KR20180083988A - Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof - Google Patents

Abstract

The present invention relates to a species-specific primer set for discriminating species of two skin webfoot octopus, one skin webfoot octopus, long arm octopus, and Japanese flying squid, and a high-speed analysis method of gene amplification. Mixing of two skin webfoot octopus into a raw material for cooking which includes one skin webfoot octopus can be prevented by the primer set or high-speed analysis method of gene amplification using the same. Additionally, species of one skin webfoot octopus can be easily guaranteed, and proper pricing of one skin webfoot octopus which is domestic webfoot octopus, long arm octopus, and Japanese flying squid is possible. Moreover, the present invention is helpful for revitalization of distribution and a consumer market by exposing an example that two skin webfoot octopus which is imported webfoot octopus is disguised into domestic webfoot octopus, long arm octopus, squid, or the like, and monitoring imported webfoot octopus.

Description

TECHNICAL FIELD [0001] The present invention relates to a high-speed real-time PCR-specific primer set for the discrimination of two-skin web juice octopus from One skin webfoot octopus, long arm octopus and Japanese flying squid, or method of discriminating species using thereof)

The present invention relates to a high-speed real-time PCR-specific primer set for discriminating two-skinned jujube, one-skinned jujube, octopus and squid, or to a method of discriminating a variety using the same.

As the market for processed fish products for marine products is gradually expanding, there are also cases in which processed marine products are manufactured and distributed as EMA (Economically motivated adulteration) foods. In the case of EMA foods using aquatic products, it is difficult for consumers to distinguish morphologically. Therefore, there is an increasing tendency that aquatic products sellers make products using low-cost imported or similar bio-products to consumers. Especially, in the case of jukugi living in the coastal area of Korea recently, the number of individuals is suddenly decreased due to indiscreet overfishing and is being imported from Southeast Asia or China.

Amphioctopus fangsiao is a marine invertebrate belonging to the mollusc line, bivalve river, octopus and octopus. It is commonly found in the sand or gravel bottom of 5-50m depth. It is commonly found in Korea. In the morphological classification, it is classified as one skin webfoot octopus. On the contrary, the two kinds of nutrients in the Southeast Asian region live in the same time with two skin webfoot octopus. In Korea, jucukmi used as food is one-skin jukumi. In the past, tucson jukumi, which is not inhabited in Korea, rarely used as food.

On the other hand, the number of jukyu inhabitants in the coastal area of Korea has been rapidly decreasing, and the jukugi has been imported from Southeast Asia or China. In this case, it is processed or cut into pieces and imported. However, it is not possible to distinguish between the one-skin jukipui and the two-skin jukumi morphologically in the case of the jukuni which are imported by processing and cutting. In addition, it is difficult to distinguish between cut and sliced squid and octopus, and it is used for manufacturing EMA foods by using sliced tsukin juku.

Ultra-Fast PCR system is a UF-150 GENECHECKER ™ model of Gene System Co., Ltd. It is possible to heat a sample faster by using a special polymer chip (RAPI: CHIP ™) rather than using a general tube. The Rapi: chip ™ PCR chip enables ultra-high-speed gene amplification by the thin film film being precisely bonded to the bottom surface of the plastic body. The genome amplification mechanism of GENECHECKER ™ enables ultra-high-speed heating and cooling at 8 ° C / sec. The fluorescence analysis module enables the user to observe and analyze the reaction process in real time through the GENERECORDER software by detecting and recording the fluorescence emitted in the gene amplification process in real time. Through this fluorescence analysis method, the model UF-150 provides precise analysis results compared to real-time PCR equipment that analyzes fluorescence values by optical scanning method. The user interface of the GENERECORDER software is designed to be similar to the real-time PCR instruments on the market, so that users of third-party equipment can use it without difficulty. The model UF-150 is supplied with the notebook (GENERECORDER installed and calibrated) to be connected to the main unit, so it can be used immediately without any user calibration process.

The inventors of the present invention have completed the present invention by deriving polynucleotide primers for discriminating varieties of jukebooks and Ultra-Fast PCR method using the same, in order to overcome these problems based on gene amplification technology for accurate and rapid identification of breeds .

Korean Patent No. 10-1151747 (Title of the Invention: Polynucleotide probe, DNA chip and kit for discrimination of marine organisms and species discrimination according to the same, Applicant: Zinocheck Co., Ltd. and others) 24 days) Korean Patent No. 10-1196640 (Name of invention: Polynucleotide probe, DNA chip and kit for discrimination of squid, and species discrimination thereof) Applicant: Zinocheck Co., Ltd. et al., Registered: October 26, 2012 Work)

It is an object of the present invention to provide a high-speed real-time PCR-specific primer set for discrimination of Tuskin jukumi, one skin juku, octopus and squid, or a method of discriminating a variety using the same.

