JP2010154802A - Method for identifying species of plant of genus chrysanthemum - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for identifying species of the plant of the genus Chrysanthemum and a primer set for the method. <P>SOLUTION: The method for identifying the species of the plant of the genus Chrysanthemum by amplifying a genome DNA derived from the plant of the genus Chrysanthemum by using the primer set designed in an IGS region of repeat DNA or rDNA of the plant of the genus Chrysanthemum, and analyzing the electrophoretic pattern of the amplification product, and the primer set for the method. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a method for identifying species of Chrysanthemum plants.

  Chrysanthemum plants are widely distributed in East Asia, and about 30 species are differentiated. It was introduced as a plant having a higher polyploid series in the early 1900s, and since then, many studies have been conducted cytologically. Genomic analysis revealed that it is a typical homoploid plant. However, interspecific crosses caused the chromosomes to pair with each other, and crosses with different ploidy caused homologous pairings, which completely stalled the study of genome differentiation cytologically. In addition, we have been trying to analyze cytologically or genetically about cultivated cherries that are appreciated by many people all over the world. Most of the varieties are homopolyploid and the number of chromosomes is 6 to 7. Since it is a high-order polyploid (2n = 54 to 63), it has not progressed to any extent. For example, even the basics such as which chromosome the white flower gene is on are unknown. Thus, the linkage map that is the basis of genetic research of Chrysanthemum has not been created at all, and genome research is very late.

  In many cultivated plants, PCR band markers for identifying varieties and species have been identified and actually used for elucidating genetic relationships among complex species (Non-Patent Documents 1 to 11). In addition, rare plants and excellent commercial cultivars are at risk of theft and fraudulent sales, and there is a need to establish a technical basis for identifying them. This identification technique has already been established and put into practical use in rice. On the other hand, chrysanthemum contains yeiku (cultivated ginkgo), which is one of the most appreciated flower buds in the world, and so many horticultural varieties continue to be produced. With the rapid development of molecular research, the importance of creating genetic maps on the chromosomal genome as well as clarifying the genomic differentiation of wild and cultivated chicks has been questioned. Yes. However, this type of report on chrysanthemum plants is very limited. In the genus Chrysanthemum, only some genome differentiation studies have been made using the polymorphisms observed in wild species Aedes alga using RAPD and ISSR primers (Non-patent Documents 12 and 13).

  If you can detect the genetic polymorphism of any organism using a single primer set, you can easily examine the genetic polymorphism of the organism you want to examine, which is extremely innovative. It is. In reality, few primers are known that can be amplified by PCR in a wide range of organisms. However, in a very limited number of DNA species, that is, some of rDNA, transposon, and the like show a region having a wide base sequence common beyond the species. In most cases, rDNA appears as a single band and is generally not suitable for identification. On the other hand, transposon itself may show similar sequences across animals and plants, but even if it is seen as a polymorphic band in a somewhat wide group of organisms (for example, angiosperms) with a single primer set, it extends to the whole organism group. There was no.

Soltis DE, Soltis PS. 1995. “The dynamic nature of polyploid genomes.” Proceedings of the National Academy of Sciences, USA 92: 8089-8091 Lowe AJ, Abbott RJ. 1996. “Origins of the new allopolyploid species Senecio cambrensis (Asteraceae) and its relationship to the Canary Islandsendemic Senecio teneriffae.” American Journal of Botany 83: 1365-1372. Brochmann C, Xiang Q, Brunsfeld SJ, Soltis DE, Soltis PS. 1998. “Molecular evidence for polyploid origins in Saxifraga (Saxifragaceae): the narrow arctic endemic S. svalbardensis and its widespread allies.” American Journal of Botany 85: 135- 143. Cook LM, Soltis PS, Brunsfeld SJ, Soltis DE. 1998. “Multiple independent formations of Tragopogon tetraploids (Asteraceae): evidence from RAPD markers.” Molecular Ecology 7: 1293-1302. Wallace LE. 2003. “Molecular evidence for allopolyploid speciation and recurrent origins in Platanthera huronensis (Orchidaceae).” Journal of Plant Science 164: 907-916. Awasthi AK, Nagaraja GM, Naik GV, Kanginakudru S, Thangavelu K, Nagaraju J. 2004. “Genetic diversity and relationships in mulberry (genus Morus) as revealed by RAPD and ISSR marker assays.” BMC Genetics 5: 1. Budak H, Shearman RC, Parmaksiz I, Dweikat I. 2004. “Comparative analysis of seeded and vegetative biotype buffalograsses based on phylogenetic relationship using ISSRs, SSR, RAPD, and SRAPs.” Theoretical and Applied Genetics 109: 280-288. Souframanien J, Gopalakrishna T. 2004. “A comparative analysis of genetic diversity in blackgram genotypes using RAPD and ISSR markers.” Theoretical and Applied Genetics 109: 1687-1693. Guo YP, Saukel J, Mittermayr R, Ehrendorfer F. 2005. “AFLP analyzes demonstrate genetic divergence, hybridization, and multiple polyploidization in the evolution of Achillea (Asteraceae-Anthemideae).” New Phytologist 166: 273-290. Chang-Xing Ma, George Casella, Zuo-Jun Shen, Thomas C. Osborn and Rongling Wu. 2002. “A Unified Framework for Mapping Quantitative Trait Loci in Bivalent Tetraploids Using Single-dose Restriction Fragments: A Case Study from Alfalfa”, Genome Res. 12: 1974-1981. Dachuang Cao, Thomas C. Osborn, and Rebecca W. Doerge 2004. “Correct Estimation of Preferential Chromosome Pairing in Autotetraploids”, Genome Res. 14: 459-462. Dai SL, Zhong Y, Zhang XY. 1995. “Study on numerical taxonomy of some Chinese species of Chrysanthemum (DC.) Des Moul.” Journal of Beijing Forestry University 17: 9-14. Dai SL, Chen JY. 1997. “Cladistic study on some Chrysanthemum spp. In China.” Journal of WuhanBotanical Research 15: 27-34.

