KR20110042734A - Identifying method of origin and species about squids, polynucleotide probe, dna chip and kit for identifying the same - Google Patents

Identifying method of origin and species about squids, polynucleotide probe, dna chip and kit for identifying the same Download PDF

Info

Publication number
KR20110042734A
KR20110042734A KR1020090099541A KR20090099541A KR20110042734A KR 20110042734 A KR20110042734 A KR 20110042734A KR 1020090099541 A KR1020090099541 A KR 1020090099541A KR 20090099541 A KR20090099541 A KR 20090099541A KR 20110042734 A KR20110042734 A KR 20110042734A
Authority
KR
South Korea
Prior art keywords
species
seq
squid
dna
probe
Prior art date
Application number
KR1020090099541A
Other languages
Korean (ko)
Other versions
KR101196640B1 (en
Inventor
이윤호
김충곤
김성
정다금
황창남
황승용
정진욱
정인혁
Original Assignee
한국해양연구원
(주)지노첵
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국해양연구원, (주)지노첵 filed Critical 한국해양연구원
Priority to KR1020090099541A priority Critical patent/KR101196640B1/en
Publication of KR20110042734A publication Critical patent/KR20110042734A/en
Application granted granted Critical
Publication of KR101196640B1 publication Critical patent/KR101196640B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

PURPOSE: A polynucleotide probe, DNA chip, and kit for determining cuttlefish species are provided to simply and accurately determine cuttlefish species and distinguish the origin of cuttlefishes. CONSTITUTION: A method for determining cuttlefish species comprises: a step of isolating DNA from a cuttlefish and performing PCR using the DNA; a step of conjugating the PCR product with a probe containing DNA sequence of sequence number 3-11 or complementary base thereof; and a step of determining the species of cuttlefish. The cuttlefishes are Dosidicus gigas, or Todarodes pacificus. A DNA chip for determining cuttlefishes contains the probe. A kit for determining cuttlefishes contains the polynucleotide probe and primer for PCR.

Description

오징어류의 종 판별 방법과 이를 위한 오징어 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트{Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same}Identifying methods of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same}

본 발명은 오징어류의 종을 판별하고 이를 통하여 원산지를 구별하기 위한 것으로, 특히 다양한 오징어 종의 단염기다형성(single nucleotide polymorphism, SNPs)을 기반으로, 오징어류의 유전자형을 분석하여, 간단하고 신속, 정확하게 종을 판별할 수 있는 오징어류의 종 판별 방법과 이에 따른 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트에 대한 것이다. The present invention is to identify the species of squid and to distinguish the origin through it, and in particular, based on the single nucleotide polymorphism (SNPs) of various squid species, by analyzing the genotype of squids, the species is simple, quick and accurate. The present invention relates to a species discrimination method for squid species and a polynucleotide probe, a DNA chip, and a kit for discriminating species accordingly.

국내외 종래의 생물종 분류연구는 형태의 계측형질, 계수형질을 바탕으로 하고 있다. Conventional species classification research at home and abroad is based on morphological and counting traits.

근래에는 형태형질을 이용한 분류 및 계통연구에 많은 문제점들이 발견되어 분자생물학적 기법이 활발하게 도입되고 있다. 이 방법은 성체를 중심으로 이루어진 기존 의 형태분류의 단점을 보완하는 것으로 발생초기 생물종 혹은 가공된 개체의 경우와 비교할 수 있어 이점으로 작용하고 있다. Recently, many problems have been discovered in classification and phylogenetic studies using morphology, and molecular biological techniques have been actively introduced. This method compensates for the shortcomings of existing morphological classifications centered on adulthood, which is an advantage compared to early species or processed individuals.

하지만, 오징어류에 대하여, 생물다양성 조사를 위한 다양한 생물종을 한번에, 그리고 신속 정확하게 판별할 수 있는 분자 생물학적인 연구는 국내외에서 그 사례를 찾기 어려운 실정이다.However, for squids, molecular and biological studies that can quickly and accurately identify various species for biodiversity research are difficult to find in Korea and abroad.

본 발명은 오징어류에 속하는 다양한 오징어 종에 대하여 유전자형을 분석하여, 간단하고 신속, 정확하게 종을 판별할 수 있는 방법을 제공하는 것이 목적이다. It is an object of the present invention to provide a method for analyzing genotypes of various squid species belonging to squids, thereby allowing a simple, quick and accurate method of discriminating species.

또한, 본 발명은 육안으로는 종을 분별하기 힘든 유생, 조미 가공물, 또는 분말가루 등에 대해서, 하나의 슬라이드 위에 오징어류의 시료를 올려 놓는 것만으로도 그 종을 판별할 수 있는 프로브, 이를 포함하는 DNA 칩 또는 키트를 제공하기 위한 것이다. In addition, the present invention is a probe that can determine the species by simply placing a sample of squid on one slide for larvae, seasoned products, or powdered powder, etc. To provide a chip or kit.

또한, 본 발명은 종래의 방법에 비해 시료를 분석하는 시간을 크게 단축하면서, 다량의 시료를 짧은 시간 내에 검사할 수 있는 수단을 제공하고자 한다.In addition, the present invention is to provide a means for inspecting a large amount of samples in a short time, while significantly reducing the time to analyze the sample compared to the conventional method.

상기한 목적을 달성하기 위한 본 발명에 따른 오징어류의 종 판별 방법은, 오징어류로부터 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계; 상기 PCR 산물을, 서열번호 3 내지 서열번호 11의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및, 상기 결합 여부에 따라 상기 시료가 속하는 종을 판별하는 단계;를 포함하여 이루어지는 것이 특징이다.In order to achieve the above object, a species identification method of squids according to the present invention comprises the steps of: obtaining a PCR product by performing a polymerase chain reaction (PCR) on DNA extracted from squids; Binding the PCR product to a probe each comprising a base sequence identical to or complementary to each DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 11; And determining the species to which the sample belongs according to the binding.

그리고, 본 발명의 다른 실시형태는, 서열번호 3 내지 서열번호 11 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 폴리뉴클레오티드로 이루어진 오징어류의 종 판별용 프로브일 수 있다. In another embodiment of the present invention, a species of cuttlefish consisting of at least one polynucleotide each comprising a base sequence identical to or complementary to each DNA sequence selected from SEQ ID NOs: 3 to 11 It may be a determination probe.

또한, 본 발명의 또 다른 실시형태는 서열번호 3 내지 서열번호 11 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 프로브를 포함하는 오징어류의 종 판별용 DNA 칩인 것도 가능하다. Further, another embodiment of the present invention is a species of squid including at least one or more probes each comprising a base sequence identical to or complementary to each DNA sequence selected from SEQ ID NOs: 3 to 11 It may also be a DNA chip for discrimination.

이와 함께, 본 발명의 또 다른 실시형태는 오징어류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열과 결합하는 것으로, 서열번호 3 내지 서열번호 11 중 어느 하나의 DNA 서열과 동일하거나 상보적인(complementary) 15-30개의 연속 염기서열로 이루어진 것을 특징으로 하는 폴리뉴클레오티드 프로브와; 상기 오징어 시료의 미토콘드리아 DNA를 중합효소연쇄반응(PCR)으로 증폭시키기 위한 프라이머를 포함하는 것을 특징으로 하는 오징어류의 종 판별용 키트일 수도 있다. In addition, another embodiment of the present invention binds to the mononucleotide polymorphism (SNP) region DNA sequence of the COI gene in the mitochondrial DNA of squid, which is the same as or complementary to the DNA sequence of any one of SEQ ID NOs: 3 to 11 A polynucleotide probe comprising complementary 15-30 contiguous sequences; It may be a kit for determining species of squids, comprising a primer for amplifying the mitochondrial DNA of the squid sample by a polymerase chain reaction (PCR).

