KR101999813B1 - Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof - Google Patents
Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof Download PDFInfo
- Publication number
- KR101999813B1 KR101999813B1 KR1020170006042A KR20170006042A KR101999813B1 KR 101999813 B1 KR101999813 B1 KR 101999813B1 KR 1020170006042 A KR1020170006042 A KR 1020170006042A KR 20170006042 A KR20170006042 A KR 20170006042A KR 101999813 B1 KR101999813 B1 KR 101999813B1
- Authority
- KR
- South Korea
- Prior art keywords
- octopus
- skin
- primer
- squid
- juku
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2521/00—Reaction characterised by the enzymatic activity
- C12Q2521/10—Nucleotidyl transfering
- C12Q2521/101—DNA polymerase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2531/00—Reactions of nucleic acids characterised by
- C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
- C12Q2531/113—PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2561/00—Nucleic acid detection characterised by assay method
- C12Q2561/113—Real time assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어의 품종 판별을 위한 종 특이 프라이머 세트 또는 이를 이용한 초고속 유전자 증폭 분석법에 관한 것이다. 상기 프라이머 세트 또는 이를 이용한 초고속 유전자 증폭 분석법을 통해 원스킨 주꾸미가 포함된 요리용 원재료에 투스킨 주꾸미가 혼입되는 것을 방지할 수 있으며, 원스킨 주꾸미의 품종 보증을 용이하게 할 수 있어, 국내산 주꾸미인 원스킨 주꾸미, 낙지, 살오징어의 합당한 가격 책정이 가능하다. 또한 수입산 주꾸미인 투스킨 주꾸미가 국내산 주꾸미, 낙지, 오징어 등으로 둔갑하는 사례를 적발하여 수입산 주꾸미를 감시하여 유통 및 소비시장의 활성화에 도움이 될 수 있다.TECHNICAL FIELD The present invention relates to a species specific primer set for discriminating a variety of two-skinned squid, one-skinned squid, octopus and squid, or a high-speed gene amplification method using the same. Through the primer set or the ultra-high speed gene amplification analysis method using the primer set, it is possible to prevent the incorporation of the toskin jukumi into the raw material for cooking containing the one skin jukumi, and it is possible to easily assure the variety of the one skin jukisumi, It is possible to make a reasonable price of one skin juku, octopus, and squid. In addition, Tucson jukumi, which is imported jumbo jumbo, can detect domestic jumbo jumbo, octopus, squid, etc., and it can help to activate the distribution and consumption market by monitoring imported jumbo jumbo.
Description
본 발명은 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어의 판별을 위한 초고속 실시간 PCR용 품종 특이 프라이머 세트 또는 이를 이용한 품종 판별법에 관한 것이다. The present invention relates to a high-speed real-time PCR-specific primer set for discriminating two-skinned jujube, one-skinned jujube, octopus and squid, or to a method of discriminating a variety using the same.
수산물 가공식품에 대한 시장이 점차 확대되면서, 수산물 가공식품이 EMA (Economically motivated adulteration) 식품으로 제조, 유통되는 사례도 급증하고 있다. 수산물을 이용한 EMA 식품의 경우 일반 소비자들이 형태학적으로 구분하기는 힘들어 수산물 판매자들이 저가의 수입산 또는 유사 생물을 이용한 제품을 만들어 소비자들에게 판매하는 경우가 늘어나고 있다. 특히 최근 들어 우리나라 연안에 서식하는 주꾸미의 경우 무분별한 남획으로 개체 수가 급감하여 동남아 일대 또는 중국에서 수입하여 대체하고 있다.As the market for processed fish products for marine products is gradually expanding, there are also cases in which processed marine products are manufactured and distributed as EMA (Economically motivated adulteration) foods. In the case of EMA foods using aquatic products, it is difficult for consumers to distinguish morphologically. Therefore, there is an increasing tendency that aquatic products sellers make products using low-cost imported or similar bio-products to consumers. Especially, in the case of jukugi living in the coastal area of Korea recently, the number of individuals is suddenly decreased due to indiscreet overfishing and is being imported from Southeast Asia or China.
우리나라에 서식하는 주꾸미(Amphioctopus fangsiao)는 연체동물문, 두족강, 문어목, 문어과에 속하는 해양 무척추동물로써 우리나라 전 연안에 분포하며 수심 5-50m 정도의 모래 또는 자갈 바닥에서 흔히 발견되는 문어류이며, 통상적인 형태학적 분류에서는 원스킨 주꾸미(One skin webfoot octopus)로 분류되고 있다. 이에 반하여 동남아 일대에 서식하는 주꾸미류는 원스킨 주꾸미와 투스킨 주꾸미(Two skin webfoot octopus)가 동시에 서식하고 있다. 우리나라의 경우 식품으로 이용되는 주꾸미는 원스킨 주꾸미이며, 예전에는 우리나라 연안에 서식하지 않는 투스킨 주꾸미의 경우 식품으로 이용되는 사례가 거의 없었다. Amphioctopus fangsiao is a marine invertebrate belonging to the mollusc line, bivalve river, octopus and octopus. It is commonly found in the sand or gravel bottom of 5-50m depth. It is commonly found in Korea. In the morphological classification, it is classified as one skin webfoot octopus. On the contrary, the two kinds of nutrients in the Southeast Asian region live in the same time with two skin webfoot octopus. In Korea, jucukmi used as food is one-skin jukumi. In the past, tucson jukumi, which is not inhabited in Korea, rarely used as food.
한편 최근 들어 우리나라 연안에 서식하는 주꾸미의 개체 수가 급감하여 동남아 일대나 중국에서 주꾸미를 수입하여 대체하고 있다. 이 경우 가공 또는 절편으로 만들어 수입하게 된다. 하지만 가공 및 절편으로 수입되는 주꾸미류의 경우 형태학적으로 원스킨 주꾸미와 투스킨 주꾸미를 구별할 수 없다. 이 뿐만 아니라 절편된 투스킨 주꾸미의 경우 낙지, 오징어류와도 구별하기 힘들어 절편된 투스킨 주꾸미를 이용하여 EMA 식품 제조에 이용되는 사례가 발생하고 있다. On the other hand, the number of jukyu inhabitants in the coastal area of Korea has been rapidly decreasing, and the jukugi has been imported from Southeast Asia or China. In this case, it is processed or cut into pieces and imported. However, it is not possible to distinguish between the one-skin jukipui and the two-skin jukumi morphologically in the case of the jukuni which are imported by processing and cutting. In addition, it is difficult to distinguish between cut and sliced squid and octopus, and it is used for manufacturing EMA foods by using sliced tsukin juku.
