KR20130136264A - Specific primers for pines distinction, analysis kit using its primers, and pines distinciton method using thereof - Google Patents

Abstract

The present invention relates to: a SNP primer capable of easily differentiating P. densiflora, P. thunbergii, P. sylvestris, P. densiflora for. Multicanlis, P. rigida, P. rigitaeda, P. mugo, P. koraiensis, and P. bungean; a kit including the same; and a method for differentiating pines using the same. According to the present invention, the SNP primer for differentiating pines on the basis of trnT(UGU)- trnL(UAA)3' axon of chlorophyll of pine leaves can easily differentiate pines which are difficult to be morphologically differentiate such as P. densiflora, P. thunbergii, P. sylvestris, P. densiflora for. Multicanlis, P. rigida, P. rigitaeda, P. mugo, P. koraiensis, P. bungean and the like so as to secure genetic specificity of Korean red pines and to provide as a breed development marker for Korean red pines. Additionally, the present invention can block disguise of imported log as Korean red pines to be sold at a high price, and therefore, it can establish a distribution order system in a purely functional way and prevent imported log from illegally being brought in to the country.

Description

[0001] The present invention relates to SNP primers for distinguishing pine species, a kit containing the SNP primers, and a method for distinguishing pine trees using the same. [0002] Specific primers for pines distinction,

The present invention relates to a SNP primer capable of easily discriminating between a pine tree, a pine tree, a Siberian pine tree, a conveyor, a ligature, a lycetta, a mugo, a pine tree, and a pine tree, a kit including the SNP primer, and a pine tree discriminating method using the same.

Pinus densiflora ) is a pine tree species and is classified as evergreen tree or shrub. They grow in the American tropics, northern Eurasia, and in Southeast Asia (Plomion et al. 2007).

The pine tree is the most economical wood production, and it is used as raw material of pulp. It can produce terfenfin oil and rosin as by-products, which is very useful value. Especially, in the case of wintering, it is a representative softwood of Korea, so it is good for wood and it is widely used for building and furniture materials. However, as the quantity of imported wood is increasing recently, it is difficult to distinguish between the wrinkled and radiating ducts due to the anatomical structure, despite the fact that the cheap Soviet shipments are sold by the Korean shipments. Therefore, it is imperative to find a marker that can distinguish between the shipment and the Savior's shipment, and that can systematically analyze Mucho, Rigida, Rigida, Haesong, and Baitsong belonging to the same group and barcode them.

DNA barcodes are research methods that are applied to the identification, classification, and identification of cultivars using the relatively short and similarity of generalized DNA sequences. The CBOL Plant Working Group, 2009, has been evaluated to overcome the limitations of morphological classification because it can be used as a means to evaluate biodiversity,

The first type of marker developed in pine trees was a marker using isozymes (Tulsieram et al. 1992). Markers using homozygous enzymes have the advantage of being able to compare multiplexes of pine proteins by 2D-PAGE. However, this marker did not cover the pine tree genome. Importantly, proteins can be easily analyzed by mass spectrometry (Gion et al. 2005).

RFLP is a marker for polymorphism analysis using restriction enzymes, and was reported by a study of P. taeda in the early 1990s (Neale and Williams 1991). Although researchers have suggested that there are sufficient numbers for high-density genome mapping, studies have been done only on P. taeda (Devey et al. 1994) and P. radiata (Devey et al.

As the PCR technique was developed in the mid-1990s, molecular markers also introduced PCR techniques. The development of this technology has drastically reduced the time required to obtain the experimental results. The early markers developed using the PCR technique include AFLP and RAPD, which led to a genome-wide analysis of the genomes in the forest trees including pine species (Cervera et al. 2000). However, they were limited due to the nature of the dominant mark.