A first primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 5 and a primer comprising the nucleotide sequence of SEQ ID NO: 6 for the identification of Two skin webfoot octopus ( Amphioctopus marginatus );

A second primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 7 and a primer comprising the nucleotide sequence of SEQ ID NO: 8 for the discrimination of One skin webfoot octopus ( Amphioctopus fangsiao );

A third primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 9 and a primer comprising the nucleotide sequence of SEQ ID NO: 10 for the determination of octopus ( Octopus minor ); And

A fourth primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 11 and a primer comprising the nucleotide sequence of SEQ ID NO: 12, for the discrimination of Japanese squid ( Todarodes pacificus );

And a primer set for discriminating the breeds of cephalopods containing at least one of the primer sets selected from the group consisting of:

The present invention also relates to a composition for real-time PCR comprising a primer set for discrimination of the cephalopods. The composition may comprise a Taq DNA polymerase derived from Thermus aquaticus .

In another aspect, the present invention provides a diagnostic kit for discriminating the breeds of at least one cephalopod selected from the group consisting of tsukin juku, one skin juku, octopus and squid including the above composition.

The present invention also provides a method for producing a variety of primer-specific primer sets for the identification of the two-skin juki, one-skin jukumi, octopus and squid;

A second step of preparing a composition comprising the primer set and the Taq DNA polymerase;

A third step of preparing a reaction solution by adding a sample of Tuskin jukumi, one skin juku, octopus or squid squid to the composition; And

A fourth step of performing gene amplification analysis using the reaction solution;

And a method of distinguishing one or more species of at least one cephalopod selected from the group consisting of a squid, a squid, a squid, an octopus, or a squid. The specimen may be a tissue lysate or genomic DNA.

Hereinafter, the present invention will be described in detail.

The present invention relates to a primer set for discriminating breeds of cephalopods comprising at least one primer set selected from the first to fourth primer sets, and more preferably, the primer set includes all of the first to fourth primer sets It may be related to a set of primers for discriminating the breeds of cephalopods.

The term " primer " in the present invention means a short nucleic acid sequence capable of forming a base pair with a complementary template with an oligonucleotide and serving as a starting point for template strand copying . Primers can initiate DNA synthesis in the presence of reagents for polymerization ( Taq DNA polymerase) and four different dNTPs (deoxynucleoside triphospate) at appropriate buffer solutions and temperatures. According to the present invention, it is preferable that the primer is composed of a nucleic acid having 15 to 50 nucleotide sequences.

The nucleotide sequence of Cytochrome C oxidase I (COI) genomic DNA of two skin webfoot octopus ( Amphioctopus marginatus ) recognized by the primer set of the present invention is represented by SEQ ID NO: 1 in Table 1 below.

SEQ ID NO: 1: ACCESSION NO. 1 to 676 of the sequence of KJ168052.1,

https://www.ncbi.nlm.nih.gov/nuccore/KJ168052.1

gatattggaactttatacttcattttcggaatttgatcaggcctcctaggtacttcattaagattaataatccgaacggaactaggacaaccaggatcactattaaatgatgatcaattatataatgtaattgtaacagcccatgcatttgtaataatttttttcctcgttataccagtaataattggaggatttggaaattgattagtaccattaatactaggtg ccccagatatagcatttccccgta taaacaatataagattttgattattacccccttcctt aaccttactcctttcctcagctgc agtagaaagaggtgttggtactggatgaacagtatatcctcctttatcaagaaatttagcacatataggaccatctgttgatctagcaattttttctcttcacttagcaggaatctcatcaattctaggagcaattaacttcattactaccatcatcaatatacgatgagaaggtatactcatagaacgactcccattgtttgtatgatctgtatttatcacagccgtgttactacttctatcgttaccagtattagctggtgcaattaccatattattaactgaccgaaacttcaataccacattttttgaccctagaggaggtggggatcctattctctaccaacacttattctgattttttg

The nucleotide sequence of Cytochrome C oxidase I (COI) genome of One skin webfoot octopus ( Amphioctopus fangsiao ) recognized by the primer set of the present invention is represented by SEQ ID NO: 2 in Table 2 below.

SEQ ID NO: 2: ACCESSION NO. Sequence 2542 to 4074 of the sequence of AB240156.1,

https://www.ncbi.nlm.nih.gov/nuccore/AB240156.1

atgcgatgaatattttcaacaaatcataaagacattggtacattatactttatcttcggaatttgatcaggcctcctaggtacatctttaagcttaataattcgaacagaattaggtcaaccaggatctttattaaatgatgatcaattatataatgtaattgttacagcccatgcatttgtaataattttttttttggttatacctgttataattggaggatttggtaactgattagtccccttaatattaggtgctccagatatagcttttcctcgtataaataatataagattctgattattacctccctctcttacttt attactttcctcagctgcggtaga aagaggagctggtactggatgaactgtctatccacctctatcaagtaattta gctcatataggaccctccgtcgat ccatttaaatacatctttagaatgagataatcgattaccagtagattttcacaaccaaatagaaacaggagccctatttatttaa

The nucleotide sequence of Cytochrome C oxidase I (COI) genome of long arm octopus ( Octopus minor ) recognized by the primer set of the present invention is represented by SEQ ID NO: 3 in Table 3 below.

