia subpacifica, Prorocentrum minimum, Skeletonema costatum , Stephanopyxis turris, Thalassiosira allenii, Thalassiosira baltica . T. decepiens , T. puntigera , Thalassiosira conferta , Thalassiosira nordenskioldi , T. weissflogii, Thalassiosira ostupii 및 Thalassiosira rotula 로 이루어진 군에서 적어도 하나 이상이 선택된 것일 수 있다. In the present invention, the diatom is Achnanthes longipes , Amphora sp . , Asterionella glacialis , Chaetoceros atlanticus , Chaetoceros didymus , Chaetoceros septentrionalis , Chaetoceros vistulae , Chlorella ellipsoidea , C. schroeteri , Chlorella ellipsoidea , C. schroeteri , Chlorophyta UF , Coscinodiscus perforatus , C. rothii , Cylindrotheca closterium , Cylindrotheca fusiformi , Cymatosira lorenziana , Ditylum brightwellii , Gloeocystis gigas , Gyrodimium impudicum , Heterosigma akashiwo , Melosira nummuloides , Navicula sp. , Nitzschia pungens , Nitzschia subpacifica, Prorocentrum minimum , Skeletonema costatum , Stephanopyxis turris , Thalassiosira allenii , Thalassiosira baltica . T. decepiens , T. puntigera , Thalassiosira conferta, Thalassiosira nordenskioldi, T. weissflogii, Thalassiosira ostupii And at least one or more may be selected from the group consisting of Thalassiosira rotula.

그래서, 상기 결합 여부에 따라 규조류가 속하는 종을 판별하는 것은, 상기 결합되는 서열번호를 근거로 하여, 서열번호 3의 프로브와 결합하면 Achnanthes longipes 종, 서열번호 4 또는/및 서열번호 5와 결합하면 Amphora sp . 종인 것으로 판별할 수 있다. 기타 규조류 종에 대해서도 상기 표 1에 기재된 각 서열번호의 염기서열을 포함하는 프로브와의 결합에 따라 그에 맞는 종 판별이 가능하다. So, to determine the species to which the diatom belongs according to the binding status, based on the binding sequence number, when combined with the probe of SEQ ID NO: 3, when combined with the Achnanthes longipes species, SEQ ID NO: 4 or/and SEQ ID NO: 5 Amphora sp . It can be identified as being a species. For other diatom species, it is possible to determine the appropriate species according to the binding with the probe containing the nucleotide sequence of each sequence number shown in Table 1 above.

또한, 본 발명에 따른 상기 프로브는 규조류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성 부위와 결합하고, 상기 결합은 상기 규조류의 종에 따라 다르게 이루어지는 것이 바람직하다. In addition, it is preferable that the probe according to the present invention binds to the monobasic polymorphic site of the COI gene site in the mitochondrial DNA of the diatom, and the bonding is made differently depending on the species of the diatom.

예를 들어, 상기 결합이 상기 규조류의 종에 따라 다르게 이루어진다는 것은, 서열번호 3의 염기서열을 포함하는 프로브는 Achnanthes longipes 종의 미토콘드리아 DNA 중 COI 유전자 부위의 26-49번째 DNA 서열과 특이적으로 결합하고, 서열번호 4의 프로브는 Amphora sp . 종의 544-567번째 DNA 서열, 서열번호 5의 경우는 Amphora sp .종의 55-78번째 DNA 서열, 서열번호 6의 경우는 Asterionella glacialis 종의 706-729번째 DNA 서열, 서열번호 7의 경우는 Asterionella glacialis 종의 485-508번째 DNA 서열, 서열번호 8의 경우는 Chaetoceros atlanticus 종의 58-81번째 DNA 서열, 서열번호 9의 경우는 Chaetoceros atlanticus 종의 39-62번째 DNA 서열, 서열번호 10의 경우는 Chaetoceros didymus 종의 638-706번째 DNA 서열, 서열번호 11의 경우는 Chaetoceros didymus 종의 625-648번째 DNA 서열, 서열번호 12의 경우는 Chaetoceros septentrionalis 종의 639-662번째 DNA 서열, 서열번호 13의 경우는 Chaetoceros vistulae 종의 585-608번째 DNA 서열, 서열번호 14의 경우는 Chaetoceros vistulae 종의 447-470번째 DNA 서열, 서열번호 15의 경우는 Chlorella ellipsoidea 와 C. schroeteri 종의 706-729번째 DNA 서열, 서열번호 16의 경우는 Chlorella ellipsoidea 와 C. schroeteri 종의 551-574 번째 DNA 서열, 서열번호 17의 경우는 Chlorophyta UF 종의 709-730 번째 DNA 서열, 서열번호 18의 경우는 Chlorophyta UF 종의 654-675 번째 DNA 서열, 서열번호 19의 경우는 Coscinodiscus perforatus 와 C. rothii 종의 635-658 번째 DNA 서열, 서열번호 20의 경우는 Coscinodiscus perforatus 와 C. rothii 종의 482-505 번째 DNA 서열, 서열번호 21의 경우는 Cylindrotheca closterium 종의 547-570 번째 DNA 서열, 서열번호 의 22경우는 Cylindrotheca closterium 종의 534-557 번째 DNA 서열, 서열번호 23의 경우는 Cylindrotheca fusiformi 종의 700-723 번째 DNA 서열, 서열번호 24의 경우는 Cymatosira lorenziana 종의 684-704 번째 DNA 서열, 서열번호 25의 경우는 Cymatosira lorenziana 종의 651-674 번째 DNA 서열, 서열번호 26의 경우는 Ditylum brightwellii 종의 478-501 번째 DNA 서열, 서열번호 27의 경우는 Gloeocystis gigas 종의 540-563 번째 DNA 서열, 서열번호 28의 경우는 Gyrodimium impudicum 종의 677-700 번째 DNA 서열, 서열번호 29의 경우는 Heterosigma akashiwo 종의 580-601 번째 DNA 서열, 서열번호 30의 경우는 Melosira nummuloides 종의 707-729 번째 DNA 서열, 서열번호 31의 경우는 Melosira nummuloides 종의 681-704 번째 DNA 서열, 서열번호 32의 경우는 Melosira nummuloides 종의 626-649 번째 DNA 서열, 서열번호 33의 경우는 Navicula sp . 종의 706-729 번째 DNA 서열, 서열번호 34의 경우는 Navicula sp . 종의 580-603 번째 DNA 서열, 서열번호 35의 경우는 Nitzschia pungens 종의 100-723 번째 DNA 서열, 서열번호 36의 경우는 Nitzschia pungens 종의 634-657 번째 DNA 서열, 서열번호 37의 경우는 Nitzschia subpacifica 종의 710-733 번째 DNA 서열, 서열번호 38의 경우는 Prorocentrum minimum 종의 21-44 번째 DNA 서열, 서열번호 39의 경우는 Skeletonema costatum 종의 712-734 번째 DNA 서열, 서열번호 40의 경우는 Skeletonema costatum 종의 626-649 번째 DNA 서열, 서열번호 41의 경우는 Stephanopyxis turris 종의 571-594 번째 DNA 서열, 서열번호 42의 경우는 Thalassiosira allenii 종의 678-699 번째 DNA 서열, 서열번호 43의 경우는 Thalassiosira allenii 종의 651-674 번째 DNA 서열, 서열번호 44의 경우는 Thalassiosira baltica . T. decepiens 와 T. puntigera 종의 491-514 번째 DNA 서열, 서열번호 45의 경우는 Thalassiosira conferta 종의 637-660 번째 DNA 서열, 서열번호 46의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 491-514 번째 DNA 서열, 서열번호 47의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 464-487 번째 DNA 서열, 서열번호 48의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 491-514 번째 DNA 서열, 서열번호 49의 경우는 Thalassiosira ostupii 종의 584-607 번째 DNA 서열, 서열번호 50의 경우는 Thalassiosira rotula 종의 242-265 번째 DNA 서열, 서열번호 51의 경우는 Thalassiosira rotula 종의 448-471 번째 DNA 서열과 특이적으로 결합하는 것일 수 있다. For example, that the binding is made differently depending on the species of the diatom, the probe containing the nucleotide sequence of SEQ ID NO: 3 is Achnanthes Longipes species mitochondrial DNA specifically binds to the 26-49th DNA sequence of the COI gene site, and the probe of SEQ ID NO: 4 is Amphora sp . The 544-567 DNA sequence of the species, in the case of SEQ ID NO: 5, Amphora sp . The 55-78th DNA sequence of the species, the 706-729th DNA sequence of the Asterionella glacialis species in the case of SEQ ID NO: 6, the 485-508th DNA sequence of the Asterionella glacialis species in the case of SEQ ID NO: 8, the Chaetoceros atlanticus species 58-81 DNA sequence, In the case of SEQ ID NO: 9, the 39-62 DNA sequence of Chaetoceros atlanticus species, in the case of SEQ ID NO: 10, Chaetoceros didymus DNA sequence of the species 638-706, in the case of SEQ ID NO: 11 Chaetoceros didymus DNA sequence of the species 625-648, in the case of SEQ ID NO: 12, Chaetoceros septentrionalis The 639-662 DNA sequence of the species, in the case of SEQ ID NO: 13, Chaetoceros vistulae DNA sequence of the species 585-608, in the case of SEQ ID NO: 14, Chaetoceros vistulae 447-470 DNA sequence of the species, in the case of SEQ ID NO: 15 Chlorella ellipsoidea And C. schroeteri DNA sequence of the species 706-729, in the case of SEQ ID NO: 16 Chlorella ellipsoidea And C. schroeteri The 551-574th DNA sequence of the species, in the case of SEQ ID NO: 17 Chlorophyta UF The 709-730th DNA sequence of the species, in the case of SEQ ID NO: 18 Chlorophyta UF DNA sequence of the species 654-675, in the case of SEQ ID NO: 19, Coscinodiscus perforatus And C. rothii For species 635-658 second DNA sequence, SEQ ID NO: 20 of the Coscinodiscus perforatus And C. rothii sp. 482-505 DNA sequence, Cylindrotheca for SEQ ID NO: 21 DNA sequence 547-570 of the species closterium, Cylindrotheca in the case of SEQ ID NO: 22 DNA sequence 534-557 of the species closterium, Cylindrotheca for SEQ ID NO: 23 DNA sequence 700-723 of the species fusiformi, Cymatosira in the case of SEQ ID NO: 24 684-704th DNA sequence of lorenziana species, Cymatosira in the case of SEQ ID NO: 25 651-674th DNA sequence of lorenziana species, Ditylum for SEQ ID NO: 26 478-501 DNA sequence of species brightwellii, Gloeocystis for SEQ ID NO: 27 the 540-563th DNA sequence of species gigas, Gyrodimium for SEQ ID NO: 28 677-700th DNA sequence of species impudicum, In the case of SEQ ID NO: 29, Heterosigma DNA sequence 580-601 of species akashiwo, For SEQ ID NO: 30 is the DNA sequence of the first 707-729 Melosira nummuloides species, Melosira nummuloides for SEQ ID NO: 31 DNA sequence of the species 681-704, in the case of SEQ ID NO: 32, Melosira nummuloides Species 626-649th DNA sequence, for SEQ ID NO: 33, Navicula sp . Species 706-729th DNA sequence, for SEQ ID NO: 34, Navicula sp . 580-603 DNA sequence of the species, Nitzschia for SEQ ID NO: 35 pungens DNA sequence of the species 100-723, for SEQ ID NO: 36 is Nitzschia pungens The 634-657th DNA sequence of the species, for SEQ ID NO: 37 is Nitzschia subpacifica For species 710-733 second DNA sequence, SEQ ID NO: 38 is the Prorocentrum minimum The 21st-44th DNA sequence of the species, in the case of SEQ ID NO: 39 Skeletonema costatum 712-734th DNA sequence of the species, in the case of SEQ ID NO: 40 Skeletonema costatum 626-649th DNA sequence of the species, Stephanopyxis turris in the case of SEQ ID NO: 41 Species 571-594th DNA sequence, for SEQ ID NO: 42, Thalassiosira allenii DNA sequence of the species 678-699, for SEQ ID NO: 43 is Thalassiosira allenii The 651-674th DNA sequence of the species, for SEQ ID NO: 44 is Thalassiosira baltica . T. decepiens And T. puntigera The 491-514th DNA sequence of the species, in the case of SEQ ID NO: 45 Thalassiosira conferta DNA sequence 637-660 of the species, Thalassiosira for SEQ ID NO: 46 nordenskioldi And T. weissflogii The 491-514th DNA sequence of the species, in the case of SEQ ID NO: 47, Thalassiosira nordenskioldi And T. weissflogii sp. 464-487 DNA sequence, in the case of SEQ ID NO: 48, Thalassiosira nordenskioldi and T. weissflogii The 491-514th DNA sequence of the species, in the case of SEQ ID NO: 49 Thalassiosira ostupii DNA sequence of the species 584-607, in the case of SEQ ID NO: 50, Thalassiosira rotula DNA sequence of the species 242-265, in the case of SEQ ID NO: 51, Thalassiosira rotula It may be one that specifically binds to the 448-471th DNA sequence of the species.