초고속 실시간 PCR(Ultra-Fast PCR) 시스템은 ㈜진시스템의 UF-150 GENECHECKER™ 모델로 일반적인 튜브를 사용하는 경우보다 특수한 폴리머 칩(RAPI:CHIP™)을 사용함으로써 빠른 시료의 열처리가 가능하다. Rapi:chip™ PCR 칩은 박막 필름이 플라스틱 본체의 하부면에 정밀하게 접착된 구조로 되어 있어 초고속 유전자 증폭 작업을 가능하게 해준다. GENECHECKER™의 유전자 증폭 메커니즘은 8℃/SEC의 초고속 가열, 냉각이 가능하여 초고속 PCR 반응을 가능하다. 형광분석 모듈은 유전자 증폭 과정에서 발현되는 형광을 실시간으로 감지, 기록함으로써 사용자가 GENERECORDER 소프트웨어를 통해 실시간으로 반응 과정을 관찰, 분석할 수 있게 한다. 이러한 형광 분석기법을 통해 모델 UF-150은 광학 스캐닝 방식으로 형광값을 분석하는 시중의 실시간 PCR 장비 대비 정밀한 분석 결과를 제공한다. GENERECORDER 소프트웨어의 사용자 인터페이스는 시중의 실시간 PCR 장비들과 유사한 형태로 디자인되어 타사 장비 사용자들도 어려움 없이 사용할 수 있다. 모델 UF-150은 본체와 연결하여 사용할 노트북(GENERECORDER 설치, 보정 완료)과 함께 공급되어 별도의 사용자 보정 과정 없이 즉시 활용 가능하다.Ultra-Fast PCR system is a UF-150 GENECHECKER ™ model of Gene System Co., Ltd. It is possible to heat a sample faster by using a special polymer chip (RAPI: CHIP ™) rather than using a general tube. The Rapi: chip ™ PCR chip enables ultra-high-speed gene amplification by the thin film film being precisely bonded to the bottom surface of the plastic body. The genome amplification mechanism of GENECHECKER ™ enables ultra-high-speed heating and cooling at 8 ° C / sec. The fluorescence analysis module enables the user to observe and analyze the reaction process in real time through the GENERECORDER software by detecting and recording the fluorescence emitted in the gene amplification process in real time. Through this fluorescence analysis method, the model UF-150 provides precise analysis results compared to real-time PCR equipment that analyzes fluorescence values by optical scanning method. The user interface of the GENERECORDER software is designed to be similar to the real-time PCR instruments on the market, so that users of third-party equipment can use it without difficulty. The model UF-150 is supplied with the notebook (GENERECORDER installed and calibrated) to be connected to the main unit, so it can be used immediately without any user calibration process.
본 발명자들은 간단하면서도 신속정확한 품종 판별을 위한 유전자 증폭 기술 기반 하에 이러한 문제점을 극복하기 위해, 주꾸미류의 품종 판별용 폴리뉴클레오티드 프라이머 및 이를 이용한 Ultra-Fast PCR 방법을 도출함으로써 본 발명을 완성할 수 있었다. The inventors of the present invention have completed the present invention by deriving polynucleotide primers for discriminating varieties of jukebooks and Ultra-Fast PCR method using the same, in order to overcome these problems based on gene amplification technology for accurate and rapid identification of breeds .
본 발명의 목적은 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어의 판별을 위한 초고속 실시간 PCR용 품종 특이 프라이머 세트 또는 이를 이용한 품종 판별법을 제공하는 데에 있다. It is an object of the present invention to provide a high-speed real-time PCR-specific primer set for discrimination of Tuskin jukumi, one skin juku, octopus and squid, or a method of discriminating a variety using the same.
본 발명은, 투스킨 주꾸미(Two skin webfoot octopus, Amphioctopus marginatus)의 판별을 위한, 서열번호 5의 염기서열을 포함하는 프라이머 및 서열번호 6의 염기서열을 포함하는 프라이머로 이루어진 제1 프라이머 세트;A first primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 5 and a primer comprising the nucleotide sequence of SEQ ID NO: 6 for the identification of Two skin webfoot octopus ( Amphioctopus marginatus );
원스킨 주꾸미(One skin webfoot octopus, Amphioctopus fangsiao)의 판별을 위한, 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 제2 프라이머 세트; A second primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 7 and a primer comprising the nucleotide sequence of SEQ ID NO: 8 for the discrimination of One skin webfoot octopus ( Amphioctopus fangsiao );
낙지(Long arm octopus, Octopus minor)의 판별을 위한, 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 제3 프라이머 세트; 및,A third primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 9 and a primer comprising the nucleotide sequence of SEQ ID NO: 10 for the determination of octopus ( Octopus minor ); And
살오징어(Japanese flying squid, Todarodes pacificus)의 판별을 위한, 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 제4 프라이머 세트;A fourth primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 11 and a primer comprising the nucleotide sequence of SEQ ID NO: 12, for the discrimination of Japanese squid ( Todarodes pacificus );
로 이루어진 군에서 선택되는 프라이머 세트 중 1종 이상이 포함된 두족류의 품종을 판별하는 프라이머 세트에 관한 것이다. And a primer set for discriminating the breeds of cephalopods containing at least one of the primer sets selected from the group consisting of:
또한 본 발명은 상기 두족류 품종 판별용 프라이머 세트를 포함하는 실시간 PCR용 조성물에 관한 것이다. 상기 조성물은 Thermus aquaticus에서 유래된 Taq DNA 중합효소를 포함할 수 있다. The present invention also relates to a composition for real-time PCR comprising a primer set for discrimination of the cephalopods. The composition may comprise a Taq DNA polymerase derived from Thermus aquaticus .
또 다른 양태에서 본 발명은 상기 조성물을 포함하는 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어로 이루어진 군에서 선택되는 1종 이상의 두족류의 품종을 판별하는 진단키트를 제공한다.In another aspect, the present invention provides a diagnostic kit for discriminating the breeds of at least one cephalopod selected from the group consisting of tsukin juku, one skin juku, octopus and squid including the above composition.
본 발명은 또한 상기 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어의 판별을 위한 품종 특이 프라이머 세트를 제조하는 제1단계; The present invention also provides a method for producing a variety of primer-specific primer sets for the identification of the two-skin juki, one-skin jukumi, octopus and squid;
상기 프라이머 세트와 Taq DNA 중합효소를 포함하는 조성물을 제조하는 제2단계; A second step of preparing a composition comprising the primer set and the Taq DNA polymerase;
상기 조성물에 투스킨 주꾸미, 원스킨 주꾸미, 낙지 또는 살오징어의 검체를 첨가하여 반응액을 제조하는 제3단계; 및, A third step of preparing a reaction solution by adding a sample of Tuskin jukumi, one skin juku, octopus or squid squid to the composition; And
상기 반응액을 이용하여 유전자 증폭 분석을 수행하는 제4단계;A fourth step of performing gene amplification analysis using the reaction solution;
를 포함하는 투스킨 주꾸미, 원스킨 주꾸미, 낙지 또는 살오징어로 이루어진 군에서 선택되는 1종 이상 두족류의 품종을 판별하는 방법을 제공한다. 상기 검체는 조직 용해액 또는 게놈 DNA일 수 있다. And a method of distinguishing one or more species of at least one cephalopod selected from the group consisting of a squid, a squid, a squid, an octopus, or a squid. The specimen may be a tissue lysate or genomic DNA.
이하, 본 발명을 상세하게 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 상기 제1 내지 제4 프라이머 세트 중 선택되는 프라이머 세트 중 1종 이상이 포함된 두족류의 품종을 판별하는 프라이머 세트에 관한 것으로서, 바람직하게는 상기 제1 내지 제4 프라이머 세트를 모두 포함하는 두족류의 품종을 판별하는 프라이머 세트에 관한 것일 수 있다. The present invention relates to a primer set for discriminating breeds of cephalopods comprising at least one primer set selected from the first to fourth primer sets, and more preferably, the primer set includes all of the first to fourth primer sets It may be related to a set of primers for discriminating the breeds of cephalopods.