SEQ ID NO: 3: ACCESSION NO. 2546 to 4078 < th > order in NC_015896.1,

https://www.ncbi.nlm.nih.gov/nuccore/NC_015896.1

atgcgatgaatattttcaacaaatcataaagatattggaacactatattttatttttggaatctgatcaggtcttctaggaacttctttaagattaataattcgtactgaattaggtcaaccaggttcactactcaacgatgatcaactttataatgttattgtaactgcacatgcatttgtaataattttttttttagtaatacctgttataatcggaggatttggaaattgattagttcctttaatattaggtgcaccagatatagcattcccccgaataaataatataagattttgacttcttcctccttccctaaccttattattaacc tctgcagctgttgaaagaggagta ggaacaggatgaaccgtatatcctcctttatcaagaaatctcgctcata caggaccatctgtagacctagcaa aacacatccttagaatgaaacaatcgtcttccagtagattttcataaccaaatagaaactggagctttatttatttaa

The nucleotide sequence of Cytochrome C oxidase I (COI) genomic DNA of Japanese squid ( Todarodes pacificus ) recognized by the primer set of the present invention is represented by SEQ ID NO: 4 in Table 4 below.

SEQ ID NO: 4: ACCESSION NO. AB158364.1, 1400 to 2938 < th >

https://www.ncbi.nlm.nih.gov/nuccore/AB158364.1

ctccttaccagtgctagcaggtgc aattactatgctgttaactgatcgaaacttcaatactactttttttgatcctagtggagggggagacccaattttataccaacatt tattttgattctttgggcatccccga

The nucleotide sequences of the DNAs constituting the primers of SEQ ID NOS: 5 to 12 are as follows.

SEQ ID NO: 5: Forward primer for amplification of Cytochrome C oxidase I (COI) gene region of ccccagatat agcatttccc cgta-Tuskin juku ( Amphioctopus marginatus )

SEQ ID NO: 6: gcagctgagg aaaggagtaa ggtt - Amphioctopus marginatus Reverse primer sequence for Cytochrome C oxidase I (COI) gene amplification

SEQ ID NO: 7: attactttcc tcagctgcgg taga - Forward primer sequence for Amphioctopus fangsiao Cytochrome C oxidase I (COI) gene partial amplification

SEQ ID NO: 8: atcgacggag ggtcctatat gagc - Amphioctopus fangsiao Reverse primer sequence for Cytochrome C oxidase I (COI) gene amplification

SEQ ID NO: 9: tctgcagctg ttgaaagagg agta - Octopus minor Forward primer sequence for amplification of Cytochrome C oxidase I (COI)

SEQ ID NO: 10: ttgctaggtc tacagatggt cctg- Octopus minor Reverse primer sequence for Cytochrome C oxidase I (COI) gene amplification

SEQ ID NO: 11: ctccttacca gtgctagcag gtg - Todarodes pacificus Forward primer sequence for Cytochrome C oxidase I (COI) gene partial amplification

SEQ ID NO: 12: tcgggatgcc caaagaatca aaata - Todarodes pacificus Reverse primer sequence for amplification of Cytochrome C oxidase I (COI)

T.pacificus atgcgatgactattttctacaaaccataaagacattggtaccttatattttatctttggt
O.minor atgcgatgaatattttcaacaaatcataaagatattggaacactatattttatttttgga
A.fangsiao atgcgatgaatattttcaacaaatcataaagacattggtacattatactttatcttcgga
A.marginatus ------------------------------ gatattggaactttatacttcattttcgga
** *****: ** **** ** ** ** **:
T.pacificus atctgggcaggactattaggtacatcattaagattaatgattcgtaccgaattaggtcaa
O.minor atctgatcaggtcttctaggaacttctttaagattaataattcgtactgaattaggtcaa
A.fangsiao atttgatcaggcctcctaggtacatctttaagcttaataattcgaacagaattaggtcaa
A. marginatus atttgatcaggcctcctaggtacttcattaagattaataatccgaacggaactaggacaa
** **. **** ** ****: **: **: *****. *****. ** **: ** *** ****: ***

T.pacificus cccggatctttattaaatgatgatcaattatataacgtagtagttactgctcacggattt
O.minor ccaggttcactactcaacgatgatcaactttataatgttattgtaactgcacatgcattt
A.fangsiao ccaggatctttattaaatgatgatcaattatataatgtaattgttacagcccatgcattt
A.marginatus ccaggatcactattaaatgatgatcaattatataatgtaattgtaacagcccatgcattt
**. **: **: ** *. ** ********* *: ***** **: **. ** ** ** ** ** ** ** **