나아가, 상술한 본 발명에서, 상기 PCR 산물을 프로브에 결합시키는 단계는 적어도 2회 이상 수행되는 것이 바람직한데, 이와 같이 상기 결합을 확인하는 단계 이전에, 추출된 DNA와 본 발명에 따른 프로브의 결합 과정을 반복적으로 수행한다면, 상기 결합을 더욱 확실히 하여 프로브와 대상 DNA 산물의 결합을 더욱 견고히 할 수 있기 때문이다.
Further, in the present invention described above, the step of binding the PCR product to the probe is preferably performed at least two or more times. Prior to the step of confirming the binding as described above, the binding of the extracted DNA and the probe according to the present invention This is because if the process is repeatedly performed, the binding can be more secured to further strengthen the binding of the probe and the target DNA product.

한편, 본 발명의 다른 실시형태는, 상술한 규조류의 종 판별 방법에 있어서, 상기 중합효소연쇄반응(PCR)을 수행하는 것은, 서열번호 1 또는 서열번호 2의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드를 정방향 프라이머 또는 역방향 프라이머로 사용하는 것을 특징으로 할 수 있다. On the other hand, in another embodiment of the present invention, in the method for determining the species of diatoms described above, performing the polymerase chain reaction (PCR) is identical to or complementary to each of the DNA sequences of SEQ ID NO: 1 or SEQ ID NO: 2. (complementary) It may be characterized by using a polynucleotide each containing a nucleotide sequence as a forward primer or a reverse primer.

즉, 본 발명에 따른 36종의 규조류에서 DNA 시료를 채취하고, 이를 증폭시켜서 PCR 산물을 증폭시키는데 있어서, 상기 규조류의 종에 적합한 특별한 염기서열을 상기 증폭을 위한 프라이머로 사용하는 것이다. 이러한 특정한 프라이머는 규조류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열에 부합하는 것으로써, 상기 추출한 DNA를 더욱 우수하게 증폭시킬 수 있다. 이를 위해 상기와 같이 혈액, 세포 또는 조직으로부터 추출된 DNA는 COI 유전자의 단염기다형성(SNP) 부위를 포함하는 것이 바람직하다.That is, in the amplification of PCR products by collecting DNA samples from 36 kinds of diatoms according to the present invention and amplifying them, a special nucleotide sequence suitable for the species of diatoms is used as a primer for the amplification. These specific primers correspond to the DNA sequence of the mononucleotide polymorphism (SNP) site of the COI gene in the mitochondrial DNA of diatoms, and thus the extracted DNA can be more excellently amplified. For this purpose, it is preferable that the DNA extracted from blood, cells or tissues as described above includes a mononucleotide polymorphism (SNP) site of the COI gene.

예를 들어, 상기 규조류에 속하는 종에 대해서는, 하기 표 2에 기재된 서열번호 1과 서열번호 2의 염기서열을 포함하는 프라이머를 정방향 프라이머와 역방향 프라이머로 이용하는 것이 바람직하다. For example, for the species belonging to the diatoms, it is preferable to use a primer containing the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 shown in Table 2 below as a forward primer and a reverse primer.