본 발명에서의 용어, "프라이머"란 올리고뉴클레오타이드(oligonucleotide)로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(Taq DNA 중합효소) 및 상이한 4가지 dNTP(deoxynucleoside triphospate)의 존재하에서 DNA 합성을 개시할 수 있다. 본 발명에 의하면, 상기 프라이머는 15 내지 50개의 염기서열을 가지는 핵산으로 구성됨이 바람직하다.The term "primer " in the present invention means a short nucleic acid sequence capable of forming a base pair with a complementary template with an oligonucleotide and serving as a starting point for template strand copying . Primers can initiate DNA synthesis in the presence of reagents for polymerization ( Taq DNA polymerase) and four different dNTPs (deoxynucleoside triphospate) at appropriate buffer solutions and temperatures. According to the present invention, it is preferable that the primer is composed of a nucleic acid having 15 to 50 nucleotide sequences.
본 발명의 프라이머 세트가 인식하는 투스킨 주꾸미(Two skin webfoot octopus, Amphioctopus marginatus)의 Cytochrome C oxidase I (COI) 게놈 DNA 염기서열은 하기 표 1의 서열번호 1로 표현된다. The nucleotide sequence of Cytochrome C oxidase I (COI) genomic DNA of two skin webfoot octopus ( Amphioctopus marginatus ) recognized by the primer set of the present invention is represented by SEQ ID NO: 1 in Table 1 below.
서열번호 1 : ACCESSION No. KJ168052.1의 서열 중 1~676번째 서열,SEQ ID NO: 1: ACCESSION NO. 1 to 676 of the sequence of KJ168052.1,
https://www.ncbi.nlm.nih.gov/nuccore/KJ168052.1https://www.ncbi.nlm.nih.gov/nuccore/KJ168052.1
본 발명의 프라이머 세트가 인식하는 원스킨 주꾸미(One skin webfoot octopus, Amphioctopus fangsiao)의 Cytochrome C oxidase I (COI) 게놈 DNA 염기서열은 하기 표 2의 서열번호 2로 표현된다. The nucleotide sequence of Cytochrome C oxidase I (COI) genome of One skin webfoot octopus ( Amphioctopus fangsiao ) recognized by the primer set of the present invention is represented by SEQ ID NO: 2 in Table 2 below.
서열번호 2 : ACCESSION No. AB240156.1의 서열 중 2542~4074번째 서열,SEQ ID NO: 2: ACCESSION NO. Sequence 2542 to 4074 of the sequence of AB240156.1,
https://www.ncbi.nlm.nih.gov/nuccore/AB240156.1https://www.ncbi.nlm.nih.gov/nuccore/AB240156.1
본 발명의 프라이머 세트가 인식하는 낙지(Long arm octopus, Octopus minor)의 Cytochrome C oxidase I (COI) 게놈 DNA 염기서열은 하기 표 3의 서열번호 3으로 표현된다. The nucleotide sequence of Cytochrome C oxidase I (COI) genome of long arm octopus ( Octopus minor ) recognized by the primer set of the present invention is represented by SEQ ID NO: 3 in Table 3 below.
서열번호 3 : ACCESSION No. NC_015896.1의 서열 중 2546~4078번째 서열,SEQ ID NO: 3: ACCESSION NO. 2546 to 4078 < th > order in NC_015896.1,
https://www.ncbi.nlm.nih.gov/nuccore/NC_015896.1https://www.ncbi.nlm.nih.gov/nuccore/NC_015896.1
본 발명의 프라이머 세트가 인식하는 살오징어(Japanese flying squid, Todarodes pacificus)의 Cytochrome C oxidase I (COI) 게놈 DNA 염기서열은 하기 표 4의 서열번호 4로 표현된다. The nucleotide sequence of Cytochrome C oxidase I (COI) genomic DNA of Japanese squid ( Todarodes pacificus ) recognized by the primer set of the present invention is represented by SEQ ID NO: 4 in Table 4 below.
서열번호 4 : ACCESSION No. AB158364.1, 1400~2938번째 서열,SEQ ID NO: 4: ACCESSION NO. AB158364.1, 1400 to 2938 < th >
https://www.ncbi.nlm.nih.gov/nuccore/AB158364.1https://www.ncbi.nlm.nih.gov/nuccore/AB158364.1
또한 서열번호 5~12의 프라이머를 구성하는 DNA 염기서열은 하기와 같다. The nucleotide sequences of the DNAs constituting the primers of SEQ ID NOS: 5 to 12 are as follows.
서열번호 5 : ccccagatat agcatttccc cgta - 투스킨 주꾸미(Amphioctopus marginatus)의 Cytochrome C oxidase I (COI) 유전자 부분 증폭을 위한 Forward 프라이머 SEQ ID NO: 5: Forward primer for amplification of Cytochrome C oxidase I (COI) gene region of ccccagatat agcatttccc cgta-Tuskin juku ( Amphioctopus marginatus )
서열번호 6 : gcagctgagg aaaggagtaa ggtt - 투스킨 주꾸미(Amphioctopus marginatus) Cytochrome C oxidase I (COI) 유전자 부분 증폭을 위한 Reverse 프라이머 염기서열SEQ ID NO: 6: gcagctgagg aaaggagtaa ggtt - Amphioctopus marginatus Reverse primer sequence for Cytochrome C oxidase I (COI) gene amplification
서열번호 7 : attactttcc tcagctgcgg taga - 원스킨 주꾸미(Amphioctopus fangsiao) Cytochrome C oxidase I (COI) 유전자 부분 증폭을 위한 Forward 프라이머 염기서열SEQ ID NO: 7: attactttcc tcagctgcgg taga - Forward primer sequence for Amphioctopus fangsiao Cytochrome C oxidase I (COI) gene partial amplification
서열번호 8 : atcgacggag ggtcctatat gagc - 원스킨 주꾸미(Amphioctopus fangsiao) Cytochrome C oxidase I (COI) 유전자 부분 증폭을 위한 Reverse 프라이머 염기서열SEQ ID NO: 8: atcgacggag ggtcctatat gagc - Amphioctopus fangsiao Reverse primer sequence for Cytochrome C oxidase I (COI) gene amplification
서열번호 9 : tctgcagctg ttgaaagagg agta - 낙지(Octopus minor) Cytochrome C oxidase I (COI) 유전자 부분 증폭을 위한 Forward 프라이머 염기서열SEQ ID NO: 9: tctgcagctg ttgaaagagg agta - Octopus minor Forward primer sequence for amplification of Cytochrome C oxidase I (COI)
서열번호 10 : ttgctaggtc tacagatggt cctg - 낙지(Octopus minor) Cytochrome C oxidase I (COI) 유전자 부분 증폭을 위한 Reverse 프라이머 염기서열SEQ ID NO: 10: ttgctaggtc tacagatggt cctg- Octopus minor Reverse primer sequence for Cytochrome C oxidase I (COI) gene amplification
서열번호 11 : ctccttacca gtgctagcag gtg - 살오징어(Todarodes pacificus) Cytochrome C oxidase I (COI) 유전자 부분 증폭을 위한 Forward 프라이머 염기서열SEQ ID NO: 11: ctccttacca gtgctagcag gtg - Todarodes pacificus Forward primer sequence for Cytochrome C oxidase I (COI) gene partial amplification