T.pacificus attataatttttttcatagttatacctattataattggaggatttggtaactggttagtt
O.minor gtaataattttttttttagtaatacctgttataatcggaggatttggaaattgattagtt
A.fangsiao gtaataattttttttttggttatacctgttataattggaggatttggtaactgattagtc
A.marginatus gtaataattttttcctcgttataccagtaataattggaggatttggaaattgattagta
. *: *********** * **: *****:. *: ***** ***********: ** **. * ****

T.pacificus cccttaatattaggtgctccagatatagcattcccacgtataaacaatataagattctga
O.minor cctttaatattaggtgcaccagatatagcattcccccgaataaataatataagattttga
A.fangsiao cccttaatattaggtgctccagatatagcttttcctcgtataaataatataagattctga
A. marginatus ccattaatactaggtg ccccagatatagcatttccccgta taaacaatataagattttga
** ****** ******* ***********: ** ** **: ***** *********** ***

T.pacificus ctacttcctccatccttaactcttttattagcttcatctgctgtagaaagaggagccgga
O.minor cttcttcctccttccctaaccttattattaacc tctgcagctgttgaaagaggagta gga A.fangsiao ttattacctccctctcttacttt attactttcctcagctgcggtaga aagaggagctggt
A. marginatus ttattacccccttcctt aaccttactcctttcctcagctgc agtagaaagaggtgttggt
*: *: ** ** ** *: ** *: *. *: * **: *: ** **: ********: * **:

T.pacificus acaggttgaacagtttatccccctttatctaggaatttatcccatgctggtccttcagtt
O.minor acaggatgaaccgtatatcctcctttatcaagaaatctcgctcata caggaccatctgta

A.fangsiao actggatgaactgtctatccacctctatcaagtaattta gctcatataggaccctccgtc
A. marginatus actggatgaacagtatatcctcctttatcaagaaatttagcacatataggaccatctgtt
**: **: ***** ** ***** *** ****: ** *** *. * ***. : **: ** **

T.pacificus gatctagcaattttctcactccacttagctggtgtctcttccattttaggtgcaattaat
O.minor gacctagcaa ttttctcactccatttagcaggaatttcatctattttaggagctattaac
A.fangsiao gat ttagctattttctccttacatttagcaggaatttcatcatattttaggagctattaat
A.marginatus gatctagcaattttttctcttcacttagcaggaatctcatcaattctaggagcaattaac
** ****: ***** ** * ** *****: **:. * **: ** *** ****: **: *****

T.pacificus ttcattacaactatcttaaatatacgatgagaaggtcttcaaatagaacgtcttccttta
O.minor ttcataactactattatcaatatacgatgagaaggaatacaaatagaacgtcttcctttg
A.fangsiao tttattactactattattaatatacgttgagaaggaatattaatagaacgactcccttta
A.marginatus ttcattactaccatcatcaatatacgatgagaaggtatactcatagaacgactcccattg
** **: **: ** **: * ********: ********:. *::. ********: ** ** : **.

T.pacificus tttacatgatctgtatttattacagccattttattgctact ctccttaccagtgctagca
O.minor tttgtttgatcagtatttattacagctatccttcttcttttatcattacctgttcttgct
A.fangsiao tttgtatgatctgtctttattacagctgttttattacttctttcactaccagtacttgct
A.marginatus tttgtatgatctgtatttatcacagccgtgttactacttctatcgttaccagtattagct
***. *****: **. ***** *****. * *: * **: * ** ****: ** *: **:

T.pacificus ggtgc aattactatgctgttaactgatcgaaacttcaatactactttttttttgatcctagt
O.minor ggagctattactatattattaactgatcgaaattttaatactactttttctttgacccaaga
A.fangsiao ggtgcaatcactatacttttaactgatcgaaatttcaacacaactttttttgacccaaga
A. marginatus ggtgcaattaccatattattaactgaccgaaacttcaataccacattttttgaccctaga
**: ** ** ** **. ******** ***** ** ** ** **: ** ***** **: **:

T.pacificus ggagggggagacccaattttataccaacatt tattttgattctttgggcatcccga agta
O.minor ggaggaggagatccaatcttataccaacatttattctgattctttggtcatcccgaagtt
A.fangsiao ggaggaggtgaccctatcctatatcaacatttattttgattttttggtcatccgaagta
A.marginatus ggaggtggggatcctattctctaccaacacttattctgattttttg --------------
***** ** ** **: ** *. ** ***** ***** ***** ****

T.pacificus tatattttaattttacctgcctttggtattatttcacacattgtatctcaccactcttta
O.minor tacattcttattttaccaggttttggaataatctcccacattgtatctcactattcatta
A.fangsiao tatattttaattttaccaggatttggtataatttcccatattgtttcccattattctata
A. marginatus ----------------------------------------------- -------------