  An object of the present invention is to provide a method for identifying species of Chrysanthemum plants and a primer set used therefor. Another object of the present invention is to provide a method for identifying a biological species and a primer set used therefor, a method for identifying a genus, species or variety of a solanaceous plant and a primer set used therefor.

  The present inventor has searched for genetic markers of Chrysanthemum plants and has been working on the creation of genetic maps that have never been created in Chrysanthemum plants. In that process, cloning of repetitive DNA, etc., and designing a primary primer based on this, designing many primers secondarily from the species-specific base sequence distinguished in this process, As a result of confirming the polymorphic variation, the present inventors have succeeded in selecting a primer set that can be used to identify species of Chrysanthemum plants, and have completed the present invention. In addition, the present inventors have succeeded in selecting a primer set that can be used for identification of a biological species and a primer set that can be used for identification of a genus, species, or variety of a solanaceous plant, thereby completing the present invention.

That is, the present invention includes the following inventions.
[1] Using a primer set designed in the repetitive DNA or rDNA IGS region (Intergenic Spacer region) of chrysanthemum plants, a genomic DNA derived from chrysanthemum plants is amplified and the electrophoresis pattern of the amplified product is analyzed. A method for identifying species of Chrysanthemum plants, characterized in that.

[2] The method according to [1], wherein the repetitive DNA comprises the DNA sequence of pNN806 shown in SEQ ID NO: 1 or the DNA sequence of pMB578 comprising the DNA sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3.
[3] The method according to [1], wherein the IGS region of the rDNA consists of a DNA sequence represented by SEQ ID NO: 4.

[4] The method according to any one of [1] to [3], wherein the primer is at least one selected from the group consisting of the following (a) to (j).
(A) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6)
(B) 59R (SEQ ID NO: 7) and 67F (SEQ ID NO: 8)
(C) 160R (SEQ ID NO: 9) and 162F (SEQ ID NO: 10)
(D) 192R (SEQ ID NO: 11) and 193F (SEQ ID NO: 12)
(E) 196R (SEQ ID NO: 13) and 197F (SEQ ID NO: 14)
(F) 176R (SEQ ID NO: 15) and 71F (SEQ ID NO: 16)
(G) 179R (SEQ ID NO: 17) and 71F (SEQ ID NO: 16)
(H) 180R (SEQ ID NO: 18) and 71F (SEQ ID NO: 16)
(I) 187R (SEQ ID NO: 19) and 71F (SEQ ID NO: 16)
(J) 143R (SEQ ID NO: 20) and 145F (SEQ ID NO: 21)

[5] Chrysanthemum species identified are Ajania latifolia (abbreviation: AL), Ajania rupestre (abbreviation: AR), Chrysanthemum pacificum (abbreviation: DP), Chrysanthemum shiwogiku (abbreviation: DS), Chrysanthemum boreale (seed shown: DB), Chrysanthemum indicum (seeds shown: DI4), Chrysanthemum chanetii (seed shown: DC4), Chrysanthemum zawadskii. (seed shown: DZ4 and DZ6), Chrysanthemum zawadskii var latilobum (seed shown: DZL), Chrysanthemum weyrichii (Species abbreviation: DWy), Chrysanthemum arcticum ssp. Maekawanum (Species abbreviation: DA), Chrysanthemum makinoi (Species abbreviation: DM), Chrysanthemum yoshinaganthum (Species abbreviation: DY), Chrysanthemum wakasaense (Species abbreviation: DW), Chrysanthemum japonense (Species abbreviation) Abbreviation: DJ), Chrysanthemum ornatum (species abbreviation: DJO), Chrysanthemum crassum (species abbreviation: DJL), Chrysanthemum vestitum (species abbreviation: DV), and Chrysanthemum morifolium (species abbreviation: DG), 1] to [4] The method according to any one of the above.

[6] The analysis of the electrophoresis pattern of the amplification product is performed by comparing with the table of presence or absence of the amplification product in Table 2 below, and specifying the species of the genus Chrysanthemum, [1] to [5] The method in any one of.