[규조류의 판별을 위한 프라이머 서열][Primer sequence for discrimination of diatoms] 프 라 이 머primer 염 기 서 열Heat 전위 프라이머(서열번호1)Translocation primer (SEQ ID NO: 1) TCAACAAATCATAAAGATATTGGTCAACAAATCATAAAGATATTGG 역위 프라이머 (서열번호2)Inverted primer (SEQ ID NO: 2) ACTTCTGGATGTCCAAAAAAYCAACTTCTGGATGTCCAAAAAAYCA

상기한 바와 같이, 본 발명은 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브를 이용하는 것이 특징이고, 이에 따라 본 발명의 다른 실시형태는 상기한 프로브, 이러한 프로브를 포함하는 DNA 칩 및 키트일 수 있다. 상기 DNA 칩 및 키트에는 프로브와의 결합 및 검출의 정확성을 높이기 위하여, 특정한 염기서열로 표시되는 별도의 위치마커(position marker)가 추가로 고정되어 있는 것도 가능하다. As described above, the present invention is characterized by using a probe each containing a nucleotide sequence identical to or complementary to each of one or more DNA sequences of SEQ ID NO: 3 to SEQ ID NO: 51, and accordingly, another implementation of the present invention The form may be the above-described probe, a DNA chip and a kit including such a probe. In order to increase the accuracy of detection and binding with the probe, the DNA chip and kit may additionally be fixed with a separate position marker indicated by a specific nucleotide sequence.

이러한 본 발명은 DNA 마이크로어레이 기술에 따라 하나의 슬라이드 위에서 다수 규조류의 종을 동시에 판별할 수 있다. 본 발명에 따른 DNA 칩 및 키트는 상기한 프로브를 포함하여, 종 특이적 단염기다형성을 DNA의 혼성화 가부에 따라 판별함으로서, 염기서열을 분석하기 않고도 분석하고자 하는 규조류의 유전자형과 그 종을 신속히 판정할 수 있는 효용성을 가지고 있다. 또한 상기 규조류에 속하는 어종을 한 번의 실험으로 정확한 유전자형을 분석할 수 있어, 상기 규조류의 유전자형과 종을 판별하는 방법을 표준화 및 자동화하는 것도 가능하다.
The present invention can simultaneously discriminate multiple species of diatoms on one slide according to the DNA microarray technology. The DNA chip and kit according to the present invention include the above probes, by determining the species-specific mononucleotide polymorphism according to the hybridization of DNA, and quickly determine the genotype of the diatom to be analyzed and its species without sequencing. It has the utility that can be done. In addition, it is possible to analyze the exact genotype of the fish species belonging to the diatoms in one experiment, and it is also possible to standardize and automate the method of discriminating the genotype and species of the diatoms.

본 발명은 하기의 실시예에 의하여 보다 더 잘 이해 될 수 있으며, 하기의 실시예는 본 발명의 예시 목적을 위한 것이며, 첨부된 특허청구범위에 의하여 한정되는 보호범위를 제한하고자 하는 것은 아니다.
The present invention may be better understood by the following examples, and the following examples are for illustrative purposes of the present invention, and are not intended to limit the scope of protection defined by the appended claims.

실시예Example 1: One: 프라이머의Of the primer 합성 synthesis

먼저, 규조류에서 추출한 DNA를 증폭시키기 위한 프라이머를 합성하였다. 본 실시예에서 사용한 규조류와 이에 따른 프라이머는 상기 표 1에 기재된 것과 같은 것을 사용하였다. First, primers for amplifying DNA extracted from diatoms were synthesized. Diatoms used in this example and primers according to the diatoms were the same as those described in Table 1 above.

대칭 또는 비대칭 PCR에 사용하는 역방향(앤티센스) 프라이머는 교잡화 반응 후에 형광을 확인하기 위하여, 말단에 로다민, cy3, cy5를 부착시켜서 제작하거나 바이오틴을 부착시켰고, 교잡화 반응 후 Syreptavidin-Cyanine과 결합하도록 제작하여 사용하였다.
Reverse (antisense) primers used for symmetric or asymmetric PCR were prepared by attaching rhodamine, cy3, and cy5 to the end to confirm fluorescence after hybridization reaction, or by attaching biotin, and after hybridization reaction with Syreptavidin-Cyanine It was made to be combined and used.

실시예Example 2: 규조류의 2: of diatoms DNADNA 추출과 Extraction department PCRPCR 반응 reaction

대한민국 연안에 서식하는 주요 규조류 36종, 즉 Achnanthes longipies, Chaetoceros atlanticus, Chaetoceros septentrionalis, Chaetoceros vistulae, Coscinodiscus rothii, Cylindrotheca fusiformis, Cymatosira lorenziana, Melosira nummuloides, Naviclua sp., Nitzschia pungens, Nitzschia subpacifica, Skeletonema costatum, Stephanopysxis turris, Thalassiosira allenii, Thalassiosira baltica, Thalassiosira conferta, Thalassiosira ostupii 종 등의 DNA는 독일 QIAGEN사의 DNeasy tissue kit을 사용하여 추출하였다.36 major diatom species living off the coast of Korea, namely Achnanthes longipies , Chaetoceros atlanticus , Chaetoceros septentrionalis , Chaetoceros vistulae , Coscinodiscus rothii , Cylindrotheca fusiformis , Cymatosira lorenziana , Melosira nummuloides , Naviclua sp ., Nitzschia pungens , Nitzschia subpacifica, Skeletonema costatum, Stephanopysxis turris , Thalassiosira allenii , Thalassiosira baltica , Thalassiosira conferta , Thalassiosira DNA such as ostupii species was extracted using DNeasy tissue kit of QIAGEN, Germany.

하기의 표 3과 같은 조건의 방법으로 PCR 반응을 DNA Engine(MJ Research사, 미국)으로 PCR 반응을 시행하였다.The PCR reaction was performed with a DNA Engine (MJ Research, USA) in the manner of the conditions shown in Table 3 below.

[프라이머 정상 증폭 확인 조건][Conditions to confirm normal amplification of primer] 반응조성Reaction composition 반응 조건Reaction conditions 멸균증류수
10X PCR buffer 2.5mM dNTP
10 uM forward
10 uM reverse
1unit Hot start Taq 정제 DNA Sterile distilled water
10X PCR buffer 2.5mM dNTP
10 uM forward
10 uM reverse
1unit Hot start Taq purified DNA 9.5 ul
2 ul
2 ul
1 ul
1 ul
0.5 ul
4 ul9.5 ul
2 ul
2 ul
1 ul
1 ul
0.5 ul
4 ul 94℃, 5분94℃, 5 minutes 1 cycle1 cycle 94℃, 30초
49℃, 30초
72℃, 1분 94℃, 30 seconds
49℃, 30 seconds
72℃, 1 minute 40 cycle40 cycle 72℃, 7분72℃, 7 minutes 1 cycle1 cycle

PCR 산물은 EtBr이 함유된 아가로스젤에 전기영동하고 UV transillunimator가 부착된 Image analyzer를 이용하여 확인하였다.
The PCR product was electrophoresed on an agarose gel containing EtBr and confirmed using an image analyzer equipped with a UV transillunimator.

실시예Example 3: 서열번호 3 내지 51의 3: of SEQ ID NO: 3 to 51 프로브Probe 제작 making

본 실시예에서는 36종 각각의 규조류에 대한 프로브를 합성하였다. 교잡화 반응을 위한 프로브의 서열정보는 상기 표 1에 나타낸 것과 같다. 규조류 각 종의 미토콘드리아 COI 유전자 염기서열의 다중 비교를 통해 가장 상동성이 낮은 염기서열 부위를 바탕으로 종 특이적인 프로브의 염기서열을 결정하였다.In this example, probes for each of 36 types of diatoms were synthesized. The sequence information of the probe for the hybridization reaction is as shown in Table 1 above. The nucleotide sequence of the species-specific probe was determined based on the nucleotide sequence site with the lowest homology through multiple comparisons of the mitochondrial COI gene sequences of each species of diatoms.