T.pacificus aagaaagaaatttttggagccttaggtataatttacgccatactatcaattggtctccta
O.minor aaaaaagaaacatttggtagtctcggaataatctatgcaatactatcaattggtctatta
A.fangsiao aaaaaagaaacatttggtagattaggaataatttatgctatattatctattgggttatta
A. marginatus ----------------------------------------------- -------------

T.pacificus ggttttattgtctgagcacatcatatattcaccgtaggaatggatgtagatactcgagct
O.minor ggatttattgtatgagcacatcacatatttactgttggtatagatgtagatacacgagca
A.fangsiao ggatttattgtatgagcccatcatatatttacagttggaatagatgttgatacacgagca
A. marginatus ----------------------------------------------- -------------

T.pacificus tatttcacatcagcaacaataattattgcaattcctaccggaattaaagtatttagttga
O.minor tattttactgccgcaacaataattattgcaattcctactggaattaaagtctttagatga
A.fangsiao tattttacagccgcaacaataattattgccatcccaacaggaattaaagtttttagatga
A. marginatus ----------------------------------------------- -------------

T.pacificus ttagcaactatttatggttctcctattaaatataatacacctatactctgagcattaggg
O.minor ttagcaaccatttatggatcaccaatcaaatatacttcacctatattatgatctcttgga
A.fangsiao ttagccacaatttatggatcccctattaaatatacccctcctatattatgatctttagga
A. marginatus ----------------------------------------------- -------------

T.pacificus ttcatctttttatttactgtaggaggtttaacaggtattattctttctaattcatcatta
O.minor tttatttttttatttacaataggaggactaacaggtattgttctatctaattcatcttta
A.fangsiao tttatttttttattcaccacaggaggattaacaggaattgtattatctaattcatcttta
A. marginatus ----------------------------------------------- -------------

T.pacificus gatattatacttcatgacacatattatgttgtagctcatttccattatgtcttatctata
O.minor gatattatactacatgatacctactatgtagtagcccatttccactatgttttatccata
A.fangsiao gatattatattacatgatacatattatgtagtagcacatttccactatgtcctatcaata
A. marginatus ----------------------------------------------- -------------

T.pacificus ggagccgtgttcgctttatttgctggttttaaccattgataccctttaattacaggatta
O.minor ggagcagtatttgcattatttgcaggatttaatcattgataccccataattactggttta
A.fangsiao ggagcagtttttgctttatttgccggttttacccactgatatcctataattacaggttta
A. marginatus ----------------------------------------------- -------------

T.pacificus acactaaaccaacaatgaaccaaagctcattttatgacaatattcttaggtgtcaacgta
O.minor tcattaaatcaacaatatactaaatcccatttttatataatatttattggagttaatatt
A.fangsiao tcattaaatcaacaatatactaaatctcacttttatataatatttattggagtaaatatt
A. marginatus ----------------------------------------------- -------------

T.pacificus actttttttcctcaacattttctaggattagcaggaatacctcgacggtactcagattat
O.minor acctttttcccacaacactttctaggattagcaggtataccccgtcgatactcagattac
A.fangsiao actttttttccacaacactttttaggattagctggtataccacgacgatactcagattat
A. marginatus ----------------------------------------------- -------------

T.pacificus ccagattgttatactaaatgaaacatagtatcatctataggatctataatttcacttact
O.minor cccgattcttatactaaatgaaatatattatcatcaataggatcattattatccttaaca
A.fangsiao cctgactcctatactaaatgaaatatactttcatctataggatctcttttatcattaaca
A. marginatus ----------------------------------------------- -------------

T.pacificus agtgtgttgttctttatttttattgtttgagaaagtttaatttcacaacgaactgtgatt
O.minor tctattatatttttcatatttattgtatgagaaagattaatttctcaacgaactattatt
A.fangsiao tctattatattttttatatttattgtttgagaaagtttaatttcacaacgaacagttatt
A. marginatus ----------------------------------------------- -------------

T.pacificus tgatctaaccacataactacatctttagaatgagacaaccgtcttccagttgacttccat
O.minor tgatcaaaccacttaaacacatccttagaatgaaacaatcgtcttccagtagattttcat
A.fangsiao tgatcaaaccatttaaatacatctttagaatgagataatcgattaccagtagattttcac
A. marginatus ----------------------------------------------- -------------

T.pacificus agtctccctgaaacaggggctctttatatttaa
O.minor aaccaaatagaaactggagctttatttatttaa
A.fangsiao aaccaaatagaaacaggagccctatttatttaa
A. marginatus ---------------------------------

The sequences shown in bold in Tables 1 to 5 indicate the positions where each primer binds. In Table 5, the asterisk (*) at the bottom of each sequence indicates a position having the same base, and positions having different bases are shown as blank or ':' and '.'