[7] Species of Chrysanthemum plants comprising at least one primer set selected from the group consisting of the following (a) to (j) and used in the method according to any one of [1] to [6] Identification primer set.
(A) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6)
(B) 59R (SEQ ID NO: 7) and 67F (SEQ ID NO: 8)
(C) 160R (SEQ ID NO: 9) and 162F (SEQ ID NO: 10)
(D) 192R (SEQ ID NO: 11) and 193F (SEQ ID NO: 12)
(E) 196R (SEQ ID NO: 13) and 197F (SEQ ID NO: 14)
(F) 176R (SEQ ID NO: 15) and 71F (SEQ ID NO: 16)
(G) 179R (SEQ ID NO: 17) and 71F (SEQ ID NO: 16)
(H) 180R (SEQ ID NO: 18) and 71F (SEQ ID NO: 16)
(I) 187R (SEQ ID NO: 19) and 71F (SEQ ID NO: 16)
(J) 143R (SEQ ID NO: 20) and 145F (SEQ ID NO: 21)
[8] A kit comprising at least one primer set of (a) to (j) according to [7].

[9] A living organism characterized by amplifying a genomic DNA derived from an organism using primer set (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6) and analyzing the electrophoresis pattern of the amplified product. How to identify species.
[10] Primer set (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6), which are used in the method according to [9], for identifying species.

[11] A kit comprising the primer set according to [10].
[12] Amplifying genomic DNA derived from solanaceous plants using primer set (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6), and analyzing the electrophoresis pattern of the amplified product , A method for identifying the genus, species or variety of solanaceous plants.
[13] Primer set (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6), a primer set for identifying a genus, species or variety of a solanaceous plant used in the method according to [12] .
[14] A kit comprising the primer set according to [13].

  According to the present invention, a method for discriminating 17 species of chrysanthemum and one cultivated species by DNA identification and a primer set used therefor are provided. Also provided are a method for identifying a biological species using a primer set derived from Chrysanthemum plants and a primer set used therefor, a method for identifying a genus, species or variety of solanaceous plants, and a primer set used therefor.

(1) Method for identifying species of Chrysanthemum plants The method for identifying species of Chrysanthemum plants of the present invention is to design primary primers from the IGS region (Intergenic Spacer region) of repetitive DNA or rDNA of Chrysanthemum plants. , Using a primer set that is secondarily designed from the species-specific base sequence distinguished in this process, amplifying genomic DNA from Chrysanthemum plants and analyzing the electrophoresis pattern of the amplified product And

The object to be subjected to the method for identifying species of Chrysanthemum plant of the present invention is specifically shown in Table 1 18.
Species 20 taxonomic group ( Chrysanthemum morifolium in the last row of Table 1 is a cultivated species, otherwise wild species). In the present specification, the species name of Chrysanthemum may be represented by “Species Abbreviation” in Table 1.

  In order to identify species of Chrysanthemum plants, first, genomic DNA is extracted from Chrysanthemum plants. Genomic DNA can be extracted from any tissue collected from chrysanthemum (eg, leaves, stems, petals, sepals, roots, callus, etc.) according to known methods, purified as necessary, and prepared as a test sample. That's fine. Examples of the DNA extraction method include a phenol extraction method, a cetyltrimethylammonium bromide (CTAB) method, and an alkaline SDS method, and may be modified as appropriate. After DNA extraction, purification treatment such as chloroform / isoamyl alcohol treatment, isopropanol precipitation, deproteinization with phenol / chloroform, and ethanol precipitation may be performed. For the genomic DNA extraction, a commercially available plant genomic DNA extraction kit (for example, Plant Genomic DNA Extraction Mini (manufactured by VIOGENE)) can also be used.

  The “primer designed in the repetitive DNA of chrysanthemum plant or the IGS region of rDNA” used for amplification in the present invention refers to the sequence of the repetitive DNA of chrysanthemum plant or the sequence of the IGS region of rDNA during the amplification reaction. The oligonucleotide primer prepared so that those partial sequences or its variation | mutation sequence (or those complementary sequences) may be included so that it may anneal specifically to the predetermined position of this.

As the “repetitive DNA” used for the primer design, specifically, the present inventor discovered on the way of attempting to analyze the differentiation of the homoploid genome of Chrysanthemum using genetic polymorphism. Hamagiku of (Nipponanthemum nipponicum) EK1 derived DNA, decomposing obtained repetitive sequences in the restriction enzyme Hind III (789Bp, SEQ ID NO: 1, herein sometimes referred pNN806.), Ryuunougiku (Chrysanthemum makinoi) x Aburagiku ( Chrysanthemum boreale ) DNA sequence obtained by digestion of DNA derived from hybrid MB43 with Hind III restriction enzyme (approximately 2000 bp, including SEQ ID NO: 2 and SEQ ID NO: 3. The base sequence is not decoded between SEQ ID NO: 2 and SEQ ID NO: 3. And may be referred to as pMB578 in this specification).