먼저, 알데히드 작용기가 처리되어 있는 글라스 위에, 상기한 서열정보를 가지는 폴리뉴클레오티드의 5'말단에 아미노 링크를 수식하고, 교잡화 반응시 슬라이드 글라스 위에 집적되어 있는 프로브 간의 공간적인 방해를 최소화시키기 위하여, 10-20 개의 올리고(dT)를 부가하여 본 발명에 따른 프로브를 완성하였다. 본 발명에서 사용한 프로브는 독일의 Metabion 사에 의뢰하여 합성하였다.
First, on the glass treated with the aldehyde functional group, in order to modify the amino link at the 5'end of the polynucleotide having the above sequence information, and to minimize the spatial interference between the probes accumulated on the slide glass during the hybridization reaction, 10-20 oligos (dT) were added to complete the probe according to the present invention. The probe used in the present invention was synthesized by requesting Metabion of Germany.

실시예Example 4: 4: DNADNA 칩 제작 Chip making

실시예 3에서 제조된 아미노 링크가 수식되어 있는 규조류 종 판별용 프로브 50 μM을 동일한 양의 3X SSC와 혼합하여 집적하였고, 이를 16시간 동안 실온에서 반응시켰다. 반응이 완료된 슬라이드는 0.1 % SDS로 5분간 2회 세척한 다음 소디움 보로하이드리드 용액 (1.3g NaBH4, 375ml PBS, 125ml EtOH)에 5분간 반응시키고 증류수로 세척한 후 진공 원심분기기에서 800 rpm 속도로 10분간 회전시켜 건조하고 상온에 보관하였다. 이렇게 제작된 DNA 칩 구조의 모식도는 도 37에 도식화하였다.50 μM of the amino link-modified diatom species discrimination probe prepared in Example 3 was mixed with the same amount of 3X SSC and accumulated, and this was reacted at room temperature for 16 hours. After the reaction was completed, the slide was washed twice with 0.1% SDS for 5 minutes, and then reacted in sodium borohydride solution (1.3g NaBH4, 375ml PBS, 125ml EtOH) for 5 minutes, washed with distilled water, and then at 800 rpm in a vacuum centrifuge. It was rotated for 10 minutes, dried, and stored at room temperature. A schematic diagram of the structure of the DNA chip thus produced is schematically illustrated in FIG. 37.

도 37은 상기 도 1 내지 36에 나타난 단염기다형성에 근거하여 제작된 올리고뉴클레오티드 프로브를 포함하는, 본 발명의 일 실시예에 따른 규조류 종 판별용 DNA칩의 구조를 도식화한 모식도이고, 여기에 도시된 바와 같이, 본 발명은 DNA 칩을 제작하기 위해 칩의 기판으로 사용된 슬라이드 상의 각 도트에 하나의 프로브만이 함유되도록 집적하고, 왼쪽 위와 오른쪽 아래 도트에는 위치 마커 (position marker)의 프로브를 집적하여 형광스캔 결과와 비교분석하는데 사용할 수 있도록 구성하였다.
37 is a schematic diagram showing the structure of a DNA chip for diatom species identification according to an embodiment of the present invention, including an oligonucleotide probe manufactured based on monobasic polymorphism shown in FIGS. 1 to 36, shown here As described above, the present invention integrates so that only one probe is contained in each dot on a slide used as a substrate for a DNA chip, and a position marker probe is integrated in the upper left and lower right dots. Thus, it was configured to be used for comparative analysis with fluorescence scan results.

실시예Example 5: 5: 교잡화Hybrid 반응 reaction

상기 실시예 2에서 얻은 PCR 산물 10 ㎕를 99℃에서 3분간 변성시키고 90 ㎕의 혼성화용액과 혼합하여 실시예 4에서 제작된 DNA 칩에 도포하고, 55℃ 습윤 반응기에서 1시간 동안 반응시켰다. 혼성화 반응 후 1X SSC와 0.1 % sarcosyl 혼합용액에 5분, 1X SSC 용액에 5분, 0.1X SSC 용액에서 1분간 교반 세척하고 진공 원심분기기에서 800 rpm 속도로 5분간 회전시켜 건조하였다. 10 µl of the PCR product obtained in Example 2 was denatured at 99° C. for 3 minutes, mixed with 90 µl of hybridization solution, applied to the DNA chip prepared in Example 4, and reacted in a humidified reactor at 55° C. for 1 hour. After the hybridization reaction, the mixture was washed with stirring in 1X SSC and 0.1% sarcosyl solution for 5 minutes, 1X SSC solution for 5 minutes, and 0.1X SSC solution for 1 minute, and then rotated in a vacuum centrifuge at 800 rpm for 5 minutes and dried.

그런 다음, GenePix 4000B 스캐너 (Molecular Device, 미국)를 이용하여 혼성화 결과를 분석하여 규조류 종에 따란 칩 상에 나타난 형광의 분포가 다르게 나타나며, 종 사이의 판별력이 있음을 확인하였다. 그 결과는 도 38 내지 도 54에 나타낸 바와 같다. Then, by analyzing the hybridization result using a GenePix 4000B scanner (Molecular Device, USA), it was confirmed that the distribution of fluorescence appeared on the chip according to the diatom species was different, and there was discriminant power between species. The results are as shown in Figs. 38 to 54.

도 38 내지 도 54는 각각 상기 도 37의 DNA칩을 이용하여 본 발명에 따른 올리고뉴클레오티드 프로브와 Achanathes longipes 를 비롯한 특정 규조류의 PCR 증폭산물을 결합시킨 후의 반응 결과를 나타내는 사진이다. 38 to 54 show the oligonucleotide probe and Achanathes according to the present invention using the DNA chip of FIG. 37, respectively. This is a photograph showing the reaction result after combining the PCR amplification products of certain diatoms including longipes.

여기서, 도 38은 Achnanthes longipes, 도 39는 Chaetoceros atlanticus, 도 40은 Chaetoceros septentrionalis, 도 41는 Chaetoceros vistulae, 도 42는 Coscinodiscus rothii, 도 43은 Cylindrotheca fusiformi, 도 44은 Cymatosira lorenziana, 도 45은 Melosira nummuloides, 도 46은 Navicula sp ., 도 47은 Nitzschia pungens, 도 48은 Nitzschia subpacifica, 도 49는 Skeletonema costatum, 도 50은 Stephanopyxis turris, 도 51는 Thalassiosira allenii, 도 52는 Thalassiosira baltica, 도 53은 Thalassiosira conferta, 도 54은 Thalassiosira ostupii에 대한 결과이다. Here, Figure 38 is Achnanthes longipes , Figure 39 is Chaetoceros atlanticus , Figure 40 is Chaetoceros septentrionalis , Figure 41 is Chaetoceros vistulae , Figure 42 is Coscinodiscus rothii , Figure 43 is Cylindrotheca fusiformi , Figure 44 is Cymatosira lorenziana , Figure 45 is Melosira nummuloides , Figure 46 is Navicula sp . , Figure 47 is Nitzschia pungens , Figure 48 is Nitzschia subpacifica , Figure 49 is Skeletonema costatum , Figure 50 is Stephanopyxis turris , Figure 51 is Thalassiosira allenii , Figure 52 is Thalassiosira baltica , Figure 53 is Thalassiosira conferta , Figure 54 is the result for Thalassiosira ostupii.

여기에 도시된 것과 같이, 본 발명에 의하는 경우 해당 생물 종에 따라 형광 표지가 다르게 나타나므로, 이에 따라 해당 종을 판별할 수 있음을 확인하였다.
As shown here, in the case of the present invention, since the fluorescent label appears differently depending on the species in question, it was confirmed that the species can be identified accordingly.