In addition, the present invention relates to a composition for real-time PCR comprising a primer set for discrimination of a cephalopod varieties, wherein the real-time PCR is preferably a high-speed real-time PCR.

In another aspect, the present invention provides a diagnostic kit for identifying a variety of tuskkin juku, one skin juku, octopus and squid including the above composition. In addition to the respective primer sets specific for each strain and the Taq DNA polymerase for amplifying the DNA, the diagnostic kit may further comprise a tube or other suitable container, a thermostat or constant temperature bath, a reaction buffer (pH and magnesium concentrations vary) Nucleotides (dNTPs), sterile water, luminescent dyes. Eva green can be used as a luminescent dye at this time.

The sample to be used in the gene amplification analysis of the present invention may be a tissue lysis solution or genomic DNA. The tissue lysate may be prepared by dissolving or suspending a tissue sample of Tuskin jukumi, one skin juku, octopus or squid squid in a cell lysis buffer cell lysis buffer).

At this time, the gene amplification analysis is preferably a real-time PCR method, and more preferably, a high-speed real-time PCR method can be used.

The present invention relates to a species-specific primer set for discriminating the variety of two-skinned squid, one-skinned squid, octopus and squid, or a gene amplification assay using the same. The primer set or the gene amplification analysis method using the primer set can prevent the penetration of the toskin jukumi into the raw material for cooking containing the one skin jukumi, and it is possible to guarantee the variety of the one skin jukumi, Skinjuku, octopus, squid can afford reasonable price. In addition, Tucson jukumi, which is imported jumbo jumbo, can detect domestic jumbo jumbo, octopus, squid, etc., and it can help to activate the distribution and consumption market by monitoring imported jumbo jumbo. Korean Patent No. 10-1151747 and Korean Patent No. 10-1196640 disclose a method of discriminating marine species such as Salmonid using a polymerase chain reaction. However, it is also possible to use the primer sets disclosed in the present invention, The methods for discriminating the varieties of squid, one skin juku, octopus and squid are not disclosed at all.

FIG. 1 is a photograph of a gel obtained by performing a single PCR (polymerase chain reaction) using genomic DNA of Tuskin juku, one skin juku, one octopus, and squid squid using a PCR primer for discrimination of breeds. 1, 2, 3 and 4 indicate that genomic DNA samples were sequentially taken from Tuskin jukumi, one skin juku, octopus, and squid squid respectively.
FIG. 2 is a diagram showing the results of analysis of genomic DNA (1, black line) of one skin jukebox, tissue lysate (3, yellow line) of one skin jukumi using a PCR primer for discrimination of one- Real-time PCR was performed on the tissue solution (4, gray line), tissue solution (5, green line), and squid tissue lysis solution (6, blue line) The amplification result of the yellow line, which is the result of the tissue solution of one skin jukumi, is confirmed along with the black line which is the genomic DNA amplification result of the skin jukipan, and the melting peak is formed at the same temperature.
FIG. 3 is a graph showing the results of analysis of the genomic DNA (1, black line) of Tuskin jukipui, tissue solution (3, yellow line) of one skin jukumi using a PCR primer for discriminating the species of Tuskin jukipi of the present invention, Real-time real-time PCR was performed on the tissue solution (4, gray line), tissue solution (5, green line), and squid tissue solution (6, blue line) The amplification result of the gray line, which is the result of the tissue solution of Tuskin jukumi, was confirmed along with the black line which is the genomic DNA amplification result of the skin jukipan, and the melting peak was formed at almost the same temperature.
FIG. 4 is a graph showing the results of analysis of genomic DNA (1, black line) of octopus, tissue lysis solution (3, yellow line) of one skin jukumi, Speed real-time PCR on tissue solution (4, gray line), tissue solution of octopus (5, green line), and tissue lysate of squid (6, blue line) As a result, the amplification result of the green line, which is the result of the tissue solution of octopus, is confirmed and the melting peak is formed at almost the same temperature.
FIG. 5 is a graph showing the results of analysis of the genomic DNA (1, black line) of salmon squid, the tissue lysate (3, yellow line) of one skin jukumi, Real-time real-time PCR was performed on tissue solution (4, gray line), tissue solution (5, green line) of octopus, and tissue solution (6, blue line) of cuttlefish. And the amplification result of the blue line, which is the result of the tissue lysis solution of squid, was confirmed, and the melting peak was formed at almost the same temperature.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the invention to those skilled in the art.

EXAMPLES Example 1. Sample preparation and DNA isolation of Tuskin juku, one skin juku, octopus and squid,

As a target material, we used Cutting juku (Touskin juku) imported from Thailand, Thai domestic juku, Domestic octopus, Domestic squid varieties imported from Thailand.