The “rDNA IGS region” used for primer design is specifically: DNA of 25S-18S IGS region of DNA derived from Chrysanthemum makinoi IP2 (2822 bp, SEQ ID NO: 4, this specification) May be referred to as pDM2907).

  Each primer constituting the primer set of the present invention preferably has a length of 15 to 30 bases, more preferably 18 to 25 bases. Each primer may be further modified in the oligonucleotide. For example, the primer of the present invention has a labeling substance (for example, a fluorescent dye, a radioisotope, an organic compound such as digoxigenin, biotin, etc.) for facilitating detection and amplification of the primer at its 5 ′ end or 3 ′ end. Or may be phosphorylated or aminated at the 5 ′ end.

Examples of primer sets that can be used particularly preferably in the present invention include the following (a) to (j) (R represents a reverse primer, and F represents a forward primer).
(A) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6)
(B) 59R (SEQ ID NO: 7) and 67F (SEQ ID NO: 8)
(C) 160R (SEQ ID NO: 9) and 162F (SEQ ID NO: 10)
(D) 192R (SEQ ID NO: 11) and 193F (SEQ ID NO: 12)
(E) 196R (SEQ ID NO: 13) and 197F (SEQ ID NO: 14)
(F) 176R (SEQ ID NO: 15) and 71F (SEQ ID NO: 16)
(G) 179R (SEQ ID NO: 17) and 71F (SEQ ID NO: 16)
(H) 180R (SEQ ID NO: 18) and 71F (SEQ ID NO: 16)
(I) 187R (SEQ ID NO: 19) and 71F (SEQ ID NO: 16)
(J) 143R (SEQ ID NO: 20) and 145F (SEQ ID NO: 21)
In this specification, for example, the 58R and 66F primer sets may be described as 58R66F.

  Amplification of genomic DNA derived from Chrysanthemum plants using the above primer set can utilize a known nucleic acid amplification method such as PCR (polymerase chain reaction). When two or more primer sets are used in the amplification reaction, the reaction can be performed using a plurality of primer sets in one reaction solution, but it is more preferable to perform the reaction using a separate reaction solution for each primer set. A person skilled in the art can appropriately determine the composition of the reaction solution and the cycling conditions when performing amplification according to the nucleic acid amplification method to be used, the Tm value of the primer, the specifications of the thermal cycler, and the like. For example, a heat-resistant DNA polymerase and a primer are added to a template DNA, and three steps of denaturation at about 90 to 96 ° C., annealing at about 40 to 70 ° C., and extension at about 70 to 75 ° C. are repeated 20 to 60 cycles. This is only an example, and the composition, reaction temperature, and time of the PCR reaction solution can be appropriately set according to the length of the oligonucleotide sequence that serves as a primer, the base composition, and the like. A series of these PCR operations can be performed using a commercially available PCR kit or PCR apparatus according to the operating instructions. See also Sambrook et al. (1989), Molecular Cloning: Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Ausubel et al. (1995), Short Protocols In Molecular Biology, third edition, John Wiley & Sons, Inc. .

  The amplification product obtained by the amplification is subjected to electrophoresis, and the obtained electrophoresis pattern is analyzed to identify the species of Chrysanthemum plants. Examples of the electrophoresis method include a method using an agarose gel, a denaturing and non-denaturing acrylamide gel, and the like. Band detection is performed by ethidium staining. When a labeling substance is used, depending on the labeling, for example, when a primer added with a fluorescent dye (FAM, NED, HEX, etc.) is used, fluorescence coloring is used as an index. May be. Examples of electrophoretic images of Chrysanthemum plants are shown in FIGS.

  “Electrophoresis pattern” means a band pattern obtained by electrophoresis of the amplification product. The pattern includes the presence or absence of a band (nucleic acid fragment), the molecular weight size or base length (band position) of the band, or the abundance (absolute amount, relative amount, or shading of the band).

  “Analyzing the electrophoresis pattern of the amplification product” means, for example, performing PCR amplification using a chrysanthemum genus plant with a clear species as a template sample, as shown in the Examples, and previously setting the electrophoresis pattern of the amplification product. It is obtained by comparing the electrophoresis pattern with the electrophoresis pattern of the chrysanthemum plant to be examined. For each Chrysanthemum plant species, the species of Chrysanthemum plant can be identified by comparing the primer set and the presence or absence of a band (for example, Table 2) with the electrophoresis pattern to be examined. it can.

  In carrying out the method of the present invention, a database associating the species of the genus Chrysanthemum with the pattern of the electrophoresis band of the species is prepared (for example, the contents of Table 2 are incorporated as data), and the chrysanthemum subject to be examined is incorporated. It is also possible to identify the species of Chrysanthemum plants by comparing the pattern of the electrophoresis band of the genus plant with the pattern of the band contained in the database.