기타 본 발명의 다른 실시형태는 후술하는 본 발명의 실시를 위한 구체적인 내용 및 첨부된 도면에 널리 기재되어 있다. Other embodiments of the present invention are widely described in the following detailed description for carrying out the present invention and the accompanying drawings.

상기한 본 발명은 오징어류에 속하는 다양한 종에 대한 유전자형을 분석하여, 상기 오징어류의 단염기다형성(single nucleotide polymorphism, SNPs)을 기반으로, 간단하고 신속, 정확하게 종을 판별하며, 이를 통하여 오징어류의 원산지를 구분할 수 있는 효과가 있다. According to the present invention, genotypes of various species belonging to squids are analyzed, based on single nucleotide polymorphisms (SNPs) of the squids, and a simple, quick and accurate species is identified. There is a distinguishing effect.

즉, 본 발명은 오징어류의 유전자형으로 구별하기에 가장 적합한 유전자군으로서, 미토콘드리아 DNA 중 COI 유전자를 선택하였고, 거기에 존재하는 특정한 단염기다형성(SNPs) 부위를 찾아내었으며, 이를 바탕으로 다양한 오징어류의 종 간에 구별되는 DNA 서열을 임의의 만들어, 오징어의 종 판별을 간단하고 용이하게 하였다. That is, the present invention selected the COI gene from the mitochondrial DNA as the most suitable gene group to distinguish the squid genotype, and found the specific monobasic polymorphism (SNPs) site there, and based on this DNA sequences distinguished between species were randomized to facilitate species identification of squid.

또한, 본 발명은 오징어 종 판별용 프로브, 또는 상기 프로브를 포함하는 DNA 칩이나 키트로 제작되어, 육안으로는 종을 분별하기 힘든 유생, 조미 가공물 또는 분말가루 등에 대해서도, 하나의 슬라이드 위에 시료를 올려놓는 것만으로도 그 종을 판별할 수 있는 것이다. In addition, the present invention is made of a squid species discrimination probe, or a DNA chip or kit including the probe, and the sample is placed on one slide for larvae, seasoned products, or powdered powder, which are difficult to discriminate with the naked eye. The species can be determined simply by placing it.

또한, 본 발명에 따른 프로브를 사용하여 마이크로어레이 방법을 활용하면, 종래의 방법에 비해 시료를 분석하는 시간이 크게 단축되어, 다량의 시료를 짧은 시간 내에 검사할 수 있다.In addition, when the microarray method is used using the probe according to the present invention, the time for analyzing a sample is greatly shortened compared to the conventional method, and a large amount of samples can be inspected within a short time.

이하에서는 본 발명의 바람직한 실시형태를 첨부된 도면을 참고로 하여, 상세하게 살펴보기로 한다.Hereinafter, with reference to the accompanying drawings, preferred embodiments of the present invention will be described in detail.

본 발명에 따른 오징어류의 종 판별 방법은, 먼저 오징어류에 속하는 다양한 해양생물 시료에서 DNA를 추출하고, 이렇게 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계를 거친다. In the method for determining species of squids according to the present invention, first, DNA is extracted from various marine organisms belonging to squids, and then PCR is performed on the extracted DNA to obtain a PCR product.

상기 시료에서 DNA를 추출하는 것은 시료의 각 조직 혹은 다양한 가공물 등으로부터 다양한 방법에 의해 DNA를 추출할 수 있고, 이는 추출된 DNA를 분석하여 종을 판별하기 위한 것이기 때문에, 상기 시료의 어느 부위에서 DNA를 추출하는지 또는 어떠한 방법으로 추출하는지는 특별히 제한되지 않는다. Extracting DNA from the sample may extract DNA from various tissues or various processed materials of the sample by various methods, and since DNA is extracted to analyze the extracted DNA, the DNA may be extracted at any part of the sample. Whether or not to extract is not particularly limited.

그리고, 이렇게 추출한 DNA를 PCR로 증폭하는 것 또한 검사 표본을 늘이기 위한 것으로, 증폭산물을 얻는 방법은 특별히 제한되지 않는다. 본 발명이 속하는 기술분야의 당업자에게 알려진 다른 DNA 추출방법이나 증폭방법 또한 본 발명의 범주에 속한다는 것은 명백하다.In addition, amplifying the DNA thus extracted by PCR is also used to extend the test sample, and the method of obtaining the amplified product is not particularly limited. It is obvious that other DNA extraction methods or amplification methods known to those skilled in the art also belong to the scope of the present invention.

또한, 본 발명이 대상으로 하는 오징어류는 바다에서 잡힌 생물 오징어, 또는 조미 가공된 형태의 오징어로서 그 형태형질을 알 수 없는 식품(예로 진미채, 분말수프 등) 등을 포함할 수 있다. 상기 조미 가공된 오징어는 간식용 또는 술안주나 반찬용으로 많은 양이 소비되고 있는데 국산 오징어 가격의 상승으로, 페루, 멕시코 등지에서 원료를 수입하여 조미오징어를 만들고 있다. 조미오징어로 가공하면 일반인들은 국산과 수입산을 구별하지 못한다는 점과 국산과 수입산을 혼합하면 전문가도 구별하기 쉽지 않다는 점 때문에 가공업자들이 이를 악용, 원산지를 속이거나 혼합하여 부당이득을 취하기도 한다. 이를 방지하기 위한 방법으로 본 발명에서는 국내에 유통되고 있는 수입산 오징어(페루, 멕시코)와 국내산 오징어를 판별할 수 있는 DNAchip을 제작하고자 하였다. In addition, the squids targeted by the present invention may be a biological squid caught in the sea, or a seasoned processed squid, and foods whose morphology is unknown (for example, delicacy, powdered soup, etc.). The seasoned squid is consumed in a large amount for snacks, wine snacks or side dishes, but with the rise of domestic squid prices, raw materials are imported from Peru and Mexico to make seasoned squid. When processed with seasoned squids, the general public cannot distinguish between domestic and imported products, and because it is not easy to distinguish between experts from domestic and imported products, processors sometimes exploit it, and deceive or mix it with the origin. In order to prevent this, in the present invention, it was intended to manufacture a DNAchip capable of distinguishing imported squid (Peru, Mexico) and domestic squid distributed in Korea.

본 발명자들은 오징어의 유전자형으로 구별하기에 가장 적합한 유전자군으로서, 미토콘드리아 DNA 중 COI 유전자를 선택하였고, 거기에 존재하는 특정한 단염기다형성(single nucleotide polymorphism, SNPs) 부위를 찾아내었으며, 이를 바탕으로 다양한 오징어류의 종간에 구별되는 DNA 서열을 만들어서, 종 판별을 간단하고 용이하게 하고자 하였다. The inventors of the present invention selected COI genes from mitochondrial DNA as the most suitable genotypes to distinguish the squid genotypes, and found specific single nucleotide polymorphism (SNPs) sites therein. DNA sequences distinguished between squid species were made to make species identification simple and easy.

도 1은 오징어류의 미토콘드리아 DNA 상의 유전자 배열을 나타내는 모식도이고, 여기에 도시된 바와 같은 유전자 중에서도, 본 발명은 특별히 COI 유전자 부위에 존 재하는 단염기다형성(SNPs) 부위를 이용한 것이며, 이에 따라 상기 오징어류에서 추출한 DNA는 오징어의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성(SNPs)을 포함하는 것이 바람직하다. Figure 1 is a schematic diagram showing the gene sequence on the mitochondrial DNA of squids, among the genes shown here, the present invention uses a single nucleotide polymorphism (SNPs) site specifically present in the COI gene site, according to the squid The DNA extracted from preferably contains monobasic polymorphisms (SNPs) of the COI gene region in the squid mitochondrial DNA.