In general, chloroplast DNA in coniferous trees is a haploid diagenesis that is inherited only by paternity, and cpSSR has an advantage in that it exhibits the characteristics of expressive features (Anzidei et al. 1999). (Echt et al., 1998), which has been used as a useful marker by several researchers (Powell et al., 1996; Morgante et al., 1997)

As the genome structure of living organisms is known, studies on mutation among individuals have been actively conducted. SNPs are used as markers useful for mutation among individuals. SNPs are single base mutations and are also referred to as point mutants. These markers can be applied to genetic mapping, QTL analysis, genetic diversity measurement, and useful gene-based gene search using a large number of SNPs in a short time (Shin et al., 2006).

In the case of plants, various interspecific and interspecific hybrids are frequently reported, and it is difficult to understand the exact identification, phylogeny and evolution of botanical taxa only with the barcode markers that make up the maternal or paternal heredity by complicated patterns. Therefore, it is desired to develop nuclear DNA that can grasp both the paternal and maternal systems. Although there are rDNA and ITS regions in the nuclear DNA markers, there is almost no difference between species and interspaces in rRNA genes, and ITS regions are not applied as DNA markers because there are thousands of copies per single genome (Alvarez and Wendel, 2003).

Non-coding regions tend to evolve biologically faster than coded regions. Thus, the noncoding region provides properties with useful information for phylogenetic analysis (Wang et al. 1999). Thus, this site can be used as an evolutionary study or as an intraspecific genetic marker through amplification or direct sequencing (Palmer et al., 1988, Clegg et al., 1991). Thus, efforts are recently being made to utilize the noncoding region to build a barcode system for plants.

United States Patent 6,733,965

Accordingly, an object of the present invention is to provide a SNP primer for distinguishing pine species based on a non-coding region of pine trees, which can be specifically reproduced and simply identified.

It is another object of the present invention to provide a real-time PCR detection kit comprising the pair of SNP primers for distinguishing pines.

It is still another object of the present invention to provide a method for distinguishing pine trees using SNP primers for distinguishing pine trees.

In order to achieve the above object, the present invention provides a SNP primer set for discriminating pine trees, which comprises a primer represented by SEQ ID NO: 3 and a primer represented by SEQ ID NO: 4.

The present invention also provides a real-time PCR detection kit for distinguishing pine species, which comprises a primer represented by SEQ ID NO: 3, a primer represented by SEQ ID NO: 4, and a fluorescent marker.

In one embodiment of the present invention, the fluorescent marker may be EVER green or SYBR green-1.

The present invention also relates to a method for distinguishing pine trees comprising the steps of PCR using the DNA extracted from a sample to be distinguished as a template and the SNP primer set for distinguishing pines of the present invention, to provide.

The present invention also relates to a method for identifying a pine species, comprising the step of performing real-time PCR using the DNA extracted from a sample to be distinguished as a template and using the real-time PCR detection kit for isolating pines of the present invention, ≪ / RTI >

According to an embodiment of the present invention, the pine tree may be selected from the group consisting of a pine tree, a pine tree, a pine tree, a pine tree, a migratory pine tree, a migigorus, a pine tree or a white pine tree.

According to the present invention, the SNP primers for distinguishing pine trees based on the trnT (UGU) -trnL (UAA) 3 'exon of the chloroplast of the pine tree leaves can be classified into three types of primers: red pepper, red pepper, Pine trees which are difficult to be classified morphologically such as pine trees and white pine can be easily identified, and the genetic specificity of the Korean pine tree can be secured and it can be provided as a development marker for the pine tree. Also, it is possible to prevent the imported timber from being sold at a high price due to the shipment of our country, so that the system of distribution order can be established in a net function, and the prevention of the unauthorized import of imported timber will be possible in advance.

Figure 1 shows the location of the primer used according to one embodiment of the invention.
2 is an electrophoresis image showing the PCR amplification of the trnT (UGU) -trnL (UAA) 3 'exon region of the chloroplast of a pine tree leaf according to an embodiment of the present invention (A: primers of SEQ ID NOS: 1 and 2, B: primers of SEQ ID NOS: 3 and 4).
FIG. 3 is a maximum likelihood tree obtained by genetic analysis of the trnT-trnL (UAA) 3 'exon region of a chloroplast of a pine tree leaf according to an embodiment of the present invention.