본 발명에 의하는 경우, 하나의 슬라이드 위에서 다수의 해양 생물 종에 대한 유전자형 분석을 간단하고 신속, 정확하게 판별할 수 있는 효과가 있다. 본 발명에 따라 해양 생물 30종의 미토콘드리아 COI지역을 유전자 표지로 사용하면, 종래의 형태학적 구별법으로 해당 종을 판별하는 지금까지의 방법이 가졌던 낮은 분해능의 문제점을 해결 할 수 있다. 종래와 같이, 형태학적인 차이점을 기초로 판별하는 것 보다 본 발명에 따라 단염기다형성을 근거로한 DNA칩 방법을 이용하면, 종래기술보다 한 단계 진보된 형태의 유전자 분석법을 제공하여, 더욱 효과적으로 해양 생물종을 판별할 수 있고, 분해능도 현저히 증가시킬 수 있다. According to the present invention, there is an effect of being able to easily, quickly and accurately discriminate genotyping for a plurality of marine species on one slide. If the mitochondrial COI region of 30 marine organisms according to the present invention is used as a genetic marker, it is possible to solve the problem of low resolution of the conventional method of discriminating the species by the conventional morphological discrimination method. If the DNA chip method based on monobasic polymorphism according to the present invention is used rather than discriminating based on morphological differences as in the prior art, it provides a more advanced genetic analysis method than the prior art, and more effectively marine Species can be identified, and resolution can be significantly increased.

그리고 본 발명에 따라 상기한 폴리뉴클레오티드 프로브를 사용하여 마이크로어레이 방법을 활용하면, 종 특이적 단염기다형성을 DNA의 혼성화 가부에 따라 판별함으로써, 염기서열을 분석하지 않고도 각 생물종의 유전자형을 신속히 판정할 수 있는 적용성을 갖고 있다. 또한 다수의 생물종을 한 번의 실험으로 정확한 유전자형을 분석할 수 있어, 해당 생물종의 유전자형을 표준화, 자동화할 수 있도록 기술 개발의 적용성을 극대화시켰다. 즉, 본 발명은 종래의 방법에 비해 시료를 분석하는 데 걸리는 시간을 크게 단축시켰으며, 다량의 시료를 짧은 시간 내에 처리할 수 있는 효과가 있다.
In addition, by using the microarray method using the polynucleotide probe described above according to the present invention, the genotype of each species is quickly determined without analyzing the base sequence by discriminating the species-specific mononucleotide polymorphism according to the hybridization of DNA. It has the applicability that can be done. In addition, it is possible to analyze the exact genotype of multiple species in one experiment, maximizing the applicability of technology development to standardize and automate the genotype of the species. That is, the present invention significantly shortens the time taken to analyze a sample compared to the conventional method, and has the effect of being able to process a large amount of samples within a short time.

한편, 상기에서는 본 발명을 특정의 바람직한 실시예에 관련하여 도시하고 설명하였지만, 이하의 특허청구범위에 의해 마련되는 본 발명의 기술적 특징이나 분야를 이탈하지 않는 한도 내에서 본 발명이 다양하게 개조 및 변화될 수 있다는 것은 당업계에서 통상의 지식을 가진 자에게 명백한 것이다.
On the other hand, in the above, the present invention has been shown and described in connection with specific preferred embodiments, but the present invention is variously modified and modified within the scope of not departing from the technical features or fields of the present invention provided by the following claims. It is obvious to one of ordinary skill in the art that it can be changed.