본 명세서에서 '다형성(polymorphism)'이란 유전학적으로 결정된 집단 내에서 2 이상의 대체적 서열 또는 대립형질의 발생을 의미한다. 다형 마커 또는 부위는 발산이 일어나는 위치(locus)이다. 바람직한 마커는 선택된 집단에서 1% 이상, 더욱 바람직하기로는 10% 또는 20% 이상의 발생 빈도를 나타내는 두개 이상의 대립 형질을 가진다. 다형성 부위는 단일 염기쌍일 수도 있다.As used herein, 'polymorphism' refers to the occurrence of two or more alternative sequences or alleles within a genetically determined population. The polymorphic marker or site is the location where divergence occurs. Preferred markers have two or more alleles which exhibit a frequency of occurrence of at least 1%, more preferably at least 10% or 20% in the selected population. The polymorphic site may be a single base pair.

도2 내지 도 4는 각각 본 발명의 바람직한 일 실시예에 따른 오징어류의 미토콘드리아 DNA 중 COI 유전자 부위의 염기서열과, 특별히 그 중에서 단염기다형성(SNPs) 부위에 속하는 염기서열을 함께 나타내고 있다. 2 to 4 respectively show the nucleotide sequence of the COI gene region in the mitochondrial DNA of the cuttlefish according to the preferred embodiment of the present invention, and particularly the nucleotide sequence belonging to the monobasic polymorphism (SNPs) site.

본 발명자들은 수많은 연구와 노력 끝에 오징어 DNA의 COI 유전자 중에서, 상기 단염기다형성(SNPs) 부위에 속하는 염기서열을 프로브로 이용하면, 오징어류의 종을 구별하기에 가장 적합하다는 것을 확인하였다. The inventors of the present invention have found that, among the COI genes of squid DNA, using a nucleotide sequence belonging to the SNPs as a probe, it is most suitable for distinguishing species of squids.

이에 따라, 본 발명은 상기 단염기다형성(SNPs) 부위에 속하는 염기서열, 즉 후술하는 서열번호 3 내지 서열번호 11의 DNA 서열을 포함하는 염기서열을 프로브로 이 용한 것이다. 이러한 프로브는 오징어류 각 종의 단염기다형성(SNP) 부위를 근거로 제작되었기 때문에, 의도한 오징어류에 속하는 PCR 시료 산물과는 결합하지만 이외에 다른 종에 속하는 오징어류의 그것과는 결합하지 않는 것이 바람직하다.Accordingly, the present invention uses a nucleotide sequence belonging to the mononucleotide polymorphism (SNPs) site, that is, a nucleotide sequence including the DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 11 to be described later as a probe. Since these probes are manufactured based on the mononucleotide polymorphism (SNP) site of each species of squid, it is preferable to bind to the PCR sample product belonging to the intended squid, but not to that of other squids belonging to other species.

본 발명에 따른 서열번호 3 내지 서열번호 11의 DNA 서열은 하기의 표 1에 나타낸 바와 같다.DNA sequences of SEQ ID NO: 3 to SEQ ID NO: 11 according to the present invention are as shown in Table 1 below.

[표 1: 국내에 유통되는 주요 오징어류의 종 판정을 위한 DNA 서열]Table 1: DNA Sequence for Species Identification of Major Squids in Korea

국내에 유통되는 주요 오징어류의 종 판정을 위한 DNA서열DNA sequence for species determination of major squids distributed in Korea 프로브 명칭Probe Name DNA서열DNA sequence 반응어종Reactive fish species DNA 서열 위치DNA sequence position R1(서열번호 3)R1 (SEQ ID NO: 3) GCTGAACTGTCTACCCTCCTTTAGCTGAACTGTCTACCCTCCTTTA 멕시코/페루/외산(아메키라 빨강 오징어)Mexico / Peru / Foreign (Amekira Red Squid) 339-361339-361 R2(서열번호 4)R2 (SEQ ID NO: 4) TAGTAACTTATCCCATGCAGGCCTAGTAACTTATCCCATGCAGGCC 멕시코/페루/외산(아메키라 빨강 오징어)Mexico / Peru / Foreign (Amekira Red Squid) 364-386364-386 R3(서열번호 5)R3 (SEQ ID NO: 5) TAACTTATCCCATGCAGGCCCTTTAACTTATCCCATGCAGGCCCTT 멕시코/페루/외산(아메키라 빨강 오징어)Mexico / Peru / Foreign (Amekira Red Squid) 367-389367-389 R4(서열번호 6)R4 (SEQ ID NO: 6) TGAACGGTATATCCTCCTTTATCTGAACGGTATATCCTCCTTTATC 남대서양/원양산South Atlantic / Wonyangsan 341-363341-363 R5(서열번호 7)R5 (SEQ ID NO: 7) CACCTTGCAGGTGTCTCTTCTATCACCTTGCAGGTGTCTCTTCTAT 남대서양/원양산South Atlantic / Wonyangsan 413-438413-438 R6(서열번호 8)R6 (SEQ ID NO: 8) GCAGGTGTCTCTTCTATTCTAGGGCAGGTGTCTCTTCTATTCTAGG 남대서양/원양산South Atlantic / Wonyangsan 422-444422-444 R7(서열번호 9)R7 (SEQ ID NO: 9) CTACTTCCTCCATCCTTAACTCTCTACTTCCTCCATCCTTAACTCT 국산(살오징어)Domestic (squid) 275-297275-297 R8(서열번호 10)R8 (SEQ ID NO: 10) GCTGGTGTCTCTTCCATTTTAGGGCTGGTGTCTCTTCCATTTTAGG 국산(살오징어)Domestic (squid) 422-444422-444 R9(서열번호 11)R9 (SEQ ID NO: 11) TACTCTCCTTACCAGTGCTAGCATACTCTCCTTACCAGTGCTAGCA 국산(살오징어)Domestic (squid) 552-574552-574

본 발명은 상기 서열번호 3 내지 서열번호 11의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하도록 다수의 프로브를 제작할 수 있고, 이러한 프로브 중 적어도 하나 이상을 상기에서 얻은 PCR 산물과 결합시킴으로서, 그 결합 여부에 따라 오징어류의 종을 판별할 수 있는 것이다. The present invention can be produced a plurality of probes each comprising a base sequence identical to or complementary to each DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 11, at least one or more of these probes PCR products obtained above By combining with, it is possible to determine the species of squid species according to the combination.

즉, 본 발명에 있어서, 상기 결합 여부에 따라 상기 오징어류가 속하는 종을 판별하는 것은, 서열번호 3, 4 및 5의 염기서열을 포함하는 프로브와 결합하는 경우에는 멕시코, 페루 또는 아메리카 빨강오징어(Dosidicus gigas) 종으로 판별하고, 서열번호 6, 7 및 8의 염기서열을 포함하는 프로브와 결합하는 경우에는 남대서양산 오징어 종으로 판별하며, 서열번호 9, 10 및 11의 염기서열을 포함하는 프로브와 결합하는 경우에는 국내산 살오징어(Todarodes pacificus) 종으로 판별하는 것일 수 있다. In other words, in the present invention, the species to which the cuttlefish belongs depends on whether it is bound, when combined with a probe including the nucleotide sequences of SEQ ID NOs: 3, 4 and 5, Mexican, Peru or American red squid ( Dosidicus) gigas ) species, and when combined with a probe containing the nucleotide sequences of SEQ ID NOs: 6, 7 and 8, and distinguished to the South Atlantic squid species, and a probe comprising the nucleotide sequences of SEQ ID NOs: 9, 10 and 11 When combined, it may be determined by the domestic Todarodes pacificus species.

또한, 본 발명에 따른 상기 프로브는 오징어류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성 부위와 결합하고, 상기 결합은 상기 오징어류의 종에 따라 다르게 이루어지는 것이 바람직하다. In addition, the probe according to the present invention binds to the monobasic polymorphism site of the COI gene region in the mitochondrial DNA of the cuttlefish, and the binding is preferably made differently depending on the species of the cuttlefish.