In order to define genome-specific primer set by real-time PCR analysis, 3 legs of each strain were collected to obtain the genomic DNA of Tuskin juku, one skin juku, octopus, and squid squid to be used as a control group, Washed with sterile distilled water, quenched with liquid nitrogen, disrupted using a mortar and then extracted with genomic DNA extraction kit (Bioneer, Korea).

The concentration of the extracted DNA was measured using a UV / Via Spectrophotometer (Optigen NANO Q, Mecasys, Korea). Each DNA sample for which the concentration measurement was completed was used for the PCR reaction by adjusting the final DNA concentration to 10 ng / μl using sterilized tertiary distilled water.

The genomic DNA extracted from Tuskin juku, one skin juku, octopus, and squid squid was amplified and cloned using the primer set of Table 6 to amplify the 16s rDNA nucleotide sequence present in the genomic DNA. Through the nucleotide sequence analysis, Amphioctopus marginatus, Amphioctopus fangsiao , Octopus minor and Todarodes pacificus were identified.

Target gene
(Name of primer) Primer sequences and combinations Forward Reverse 16s rRNA
(Cephal-16s-U) 5'-tttaatccaacatcgaggtcgcaa-3 ' 5'-ggctagaatgaatggtttgacgaa-3 '

< Example  2. PCR  And electrophoresis analysis>

The PCR reaction was carried out using the primers shown in Table 7 for the respective cultivars developed by the present inventors, targeting the region having the species mutation, and the Tuskin jukumi, one skin jukumi, octopus, and salting squid varieties.

object
Species / gene
(Name of primer) Primer sequences and combinations Forward Reverse Tuskin juku / COI
(Am_COI_2-1) 5'-ccccagatatagcatttccccgta-3 '
(SEQ ID NO: 5) 5'-gcagctgaggaaaggagtaaggtt-3 '
(SEQ ID NO: 6) One skin jukumi / COI
(Af_COI_2-1) 5'-attactttcctcagctgcggtaga-3 '
(SEQ ID NO: 7) 5'-atcgacggagggtcctatatgagc-3 '
(SEQ ID NO: 8) Octopus / COI
(Om_COI_2) 5'-tctgcagctgttgaaagaggagta-3 '
(SEQ ID NO: 9) 5'-ttgctaggtctacagatggtcctg-3 '
(SEQ ID NO: 10) Squid / COI
(Tp_COI_3) 5'-ctccttaccagtgctagcaggtg-3 '
(SEQ ID NO: 11) 5'-tcgggatgcccaaagaatcaaaata-3 '
(SEQ ID NO: 12)

Meanwhile, the composition of the PCR reaction mixture (20 μl) for discrimination of Tuskin juku, one skin jukumi, octopus, and squid varieties was as follows: AccuPower ^® PCR PreMix (reaction volume 20 μl, Bioneer, Korea) 20 ng of genomic DNA of squid, one skin juku, octopus, and squid, and 2 pmol of each primer were added to the final 20 μl of sterile distilled water.

The PCR reaction was performed at 94 ° C for 5 minutes, followed by denaturation at 94 ° C for 30 seconds, binding at 62 ° C for 30 seconds, and extension at 72 ° C for 30 seconds, using a SimpliAmp Thermal Cycler (ThermoFisher Scientific, USA) Lt; RTI ID = 0.0 &gt; 72 C &lt; / RTI &gt; for 5 minutes. The amplified PCR product was electrophoresed on 2% agarose gel and stained with EtBr. The amplification product of each strain was confirmed by an image analyzer. PCR products of Tuskin jukumi, one skin jukumi, octopus, After gene cloning, the nucleotide sequences of the cultivars were compared and analyzed. 1, the numbers 1, 2, 3, and 4 in the photograph of FIG. 1 are shown in the order of Tuskin juku (1), one skin juku (2), octopus (3) Of the sample was used.

Referring to FIG. 1, PCR was carried out using Am_COI_2-1 primer in Tuskin jukumi. As a result, a DNA fragment of 85 bp in size was observed. In the case of one-skin junk medicine, PCR was performed using Af_COI_2-1 primer, Sized DNA fragments are observed. In octopus, 100 bp DNA fragments were confirmed by Om_COI_2 primer and 135 bp DNA fragments were confirmed by PCR using Tp_COI_3 primer.

&Lt; Example 3: Preparation of sample for ultra high-speed real-time PCR analysis >

50 mg of a tissue sample of Tuskin juku, one skin juku, octopus, and squid was placed in 500 μl of DLB tube (Gene System), and the tissue solution containing the tissue sample was mixed at 1 minute intervals Min at room temperature. 10 μl of the supernatant of tissue lysis was taken and 90 μl of sterilized tertiary distilled water was added and mixed. The mixture was diluted by the same method and mixed well (diluted with sterilized tertiary distilled water at 10 ^-2 for the initial tissue lysis solution). The diluted tissue lysate contained the genomic DNA of each sample cultivar extracted in Example 1. The procedure required for purifying the genomic DNA using such a tissue lysate was not performed cumbersome, but was immediately used as a sample for high-speed real-time PCR.