The ten primer sets (a) to (j) are selected from the primer sets used so far in order to distinguish between chrysanthemum species. As shown in Table 2 and FIG. 1 and FIG. 2, all of 22 lines of Chrysanthemum 18 species 20 taxonomic groups were distinguished from 12 bands that appeared by 10 kinds of primer sets. Each primer set is characteristic for the appearance between species. For example, in the 187R71F primer, a strong signal band is observed in DM, and a weak signal band is present in DY and DW which are very closely related to DM. The appearance was limited to a very specific species. On the other hand, each band that appeared with the primers 176R71F, 180R71F, 160R162F, 58R66F (amplification product size of about 420 bp) appeared in almost all species, and a feature that did not appear in the most part of the species was observed. Other primers were intermediate and tended to correspond to specific taxa. All species, taxa, and strains were distinguished by the combination of the appearance of these bands. In addition to the position and concentration of the band, for example, when viewed in a band pattern, the NN species ( Nipponanthemum nipponicum ) EK01 strain appears as a smear band with a strong signal in the 58R66F primer. On the other hand, in the DI4 species NDL1 strain, a band appears in response to the 58R66F primer, so that both strains can be distinguished from each other. The indication of r shown in Table 2 is not merely a technical problem, but indicates that it is quantitatively different. This is considered to be due to the result of searching for a marker for repetitive DNA. Thus, since the position, number, and intensity of the band are different depending on the respective species and strains, each species and strain can be identified by analyzing these polymorphisms.

  The above primer set is selected as a combination for distinguishing species from comparison of many primer sets, and can also be made into a kit. The kit of the present invention only needs to contain at least the primer set described above. If necessary, PCR extraction reagents (excluding primers) such as DNA extraction reagents, PCR buffers and DNA polymerase, stains, It may contain a detection reagent such as an electrophoresis gel, instructions and the like.

(2) Method for distinguishing biological species The primer set 58R66F derived from the above-mentioned Chrysanthemum plant repetitive DNA (pNN806, SEQ ID NO: 1) can be used for examining polymorphisms of biological species, and is also derived from living organisms. It is also possible to amplify the genomic DNA and analyze the electrophoresis pattern of the amplified product to identify the species.

  The biological species that are targets of the method for identifying a biological species of the present invention are not particularly limited, and examples thereof include animals, fungi, moss plants, gymnosperms, angiosperms and the like shown in Table 3 below.

  In the method for identifying a biological species of the present invention, DNA extraction, amplification by PCR using primer set 58R66F, and electrophoresis can be performed according to the methods described above. In the case of animals, various cells contained in various tissues such as epithelial tissue, connective tissue, muscle tissue, and nerve tissue are used as the DNA extraction material. In the case of fungi and plants, any cell or plant tissue may be used. An example of an electrophoresis image of the amplification product of each species shown in Table 3 is shown in FIG. Biological species can be identified by obtaining an electrophoretic band pattern in advance for a human or the like and comparing the pattern with the pattern to be examined.

That is, since the patterns such as the position, number, and density of the bands amplified by the PCR method are different, it is possible to determine which biological species by comparing them. In addition, since the primer set 58R66F reacts with a wide range of species and shows a band, it can also be used to identify whether or not it is a species.
The primer set 58R66F can also be used as a biological species identification kit. The kit may contain the above-described DNA extraction reagent, PCR buffer, and the like.

(3) Method for discriminating genus, species or variety of solanaceous plant The primer set 58R66F derived from the above-mentioned chrysanthemum plant repetitive DNA (pNN806, SEQ ID NO: 1) is used for examining polymorphisms of solanaceous plants. It is also possible to amplify genomic DNA derived from a solanaceous plant, analyze the electrophoresis pattern of the amplified product, and use it to identify the genus, species or variety of solanaceous plants.

  The solanaceous plant which is the target of the method for identifying the genus, species or variety of the solanaceous plant of the present invention is not particularly limited, and examples thereof include the plants shown in Table 4 below.

  In the method for identifying the genus, species or variety of solanaceous plants of the present invention, DNA extraction, amplification by PCR using primer set 58R66F, and electrophoresis can be performed according to the above-mentioned methods. For example, any tissue (eg, leaves, stems, petals, sepals, roots, callus, etc.) collected from a solanaceous plant individual may be used. The electrophoretic image of the amplification product of each solanaceous plant shown in Table 4 is shown in FIG. The genus, species or variety of solanaceous plants can be identified by obtaining a band pattern of electrophoresis for these plants in advance and comparing the pattern with the pattern to be inspected.

  The primer set 58R66F can also be used as a kit for identifying genus, species or variety of solanaceous plants. The kit may contain the above-described DNA extraction reagent, PCR buffer, and the like.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.
[Example 1] Identification of species of Chrysanthemum plants (1) Materials Table 20 shows 20 taxonomic groups of Chrysanthemum used in this example. These DNAs can now be provided from the plant gene storage experiment facility attached to the Graduate School of Science, Hiroshima University (1-4-3 Kagamiyama, Higashihiroshima City, Hiroshima Prefecture 739-8526).