예를 들어, 상기 결합이 상기 오징어류의 종에 따라 다르게 이루어진다는 것은, 서열번호 3의 염기서열을 포함하는 프로브는 멕시코, 페루 또는 아메리카 빨강오징어 종의 미토콘드리아 DNA 중 COI 유전자 부위의 339-361번째 DNA 서열과 특이적으로 결합하고, 서열번호 4의 프로브는멕시코, 페루 또는 아메리카 빨강오징어 종의 364-386번째 DNA 서열, 서열번호 5의 경우는 멕시코, 페루 또는 아메리카 빨강오징어 종의 367-389번째 DNA 서열, 서열번호 6의 경우는 남대서양산 오징어 종의 341-363번째 DNA 서열, 서열번호 7의 경우는 남대서양산 오징어 종의 413-438번째 DNA 서열, 서열번호 8의 경우는 남대서양산 오징어 종의 422-444번째 DNA 서열, 서열번 호 9의 경우는 국내산 살오징어 종의 275-297번째 DNA 서열, 서열번호 10의 경우는 국내산 살오징어 종의 422-444번째 DNA 서열, 서열번호 11의 경우는 국산 살오징어 종의 552-574번째 DNA 서열과 특이적으로 결합하는 것일 수 있다. For example, the binding is different depending on the species of squid species, the probe comprising the nucleotide sequence of SEQ ID NO: 3 is the 339-361 DNA of the COI gene region of the mitochondrial DNA of Mexican, Peru or American red squid species Specifically binding to the sequence, the probe of SEQ ID NO: 4 comprises the 364-386th DNA sequence of the Mexican, Peruvian or American Red Squid species, and the 367-389th DNA of the Mexican, Peruvian or American Red Squid species in SEQ ID NO: 5 SEQ ID NO: 6 is the 341-363 DNA sequence of the South Atlantic squid species, SEQ ID NO: 7 is the 413-438 DNA sequence of the South Atlantic squid species, and SEQ ID NO: 8 the South Atlantic squid 422-444 DNA sequence of species, SEQ ID NO: 9 for 275-297 DNA sequence of domestic squid species, SEQ ID NO: 10 422-444 DNA sequence for domestic squid species, For the column No. 11 may be one that binds to the second DNA sequence of the 552-574 year old domestic and squid species specific.

나아가, 상술한 본 발명에서, 상기 PCR 산물을 프로브에 결합시키는 단계는 적어도 2회 이상 수행되는 것이 바람직한데, 이와 같이 상기 결합을 확인하는 단계 이전에, 추출된 DNA와 본 발명에 따른 프로브의 결합 과정을 반복적으로 수행한다면, 상기 결합을 더욱 확실히 하여 프로브와 대상 DNA 산물의 결합을 더욱 견고히 할 수 있기 때문이다. Further, in the present invention described above, the step of binding the PCR product to the probe is preferably carried out at least two times, so before the step of confirming the binding, the binding of the extracted DNA and the probe according to the present invention If the process is performed repeatedly, the binding can be further ensured, thereby further strengthening the binding of the probe to the DNA product of interest.

한편, 본 발명의 다른 실시형태는, 상술한 오징어류의 종 판별 방법에 있어서, 상기 중합효소연쇄반응(PCR)을 수행하는 것은, 서열번호 1 내지 서열번호 2 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드를 정방향 프라이머 또는 역방향 프라이머로 사용하는 것을 특징으로 할 수 있다. On the other hand, in another embodiment of the present invention, in the above-described method for discriminating species of squids, performing the polymerase chain reaction (PCR) is the same as at least one DNA sequence selected from SEQ ID NO: 1 to SEQ ID NO: 2 Or polynucleotides each including a complementary base sequence thereof may be used as a forward primer or a reverse primer.

즉, 본 발명에 따른 3종의 오징어류에서 DNA 시료를 채취하고, 이를 증폭시켜서 PCR 산물을 증폭시키는데 있어서, 상기 오징어류의 종에 적합한 특별한 염기서열을 상기 증폭을 위한 프라이머로 사용하는 것이다. 이러한 특정한 프라이머는 오징어류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열에 부합 하는 것으로써, 상기 추출한 DNA를 더욱 우수하게 증폭시킬 수 있다. 이를 위해 상기와 같이 혈액, 세포 또는 조직으로부터 추출된 DNA는 COI 유전자의 단염기다형성(SNP) 부위를 포함하는 것이 바람직하다.That is, in order to amplify a PCR product by collecting DNA samples from three kinds of squids according to the present invention, a specific base sequence suitable for the species of squids is used as a primer for the amplification. Such specific primers can conform to the mononucleotide polymorphism (SNP) region DNA sequence of the COI gene in the mitochondrial DNA of squids, thereby further amplifying the extracted DNA. To this end, the DNA extracted from blood, cells or tissues as described above preferably comprises a monobasic polymorphism (SNP) site of the COI gene.

예를 들어, 상기 오징어류가 종은 멕시코, 페루 또는 아메리카 빨강오징어(Dosidicus gigas) 종, 남대서양산 오징어 종, 및 국내산 살오징어(Todarodes pacificus) 종으로 이루어진 군에서 선택된 하나 이상인 경우에는, 하기 표 2에 기재된 서열번호 1과 서열번호 2의 염기서열을 포함하는 프라이머를 정방향 프라이머와 역방향 프라이머로 이용하는 것이 바람직하다. For example, when the squid is one or more species selected from the group consisting of Mexican, Peruvian or American Red Squid ( Dosidicus gigas ) species, South Atlantic squid species, and Todarodes pacificus species, Table 2 It is preferable to use the primers including the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 as forward primers and reverse primers.

[표 2: 오징어류 판별을 위한 프라이머 서열]Table 2: Primer Sequence for Squid Identification

프라이머primer 염기서열Sequence 전위 프라이머(서열번호 1)Translocation primer (SEQ ID NO: 1) GTTCAACAAATCATAAAGATATTGGGTTCAACAAATCATAAAGATATTGG 후위 프라이머(서열번호 2)Trailing primer (SEQ ID NO: 2) TAAACTTCAGGGTGACCAAAAAATCATAAACTTCAGGGTGACCAAAAAATCA

상기한 바와 같이, 본 발명은 서열번호 3 내지 서열번호 11의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브를 이용하는 것이 특징이고, 이에 따라 본 발명의 다른 실시형태는 상기한 프로브, 이러한 프로브를 포함하는 DNA 칩 및 키트일 수 있다. As described above, the present invention is characterized by using a probe each comprising a base sequence identical to or complementary to each DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 11, and accordingly another embodiment of the present invention The probes described above may be DNA chips and kits including the probes.

이러한 본 발명은 DNA 마이크로어레이 기술에 따라 하나의 슬라이드 위에서 다수의 오징어류의 종을 동시에 판별할 수 있다. 본 발명에 따른 DNA 칩 및 키트는 상기한 프로브를 포함하여, 종 특이적 단염기다형성을 DNA의 혼성화 가부에 따라 판별함으로서, 염기서열을 분석하기 않고도 분석하고자 하는 오징어류의 유전자형과 그 종을 신속히 판정할 수 있는 효용성을 가지고 있다. 또한 상기 오징어류에 속하는 오징어 종을 한 번의 실험으로 정확한 유전자형을 분석할 수 있어, 상기 오징어류의 유전자형과 종을 판별하는 방법을 표준화 및 자동화하는 것도 가능하다. The present invention can simultaneously discriminate species of squid species on one slide according to DNA microarray technology. DNA chip and kit according to the present invention, including the probe described above, by determining the species-specific monobasic polymorphism according to the hybridization of DNA, to quickly determine the genotype and species of the squids to be analyzed without analyzing the nucleotide sequence It has the utility to do it. In addition, the squid species belonging to the squids can be analyzed precisely genotype in a single experiment, it is also possible to standardize and automate the method of determining the genotype and species of the squids.