<110> Korea Ocean Research & Development Institute <120> Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same <130> 0001 <160> 51 <170> KopatentIn 1.71 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 tcaacaaatc ataaagatat tgg 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 acttctggat gtccaaaaaa yca 23 <210> 3 <211> 23 <212> DNA <213> Achnanthes longipes <220> <221> gene <222> Complement((1)..(23)) <223> 26-49 <400> 3 cactgcaaaa atcagataga gcg 23 <210> 4 <211> 23 <212> DNA <213> Amphora sp. <220> <221> gene <222> Complement((1)..(23)) <223> 544-567 <400> 4 gctccaggct tttttatgca taa 23 <210> 5 <211> 23 <212> DNA <213> Amphora sp. <220> <221> gene <222> Complement((1)..(23)) <223> 55-78 <400> 5 gaaactacag ttccaataac acc 23 <210> 6 <211> 23 <212> DNA <213> Asterionella glacialis <220> <221> gene <222> Complement((1)..(23)) <223> 706-729 <400> 6 gatcctgtct tataccagca ttt 23 <210> 7 <211> 23 <212> DNA <213> Asterionella glacialis <220> <221> gene <222> Complement((1)..(23)) <223> 485-508 <400> 7 ctggtgcttc atcaatatta ggt 23 <210> 8 <211> 23 <212> DNA <213> Chaetoceros atlanticus <220> <221> gene <222> Complement((1)..(23)) <223> 58-81 <400> 8 aaagatagag cagtcccagc tac 23 <210> 9 <211> 23 <212> DNA <213> Chaetoceros atlanticus <220> <221> gene <222> Complement((1)..(23)) <223> 39-62 <400> 9 ctactccaga tattgcacca aaa 23 <210> 10 <211> 23 <212> DNA <213> Chaetoceros didymus <220> <221> gene <222> Complement((1)..(23)) <223> 638-706 <400> 10 tttttgaccc tgcagggggt gga 23 <210> 11 <211> 23 <212> DNA <213> Chaetoceros didymus <220> <221> gene <222> Complement((1)..(23)) <223> 625-648 <400> 11 ccagtgcttg cgggagctat tac 23 <210> 12 <211> 23 <212> DNA <213> Chaetoceros septentrionalis <220> <221> gene <222> Complement((1)..(23)) <223> 639-662 <400> 12 ggcaattacc atgcttttaa ctg 23 <210> 13 <211> 23 <212> DNA <213> Chaetoceros vistulae <220> <221> gene <222> Complement((1)..(23)) <223> 585-608 <400> 13 ggctgtctta ataacagctt tct 23 <210> 14 <211> 23 <212> DNA <213> Chaetoceros vistulae <220> <221> gene <222> Complement((1)..(23)) <223> 447-470 <400> 14 tggcgcagtg gatttagcta ttt 23 <210> 15 <211> 23 <212> DNA <213> Chlorella ellipsoidea, C. schroeteri <220> <221> gene <222> Complement((1)..(23)) <223> 706-729 <400> 15 gatcccgtat tgtaccaaca ttt 23 <210> 16 <211> 23 <212> DNA <213> Chlorella ellipsoidea, C. schroeteri <220> <221> gene <222> Complement((1)..(23)) <223> 551-574 <400> 16 gtatgagtat gcatagacta cct 23 <210> 17 <211> 21 <212> DNA <213> Chlorophyta UF <220> <221> gene <222> Complement((1)..(21)) <223> 709-730 <400> 17 cccagtcttg ttccagcaca t 21 <210> 18 <211> 21 <212> DNA <213> Chlorophyta UF <220> <221> gene <222> Complement((1)..(21)) <223> 654-675 <400> 18 tgctgatgga catccacttc g 21 <210> 19 <211> 23 <212> DNA <213> Coscinodiscus perforatus, C. rothii <220> <221> gene <222> Complement((1)..(23)) <223> 635-658 <400> 19 caggtgctat cacaatgctt tta 23 <210> 20 <211> 23 <212> DNA <213> Coscinodiscus perforatus, C. rothii <220> <221> gene <222> Complement((1)..(23)) <223> 482-505 <400> 20 tatcgggagc tgcttctatt tta 23 <210> 21 <211> 23 <212> DNA <213> Cylindrotheca closterium <220> <221> gene <222> Complement((1)..(23)) <223> 547-570 <400> 21 ccagaaatgg cttggcataa att 23 <210> 22 <211> 23 <212> DNA <213> Cylindrotheca closterium <220> <221> gene <222> Complement((1)..(23)) <223> 534-557 <400> 22 aaatatgcga agtccagaaa tgg 23 <210> 23 <211> 23 <212> DNA <213> Cylindrotheca fusiformi <220> <221> gene <222> Complement((1)..(23)) <223> 700-723 <400> 23 ggaggtgatc caatacttta tca 23 <210> 24 <211> 23 <212> DNA <213> Cymatosira lorenziana <220> <221> gene <222> Complement((1)..(21)) <223> 684-704 <400> 24 ctttagtgca acgggtggtg gtg 23 <210> 25 <211> 23 <212> DNA <213> Cymatosira lorenziana <220> <221> gene <222> Complement((1)..(23)) <223> 651-674 <400> 25 gcttttgaca gatcgttttt acg 23 <210> 26 <211> 23 <212> DNA <213> Ditylum brightwellii <220> <221> gene <222> Complement((1)..(23)) <223> 478-501 <400> 26 catctttctg gtgcttcttc tat 23 <210> 27 <211> 23 <212> DNA <213> Gloeocystis gigas <220> <221> gene <222> Complement((1)..(23)) <223> 540-563 <400> 27 gagagcaata ggaatgacat ttc 23 <210> 28 <211> 23 <212> DNA <213> Gyrodimium impudicum <220> <221> gene <222> Complement((1)..(23)) <223> 677-700 <400> 28 ctacctttta cgatccggca gga 23 <210> 29 <211> 21 <212> DNA <213> Heterosigma akashiwo <220> <221> gene <222> Complement((1)..(21)) <223> 580-601 <400> 29 tccttgggct atccttatca c 21 <210> 30 <211> 23 <212> DNA <213> Melosira nummuloides <220> <221> gene <222> Complement((1)..(23)) <223> 707-729 <400> 30 gatcccgttc tttatcaaca tct 23 <210> 31 <211> 23 <212> DNA <213> Melosira nummuloides <220> <221> gene <222> Complement((1)..(23)) <223> 681-704 <400> 31 tttttttgac cccgcaggag gcg 23 <210> 32 <211> 23 <212> DNA <213> Melosira nummuloides <220> <221> gene <222> Complement((1)..(23)) <223> 626-649 <400> 32 ctgttcttgc tggagctatt act 23 <210> 33 <211> 23 <212> DNA <213> Navicula sp. <220> <221> gene <222> Complement((1)..(23)) <223> 706-729 <400> 33 gatccagttt tataccagca ctt 23 <210> 34 <211> 23 <212> DNA <213> Navicula sp. <220> <221> gene <222> Complement((1)..(23)) <223> 580-603 <400> 34 gtgtggtcag tatttttaac agc 23 <210> 35 <211> 23 <212> DNA <213> Nitzschia pungens <220> <221> gene <222> Complement((1)..(23)) <223> 100-723 <400> 35 ggaggagacc ctatattata tca 23 <210> 36 <211> 23 <212> DNA <213> Nitzschia pungens <220> <221> gene <222> Complement((1)..(23)) <223> 634-657 <400> 36 gcagcaggta taactatgtt gtt 23 <210> 37 <211> 23 <212> DNA <213> Nitzschia subpacifica <220> <221> gene <222> Complement((1)..(23)) <223> 710-733 <400> 37 ctgtgttatt ccagcactta ttc 23 <210> 38 <211> 23 <212> DNA <213> Prorocentrum minimum <220> <221> gene <222> Complement((1)..(23)) <223> 21-44 <400> 38 caaaaatgag ataaagcgtg cca 23 <210> 39 <211> 23 <212> DNA <213> Skeletonema costatum <220> <221> gene <222> Complement((1)..(23)) <223> 712-734 <400> 39 gtcttgtttc agcatctttt ctg 23 <210> 40 <211> 23 <212> DNA <213> Skeletonema costatum <220> <221> gene <222> Complement((1)..(23)) <223> 626-649 <400> 40 ctgttttagc tggagctatt aca 23 <210> 41 <211> 23 <212> DNA <213> Stephanopyxis turris <220> <221> gene <222> Complement((1)..(23)) <223> 571-594 <400> 41 cctttatttg cctggtcagt ttt 23 <210> 42 <211> 21 <212> DNA <213> Thalassiosira allenii <220> <221> gene <222> Complement((1)..(21)) <223> 678-699 <400> 42 cagcgttctt taatgctgct g 21 <210> 43 <211> 23 <212> DNA <213> Thalassiosira allenii <220> <221> gene <222> Complement((1)..(23)) <223> 651-674 <400> 43 gttgattact gatcgtcact ttg 23 <210> 44 <211> 23 <212> DNA <213> Thalassiosira baltica. T. decepiens, T. puntigera <220> <221> gene <222> Complement((1)..(23)) <223> 491-514 <400> 44 catcttctrt tctaggtgct att 23 <210> 45 <211> 23 <212> DNA <213> Thalassiosira conferta <220> <221> gene <222> Complement((1)..(23)) <223> 637-660 <400> 45 ggagcgatta caatgctatt aac 23 <210> 46 <211> 23 <212> DNA <213> Thalassiosira nordenskioldi, T. weissflogii <220> <221> gene <222> Complement((1)..(23)) <223> 491-514 <400> 46 cttcttctat tctaggggca atc 23 <210> 47 <211> 23 <212> DNA <213> Thalassiosira nordenskioldi, T. weissflogii <220> <221> gene <222> Complement((1)..(23)) <223> 464-487 <400> 47 ctatctttag tttgcacgtg tct 23 <210> 48 <211> 23 <212> DNA <213> Thalassiosira nordenskioldi, T. weissflogii <220> <221> gene <222> Complement((1)..(23)) <223> 491-514 <400> 48 cttcttctat tctaggggca atc 23 <210> 49 <211> 23 <212> DNA <213> Thalassiosira ostupii <220> <221> gene <222> Complement((1)..(23)) <223> 584-607 <400> 49 gggcaacatt aattacagca ttc 23 <210> 50 <211> 23 <212> DNA <213> Thalassiosira rotula <220> <221> gene <222> Complement((1)..(23)) <223> 242-265 <400> 50 ttaacgggac aaatcagtta cca 23 <210> 51 <211> 23 <212> DNA <213> Thalassiosira rotula <220> <221> gene <222> Complement((1)..