<Example 4: High-speed real-time PCR and genotype analysis>

Real-time high-speed gene amplification was performed using UF-150 GENECHECKER Ultra-Fast PCR system (Gene System, Korea). PCR reaction mixture (10ul) was prepared by adding 1 占 퐇 (20 ng / 占 퐇) of genomic DNA or tissue lysate (extracted from Example 1 or 3) of 2-way Rapi Master Mix Gene System), 0.5 μl (10 pmole / μl) of each primer synthesized in Table 2, and 3 μl of sterilized tertiary distilled water were used. The PCR reaction conditions were 95 ° C for 30 seconds, 95 ° C for 5 seconds, , 72 ° C for 5 seconds, and 40 cycles of PCR. The genomic DNA was used in Example 1, and the tissue lysate used in Example 3 was used. The 2X Rapi Master Mix contains Eva-green fluorescent dye.

The discrimination analysis of the gene amplification of Tuskin juku, one skin jukipi, octopus, and squid varieties was carried out using one pair of primers for each kind under the above-described ultra-high speed real-time PCR conditions. In the graphical results, the black line represents the result of amplification using the genomic DNA of the corresponding strain for each strain primer set as a positive control, and the red line represents the result of addition of the sterilized tertiary distilled water as the template DNA Results. In the same graph, the yellow line represents the tissue dissolving solution of one skin jukumi, the gray line represents the tissue dissolving solution of Tuskin juku, the green line represents the tissue dissolving solution prepared by the method of Example 3, and the blue line represents the tissue of salted squid High-speed real-time PCR was performed using a solution as a template. The pink line and the blue line indicate a blank without a sample.

After completion of the PCR, the results were confirmed in real time through the Gene Recorder (Gene System) program of the PC (labtop) connected to the UF-150 Ultra-Fast PCR system.

Referring to FIGS. 2 to 5, in FIG. 2 showing the result of using the primer for discriminating one skin jukipan, the yellow line (3) was amplified in a high-speed real-time PCR performed using a tissue lysate as a sample, It is confirmed that it is used. In FIG. 3, which shows the result of using the primer for the determination of the toskin jukipo, it is confirmed that the gray line (4) is amplified in the ultrafast real-time PCR performed using the tissue lysate as a sample to use a toskin jukipan sample. In FIG. 4 showing the result of using the octopus discriminating primer, it is confirmed that the green line 5 is amplified and the octopus sample is used in the result of the high-speed real-time PCR performed using the tissue lysate as a sample. In FIG. 5 showing the result of using the squid discriminant primer, it is confirmed that the blue line 6 is amplified from the result of the high-speed real-time PCR using the tissue lysate as a sample and the squid sample is used. At this time, in each graph, it is confirmed that the amplification of all the black lines as a result of the genomic DNA amplification of the varieties to be discriminated by the primers is large.

In conclusion, it can be seen that the discrimination of Tuskin juku, One skin juku, Octopus and Salix varieties can be performed quickly, safely and accurately by using the primer set of each kind of the present invention.

Claims (6)

A first primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 5 and a primer comprising the nucleotide sequence of SEQ ID NO: 6 for discrimination of two skin webfoot octopus ( Amphioctopus marginatus );
A second primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 7 and a primer comprising the nucleotide sequence of SEQ ID NO: 8 for the discrimination of One skin webfoot octopus ( Amphioctopus fangsiao );
A third primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 9 and a primer comprising the nucleotide sequence of SEQ ID NO: 10 for the determination of octopus ( Octopus minor ); And
A fourth primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 11 and a primer comprising the nucleotide sequence of SEQ ID NO: 12, for the discrimination of Japanese squid ( Todarodes pacificus );
Wherein the primer set includes at least one primer set selected from the group consisting of: The composition for real-time PCR according to claim 1, which comprises a primer set for discriminating cephalopods. The method according to claim 1,
Wherein the composition comprises Taq DNA polymerase. A diagnostic kit for discriminating between at least one kind of cephalopods selected from the group consisting of tsukin juku, one skin juku, octopus and squid, which comprises the composition of claim 2. A first step of preparing the primer set of claim 1;
A second step of preparing a composition comprising the primer set and the Taq DNA polymerase;
A third step of preparing a reaction solution by adding a sample of Tuskin jukumi, one skin juku, octopus or squid squid to the composition; And
A fourth step of performing gene amplification analysis using the reaction solution;
Wherein the at least one kind of at least one kind selected from the group consisting of Tuskin juku, one skin juku, octopus or squid. 6. The method of claim 5,
Wherein the specimen is a tissue lysis solution or genomic DNA.

Images