서열번호 12 : tcgggatgcc caaagaatca aaata - 살오징어(Todarodes pacificus) Cytochrome C oxidase I (COI) 유전자 부분 증폭을 위한 Reverse 프라이머 염기서열SEQ ID NO: 12: tcgggatgcc caaagaatca aaata - Todarodes pacificus Reverse primer sequence for amplification of Cytochrome C oxidase I (COI)
O.minor atgcgatgaatattttcaacaaatcataaagatattggaacactatattttatttttgga
A.fangsiao atgcgatgaatattttcaacaaatcataaagacattggtacattatactttatcttcgga
A.marginatus ------------------------------gatattggaactttatacttcattttcgga
** *****:** **** ** ** ** **:
T.pacificus atctgggcaggactattaggtacatcattaagattaatgattcgtaccgaattaggtcaa
O.minor atctgatcaggtcttctaggaacttctttaagattaataattcgtactgaattaggtcaa
A.fangsiao atttgatcaggcctcctaggtacatctttaagcttaataattcgaacagaattaggtcaa
A.marginatus atttgatcaggcctcctaggtacttcattaagattaataatccgaacggaactaggacaa
** **. **** ** ****:**:**:*****.*****.** **:** *** ****:***
T.pacificus cccggatctttattaaatgatgatcaattatataacgtagtagttactgctcacggattt
O.minor ccaggttcactactcaacgatgatcaactttataatgttattgtaactgcacatgcattt
A.fangsiao ccaggatctttattaaatgatgatcaattatataatgtaattgttacagcccatgcattt
A.marginatus ccaggatcactattaaatgatgatcaattatataatgtaattgtaacagcccatgcattt
**.**:**: ** *.** ********* *:***** **:.*:**:**:** ** * ****
T.pacificus attataatttttttcatagttatacctattataattggaggatttggtaactggttagtt
O.minor gtaataattttttttttagtaatacctgttataatcggaggatttggaaattgattagtt
A.fangsiao gtaataattttttttttggttatacctgttataattggaggatttggtaactgattagtc
A.marginatus gtaataatttttttcctcgttataccagtaataattggaggatttggaaattgattagta
.*:*********** * **:*****:.*:***** ***********:** **.*****
T.pacificus cccttaatattaggtgctccagatatagcattcccacgtataaacaatataagattctga
O.minor cctttaatattaggtgcaccagatatagcattcccccgaataaataatataagattttga
A.fangsiao cccttaatattaggtgctccagatatagcttttcctcgtataaataatataagattctga
A.marginatus ccattaatactaggtg ccccagatatagcatttccccgta taaacaatataagattttga
** ****** ******* ***********:** ** **:***** *********** ***
T.pacificus ctacttcctccatccttaactcttttattagcttcatctgctgtagaaagaggagccgga
O.minor cttcttcctccttccctaaccttattattaacc tctgcagctgttgaaagaggagta gga A.fangsiao ttattacctccctctcttacttt attactttcctcagctgcggtaga aagaggagctggt
A.marginatus ttattacccccttcctt aaccttactcctttcctcagctgc agtagaaagaggtgttggt
*: *:** ** ** *:** *: *. *: * **: *:** **:********:* **:
T.pacificus acaggttgaacagtttatccccctttatctaggaatttatcccatgctggtccttcagtt
O.minor acaggatgaaccgtatatcctcctttatcaagaaatctcgctcata caggaccatctgta
A.fangsiao actggatgaactgtctatccacctctatcaagtaattta gctcatataggaccctccgtc
A.marginatus actggatgaacagtatatcctcctttatcaagaaatttagcacatataggaccatctgtt
**:**:***** ** ***** *** ****:** *** *. * ***. :**:** ** **
T.pacificus gatctagcaattttctcactccacttagctggtgtctcttccattttaggtgcaattaat
O.minor gacctagcaa ttttctcactccatttagcaggaatttcatctattttaggagctattaac
A.fangsiao gat ttagctattttctccttacatttagcaggaatttcatctattttaggagctattaat
A.marginatus gatctagcaattttttctcttcacttagcaggaatctcatcaattctaggagcaattaac
** ****:***** ** * ** *****:**:.* **:** *** ****:**:*****
T.pacificus ttcattacaactatcttaaatatacgatgagaaggtcttcaaatagaacgtcttccttta
O.minor ttcataactactattatcaatatacgatgagaaggaatacaaatagaacgtcttcctttg
A.fangsiao tttattactactattattaatatacgttgagaaggaatattaatagaacgactcccttta
A.marginatus ttcattactaccatcatcaatatacgatgagaaggtatactcatagaacgactcccattg
** **:**:** ** :* ********:********:.*: :.********:** **:**.
T.pacificus tttacatgatctgtatttattacagccattttattgctact ctccttaccagtgctagca
O.minor tttgtttgatcagtatttattacagctatccttcttcttttatcattacctgttcttgct
A.fangsiao tttgtatgatctgtctttattacagctgttttattacttctttcactaccagtacttgct
A.marginatus tttgtatgatctgtatttatcacagccgtgttactacttctatcgttaccagtattagct
***. :*****:**.***** ***** .* *: * **: * ** ****:** *:**:
T.pacificus ggtgc aattactatgctgttaactgatcgaaacttcaatactactttttttgatcctagt
O.minor ggagctattactatattattaactgatcgaaattttaatactactttctttgacccaaga
A.fangsiao ggtgcaatcactatacttttaactgatcgaaatttcaacacaactttttttgacccaaga
A.marginatus ggtgcaattaccatattattaactgaccgaaacttcaataccacattttttgaccctaga
**:**:** ** **. * ******** ***** ** ** ** **:** ***** **:**:
T.pacificus ggagggggagacccaattttataccaacatt tattttgattctttgggcatcccga agta
O.minor ggaggaggagatccaatcttataccaacatttattctgattctttggtcatcccgaagtt
A.fangsiao ggaggaggtgaccctatcctatatcaacatttattttgattttttggtcatccagaagta
A.marginatus ggaggtggggatcctattctctaccaacacttattctgattttttg--------------
***** ** ** **:** *.** ***** ***** ***** ****
T.pacificus tatattttaattttacctgcctttggtattatttcacacattgtatctcaccactcttta
O.minor tacattcttattttaccaggttttggaataatctcccacattgtatctcactattcatta
A.fangsiao tatattttaattttaccaggatttggtataatttcccatattgtttcccattattctata
A.marginatus ------------------------------------------------------------
T.pacificus aagaaagaaatttttggagccttaggtataatttacgccatactatcaattggtctccta
O.minor aaaaaagaaacatttggtagtctcggaataatctatgcaatactatcaattggtctatta
A.fangsiao aaaaaagaaacatttggtagattaggaataatttatgctatattatctattgggttatta
A.marginatus ------------------------------------------------------------
T.pacificus ggttttattgtctgagcacatcatatattcaccgtaggaatggatgtagatactcgagct
O.minor ggatttattgtatgagcacatcacatatttactgttggtatagatgtagatacacgagca
A.fangsiao ggatttattgtatgagcccatcatatatttacagttggaatagatgttgatacacgagca
A.marginatus ------------------------------------------------------------