본 발명은 하기의 실시예에 의하여 보다 더 잘 이해될 수 있으며, 하기의 실시예는 본 발명의 예시 목적을 위한 것이고, 첨부된 특허청구범위에 의하여 한정되는 보호범위를 제한하고자 하는 것은 아니다.The invention can be better understood by the following examples, which are intended for the purpose of illustration of the invention and are not intended to limit the scope of protection defined by the appended claims.

실시예 1: 서열번호 1 내지 2의 프라이머의 합성Example 1 Synthesis of Primers of SEQ ID NOS: 1-2

먼저, 오징어류에서 추출한 DNA를 증폭시키기 위한 프라이머를 합성하였다. 본 실시예에서 사용한 오징어류와 이에 따른 프라이머는 상기 표 2에 나타난 것과 동일한 오징어류 및 이에 따른 프라이머를 사용하였다. 프라이머는 독일의 Metabion 사에 의뢰하여 합성하였다.First, a primer for amplifying DNA extracted from squids was synthesized. Squids and primers according to this embodiment used the same squids and primers according to those shown in Table 2 above. Primers were synthesized by the German Metabion company.

대칭 또는 비대칭 PCR에 사용하는 역방향(앤티센스) 프라이머는 교잡화 반응 후에 형광을 확인하기 위하여, 말단에 로다민, cy3, cy5를 부착시켜서 제작하거나 바이 오틴을 부착시켰고, 교잡화 반응 후 Syreptavidin-Cyanine과 결합하도록 제작하여 사용하였다. Reverse (antisense) primers used for symmetric or asymmetric PCR were prepared by attaching rhodamine, cy3, cy5 to the ends or biotin to the end of the hybridization reaction to confirm fluorescence, and after the hybridization reaction, Syreptavidin-Cyanine It was used to make and combine.

실시예 2: 오징어류의 DNA 추출과 PCR 반응Example 2 DNA Extraction and PCR Reaction of Cuttlefish

멕시코, 페루 또는 아메리카 빨강오징어(Dosidicus gigas) 종과, 남대서양산 오징어 종(종명 확인 불가), 및 국내산 살오징어(Todarodes pacificus) 종의 DNA는 독일 QIAGEN사의 DNeasy tissue kit을 사용하여 추출하였다. DNAs of Mexican, Peruvian or American Red Squid ( Dosidicus gigas ) species, South Atlantic Squid species (not known species name), and Domestic Todarodes pacificus species were extracted using DNeasy tissue kit of QIAGEN of Germany.

상기 실시예 1에 따른 프라이머를 이용하여, 하기의 표 3과 같은 조건의 방법으로 PCR 반응을 DNA Engine(MJ Research사, 미국)에서 시행하였다.Using the primer according to Example 1, the PCR reaction was carried out in a DNA engine (MJ Research, USA) by the method of the conditions shown in Table 3 below.

[표 3: 프라이머 정상 증폭 확인 조건]TABLE 3: Primer Normal Amplification Confirmation Conditions

반응조성Reaction composition 반응 조건 Reaction conditions 멸균증류수 11.5ul
10X buffer 2ul
2mM dNTP 1ul
10uM forward 1ul
10uM reverse 1ul
1unit Hot start Taq 0.5ul
정제 DNA 2ul
Sterilized Distilled Water 11.5ul
10X buffer 2ul
2mM dNTP 1ul
10uM forward 1ul
10uM reverse 1ul
1unit Hot start Taq 0.5ul
Purified DNA 2ul
94℃, 4분94 ℃, 4 minutes 1 cycle
1 cycle
94℃, 1분
42℃, 1분
72℃, 1분
94 ° C, 1 minute
42 ° C., 1 minute
72 ° C., 1 minute

35 cycle

35 cycle
72℃, 7분
72 ° C., 7 minutes
1 cycle
1 cycle

PCR이 끝난 후, PCR 산물 10㎕에 젤 로딩 버터(0.2% orange G, 0.25% xylene cyanol FF, 60% glycerol) 2㎕를 넣고 1㎍/㎖ ethidium bromide가 함유된 2% 아가 로스젤에서 전기영동한 후 UV transilluminator가 부착된 Image analyzer(HITACHI, 일본)에서 PCR 밴드를 확인하였다.After the PCR, 2 μl of gel loading butter (0.2% orange G, 0.25% xylene cyanol FF, 60% glycerol) was added to 10 μl of the PCR product, followed by electrophoresis on 2% agarose gel containing 1 μg / ml ethidium bromide. Afterwards, PCR bands were confirmed by an image analyzer (HITACHI, Japan) equipped with a UV transilluminator.

실시예 3: 서열번호 3 내지 11의 프로브 제작Example 3: Probe Construction of SEQ ID NOs: 3 to 11

본 실시예에서는 3종 각각의 오징어류에 대한 프로브를 합성하였다. 교잡화 반응을 위한 프로브의 서열정보는 상기 표 1에 나타낸 것과 같다. In this example, probes for each of three species of squids were synthesized. Sequence information of the probe for the hybridization reaction is as shown in Table 1 above.

먼저, 알데히드 작용기가 처리되어 있는 글라스 위에, 상기한 서열정보를 가지는 폴리뉴클레오티드의 5'말단에 아미노 링크를 수식하고, 교잡화 반응시 슬라이드 글라스 위에 집적되어 있는 프로브 간의 공간적인 방해를 최소화시키기 위하여, 10-20 개의 올리고(dT)를 부가하여 본 발명에 따른 프로브를 완성하였다. 본 발명에서 사용한 프로브는 독일의 Metabion 사에 의뢰하여 합성하였다.First, in order to modify the amino link at the 5 'end of the polynucleotide having the above sequence information on the glass on which the aldehyde functional group is processed, and to minimize spatial interference between probes integrated on the slide glass during the hybridization reaction, 10-20 oligos (dT) were added to complete the probe according to the present invention. Probes used in the present invention were synthesized by the German Metabion company.

실시예 4: DNA 칩 제작Example 4 DNA Chip Preparation

올리고뉴클레오티드 칩을 제작하기 위하여, 상기 실시예 3에 따라 CSS-100 Silylatied Slide(Cell Associate사, 미국) 상에 50μM의 농도로 아미도 링크가 수식되어 있는 프로브와 동일한 양의 3X SSC를 혼합하여 집적하였고, 이를 16 시간 동안 실온에서 반응시켰다. 반응이 완료된 슬라이드를 0.1% SDS로 5분간 2회 세척 한 후, 증류수로 5분간 2회 세척하였다.In order to fabricate the oligonucleotide chip, the same amount of 3X SSC as the probe having Amido link modified at 50 μM on the CSS-100 Silylatied Slide (Cell Associate, USA) was mixed and integrated according to Example 3 It was reacted for 16 hours at room temperature. After the reaction was completed, the slide was washed twice with 0.1% SDS for 5 minutes and then with distilled water for 5 minutes.

소디움 보로하이드리드(1.3g NaBH4 375ml. PBS 125ml, 100% EtOH)에 제작된 칩을 5분간 반응시킨 후, 끓는 증류수에서 3분간 반응시킨 다음 진공 원심분리기에서 800rpm의 속도로 10분간 건조시켰다.A chip made in sodium borohydride (1.3 g NaBH 4 375 ml. PBS 125 ml, 100% EtOH) was reacted for 5 minutes, and then reacted in boiling distilled water for 3 minutes, and then dried at a speed of 800 rpm in a vacuum centrifuge for 10 minutes.

한 장의 슬라이드에서 다수의 시료 반응을 위해 perfusion chamber(BioGrace, 미국)로 분리한 후 실험 전까지 실온의 암소에서 보관하였다.One slide was separated into a perfusion chamber (BioGrace, USA) for multiple sample reactions and stored in the dark at room temperature until the experiment.