(2) DNA extraction DNA of Chrysanthemum plants was extracted by a microsample extraction method modified by the inventor based on the method of Murray and Thompson (1980).

  The leaf pieces were adjusted to 3 × 30 mm with a razor and cut into 0.5 × 3 mm well. It was put into a 1.5 mm tube containing 500 μL of CTAB extraction buffer (100 mM Tris-HCl (pH 8.0), 20 mM EDTA, 1.4 M NaCl, 2.0% CTAB) with 0.1% (v / v) mercaptoethanol. . After gently mixing several times by vortexing, the mixture was incubated at 55 ° C. for 20 minutes. After adding 500 μL of chloroform / isoamyl alcohol mixed solution (24: 1) to the tube, it was mixed by inverting at room temperature for 10 minutes, and centrifuged at 6000 rpm for 10 minutes at room temperature (DISKBOY, KURABO INDUSTRIES LTD, made in Japan). The upper layer was taken so as not to precipitate the intermediate layer with a pipette and transferred to a new tube (about 450 μL). 1 μL RNase (1 mg / ml) was added and incubated at 37 ° C. for 20 minutes to 3 hours. 450 μL of a mixed solution of chloroform and isoamyl alcohol was added and mixed by inverting at room temperature for 10 minutes, and this was centrifuged (DISKBOY) at 6000 rpm for 10 minutes at room temperature. The upper layer was taken so as not to precipitate the intermediate layer with a pipette, and transferred to a new tube (about 350 μL). After adding an equal volume (350 μL) of isopropyl alcohol, the mixture was mixed by inverting at room temperature for 10 minutes, and this was centrifuged (DISKBOY) at 12000 rpm for 10 minutes at room temperature. The supernatant was removed, leaving a precipitate, and 1000 μL of 70% ethanol was added to wash the precipitate. After centrifuging at 12000 rpm for 10 minutes at room temperature (DISKBOY), the supernatant was tumbled and removed, followed by suction drying for 5 minutes. 50 μL of TE was added. From this, 5 μL was taken and 100 μL TE was added to make a stock solution for PCR.

(3) Primer design Repetitive DNA, rDNA 5S, 18S, ITS region (Internal Transcribed Spacer region) and IGS region using 28 types and 4446 DNA strains stored in the above storage experiment facility of Hiroshima University Then, cloning was performed using a conventional method, and the nucleotide sequence was analyzed. Among the analyzed base sequences, newly found repetitive DNA pNN806 (SEQ ID NO: 1), repetitive DNA pMB578 (including SEQ ID NO: 2 and SEQ ID NO: 3), and rDNA IGS region (SEQ ID NO: 4). First, primary primers were designed, and primers were secondarily designed from the species-specific nucleotide sequences distinguished in this process, and various primers were designed. From the primer sets effective for distinguishing species, the primers shown in Table 5 and the primer set shown in Table 6 were finally selected.

(4) PCR
PCR was performed by setting a PCR apparatus (ABI: GeneAmp PCR System 9700) under the following two conditions. One is 94 ° C, denaturation for 2 minutes and 15 seconds, followed by 5 cycles of denaturation (94 ° C, 45 seconds), annealing (49 ° C, 1 minute), extension (72 ° C, 2 minutes), then denaturation (94 ° C 45 seconds), annealing (55 ° C., 30 seconds), extension (72 ° C., 2 minutes) for 30 cycles, and finally, extension conditions of 72 ° C. and 10 minutes were set. The other is 94 ° C, denaturation for 2 minutes 15 seconds, followed by 30 cycles of denaturation (94 ° C, 45 seconds), annealing (57 ° C, 1 minute), extension (72 ° C, 2 minutes), and finally 72 ° C Ten minute extension conditions were set. The former conditions were used as reaction conditions when 58R66F and 59R67F primer sets in Table 6 were used, and the latter conditions were used as reaction conditions when the other primer sets in Table 6 were used.

(5) Cloning and nucleotide sequence analysis Various genomic DNAs of Chrysanthemum of Table 1 extracted by the method of (2) above are amplified by PCR using the primers shown in Table 6, and the nucleotide sequence of the PCR product is analyzed. Went. The analysis consists of (i) a method of directly examining the base sequence of a PCR product directly amplified from genomic DNA with a primer, and (ii) a PCR product amplified from genomic DNA with a primer using a pGEM-T vector ( Ligated to Promega) and prepared a DNA library using Escherichia coli strain DH5a. From the library, insert 5 lines with the same insertion size (if there are polymorphisms in the insertion size, 5 lines from each size group). Selection, amplification with vector primers, and examination of the nucleotide sequence were performed in two ways.

  In the method (i), when the amplified DNA is one band, the purified DNA is directly cut out. In the case of a plurality of bands, the DNA is cut and purified. On the other hand, in the method (ii), the vector primer (AGCGGATAACAATTTCACACAGG (SEQ ID NO: 22)) After purifying the DNA amplified with CCCAGTCACGACGTTGTAAAACG (SEQ ID NO: 23), the nucleotide sequence was analyzed with a DNA sequencer (PRISM 3100-Genetic Analyzer manufactured by ABI).