T.pacificus tatttcacatcagcaacaataattattgcaattcctaccggaattaaagtatttagttga
O.minor tattttactgccgcaacaataattattgcaattcctactggaattaaagtctttagatga
A.fangsiao tattttacagccgcaacaataattattgccatcccaacaggaattaaagtttttagatga
A.marginatus ------------------------------------------------------------
T.pacificus ttagcaactatttatggttctcctattaaatataatacacctatactctgagcattaggg
O.minor ttagcaaccatttatggatcaccaatcaaatatacttcacctatattatgatctcttgga
A.fangsiao ttagccacaatttatggatcccctattaaatatacccctcctatattatgatctttagga
A.marginatus ------------------------------------------------------------
T.pacificus ttcatctttttatttactgtaggaggtttaacaggtattattctttctaattcatcatta
O.minor tttatttttttatttacaataggaggactaacaggtattgttctatctaattcatcttta
A.fangsiao tttatttttttattcaccacaggaggattaacaggaattgtattatctaattcatcttta
A.marginatus ------------------------------------------------------------
T.pacificus gatattatacttcatgacacatattatgttgtagctcatttccattatgtcttatctata
O.minor gatattatactacatgatacctactatgtagtagcccatttccactatgttttatccata
A.fangsiao gatattatattacatgatacatattatgtagtagcacatttccactatgtcctatcaata
A.marginatus ------------------------------------------------------------
T.pacificus ggagccgtgttcgctttatttgctggttttaaccattgataccctttaattacaggatta
O.minor ggagcagtatttgcattatttgcaggatttaatcattgataccccataattactggttta
A.fangsiao ggagcagtttttgctttatttgccggttttacccactgatatcctataattacaggttta
A.marginatus ------------------------------------------------------------
T.pacificus acactaaaccaacaatgaaccaaagctcattttatgacaatattcttaggtgtcaacgta
O.minor tcattaaatcaacaatatactaaatcccatttttatataatatttattggagttaatatt
A.fangsiao tcattaaatcaacaatatactaaatctcacttttatataatatttattggagtaaatatt
A.marginatus ------------------------------------------------------------
T.pacificus actttttttcctcaacattttctaggattagcaggaatacctcgacggtactcagattat
O.minor acctttttcccacaacactttctaggattagcaggtataccccgtcgatactcagattac
A.fangsiao actttttttccacaacactttttaggattagctggtataccacgacgatactcagattat
A.marginatus ------------------------------------------------------------
T.pacificus ccagattgttatactaaatgaaacatagtatcatctataggatctataatttcacttact
O.minor cccgattcttatactaaatgaaatatattatcatcaataggatcattattatccttaaca
A.fangsiao cctgactcctatactaaatgaaatatactttcatctataggatctcttttatcattaaca
A.marginatus ------------------------------------------------------------
T.pacificus agtgtgttgttctttatttttattgtttgagaaagtttaatttcacaacgaactgtgatt
O.minor tctattatatttttcatatttattgtatgagaaagattaatttctcaacgaactattatt
A.fangsiao tctattatattttttatatttattgtttgagaaagtttaatttcacaacgaacagttatt
A.marginatus ------------------------------------------------------------
T.pacificus tgatctaaccacataactacatctttagaatgagacaaccgtcttccagttgacttccat
O.minor tgatcaaaccacttaaacacatccttagaatgaaacaatcgtcttccagtagattttcat
A.fangsiao tgatcaaaccatttaaatacatctttagaatgagataatcgattaccagtagattttcac
A.marginatus ------------------------------------------------------------
T.pacificus agtctccctgaaacaggggctctttatatttaa
O.minor aaccaaatagaaactggagctttatttatttaa
A.fangsiao aaccaaatagaaacaggagccctatttatttaa
A.marginatus --------------------------------- T.pacificus atgcgatgactattttctacaaaccataaagacattggtaccttatattttatctttggt
O.minor atgcgatgaatattttcaacaaatcataaagatattggaacactatattttatttttgga
A.fangsiao atgcgatgaatattttcaacaaatcataaagacattggtacattatactttatcttcgga
A.marginatus ------------------------------ gatattggaactttatacttcattttcgga
** *****: ** **** ** ** ** **:
T.pacificus atctgggcaggactattaggtacatcattaagattaatgattcgtaccgaattaggtcaa
O.minor atctgatcaggtcttctaggaacttctttaagattaataattcgtactgaattaggtcaa
A.fangsiao atttgatcaggcctcctaggtacatctttaagcttaataattcgaacagaattaggtcaa
A. marginatus atttgatcaggcctcctaggtacttcattaagattaataatccgaacggaactaggacaa
** **. **** ** ****: **: **: *****. *****. ** **: ** *** ****: ***
T.pacificus cccggatctttattaaatgatgatcaattatataacgtagtagttactgctcacggattt
O.minor ccaggttcactactcaacgatgatcaactttataatgttattgtaactgcacatgcattt
A.fangsiao ccaggatctttattaaatgatgatcaattatataatgtaattgttacagcccatgcattt
A.marginatus ccaggatcactattaaatgatgatcaattatataatgtaattgtaacagcccatgcattt
**. **: **: ** *. ** ********* *: ***** **: **. ** ** ** ** ** ** ** **
T.pacificus attataatttttttcatagttatacctattataattggaggatttggtaactggttagtt
O.minor gtaataattttttttttagtaatacctgttataatcggaggatttggaaattgattagtt
A.fangsiao gtaataattttttttttggttatacctgttataattggaggatttggtaactgattagtc
A.marginatus gtaataattttttcctcgttataccagtaataattggaggatttggaaattgattagta
. *: *********** * **: *****:. *: ***** ***********: ** **. * ****
T.pacificus cccttaatattaggtgctccagatatagcattcccacgtataaacaatataagattctga
O.minor cctttaatattaggtgcaccagatatagcattcccccgaataaataatataagattttga
A.fangsiao cccttaatattaggtgctccagatatagcttttcctcgtataaataatataagattctga
A. marginatus ccattaatactaggtg ccccagatatagcatttccccgta taaacaatataagattttga
** ****** ******* ***********: ** ** **: ***** *********** ***
T.pacificus ctacttcctccatccttaactcttttattagcttcatctgctgtagaaagaggagccgga
O.minor cttcttcctccttccctaaccttattattaacc tctgcagctgttgaaagaggagta gga A.fangsiao ttattacctccctctcttacttt attactttcctcagctgcggtaga aagaggagctggt
A. marginatus ttattacccccttcctt aaccttactcctttcctcagctgc agtagaaagaggtgttggt
*: *: ** ** ** *: ** *: *. *: * **: *: ** **: ********: * **:
T.pacificus acaggttgaacagtttatccccctttatctaggaatttatcccatgctggtccttcagtt
O.minor acaggatgaaccgtatatcctcctttatcaagaaatctcgctcata caggaccatctgta
A.fangsiao actggatgaactgtctatccacctctatcaagtaattta gctcatataggaccctccgtc
A. marginatus actggatgaacagtatatcctcctttatcaagaaatttagcacatataggaccatctgtt
**: **: ***** ** ***** *** ****: ** *** *. * ***. : **: ** **
T.pacificus gatctagcaattttctcactccacttagctggtgtctcttccattttaggtgcaattaat
O.minor gacctagcaa ttttctcactccatttagcaggaatttcatctattttaggagctattaac
A.fangsiao gat ttagctattttctccttacatttagcaggaatttcatcatattttaggagctattaat
A.marginatus gatctagcaattttttctcttcacttagcaggaatctcatcaattctaggagcaattaac
** ****: ***** ** * ** *****: **:. * **: ** *** ****: **: *****
T.pacificus ttcattacaactatcttaaatatacgatgagaaggtcttcaaatagaacgtcttccttta
O.minor ttcataactactattatcaatatacgatgagaaggaatacaaatagaacgtcttcctttg
A.fangsiao tttattactactattattaatatacgttgagaaggaatattaatagaacgactcccttta
A.marginatus ttcattactaccatcatcaatatacgatgagaaggtatactcatagaacgactcccattg
** **: **: ** **: * ********: ********:. *::. ********: ** ** : **.
T.pacificus tttacatgatctgtatttattacagccattttattgctact ctccttaccagtgctagca
O.minor tttgtttgatcagtatttattacagctatccttcttcttttatcattacctgttcttgct
A.fangsiao tttgtatgatctgtctttattacagctgttttattacttctttcactaccagtacttgct
A.marginatus tttgtatgatctgtatttatcacagccgtgttactacttctatcgttaccagtattagct
***. *****: **. ***** *****. * *: * **: * ** ****: ** *: **:
T.pacificus ggtgc aattactatgctgttaactgatcgaaacttcaatactactttttttttgatcctagt
O.minor ggagctattactatattattaactgatcgaaattttaatactactttttctttgacccaaga
A.fangsiao ggtgcaatcactatacttttaactgatcgaaatttcaacacaactttttttgacccaaga
A. marginatus ggtgcaattaccatattattaactgaccgaaacttcaataccacattttttgaccctaga
**: ** ** ** **. ******** ***** ** ** ** **: ** ***** **: **:
T.pacificus ggagggggagacccaattttataccaacatt tattttgattctttgggcatcccga agta
O.minor ggaggaggagatccaatcttataccaacatttattctgattctttggtcatcccgaagtt
A.fangsiao ggaggaggtgaccctatcctatatcaacatttattttgattttttggtcatccgaagta
A.marginatus ggaggtggggatcctattctctaccaacacttattctgattttttg --------------
***** ** ** **: ** *. ** ***** ***** ***** ****
T.pacificus tatattttaattttacctgcctttggtattatttcacacattgtatctcaccactcttta
O.minor tacattcttattttaccaggttttggaataatctcccacattgtatctcactattcatta
A.fangsiao tatattttaattttaccaggatttggtataatttcccatattgtttcccattattctata
A. marginatus ----------------------------------------------- -------------
T.pacificus aagaaagaaatttttggagccttaggtataatttacgccatactatcaattggtctccta
O.minor aaaaaagaaacatttggtagtctcggaataatctatgcaatactatcaattggtctatta
A.fangsiao aaaaaagaaacatttggtagattaggaataatttatgctatattatctattgggttatta
A. marginatus ----------------------------------------------- -------------
T.pacificus ggttttattgtctgagcacatcatatattcaccgtaggaatggatgtagatactcgagct
O.minor ggatttattgtatgagcacatcacatatttactgttggtatagatgtagatacacgagca
A.fangsiao ggatttattgtatgagcccatcatatatttacagttggaatagatgttgatacacgagca
A. marginatus ----------------------------------------------- -------------
T.pacificus tatttcacatcagcaacaataattattgcaattcctaccggaattaaagtatttagttga
O.minor tattttactgccgcaacaataattattgcaattcctactggaattaaagtctttagatga
A.fangsiao tattttacagccgcaacaataattattgccatcccaacaggaattaaagtttttagatga
A. marginatus ----------------------------------------------- -------------
T.pacificus ttagcaactatttatggttctcctattaaatataatacacctatactctgagcattaggg
O.minor ttagcaaccatttatggatcaccaatcaaatatacttcacctatattatgatctcttgga
A.fangsiao ttagccacaatttatggatcccctattaaatatacccctcctatattatgatctttagga
A. marginatus ----------------------------------------------- -------------
T.pacificus ttcatctttttatttactgtaggaggtttaacaggtattattctttctaattcatcatta
O.minor tttatttttttatttacaataggaggactaacaggtattgttctatctaattcatcttta
A.fangsiao tttatttttttattcaccacaggaggattaacaggaattgtattatctaattcatcttta
A. marginatus ----------------------------------------------- -------------
T.pacificus gatattatacttcatgacacatattatgttgtagctcatttccattatgtcttatctata
O.minor gatattatactacatgatacctactatgtagtagcccatttccactatgttttatccata
A.fangsiao gatattatattacatgatacatattatgtagtagcacatttccactatgtcctatcaata
A. marginatus ----------------------------------------------- -------------
T.pacificus ggagccgtgttcgctttatttgctggttttaaccattgataccctttaattacaggatta
O.minor ggagcagtatttgcattatttgcaggatttaatcattgataccccataattactggttta
A.fangsiao ggagcagtttttgctttatttgccggttttacccactgatatcctataattacaggttta
A. marginatus ----------------------------------------------- -------------
T.pacificus acactaaaccaacaatgaaccaaagctcattttatgacaatattcttaggtgtcaacgta
O.minor tcattaaatcaacaatatactaaatcccatttttatataatatttattggagttaatatt
A.fangsiao tcattaaatcaacaatatactaaatctcacttttatataatatttattggagtaaatatt
A. marginatus ----------------------------------------------- -------------
T.pacificus actttttttcctcaacattttctaggattagcaggaatacctcgacggtactcagattat
O.minor acctttttcccacaacactttctaggattagcaggtataccccgtcgatactcagattac
A.fangsiao actttttttccacaacactttttaggattagctggtataccacgacgatactcagattat
A. marginatus ----------------------------------------------- -------------
T.pacificus ccagattgttatactaaatgaaacatagtatcatctataggatctataatttcacttact
O.minor cccgattcttatactaaatgaaatatattatcatcaataggatcattattatccttaaca
A.fangsiao cctgactcctatactaaatgaaatatactttcatctataggatctcttttatcattaaca
A. marginatus ----------------------------------------------- -------------
T.pacificus agtgtgttgttctttatttttattgtttgagaaagtttaatttcacaacgaactgtgatt
O.minor tctattatatttttcatatttattgtatgagaaagattaatttctcaacgaactattatt
A.fangsiao tctattatattttttatatttattgtttgagaaagtttaatttcacaacgaacagttatt
A. marginatus ----------------------------------------------- -------------
T.pacificus tgatctaaccacataactacatctttagaatgagacaaccgtcttccagttgacttccat
O.minor tgatcaaaccacttaaacacatccttagaatgaaacaatcgtcttccagtagattttcat
A.fangsiao tgatcaaaccatttaaatacatctttagaatgagataatcgattaccagtagattttcac
A. marginatus ----------------------------------------------- -------------
T.pacificus agtctccctgaaacaggggctctttatatttaa
O.minor aaccaaatagaaactggagctttatttatttaa
A.fangsiao aaccaaatagaaacaggagccctatttatttaa
A. marginatus ---------------------------------
표 1~5에서 bold체로 표시한 서열은 각 프라이머가 결합하는 위치를 나타낸다. 또한 표 5에서 각 서열의 밑부분에 표시한 *은 동일한 base를 갖는 위치임을 나타내며 각각 다른 base를 갖는 위치는 공란 또는 ':'과 '.'로 나타내었다. The sequences shown in bold in Tables 1 to 5 indicate the positions where each primer binds. In Table 5, the asterisk (*) at the bottom of each sequence indicates a position having the same base, and positions having different bases are shown as blank or ':' and '.'