이렇게 제작된 DNA 칩을 3가지 형태로 도 5에 예시적으로 나타내었다. 도 5는 각각 본 발명에 따른 프로브를 포함하는 DNA 칩의 구조를 도식화한 모식도이다.The DNA chip thus produced is exemplarily shown in FIG. 5 in three forms. 5 is a schematic diagram illustrating the structure of a DNA chip containing a probe according to the present invention, respectively.

실시예 5: 교잡화 반응Example 5: Hybridization Reaction

상기 실시예 2에 따라 로다민, cy3, cy5 또는 바이오틴으로 결합된 PCR 산물을 교잡화 용액(3X SSC, 0.25% SDS)과 1:9의 비율로 혼합하였다. 형광반응을 일으키기 위하여 바이오틴을 사용한 경우 Syreptavidin-Cyanine을 1㎍/㎖의 농도로 첨가하여 반응시켰다.According to Example 2, PCR products bound with rhodamine, cy3, cy5 or biotin were mixed in a ratio of 1: 9 with hybridization solution (3X SSC, 0.25% SDS). When biotin was used to cause fluorescence, Syreptavidin-Cyanine was added at a concentration of 1 µg / ml and reacted.

그리고, 준비된 교잡화 용액을 상기 실시예 4의 DNA 칩이 포함된 chamber에 도포하 여 55도에서 1시간 동안 반응시켰다.Then, the prepared hybridization solution was applied to the chamber containing the DNA chip of Example 4 and reacted at 55 degrees for 1 hour.

그런 다음, 1X SSC, 0.1% SDS에서 5분 동안 일차 세척 후, 1X SSC에서 5분동안 2차 세척 후, 0.1X SSC에서 3분간 삼차 세척을 실시하였다. 세척된 슬라이드는 원심분리기에서 800rpm의 속도로 10분간 건조하였다.Then, the first wash for 5 minutes in 1X SSC, 0.1% SDS, the second wash for 5 minutes in 1X SSC, and then the third wash in 0.1X SSC for 3 minutes. The washed slides were dried for 10 minutes at a speed of 800 rpm in a centrifuge.

실험 결과의 확인은 Genepix 4000B(Axon) 스캐너를 사용하여 형광값을 측정하여 유전자형을 분석하였고, 그 결과는 도 6 내지 도 10에 나타낸 바와 같다. In order to confirm the experimental results, the genotype was analyzed by measuring fluorescence values using a Genepix 4000B (Axon) scanner, and the results are shown in FIGS. 6 to 10.

도 6 내지 도 10은 각각 본 발명에 따른 프로브와 오징어류의 PCR 증폭산물을 결합시킨 결과사진이다. 6 to 10 are photographs showing the results of combining the PCR amplification products of the probe and squid according to the present invention, respectively.

여기서, 도 6 내지 도 10은 각각 도 5에 따른 형태의 DNA 칩 구조에서, 본 발명에 따른 프로브와 오징어류의 PCR 증폭산물을 결합시킨 결과이다. 즉, 도 6은 멕시코 오징어, 도 7은 페루산 오징어, 도 8은 외산 오징어, 도 9는 남대서양/원양산 오징어, 도 10은 국산 오징어에 대한 결과이다.6 to 10 are the results of combining the PCR amplification products of the probe and the cuttlefish according to the present invention, respectively, in the structure of the DNA chip according to FIG. 5. That is, Figure 6 is a Mexican squid, Figure 7 Peru squid, Figure 8 is a foreign squid, Figure 9 is a South Atlantic / Wonyang squid, Figure 10 is a result for domestic squid.

여기에 도시된 것과 같이, 본 발명에 의하는 경우 해당 생물 종에 따라 형광 표지가 다르게 나타나므로, 이에 따라 해당 종을 판별할 수 있음을 확인할 수 있다.As shown here, according to the present invention, since the fluorescent label is different depending on the species, it can be confirmed that the species can be determined accordingly.

한편, 상기에서는 본 발명을 특정의 바람직한 일실시예에 관하여 도시하고 설명하였지만, 이하의 특허청구범위에 의해 마련되는 본 발명의 기술적 특징이나 분야를 이탈하지 않는 한도 내에서 본 발명이 다양하게 개조 및 변화될 수 있다는 것은 당업계에서 통상의 지식을 가진 자에게는 명백한 것이다.On the other hand, while the invention has been shown and described with respect to a particular preferred embodiment, the invention is variously modified and modified without departing from the technical features and the field of the invention provided by the following claims It will be apparent to those skilled in the art that such changes can be made.

도 1은 본 발명에 따른 오징어류의 미토콘드리아 DNA 상의 유전자 배열을 예시적으로 나타내는 모식도이고, 1 is a schematic diagram showing a gene sequence on the mitochondrial DNA of squids according to the present invention,

도 2 내지 도 4는 각각 본 발명에 따른 오징어류의 미토콘드리아 DNA 중 COI(Cytochrome oxidase subunit I) 유전자의 단일염기다형성 부위가 포함된 연속된 염기서열을 예시적으로 나타내는 모식도이고,2 to 4 are each a schematic diagram showing a sequential sequence containing a single nucleotide polymorphism site of the cytochrome oxidase subunit I (COI) gene in mitochondrial DNA of the cuttlefish according to the present invention, respectively

도 5는 본 발명에 따른 프로브를 포함하는 DNA 칩의 구조를 예시적으로 도식화한 모식도이고, 5 is a schematic diagram schematically illustrating the structure of a DNA chip including a probe according to the present invention,

도 6 내지 도 10은 각각 도 5에 따른 형태의 DNA 칩 구조에서, 본 발명에 따른 프로브와 오징어류의 PCR 증폭산물을 결합시킨 결과 사진이다.6 to 10 are photographs of the results of combining the PCR amplification products of the probe and the cuttlefish according to the present invention in the DNA chip structure of FIG. 5, respectively.