(23)) <223> 448-471 <400> 51 ggttctgtag acttagcgat att 23 <110> Korea Ocean Research & Development Institute <120> Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same <130> 0001 <160> 51 <170> KopatentIn 1.71 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 tcaacaaatc ataaagatat tgg 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 acttctggat gtccaaaaaa yca 23 <210> 3 <211> 23 <212> DNA <213> Achnanthes longipes <220> <221> gene <222> Complement((1)..(23)) <223> 26-49 <400> 3 cactgcaaaa atcagataga gcg 23 <210> 4 <211> 23 <212> DNA <213> Amphora sp. <220> <221> gene <222> Complement((1)..(23)) <223> 544-567 <400> 4 gctccaggct tttttatgca taa 23 <210> 5 <211> 23 <212> DNA <213> Amphora sp. <220> <221> gene <222> Complement((1)..(23)) <223> 55-78 <400> 5 gaaactacag ttccaataac acc 23 <210> 6 <211> 23 <212> DNA <213> Asterionella glacialis <220> <221> gene <222> Complement((1)..(23)) <223> 706-729 <400> 6 gatcctgtct tataccagca ttt 23 <210> 7 <211> 23 <212> DNA <213> Asterionella glacialis <220> <221> gene <222> Complement((1)..(23)) <223> 485-508 <400> 7 ctggtgcttc atcaatatta ggt 23 <210> 8 <211> 23 <212> DNA <213> Chaetoceros atlanticus <220> <221> gene <222> Complement((1)..(23)) <223> 58-81 <400> 8 aaagatagag cagtcccagc tac 23 <210> 9 <211> 23 <212> DNA <213> Chaetoceros atlanticus <220> <221> gene <222> Complement((1)..(23)) <223> 39-62 <400> 9 ctactccaga tattgcacca aaa 23 <210> 10 <211> 23 <212> DNA <213> Chaetoceros didymus <220> <221> gene <222> Complement((1)..(23)) <223> 638-706 <400> 10 tttttgaccc tgcagggggt gga 23 <210> 11 <211> 23 <212> DNA <213> Chaetoceros didymus <220> <221> gene <222> Complement((1)..(23)) <223> 625-648 <400> 11 ccagtgcttg cgggagctat tac 23 <210> 12 <211> 23 <212> DNA <213> Chaetoceros septentrionalis <220> <221> gene <222> Complement((1)..(23)) <223> 639-662 <400> 12 ggcaattacc atgcttttaa ctg 23 <210> 13 <211> 23 <212> DNA <213> Chaetoceros vistulae <220> <221> gene <222> Complement((1)..(23)) <223> 585-608 <400> 13 ggctgtctta ataacagctt tct 23 <210> 14 <211> 23 <212> DNA <213> Chaetoceros vistulae <220> <221> gene <222> Complement((1)..(23)) <223> 447-470 <400> 14 tggcgcagtg gatttagcta ttt 23 <210> 15 <211> 23 <212> DNA <213> Chlorella ellipsoidea, C. schroeteri <220> <221> gene <222> Complement((1)..(23)) <223> 706-729 <400> 15 gatcccgtat tgtaccaaca ttt 23 <210> 16 <211> 23 <212> DNA <213> Chlorella ellipsoidea, C. schroeteri <220> <221> gene <222> Complement((1)..(23)) <223> 551-574 <400> 16 gtatgagtat gcatagacta cct 23 <210> 17 <211> 21 <212> DNA <213> Chlorophyta UF <220> <221> gene <222> Complement((1)..(21)) <223> 709-730 <400> 17 cccagtcttg ttccagcaca t 21 <210> 18 <211> 21 <212> DNA <213> Chlorophyta UF <220> <221> gene <222> Complement((1)..(21)) <223> 654-675 <400> 18 tgctgatgga catccacttc g 21 <210> 19 <211> 23 <212> DNA <213> Coscinodiscus perforatus, C. rothii <220> <221> gene <222> Complement((1)..(23)) <223> 635-658 <400> 19 caggtgctat cacaatgctt tta 23 <210> 20 <211> 23 <212> DNA <213> Coscinodiscus perforatus, C. rothii <220> <221> gene <222> Complement((1)..(23)) <223> 482-505 <400> 20 tatcgggagc tgcttctatt tta 23 <210> 21 <211> 23 <212> DNA <213> Cylindrotheca closterium <220> <221> gene <222> Complement((1)..(23)) <223> 547-570 <400> 21 ccagaaatgg cttggcataa att 23 <210> 22 <211> 23 <212> DNA <213> Cylindrotheca closterium <220> <221> gene <222> Complement((1)..(23)) <223> 534-557 <400> 22 aaatatgcga agtccagaaa tgg 23 <210> 23 <211> 23 <212> DNA <213> Cylindrotheca fusiformi <220> <221> gene <222> Complement((1)..(23)) <223> 700-723 <400> 23 ggaggtgatc caatacttta tca 23 <210> 24 <211> 23 <212> DNA <213> Cymatosira lorenziana <220> <221> gene <222> Complement((1)..(21)) <223> 684-704 <400> 24 ctttagtgca acgggtggtg gtg 23 <210> 25 <211> 23 <212> DNA <213> Cymatosira lorenziana <220> <221> gene <222> Complement((1)..(23)) <223> 651-674 <400> 25 gcttttgaca gatcgttttt acg 23 <210> 26 <211> 23 <212> DNA <213> Ditylum brightwellii <220> <221> gene <222> Complement((1)..(23)) <223> 478-501 <400> 26 catctttctg gtgcttcttc tat 23 <210> 27 <211> 23 <212> DNA <213> Gloeocystis gigas <220> <221> gene <222> Complement((1)..(23)) <223> 540-563 <400> 27 gagagcaata ggaatgacat ttc 23 <210> 28 <211> 23 <212> DNA <213> Gyrodimium impudicum <220> <221> gene <222> Complement((1)..(23)) <223> 677-700 <400> 28 ctacctttta cgatccggca gga 23 <210> 29 <211> 21 <212> DNA <213> Heterosigma akashiwo <220> <221> gene <222> Complement((1)..(21)) <223> 580-601 <400> 29 tccttgggct atccttatca c 21 <210> 30 <211> 23 <212> DNA <213> Melosira nummuloides <220> <221> gene <222> Complement((1)..(23)) <223> 707-729 <400> 30 gatcccgttc tttatcaaca tct 23 <210> 31 <211> 23 <212> DNA <213> Melosira nummuloides <220> <221> gene <222> Complement((1)..(23)) <223> 681-704 <400> 31 tttttttgac cccgcaggag gcg 23 <210> 32 <211> 23 <212> DNA <213> Melosira nummuloides <220> <221> gene <222> Complement((1)..(23)) <223> 626-649 <400> 32 ctgttcttgc tggagctatt act 23 <210> 33 <211> 23 <212> DNA <213> Navicula sp. <220> <221> gene <222> Complement((1)..(23)) <223> 706-729 <400> 33 gatccagttt tataccagca ctt 23 <210> 34 <211> 23 <212> DNA <213> Navicula sp. <220> <221> gene <222> Complement((1)..(23)) <223> 580-603 <400> 34 gtgtggtcag tatttttaac agc 23 <210> 35 <211> 23 <212> DNA <213> Nitzschia pungens <220> <221> gene <222> Complement((1)..(23)) <223> 100-723 <400> 35 ggaggagacc ctatattata tca 23 <210> 36 <211> 23 <212> DNA <213> Nitzschia pungens <220> <221> gene <222> Complement((1)..(23)) <223> 634-657 <400> 36 gcagcaggta taactatgtt gtt 23 <210> 37 <211> 23 <212> DNA <213> Nitzschia subpacifica <220> <221> gene <222> Complement((1)..(23)) <223> 710-733 <400> 37 ctgtgttatt ccagcactta ttc 23 <210> 38 <211> 23 <212> DNA <213> Prorocentrum minimum <220> <221> gene <222> Complement((1)..(23)) <223> 21-44 <400> 38 caaaaatgag ataaagcgtg cca 23 <210> 39 <211> 23 <212> DNA <213> Skeletonema costatum <220> <221> gene <222> Complement((1)..(23)) <223> 712-734 <400> 39 gtcttgtttc agcatctttt ctg 23 <210> 40 <211> 23 <212> DNA <213> Skeletonema costatum <220> <221> gene <222> Complement((1)..(23)) <223> 626-649 <400> 40 ctgttttagc tggagctatt aca 23 <210> 41 <211> 23 <212> DNA <213> Stephanopyxis turris <220> <221> gene <222> Complement((1)..(23)) <223> 571-594 <400> 41 cctttatttg cctggtcagt ttt 23 <210> 42 <211> 21 <212> DNA <213> Thalassiosira allenii <220> <221> gene <222> Complement((1)..(21)) <223> 678-699 <400> 42 cagcgttctt taatgctgct g 21 <210> 43 <211> 23 <212> DNA <213> Thalassiosira allenii <220> <221> gene <222> Complement((1)..(23)) <223> 651-674 <400> 43 gttgattact gatcgtcact ttg 23 <210> 44 <211> 23 <212> DNA <213> Thalassiosira baltica. T. decepiens, T. puntigera <220> <221> gene <222> Complement((1)..(23)) <223> 491-514 <400> 44 catcttctrt tctaggtgct att 23 <210> 45 <211> 23 <212> DNA <213> Thalassiosira conferta <220> <221> gene <222> Complement((1)..(23)) <223> 637-660 <400> 45 ggagcgatta caatgctatt aac 23 <210> 46 <211> 23 <212> DNA <213> Thalassiosira nordenskioldi, T. weissflogii <220> <221> gene <222> Complement((1)..(23)) <223> 491-514 <400> 46 cttcttctat tctaggggca atc 23 <210> 47 <211> 23 <212> DNA <213> Thalassiosira nordenskioldi, T. weissflogii <220> <221> gene <222> Complement((1)..(23)) <223> 464-487 <400> 47 ctatctttag tttgcacgtg tct 23 <210> 48 <211> 23 <212> DNA <213> Thalassiosira nordenskioldi, T. weissflogii <220> <221> gene <222> Complement((1)..(23)) <223> 491-514 <400> 48 cttcttctat tctaggggca atc 23 <210> 49 <211> 23 <212> DNA <213> Thalassiosira ostupii <220> <221> gene <222> Complement((1)..(23)) <223> 584-607 <400> 49 gggcaacatt aattacagca ttc 23 <210> 50 <211> 23 <212> DNA <213> Thalassiosira rotula <220> <221> gene <222> Complement((1)..(23)) <223> 242-265 <400> 50 ttaacgggac aaatcagtta cca 23 <210> 51 <211> 23 <212> DNA <213> Thalassiosira rotula <220> <221> gene <222> Complement((1)..(23)) <223> 448-471 <400> 51 ggttctgtag acttagcgat att 23