또한 본 발명은 상기 두족류 품종 판별용 프라이머 세트를 포함하는 실시간 PCR용 조성물에 관한 것으로서, 상기 실시간 PCR은 바람직하게는 초고속 실시간 PCR일 수 있다. In addition, the present invention relates to a composition for real-time PCR comprising a primer set for discrimination of a cephalopod varieties, wherein the real-time PCR is preferably a high-speed real-time PCR.
또 다른 양태에서 본 발명은 상기 조성물을 포함하는 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어의 품종 판별용 진단키트를 제공한다. 상기 진단키트는, 각 품종에 대한 특이적인 각각의 프라이머 세트와 DNA를 증폭하기 위한 Taq DNA 중합효소 외에도 튜브 또는 다른 적절한 컨테이너, 항온기 또는 항온수조, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), 멸균수, 발광염료를 포함할 수 있다. 이 때 발광염료로서 Eva 그린을 사용할 수 있다. In another aspect, the present invention provides a diagnostic kit for identifying a variety of tuskkin juku, one skin juku, octopus and squid including the above composition. In addition to the respective primer sets specific for each strain and the Taq DNA polymerase for amplifying the DNA, the diagnostic kit may further comprise a tube or other suitable container, a thermostat or constant temperature bath, a reaction buffer (pH and magnesium concentrations vary) Nucleotides (dNTPs), sterile water, luminescent dyes. Eva green can be used as a luminescent dye at this time.
본 발명의 유전자 증폭 분석에서 사용하는 검체는 조직 용해액 또는 게놈 DNA일 수 있는데, 상기 조직 용해액은 투스킨 주꾸미, 원스킨 주꾸미, 낙지 또는 살오징어의 조직 시료를 통상적으로 사용하는 세포용해완충액(cell lysis buffer)에 녹여 얻은 것일 수 있다. The sample to be used in the gene amplification analysis of the present invention may be a tissue lysis solution or genomic DNA. The tissue lysate may be prepared by dissolving or suspending a tissue sample of Tuskin jukumi, one skin juku, octopus or squid squid in a cell lysis buffer cell lysis buffer).
이 때 상기 유전자 증폭 분석은 바람직하게는 실시간 PCR 방법을 이용할 수 있으며, 더 바람직하게는 초고속 실시간 PCR 방법을 이용할 수 있다. At this time, the gene amplification analysis is preferably a real-time PCR method, and more preferably, a high-speed real-time PCR method can be used.
본 발명은 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어의 품종 판별을 위한 종 특이 프라이머 세트 또는 이를 이용한 유전자 증폭 분석법에 관한 것이다. 상기 프라이머 세트 또는 이를 이용한 유전자 증폭 분석법을 통해 원스킨 주꾸미가 포함된 요리용 원재료에 투스킨 주꾸미가 혼입되는 것을 방지할 수 있으며, 원스킨 주꾸미의 품종 보증을 용이하게 할 수 있어, 국내산 주꾸미인 원스킨 주꾸미, 낙지, 살오징어의 합당한 가격 책정이 가능하다. 또한 수입산 주꾸미인 투스킨 주꾸미가 국내산 주꾸미, 낙지, 오징어 등으로 둔갑하는 사례를 적발하여 수입산 주꾸미를 감시하여 유통 및 소비시장의 활성화에 도움이 될 수 있다. 대한민국 등록특허 제10-1151747호와 대한민국 등록특허 제10-1196640호에 중합효소연쇄반응을 이용한 살오징어 등의 해양생물 종 판별방법이 개시되어 있기는 하지만, 본 발명에 개시된 프라이머 세트들을 이용하여 스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어의 품종 판별을 하는 방법들은 전혀 개시된 바 없다. The present invention relates to a species-specific primer set for discriminating the variety of two-skinned squid, one-skinned squid, octopus and squid, or a gene amplification assay using the same. The primer set or the gene amplification analysis method using the primer set can prevent the penetration of the toskin jukumi into the raw material for cooking containing the one skin jukumi, and it is possible to guarantee the variety of the one skin jukumi, Skinjuku, octopus, squid can afford reasonable price. In addition, Tucson jukumi, which is imported jumbo jumbo, can detect domestic jumbo jumbo, octopus, squid, etc., and it can help to activate the distribution and consumption market by monitoring imported jumbo jumbo. Korean Patent No. 10-1151747 and Korean Patent No. 10-1196640 disclose a method of discriminating marine species such as Salmonid using a polymerase chain reaction. However, it is also possible to use the primer sets disclosed in the present invention, The methods for discriminating the varieties of squid, one skin juku, octopus and squid are not disclosed at all.
도 1은 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어의 게놈 DNA에 대해 품종 판별을 위한 PCR 프라이머를 이용하여 단일 PCR(중합효소연쇄반응)을 수행한 젤 사진을 표시한 것이며, 사진에서 숫자 1, 2, 3 및 4는 순차적으로 각각 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어로부터 채취한 게놈 DNA 시료를 사용하였음을 나타낸다.
도 2는 본 발명의 원스킨 주꾸미 품종 판별을 위한 PCR 프라이머를 이용하여, 원스킨 주꾸미의 게놈 DNA(1, 검은색 선), 원스킨 주꾸미의 조직 용해액(3, 노란색 선), 투스킨 주꾸미의 조직 용해액(4, 회색 선), 낙지의 조직 용해액(5, 초록색 선), 살오징어의 조직 용해액(6, 파란색 선)에 대해 초고속 실시간 PCR을 수행한 결과를 표시한 것으로서, 원스킨 주꾸미의 게놈 DNA 증폭결과인 검은색 선과 함께 원스킨 주꾸미의 조직 용해액 결과인 노란색 선의 증폭 결과가 확인되며 동일한 온도에서 melting peak가 형성됨을 확인할 수 있다.
도 3은 본 발명의 투스킨 주꾸미 품종 판별을 위한 PCR 프라이머를 이용하여, 투스킨 주꾸미의 게놈 DNA(1, 검은색 선), 원스킨 주꾸미의 조직 용해액(3, 노란색 선), 투스킨 주꾸미의 조직 용해액(4,회색 선), 낙지의 조직 용해액(5, 초록색 선), 살오징어의 조직 용해액(6, 파란색 선)에 대해 초고속 실시간 PCR을 수행한 결과를 표시한 것으로서, 투스킨 주꾸미의 게놈 DNA 증폭결과인 검은색 선과 함께 투스킨 주꾸미의 조직 용해액 결과인 회색 선의 증폭 결과가 확인되며 거의 동일한 온도에서 melting peak가 형성됨을 확인할 수 있다.
도 4는 본 발명의 낙지 품종 판별을 위한 PCR 프라이머를 이용하여, 낙지의 게놈 DNA(1, 검은색 선), 원스킨 주꾸미의 조직 용해액(3, 노란색 선), 투스킨 주꾸미의 조직 용해액(4,회색 선), 낙지의 조직 용해액(5, 초록색 선), 살오징어의 조직 용해액(6, 파란색 선)에 대해 초고속 실시간 PCR을 수행한 결과를 표시한 것으로서, 낙지의 게놈 DNA 증폭결과인 검은색 선과 함께 낙지의 조직 용해액 결과인 초록색 선의 증폭 결과가 확인되며 거의 동일한 온도에서 melting peak가 형성됨을 확인할 수 있다.