(6) Electrophoresis and pattern analysis After completion of PCR, electrophoresis was performed at a voltage of 50 V for 60 minutes using a 2% agarose gel (SeaKemMe, FMC) and an electrophoresis apparatus Mupid (ADVANCE). The gel after electrophoresis was photographed with EOS D30 (Canon). As an example, FIG. 1 shows (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6), (b) 59R (SEQ ID NO: 7) and 67F (SEQ ID NO: 8), (e) 196R (SEQ ID NO: 13). And 197F (SEQ ID NO: 14), (h) 180R (SEQ ID NO: 18) and 71F (SEQ ID NO: 16), (c) 160R (SEQ ID NO: 9) and 162F (SEQ ID NO: 10), (g) 179R (SEQ ID NO: 17 ) And 71F (SEQ ID NO: 16), (d) Amplification products using primer sets of 192R (SEQ ID NO: 11) and 193F (SEQ ID NO: 12), (i) 187R (SEQ ID NO: 19) and 71F (SEQ ID NO: 16) The electrophoresis image of is shown. FIG. 2 shows electrophoresis images of amplification products using primer sets of (j) 143R (SEQ ID NO: 20) and 145F (SEQ ID NO: 21), (f) 176R (SEQ ID NO: 15) and 71F (SEQ ID NO: 16). Show. In addition, alphabets such as “DP” in the lane indicate “species abbreviations” of Chrysanthemum species in Table 1. In addition, “NN” is an anteater ( Nipponanthemum nipponicum ), “LL” is an oleander ( Leucanthemella linealis ). A small number of hybrids can be made. “M” indicates a molecular weight marker. The electrophoresis bands were organized and analyzed, and Table 2 above was created.

[Example 2] Identification of biological species In this example, the primer set 58R66F (SEQ ID NO: 5 and SEQ ID NO: 6) was used to expand the target species to taxonomic groups other than chrysanthemum, and animals, fungi, moss plants, gymnosperms We examined the identification of biological species as plants and angiosperms.

  Using the organisms shown in Table 3, DNA extraction, PCR, and electrophoresis were performed in the same manner as in Example 1. The human DNA is a blood cell, and the human DNA and the fungal DNA were obtained and used in advance. FIG. 3 shows an electrophoresis image. The lane numbers correspond to the numbers in Table 3, respectively.

  The DNA of various strains listed in Table 3 is currently stored in the plant gene storage experiment facility attached to the Graduate School of Science, Hiroshima University (Kagoyama 1-4-3, Higashihiroshima, 739-8526, Hiroshima Prefecture). Can be provided.

  Polymorphic amplification bands from strong to weak bands were observed in all species. One animal (human), two protozoa, four fungi, and 17 species ranging from moss plants to whole angiosperms all show multiple bands and can be applied to a very wide range of organisms with one set of primers. It was confirmed. In addition, all the different patterns were shown among taxonomic groups. In two species of protozoa in the genus, a strong band of about 800 bp showing high commonality, a weak band of about 900 bp and about 1300 bp, and several bands specific to each other species (EplW; about 2000 bp or more) A slightly strong band, EplA; a strong band of about 1200 bp was distinguished.

Example 3
In this example, the primer set 58R66F (SEQ ID NO: 5 and SEQ ID NO: 6) was used to examine the identification of the genus, species and variety of solanaceous plants.

Using the solanaceous plants shown in Table 4, DNA extraction, PCR and electrophoresis were carried out in the same manner as in Example 1. FIG. 4 shows an electropherogram. The lane numbers correspond to the numbers in Table 4, respectively.
The DNAs of various strains listed in Table 4 are currently stored at the plant gene storage experiment facility attached to the Graduate School of Science, Hiroshima University (Kagoyama 1-4-3, Higashihiroshima City, Hiroshima Prefecture 739-8526). Can be provided.

  Characteristic patterns were shown between genera, species, and varieties. The cultivated species showed distinctly different patterns, but there were many common bands among species within the genus. Correspondence of high similarity was recognized according to each classification class within the varieties, within the species, and within the genus. Furthermore, the varieties within the variety were very common, but some varieties could be distinguished.

  These three genera of the solanaceous family include many other species, but it is easy to imagine that other species can be distinguished into several groups from the above mutation patterns.

  From the above results, it became possible to investigate the polymorphism by extending to the whole organism world except Chrysanthemum with one primer set. This means that polymorphisms can be directly examined with this primer for many unknown organism groups first, and it is considered to be an effective technique for examining genetic characteristics. If it is desired to identify more detailed genomic characteristics, it is considered that a higher degree of identification can be achieved by recloning a band showing specificity according to the purpose.