Hereinafter, the present invention will be described in detail with reference to the SNP primer for distinguishing pine trees of the present invention.

DNA barcodes are research methods that are applied to the identification, classification, and identification of cultivars using the relatively short and similarity of generalized DNA sequences. This method has been evaluated as a means to evaluate biodiversity, and it can be identified even with a part of the organism of the organism, thus overcoming the morphological classification limit (CBOL Plant Working Group, 2009). In particular, uncoated regions of DNA are particularly important because they tend to be most mutated (Fazekas et al. 2008).

The trnT (UGU) -trnL (UAA) 3 'exon region of the chloroplast of FIG. 1 has a specific nucleotide sequence structure in connection with the development of molecular markers related to the pine species distinction of the present invention, and the insertion / .

A pair of molecular marker primers designed in the present invention is dependent on the exon region.

[SEQ ID NO: 3] trnT (UGU) redesign, forward

5'-GATTCAATGACGCAATCCAG-3 '

[SEQ ID NO: 4] trnL (UAA) 3 'exon redesign, reverse

5'-TCGTCCAACCATTTATTCCA-3 '

The SNP primer for distinguishing pine species of the present invention is applied to various PCR methods, and it is possible to detect shipment among pine trees.

In recent years, real-time PCR has been shown to control the reaction products in real time and eliminate the need for gel analysis, thereby reducing the overall analysis time. Real-time PCR was widely used in biological assays for a variety of applications including clinical diagnostics, agricultural plant engineering, and research capabilities (Carey et al. 2007; Espy et al. 2006; Lipp et al 2005; Wolf et al 2007) .

The SNP primers for distinguishing pine species of the present invention were applied to PCR and real-time PCR method to suggest the possibility of distinguishing pine species among the leaves of 9 different samples.

Therefore, the SNP primer for distinguishing pine species of the present invention is remarkably reduced in the time required for the real-time PCR method compared to the PCR method, and the amount of the sample used for the PCR method is at least sufficiently satisfactory And the like can be expected. This is very useful for the analysis of multiple samples in molecular markers.

Meanwhile, the SNP primer for distinguishing pine species of the present invention can be conveniently used when it is applied to the distinction of pine species in a kit, and in particular, in order to easily apply the real time PCR method, The primers can be constructed with a kit for real-time PCR detection together with fluorescent markers. The SNP primer for distinguishing pines of the present invention can obtain sufficiently accurate results even when used with a fluorescent marker without using a separate probe. Eva Green or SYBR Green-1 may be used as the fluorescent marker.

The present invention provides a method for distinguishing nine kinds of pine trees by a simple method of performing PCR by using DNA extracted from a sample to be distinguished for SNP primers for distinguishing pine species as a template and identifying the PCR products obtained. In addition, by using a DNA extracted from a sample to be distinguished as a template, real-time PCR is performed using a real-time PCR detection kit for isolating pines of the present invention, and a PCR product obtained is identified. Provide a way to distinguish.

According to the present invention, the SNP primers for distinguishing pine trees based on the trnT (UGU) -trnL (UAA) 3 'exon of the chloroplast of the pine tree leaves can be classified into three types of primers: red pepper, red pepper, Pine trees which are difficult to be classified morphologically such as pine trees and white pine can be easily identified, and the genetic specificity of the Korean pine tree can be secured and it can be provided as a development marker for the pine tree. Also, it is possible to prevent the imported timber from being sold at a high price due to the shipment of our country, so that the system of distribution order can be established in a net function, and the prevention of the unauthorized import of imported timber will be possible in advance.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1>