<110> Korea Ocean Research & Development Institute <120> Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same <130> 0001 <160> 11 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 gttcaacaaa tcataaagat attgg 25 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 taaacttcag ggtgaccaaa aaatca 26 <210> 3 <211> 23 <212> DNA <213> Dosidicus gigas <220> <221> gene <222> Complement((1)..(23)) <223> 339~361 <400> 3 gctgaactgt ctaccctcct tta 23 <210> 4 <211> 23 <212> DNA <213> Dosidicus gigas <220> <221> gene <222> Complement((1)..(23)) <223> 364~386 <400> 4 tagtaactta tcccatgcag gcc 23 <210> 5 <211> 23 <212> DNA <213> Dosidicus gigas <220> <221> gene <222> Complement((1)..(23)) <223> 367~389 <400> 5 taacttatcc catgcaggcc ctt 23 <210> 6 <211> 23 <212> DNA <213> Unknown <220> <223> not yet confirmed, as which is gained from Atlantic Ocean <220> <221> gene <222> Complement((1)..(23)) <223> 341~363 <400> 6 tgaacggtat atcctccttt atc 23 <210> 7 <211> 23 <212> DNA <213> Unknown <220> <223> not yet confirmed, as which is gained from Atlantic Ocean <220> <221> gene <222> Complement((1)..(23)) <223> 413~438 <400> 7 caccttgcag gtgtctcttc tat 23 <210> 8 <211> 23 <212> DNA <213> Unknown <220> <223> not yet confirmed, as which is gained from Atlantic Ocean <220> <221> gene <222> Complement((1)..(23)) <223> 422~444 <400> 8 gcaggtgtct cttctattct agg 23 <210> 9 <211> 23 <212> DNA <213> Todarodes pacificus <220> <221> gene <222> Complement((1)..(23)) <223> 275~297 <400> 9 ctacttcctc catccttaac tct 23 <210> 10 <211> 23 <212> DNA <213> Todarodes pacificus <220> <221> gene <222> Complement((1)..(23)) <223> 422~444 <400> 10 gctggtgtct cttccatttt agg 23 <210> 11 <211> 23 <212> DNA <213> Todarodes pacificus <220> <221> gene <222> Complement((1)..(23)) <223> 552~574 <400> 11 tactctcctt accagtgcta gca 23 <110> Korea Ocean Research & Development Institute <120> Identifying Method of origin and species about squids,          Polynucleotide Probe, DNA Chip and Kit for Identifying The Same <130> 0001 <160> 11 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 gttcaacaaa tcataaagat attgg 25 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 taaacttcag ggtgaccaaa aaatca 26 <210> 3 <211> 23 <212> DNA <213> Dosidicus gigas <220> <221> gene <222> Complement ((1) .. (23)) <223> 339-361 <400> 3 gctgaactgt ctaccctcct tta 23 <210> 4 <211> 23 <212> DNA <213> Dosidicus gigas <220> <221> gene <222> Complement ((1) .. (23)) <223> 364-386 <400> 4 tagtaactta tcccatgcag gcc 23 <210> 5 <211> 23 <212> DNA <213> Dosidicus gigas <220> <221> gene <222> Complement ((1) .. (23)) <223> 367-389 <400> 5 taacttatcc catgcaggcc ctt 23 <210> 6 <211> 23 <212> DNA <213> Unknown <220> <223> not yet confirmed, as which is gained from Atlantic Ocean <220> <221> gene <222> Complement ((1) .. (23)) <223> 341-363 <400> 6 tgaacggtat atcctccttt atc 23 <210> 7 <211> 23 <212> DNA <213> Unknown <220> <223> not yet confirmed, as which is gained from Atlantic Ocean <220> <221> gene <222> Complement ((1) .. (23)) <223> 413-438 <400> 7 caccttgcag gtgtctcttc tat 23 <210> 8 <211> 23 <212> DNA <213> Unknown <220> <223> not yet confirmed, as which is gained from Atlantic Ocean <220> <221> gene <222> Complement ((1) .. (23)) <223> 422-444 <400> 8 gcaggtgtct cttctattct agg 23 <210> 9 <211> 23 <212> DNA <213> Todarodes pacificus <220> <221> gene <222> Complement ((1) .. (23)) <223> 275-297 <400> 9 ctacttcctc catccttaac tct 23 <210> 10 <211> 23 <212> DNA <213> Todarodes pacificus <220> <221> gene <222> Complement ((1) .. (23)) <223> 422-444 <400> 10 gctggtgtct cttccatttt agg 23 <210> 11 <211> 23 <212> DNA <213> Todarodes pacificus <220> <221> gene <222> Complement ((1) .. (23)) <223> 552-574 <400> 11 tactctcctt accagtgcta gca 23  

Claims (12)

오징어류에 속하는 종에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계;Performing PCR analysis on PCR extracted from a species belonging to a squid species to obtain a PCR product; 상기 PCR 산물을, 서열번호 3 내지 서열번호 11의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및,Binding the PCR product to a probe each comprising a base sequence identical to or complementary to each DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 11; And, 상기 결합 여부에 따라 오징어류에 속하는 종을 판별하는 단계;를 포함하여 이루어지는 오징어류의 종 판별 방법.And determining a species belonging to the cuttlefish according to the coupling. 제1항에 있어서, 상기 오징어류 종은 멕시코, 페루 또는 아메리카 빨강오징어(Dosidicus gigas) 종, 남대서양산 오징어 종, 및 국내산 살오징어(Todarodes pacificus) 종으로 이루어진 군에서 적어도 하나 이상이 선택된 것을 특징으로 하는 오징어류의 종 판별 방법.The method of claim 1, wherein the squid species is at least one selected from the group consisting of Mexican, Peru or American Dosidicus gigas species, South Atlantic squid species, and Todarodes pacificus species How to determine the species of squid. 제1항에 있어서, 상기 추출한 DNA는 상기 오징어류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성(single nucleotide polymorphism, SNPs)을 포함하는 것을 특징으로 하는 오징어류의 종 판별 방법.The method of claim 1, wherein the extracted DNA comprises single nucleotide polymorphisms (SNPs) of a COI gene region in mitochondrial DNA of the cuttlefish. 제1항에 있어서, 상기 결합 여부에 따라 상기 오징어류에 속하는 종을 판별하는 것은, The method of claim 1, wherein the species belonging to the cuttlefish is determined according to whether the combination is performed. 서열번호 3, 4 및 5의 염기서열을 포함하는 프로브와 결합하는 경우에는 멕시코, 페루 또는 아메리카 빨강오징어(Dosidicus gigas) 종으로 판별하고, 서열번호 6, 7 및 8의 염기서열을 포함하는 프로브와 결합하는 경우에는 남대서양산 오징어 종으로 판별하며, 서열번호 9, 10 및 11의 염기서열을 포함하는 프로브와 결합하는 경우에는 국내산 살오징어(Todarodes pacificus) 종으로 판별하는 것을 특징으로 하는 오징어류의 종 판별 방법.When combined with a probe comprising the nucleotide sequences of SEQ ID NOs: 3, 4, and 5, it is determined to be a Mexican, Peruvian or American Red Squid ( Dosidicus gigas ) species, and a probe comprising the nucleotide sequences of SEQ ID NOs: 6, 7, and 8; The species of squid is characterized in that it is identified as a South Atlantic squid species, and when it is combined with a probe containing the nucleotide sequences of SEQ ID NOs: 9, 10 and 11, it is determined as a domestic species of Todarodes pacificus . How to determine. 제1항에 있어서, 상기 프로브는 상기 오징어류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성 부위와 결합하고, 상기 결합은 상기 오징어류의 종에 따라 다르게 이루어지는 것을 특징으로 하는 오징어류의 종 판별 방법.The method of claim 1, wherein the probe binds to a monobasic polymorphism site of the COI gene region in the mitochondrial DNA of the cuttlefish, and the binding is different depending on the species of the cuttlefish. 제5항에 있어서, 상기 결합이 상기 오징어류의 종에 따라 다르게 이루어진다는 것은, 서열번호 3의 염기서열을 포함하는 프로브는 멕시코, 페루 또는 아메리카 빨강오징어 종의 미토콘드리아 DNA 중 COI 유전자 부위의 339-361번째 DNA 서열과 특이적으로 결합하고, 서열번호 4의 프로브는멕시코, 페루 또는 아메리카 빨강오징어 종의 364-386번째 DNA 서열, 서열번호 5의 경우는 멕시코, 페루 또는 아메리카 빨강오징어 종의 367-389번째 DNA 서열, 서열번호 6의 경우는 남대서양산 오징어 종의 341-363번째 DNA 서열, 서열번호 7의 경우는 남대서양산 오징어 종의 413-438번째 DNA 서열, 서열번호 8의 경우는 남대서양산 오징어 종의 422-444번째 DNA 서열, 서열번호 9의 경우는 국내산 살오징어 종의 275-297번째 DNA 서열, 서열번호 10의 경우는 국내산 살오징어 종의 422-444번째 DNA 서열, 서열번호 11의 경우는 국산 살오징어 종의 552-574번째 DNA 서열과 특이적으로 결합하는 것을 특징으로 하는 오징어류의 종 판별 방법.According to claim 5, The binding is different according to the species of the cuttlefish, Probe comprising the nucleotide sequence of SEQ ID NO: 3 is 339-361 of the COI gene region in the mitochondrial DNA of Mexican, Peru or American red squid species The DNA sequence specifically binds the probe of SEQ ID NO: 4 to the 364-386 DNA sequence of the Mexican, Peruvian or American Red Squid species, and 367-389 of the Mexican, Peruvian or American Red Squid species for SEQ ID NO: 5 DNA sequence, SEQ ID NO: 6 is the 341-363 DNA sequence of the South Atlantic squid species, SEQ ID NO: 7 is the 413-438 DNA sequence of the South Atlantic squid species, and SEQ ID NO: 8 the South Atlantic 422-444 DNA sequence of live squid species, SEQ ID NO: 9 is 275-297 DNA sequence of domestic squid species, and SEQ ID NO: 10 422-444 DNA of domestic squid species Column, SEQ ID NO: 11-year-old domestic method of determining ohjingeoryu characterized in that coupled to the second DNA sequence 552-574 and the specific species of squid species for. 제1항에 있어서, 상기 PCR 산물을 프로브에 결합시키는 단계는 적어도 2회 이상 수행되는 것을 특징으로 하는 오징어류의 종 판별 방법.The method of claim 1, wherein the binding of the PCR product to the probe is performed at least twice. 제1항에 있어서, 상기 중합효소연쇄반응(PCR)을 수행하는 것은, 서열번호 1 과 서열번호 2 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드를 정방향 프라이머 또는 역방향 프라이머로 사용하는 것을 특징으로 하는 오징어류의 종 판별 방법.The method of claim 1, wherein the PCR is performed by performing a polymerase chain reaction (PCR), wherein each polynucleotide comprises at least one DNA sequence identical to or complementary to each DNA sequence selected from SEQ ID NO: 1 and SEQ ID NO: 2 A method for discriminating species of cuttlefish, characterized by using nucleotides as forward primers or reverse primers. 서열번호 3 내지 서열번호 11 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 폴리뉴클레오티드로 이루어진 오징어류의 종 판별용 프로브.A probe for species identification of a squid species comprising at least one or more polynucleotides each comprising a base sequence identical to or complementary to each DNA sequence selected from SEQ ID NOs: 3 to 11. 서열번호 3 내지 서열번호 11 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 프로브를 포함하는 오징어류의 종 판별용 DNA 칩.A DNA chip for squid species identification, comprising at least one or more probes each comprising a base sequence identical to or complementary to each DNA sequence selected from SEQ ID NOs: 3 to 11. 오징어류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열과 결합하는 것으로, 서열번호 3 내지 서열번호 11 중 어느 하나의 DNA 서열과 동일하거나 상보적인(complementary) 15-30개의 연속 염기서열로 이루어진 것을 특징으로 하는 폴리뉴클레오티드 프로브와;15-30 contiguous sequences of the squid mitochondrial DNA that bind to the DNA sequence of the monobasic polymorphism (SNP) region of the COI gene and are identical or complementary to the DNA sequence of any one of SEQ ID NOs: 3-11. A polynucleotide probe, characterized in that consisting of; 상기 오징어의 미토콘드리아 DNA를 중합효소연쇄반응(PCR)으로 증폭시키기 위한 프라이머를 포함하는 것을 특징으로 하는 오징어류의 종 판별용 키트.Squid species determination kit comprising a primer for amplifying the mitochondrial DNA of the squid by a polymerase chain reaction (PCR). 제11항에 있어서, 상기 프라이머는 서열번호 1 내지 서열번호 2 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 정방향 프라이머 또는 역방향 프라이머인 것을 특징으로 하는 오징어류의 종 판별용 키트.12. The cuttlefish according to claim 11, wherein the primer is a forward primer or a reverse primer each comprising a base sequence identical to or complementary to each DNA sequence selected from SEQ ID NO: 1 to SEQ ID NO: 2 Species identification kit.
KR1020090099541A 2009-10-20 2009-10-20 Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same KR101196640B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020090099541A KR101196640B1 (en) 2009-10-20 2009-10-20 Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020090099541A KR101196640B1 (en) 2009-10-20 2009-10-20 Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Publications (2)