Claims (8)

규조류(diatom)에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계;
상기 PCR 산물을, 서열번호 42 및 서열번호 43 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및,
상기 결합 여부에 따라 상기 규조류의 종(species)을 판별하는 단계;를 포함하는 규조류의 종(species) 판별 방법.
Obtaining a PCR product by performing a polymerase chain reaction (PCR) on DNA extracted from a diatom;
Binding the PCR product to a probe comprising a base sequence identical to or complementary to each DNA sequence of at least one of SEQ ID NO: 42 and SEQ ID NO: 43; And
And determining the species of the diatom according to the presence or absence of the binding.
제1항에 있어서, 상기 규조류는 Thalassiosira allenii 인 것을 특징으로 하는 규조류의 종 판별 방법.
The method of claim 1, wherein the diatoms are selected from the group consisting of Thalassiosira allenii Wherein the diatom is classified into two types.
제1항에 있어서, 상기 프로브는 상기 규조류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성 부위와 결합하고, 상기 결합은 상기 규조류의 종에 따라 다르게 이루어지는 것을 특징으로 하는 규조류의 종 판별 방법.
[3] The method according to claim 1, wherein the probe binds to a monoclonal polymorphic site of the COI gene in the mitochondrial DNA of the diatom, and the binding is different depending on the species of the diatom.
제3항에 있어서, 상기 결합이 상기 규조류의 종에 따라 다르게 이루어진다는 것은, 서열번호 42의 염기서열을 포함하는 프로브는 Thalassiosira allenii 종의 미토콘드리아 DNA 중 COI 유전자 부위의 678-699번째 DNA 서열과 특이적으로 결합하고, 서열번호 43의 염기서열을 포함하는 프로브는 Thalassiosira allenii 종의 미토콘드리아 DNA 중 COI 유전자 부위의 651-674번째 DNA 서열과 특이적으로 결합하는 것을 특징으로 하는 규조류의 종 판별 방법.
The probe according to claim 3, wherein the binding is different depending on the species of the diatoms, wherein the probe comprising the nucleotide sequence of SEQ ID NO: 42 is Thalassiosira allenii Species specific mitochondrial DNA of the COI 678-699 second DNA sequence of the gene region is coupled to a probe comprising a base sequence of SEQ ID NO: 43 is Thalassiosira allenii Wherein the DNA is specifically bound to the 651-674th DNA sequence of the COI gene in the mitochondrial DNA of the species.
제1항에 있어서, 상기 중합효소연쇄반응(PCR)을 수행하는 것은, 서열번호 1 또는 서열번호 2의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드를 정방향 프라이머 또는 역방향 프라이머로 사용하는 것을 특징으로 하는 규조류의 종 판별 방법.
2. The method according to claim 1, wherein the PCR is performed using a polynucleotide comprising a nucleotide sequence identical to or complementary to the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 2, Or as a reverse primer.
서열번호 42 및 서열번호 43 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 폴리뉴클레오티드로 이루어진 규조류의 종(species) 판별용 프로브.
And at least one polynucleotide comprising a nucleotide sequence identical to or complementary to at least one DNA sequence selected from SEQ ID NO: 42 and SEQ ID NO: 43, respectively.
서열번호 42 및 서열번호 43 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 프로브를 포함하는 규조류의 종(species) 판별용 DNA 칩.
And at least one probe comprising a base sequence identical to or complementary to at least one DNA sequence selected from SEQ ID NO: 42 and SEQ ID NO: 43, respectively.
규조류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열과 결합하는 것으로, 서열번호 42 및 서열번호 43 중 어느 하나의 DNA 서열과 동일하거나 상보적인(complementary) 15-30개의 연속 염기서열로 이루어진 것을 특징으로 하는 폴리뉴클레오티드 프로브와;
상기 규조류의 미토콘드리아 DNA를 중합효소연쇄반응(PCR)으로 증폭시키기 위한 프라이머를 포함하는 것을 특징으로 하는 규조류의 종(species) 판별용 키트.
(SNP) site DNA sequence of the COI gene in the mitochondrial DNA of the diatom, wherein the DNA sequence of 15-30 consecutive nucleotides identical or complementary to the DNA sequence of SEQ ID NO: 42 and SEQ ID NO: 43 A polynucleotide probe comprising: a polynucleotide probe;
And a primer for amplifying the mitochondrial DNA of the diatoms by polymerase chain reaction (PCR).
KR1020140012242A 2014-02-03 2014-02-03 Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same KR101403352B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140012242A KR101403352B1 (en) 2014-02-03 2014-02-03 Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140012242A KR101403352B1 (en) 2014-02-03 2014-02-03 Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020100024939A Division KR101403351B1 (en) 2010-03-19 2010-03-19 Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Publications (2)

Publication Number Publication Date
KR20140020346A true KR20140020346A (en) 2014-02-18
KR101403352B1 KR101403352B1 (en) 2014-06-05

Family

ID=50267356

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140012242A KR101403352B1 (en) 2014-02-03 2014-02-03 Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Country Status (1)

Country Link
KR (1) KR101403352B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101955124B1 (en) * 2017-12-14 2019-03-12 아쿠아진텍주식회사 PCR primer sets for amplifying and sequencing mitochondrial cytochrome c oxidase 1 (CO1) gene used for DNA barcoding of marine fishes and uses thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101955124B1 (en) * 2017-12-14 2019-03-12 아쿠아진텍주식회사 PCR primer sets for amplifying and sequencing mitochondrial cytochrome c oxidase 1 (CO1) gene used for DNA barcoding of marine fishes and uses thereof

Also Published As

Publication number Publication date
KR101403352B1 (en) 2014-06-05

Similar Documents

Publication Publication Date Title
KR101403351B1 (en) Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR100956323B1 (en) Multiplex real time pcr method for discrimination of rice cultivar
Wang et al. Nuclear simple sequence repeat markers are superior to DNA barcodes for identification of closely related Rhododendron species on the same mountain
CN107354202B (en) Primer combination and kit for identifying flue-cured tobacco K326, application and identification method
KR101151757B1 (en) Identifying Method of jellyfish in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR102052428B1 (en) SSR molecular markers for discriminating Korean wild grape accessions and uses thereof
KR101660951B1 (en) Single nucleotide polymophism maker for selecting watermelon clutivar and uses thereof
KR20130136264A (en) Specific primers for pines distinction, analysis kit using its primers, and pines distinciton method using thereof
AU2021101595A4 (en) SSR molecular marker primer set for identifying Cattleya Alliance and use thereof
KR101248425B1 (en) Probe composition for determining phylogenetic classification of animals belonging to Cetacea, phylogenetic classification DNA chip and kit, and phylogenetic classification method using the same
CN112143829B (en) Typing and application of universal SNP (single nucleotide polymorphism) markers
KR101403359B1 (en) Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
JP5799600B2 (en) Species identification method of Eucalyptus hybrids
KR101286989B1 (en) Multiplex real time pcr method for discrimination of rice cultivar
KR101403352B1 (en) Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR101403362B1 (en) Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR101403353B1 (en) Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
Tang et al. Molecular identification and genetic-polymorphism analysis of Fasciola flukes in Dali Prefecture, Yunnan Province, China
KR101630814B1 (en) SNP molecular markers associated with distinction of grape understock variety and uses thereof
JP2007037468A (en) Method for discriminating variety of rice by using microsatelite marker
KR20120078193A (en) Multiplex real time pcr method for discrimination of rice cultivar
KR20110042734A (en) Identifying method of origin and species about squids, polynucleotide probe, dna chip and kit for identifying the same
KR101822390B1 (en) Maker for cultivar discrimination in Korean breeding wheat and method for determination using the same
CN107354203B (en) Primer combination and kit for identifying cured tobacco Bina No. 1, application and detection method
CN107345252B (en) Primer combination and kit for identifying 96 of flue-cured tobacco Qin tobacco, application and identification method

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
J202 Request for trial (for correction)
J301 Trial decision

Free format text: TRIAL DECISION FOR CORRECTION REQUESTED 20140814

Effective date: 20141121

FPAY Annual fee payment

Payment date: 20170524

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180503

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190417

Year of fee payment: 6