Pine DNA  Extraction, amplification and primer  making

Plant material

The DNA of the pine tree plant was used for leaf picking. The pine trees are classified as P. densiflora, P. thunbergii, P. bungeana, P. sylvestris, and P. vivax in the Kwangnung National Arboretum, Gyeonggi Suwon, and Chungbuk National University campus. densiflora for Multicanlis, P. rigida and P. koraiensis were collected. Table 1 shows the types of pines and plants used.

division Pine species name One P. densiflora 2 Return ( P. densiflora for . Multicanlis ) 3 The Savior ( P. sylvestris ) 4 P. thunbergii 5 P. rigida 6 P. rigitaeda 7 Mugo ( P. mugo) 8 P. koraiensis 9 P. bungeana

DNA  Extraction PCR  Amplification

20 mg of the leaves collected for each of the pine trees of Table 1 were pulverized using a pulverizer (TissueLayer) and gene DNA was extracted using a DNeasy Plant mini kit (Qiagen, &&&).

Specific primers were designed from the nucleotide sequence of the trnT (UGU) -trnL (UAA) 3 'exon (Taberlet et al., 1991) region of the common primer chloroplast non-coding region, Respectively.

SEQ ID NO: Name of the primer order Tm One trnT (UGU) CATTACAAATGCGATGCTCT 64.2 2 trnL (UAA) 3 'exon GGGGATAGAGGGACTTGAAC 70.3 3 trnT (UGU) Redesign GATTCAATGACGCAATCCAG 57.5 4 trnL (UAA) 3 'exon redesign TCGTCCAACCATTTATTCCA 57.3

The reaction conditions for type-specific amplification were 20 μl volume of standard PCR reaction (50 nM of each primer, 100 ng of extracted DNA, 0.2mM of each dNTP, 2.5 mM MgCl _2, 10XPCR buffer, and a DNA polymerase (EnzynomicsTM) 1 U), a pre-denaturation step for 5 minutes at 94 ℃ (denaturation step), 30 seconds at 94 ℃, 45 sec at 56 ℃ , Repeating the process of elongating at 72 캜 for 30 seconds 35 times, and finally maintaining the elongation at 72 캜 for 10 minutes.

The PCR product was isolated using 1.0% agarose gel and stained with Gelstar (Lonza, USA).

< Example  2>

For the distinction of pine species plant Molecular marker  Development

P. densiflora, P. thunbergii, P. bungeana, P. sylvestris, P. densiflora for Multicanlis, P. rigida, (UGU) -trnL (UAA) 3 'exon (Taberlet et al., 1991) in the chloroplast noncoding region was searched in order to find out the molecular markers capable of identifying seven species by the pine wood.

PCR  Sequence analysis of the product sequencing )

Sequencing reactions were performed using the ABI PRISM BigDye terminator cycle sequencing kit with ampli-Taq DNA polymerase (FS enzyme) according to the supplier's manual. Single-pass sequencing was performed on each template using PCR primers. The fluorescence-labeled fragments were purified from the unincorporated ends using an ethanol precipitation protocol. Performing electrophoresis on the sample in distilled water, suspended and reproduction sequence analyzer (ABI 3730xl sequencer) and the results are shown in Figure 2.

As shown in Fig . 2 (a) , PCR amplification using primers 1 and 2 of SEQ ID NO: 1 showed no amplification product for nine species of pine. However, as shown in FIG . 2 (b) , the products amplified by PCR using the primers of SEQ ID NOS: 3 and 4 were subjected to electrophoresis on a 1% agarose gel. As a result, (Invitrogen, USA). Each PCR product was purified after purification on a purification column and subjected to sanger sequencing analysis. The quality of the analyzed nucleotide sequence was confirmed and aligned using clustal X and a CLC workbench nucleotide analysis tool.

As a result of the nucleotide sequence analysis, trnT (UGU) -trnL (UAA) 3 'exon contains trnT (UAA) 3' exon because it contains trnL (UAA) 5 exon forward-trnL (UAA) It can be seen that sequence analysis between individuals can be performed using only the analyzed data.