The electrophoresis image of the amplified product which amplified the genomic DNA derived from a Chrysanthemum plant by PCR is shown. The electrophoresis image of the amplified product which amplified the genomic DNA derived from a Chrysanthemum plant by PCR is shown. Electrophoresis images of amplification products obtained by PCR amplification of various genomic DNAs in the biological world are shown. The electrophoresis image of the amplification product which amplified the genomic DNA derived from a solanaceous plant by PCR is shown.

Claims (14)

  Amplifying genomic DNA derived from Chrysanthemum plants using a primer set designed in the IGS region (Intergenic Spacer region) of repetitive DNA or rDNA of Chrysanthemum plants, and analyzing the electrophoresis pattern of the amplified products And a method for identifying species of Chrysanthemum plants.   The method according to claim 1, wherein the repetitive DNA consists of the DNA sequence of pNN806 shown in SEQ ID NO: 1 or the DNA sequence of pMB578 comprising the DNA sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3.   The method according to claim 1, wherein the IGS region of the rDNA consists of a DNA sequence represented by SEQ ID NO: 4. The method according to any one of claims 1 to 3, wherein the primer is at least one selected from the group consisting of the following (a) to (j).
(A) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6)
(B) 59R (SEQ ID NO: 7) and 67F (SEQ ID NO: 8)
(C) 160R (SEQ ID NO: 9) and 162F (SEQ ID NO: 10)
(D) 192R (SEQ ID NO: 11) and 193F (SEQ ID NO: 12)
(E) 196R (SEQ ID NO: 13) and 197F (SEQ ID NO: 14)
(F) 176R (SEQ ID NO: 15) and 71F (SEQ ID NO: 16)
(G) 179R (SEQ ID NO: 17) and 71F (SEQ ID NO: 16)
(H) 180R (SEQ ID NO: 18) and 71F (SEQ ID NO: 16)
(I) 187R (SEQ ID NO: 19) and 71F (SEQ ID NO: 16)
(J) 143R (SEQ ID NO: 20) and 145F (SEQ ID NO: 21) Chrysanthemum species to be identified, Ajania latifolia (Seed shown: AL), Ajania rupestre (Seed shown: AR), Chrysanthemum pacificum (Seed shown: DP), Chrysanthemum shiwogiku (Seed shown: DS), Chrysanthemum boreale (species shown : DB), Chrysanthemum indicum (seeds shown: DI4), Chrysanthemum chanetii (seed shown: DC4), Chrysanthemum zawadskii (species shown:. DZ4 and DZ6), Chrysanthemum zawadskii var latilobum (seed shown: DZL), Chrysanthemum weyrichii (species shown : DWy), Chrysanthemum arcticum ssp. Maekawanum (abbreviation: DA), Chrysanthemum makinoi (abbreviation: DM), Chrysanthemum yoshinaganthum (abbreviation: DY), Chrysanthemum wakasaense (abbreviation: DW), Chrysanthemum japonense (abbreviation: D ), Chrysanthemum ornatum (species abbreviation: DJO), Chrysanthemum crassum (species abbreviation: DJL), Chrysanthemum vestitum (species abbreviation: DV), and Chrysanthemum morifolium (species abbreviation: DG). Any one of 4 The method according to item. The analysis of the electrophoresis pattern of the amplification product is performed by comparing with the following table of the presence or absence of the amplification product, and the species of Chrysanthemum plant is specified, The method according to any one of claims 1 to 5. Method.

A primer for species identification of Chrysanthemum plants, comprising at least one primer set selected from the group consisting of the following (a) to (j) and used in the method according to claim 1.
(A) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6)
(B) 59R (SEQ ID NO: 7) and 67F (SEQ ID NO: 8)
(C) 160R (SEQ ID NO: 9) and 162F (SEQ ID NO: 10)
(D) 192R (SEQ ID NO: 11) and 193F (SEQ ID NO: 12)
(E) 196R (SEQ ID NO: 13) and 197F (SEQ ID NO: 14)
(F) 176R (SEQ ID NO: 15) and 71F (SEQ ID NO: 16)
(G) 179R (SEQ ID NO: 17) and 71F (SEQ ID NO: 16)
(H) 180R (SEQ ID NO: 18) and 71F (SEQ ID NO: 16)
(I) 187R (SEQ ID NO: 19) and 71F (SEQ ID NO: 16)
(J) 143R (SEQ ID NO: 20) and 145F (SEQ ID NO: 21)   A kit comprising at least one primer set of (a) to (j) according to claim 7.   Identifies a biological species characterized by amplifying genomic DNA derived from an organism using primer set (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6) and analyzing the electrophoresis pattern of the amplified product how to.   Primer set (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6), which are used in the method according to claim 9, and are a species set primer set.   A kit comprising the primer set according to claim 10.   Using the primer set (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6), genomic DNA derived from a solanaceous plant is amplified and the electrophoresis pattern of the amplified product is analyzed, A method for identifying the genus, species or variety of a plant.   Primer set (a) 58R (SEQ ID NO: 5) and 66F (SEQ ID NO: 6), a primer set for identifying a genus, species or variety of a solanaceous plant used in the method according to claim 12.   A kit comprising the primer set according to claim 13.

Images