Publication Number Publication Date
KR20110042734A true KR20110042734A (en) 2011-04-27
KR101196640B1 KR101196640B1 (en) 2012-11-02

Family

ID=44048101

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020090099541A KR101196640B1 (en) 2009-10-20 2009-10-20 Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same

Country Status (1)

Country Link
KR (1) KR101196640B1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101254082B1 (en) * 2011-05-12 2013-04-12 국방과학연구소 Inducement weapon assignment system and method using CLP method and computer-readerable storage medium having a program recorded thereon where the program is to carry out its method
KR20180083988A (en) * 2017-01-13 2018-07-24 부경대학교 산학협력단 Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof
KR20180130627A (en) * 2017-05-29 2018-12-10 한양대학교 에리카산학협력단 Identifying method of squid species using dual labeled probe and fluorescence melting curve analysis
KR20190086333A (en) * 2018-01-12 2019-07-22 부경대학교 산학협력단 The primer set for analysis of cephalopods and methods for their qualitativeand quantitative analysis

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101254082B1 (en) * 2011-05-12 2013-04-12 국방과학연구소 Inducement weapon assignment system and method using CLP method and computer-readerable storage medium having a program recorded thereon where the program is to carry out its method
KR20180083988A (en) * 2017-01-13 2018-07-24 부경대학교 산학협력단 Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof
KR20180130627A (en) * 2017-05-29 2018-12-10 한양대학교 에리카산학협력단 Identifying method of squid species using dual labeled probe and fluorescence melting curve analysis
KR20190086333A (en) * 2018-01-12 2019-07-22 부경대학교 산학협력단 The primer set for analysis of cephalopods and methods for their qualitativeand quantitative analysis

Also Published As

Publication number Publication date
KR101196640B1 (en) 2012-11-02

Similar Documents

Publication Publication Date Title
KR101211068B1 (en) Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR101151747B1 (en) Identifying Method of Marine Species, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
JP2006518194A5 (en)
JPH03224499A (en) Method and composition for specific staining of chromosome
KR100806208B1 (en) A Polynucleotide probe and chip kit for skate and ray species discrimination based on the single nucleotide polymorphisms in the mitochondrial COI gene
KR101403351B1 (en) Identifying Method of diatoms in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
CN108342477A (en) Detection kit based on multiple gene diagnosis patients with lung cancer
CN108026583A (en) HLA-B*15:02 single nucleotide polymorphism and its application
KR101196640B1 (en) Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR101140022B1 (en) Probe and DNA Chip for Identifying Freshwater Fish Species
CN109097463B (en) Specific primer probe combination, kit and detection method for detecting HLA-A24: 02 allele
KR101131789B1 (en) Identifying Method of species or origin about hairtails, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
CN103436609A (en) Method for noninvasive prenatal disgnosis of congenital deafness genetic disease
KR101151757B1 (en) Identifying Method of jellyfish in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
KR101248425B1 (en) Probe composition for determining phylogenetic classification of animals belonging to Cetacea, phylogenetic classification DNA chip and kit, and phylogenetic classification method using the same
KR101540852B1 (en) Molecular methods for identification of oyster species using species-specific probes, dna chip, and molecular kits
CN101671736B (en) Gene detection kit used for detecting cell chimerism or individual recognition
JP2007037468A (en) Method for discriminating variety of rice by using microsatelite marker
CN108396026A (en) The exploitation and application of the Chang Miho couchgrass indigo plant kernel Characters of decaploid special chemoattractant molecule label and fluorescence in situ hybridization probe
KR101817107B1 (en) Method For Identification Of Beringraja pulchra Using Real-Time PCR assay
KR20100128118A (en) Probe and dna chip for identifying freshwater fish species
KR100829421B1 (en) Identifying Method of Chum Salmon Species or Its Originated Stocks Polynucleotide Probe DNA Chip and Kit for Identifying The Same
CN111733273A (en) DNA barcode sequence and method for identifying lycium species by using same
KR101088775B1 (en) Primer sets for discriminating rice cultivars, and uses thereof
KR20140021696A (en) Identifying method of diatoms in southern sea of korea, polynucleotide probe, dna chip and kit for identifying the same

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20151026

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20161021

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20171012

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20181002

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20191002

Year of fee payment: 8