For the reproducibility analysis, the primers of SEQ ID NOS: 3 and 4 contained 15 primers, 10 primers, 6 primers, 7 primers, 6 primers, 6 primers, 5 primers, 5 pine trees, 2 pine trees, Two individual DNAs were PCR. The DNA sequence length of each of the pine trees in which the arrangement was completed was found to be 829 bp as shown in Table 3 below. The sites showing base mutations at this site included single nucleotide polymorphism (SNP) and insertional deletion at 113 points.

Sequence alignment Sequence alignment ) And systematic genetic analysis ( Phylogenetic analysis )

 Sequence analysis data were collected and aligned using ClustarX and CLC workbench programs. For the genetic analysis of nine species of pine species, we used the previously analyzed nucleotide sequences for analysis. Sequence alignments were stored as no gaps and then sorted by Clustal X (Thompson et al., 1997). Gaps in the alignment result were treated as missing characters, and all traits were assigned the same weight. (Kimura, 1980) and the maximum likelihood tree method (Kimura et al., 1985) was used for the genetic distance calculation. As shown in Fig.

Sequence divergence was calculated by the Kimura-2 parameter method using the nucleotide sequence analyzed in 9 species of pines, and the results are shown in Table 4 below.

As shown in Table 4, the degree of diversity of the nucleotide sequences was low in P. densiflora and P. densiflora for S. multicaulis and P. sylvestris, and the composition of the bases was almost the same . On the other hand, P. mugo and P. bungeana showed the highest branching value of 0.032.

In addition, by utilizing the MEGA program 5 using a base sequence analysis, and the maximum likelihood tree (Maximum likelihood tree), the results are shown in Fig.

As shown in Fig . 3 , nine kinds of pine trees formed four clusters. Specifically. Clade 1 included shipment and return, Savior shipment, and clade 2 contained Mucho pine, P. rigida, and P. rigitaeda. P. thunbergii was independently classified as clade 3 and clade 4 contained P. koraiensis and Baekson.

As described above, the SNP primer of SEQ ID NO: 3 or 4 according to the present invention for amplifying the trnT (UGU) -trnL (UAA) 3 'exon region of the chloroplast DNA was subjected to sequencing after PCR, Pine trees such as pine trees, red pine trees, pine trees, pine trees, pine trees, pine trees,

So far I looked at the center of the preferred embodiment for the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Chungbuk National University <120> Specific primers for Pines distinction, analysis kit using its          primers, and Pines using the distinciton method <130> pN1204-170 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> trnT (UGU) primer <400> 1 cattacaaat gcgatgctct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> trnL (UAA) 3 'exon primer <400> 2 ggggatagag ggacttgaac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> trnT (UGU) new primer <400> 3 gattcaatga cgcaatccag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> trnL (UAA) 3 'exon new primer <400> 4 tcgtccaacc atttattcca 20

Claims (6)

SNP primer set for distinguishing pine species, comprising a primer represented by SEQ ID NO: 3 and a primer represented by SEQ ID NO: 4. Real-time PCR detection kit for distinguishing pine trees comprising a primer represented by SEQ ID NO: 3, a primer represented by SEQ ID NO: 4 and a fluorescent labeling factor. 3. The method of claim 2,
The fluorescent labeling factor is EVER green or SYBR green-1, real-time PCR detection kit for distinguishing pines. Using the DNA extracted from the sample to be distinguished as a template, pine tree discrimination method comprising the step of identifying the PCR product obtained after performing PCR using the SNP primer set for distinguishing pine species of claim 1. Using the DNA extracted from the sample to be distinguished as a template, pine tree discrimination method comprising the step of identifying the PCR product obtained after performing a real-time PCR using a real-time PCR detection kit for distinguishing pine species of claim 2. The method according to claim 5 or 6,
The pines are pine, pine, Savior, pine, return, Rigida, Rigiteda, mugo, pine or white pine, characterized in that the pine tree.

Images