도 5는 본 발명의 살오징어에서 품종 판별을 위한 PCR 프라이머를 이용하여, 살오징어의 게놈 DNA(1, 검은색 선), 원스킨 주꾸미의 조직 용해액(3, 노란색 선), 투스킨 주꾸미의 조직 용해액(4,회색 선), 낙지의 조직 용해액(5, 초록색 선), 살오징어의 조직 용해액(6, 파란색 선)에 대해 초고속 실시간 PCR을 수행한 결과를 표시한 것으로서, 살오징어의 게놈 DNA 증폭결과인 검은색 선과 함께 살오징어의 조직 용해액 결과인 파란색 선의 증폭 결과가 확인되며 거의 동일한 온도에서 melting peak가 형성됨을 확인할 수 있다.FIG. 1 is a photograph of a gel obtained by performing a single PCR (polymerase chain reaction) using genomic DNA of Tuskin juku, one skin juku, one octopus, and squid squid using a PCR primer for discrimination of breeds. 1, 2, 3 and 4 indicate that genomic DNA samples were sequentially taken from Tuskin jukumi, one skin juku, octopus, and squid squid respectively.
FIG. 2 is a diagram showing the results of analysis of genomic DNA (1, black line) of one skin jukebox, tissue lysate (3, yellow line) of one skin jukumi using a PCR primer for discrimination of one- Real-time PCR was performed on the tissue solution (4, gray line), tissue solution (5, green line), and squid tissue lysis solution (6, blue line) The amplification result of the yellow line, which is the result of the tissue solution of one skin jukumi, is confirmed along with the black line which is the genomic DNA amplification result of the skin jukipan, and the melting peak is formed at the same temperature.
FIG. 3 is a graph showing the results of analysis of the genomic DNA (1, black line) of Tuskin jukipui, tissue solution (3, yellow line) of one skin jukumi using a PCR primer for discriminating the species of Tuskin jukipi of the present invention, Real-time real-time PCR was performed on the tissue solution (4, gray line), tissue solution (5, green line), and squid tissue solution (6, blue line) The amplification result of the gray line, which is the result of the tissue solution of Tuskin jukumi, was confirmed along with the black line which is the genomic DNA amplification result of the skin jukipan, and the melting peak was formed at almost the same temperature.
FIG. 4 is a graph showing the results of analysis of genomic DNA (1, black line) of octopus, tissue lysis solution (3, yellow line) of one skin jukumi, Speed real-time PCR on tissue solution (4, gray line), tissue solution of octopus (5, green line), and tissue lysate of squid (6, blue line) As a result, the amplification result of the green line, which is the result of the tissue solution of octopus, is confirmed and the melting peak is formed at almost the same temperature.
FIG. 5 is a graph showing the results of analysis of the genomic DNA (1, black line) of salmon squid, the tissue lysate (3, yellow line) of one skin jukumi, Real-time real-time PCR was performed on tissue solution (4, gray line), tissue solution (5, green line) of octopus, and tissue solution (6, blue line) of cuttlefish. And the amplification result of the blue line, which is the result of the tissue lysis solution of squid, was confirmed, and the melting peak was formed at almost the same temperature.
이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the invention to those skilled in the art.
<실시예 1. 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어의 시료 준비 및 DNA 분리>EXAMPLES Example 1. Sample preparation and DNA isolation of Tuskin juku, one skin juku, octopus and squid,
대상 재료로는 수산물 수입업체로부터 태국에서 수입되는 절단주꾸미(투스킨 주꾸미), 시중에서 유통되는 국내산 주꾸미, 국내산 낙지, 국내산 살오징어 품종을 사용하였다. As a target material, we used Cutting juku (Touskin juku) imported from Thailand, Thai domestic juku, Domestic octopus, Domestic squid varieties imported from Thailand.
실시간 PCR 분석에 의한 유전자별 프라이머 세트를 규정하기 위해 통제집단으로 사용할 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어의 게놈 DNA를 확보하기 위하여 각 품종당 3개체씩의 다리 조직을 채취하여 3차 멸균 증류수에 세척한 다음 액체질소로 급냉시키고, 막자사발을 이용하여 파쇄한 다음 Genomic DNA extraction kit(Bioneer, Korea)를 사용하여 DNA를 추출하였다.In order to define genome-specific primer set by real-time PCR analysis, 3 legs of each strain were collected to obtain the genomic DNA of Tuskin juku, one skin juku, octopus, and squid squid to be used as a control group, Washed with sterile distilled water, quenched with liquid nitrogen, disrupted using a mortar and then extracted with genomic DNA extraction kit (Bioneer, Korea).
추출된 DNA는 UV/Via Spectrophotometer(Optigen NANO Q, Mecasys사, Korea)를 이용하여 농도를 측정하였다. 농도 측정이 완료된 각 DNA 샘플은 멸균 3차 증류수를 이용하여 최종 DNA 농도를 10 ng/㎕로 조정하여 PCR 반응 시 사용하였다.The concentration of the extracted DNA was measured using a UV / Via Spectrophotometer (Optigen NANO Q, Mecasys, Korea). Each DNA sample for which the concentration measurement was completed was used for the PCR reaction by adjusting the final DNA concentration to 10 ng / μl using sterilized tertiary distilled water.
투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어에서 추출된 게놈 DNA는 표 6의 프라이머 세트를 이용하여 게놈 DNA에 존재하는 16s rDNA 염기서열 부위를 증폭하여 클로닝하였고, 염기서열 분석을 통해 투스킨 주꾸미는 Amphioctopus marginatus, 원스킨 주꾸미는 Amphioctopus fangsiao, 낙지는 Octopus minor, 살오징어는 Todarodes pacificus으로 품종을 확인하였다.The genomic DNA extracted from Tuskin juku, one skin juku, octopus, and squid squid was amplified and cloned using the primer set of Table 6 to amplify the 16s rDNA nucleotide sequence present in the genomic DNA. Through the nucleotide sequence analysis, Amphioctopus marginatus, Amphioctopus fangsiao , Octopus minor and Todarodes pacificus were identified.
(프라이머 이름)Target gene
(Name of primer)
(Cephal-16s-U)16s rRNA
(Cephal-16s-U)
<< 실시예Example 2. 2. PCRPCR 및 전기영동 분석> And electrophoresis analysis>
PCR 반응은 종 간 변이가 있는 부위를 타겟으로 본 발명자들에 의해 자체 개발된 각 품종에 대한 표 7의 프라이머를 이용하여 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어 품종을 대상으로 수행하였다.The PCR reaction was carried out using the primers shown in Table 7 for the respective cultivars developed by the present inventors, targeting the region having the species mutation, and the Tuskin jukumi, one skin jukumi, octopus, and salting squid varieties.
종 / 유전자
(프라이머 이름)object
Species / gene
(Name of primer)
(Am_COI_2-1)Tuskin juku / COI
(Am_COI_2-1)
(서열번호 5)5'-ccccagatatagcatttccccgta-3 '
(SEQ ID NO: 5)
(서열번호 6)5'-gcagctgaggaaaggagtaaggtt-3 '
(SEQ ID NO: 6)
(Af_COI_2-1)One skin jukumi / COI
(Af_COI_2-1)
(서열번호 7)5'-attactttcctcagctgcggtaga-3 '
(SEQ ID NO: 7)
(서열번호 8)5'-atcgacggagggtcctatatgagc-3 '
(SEQ ID NO: 8)
(Om_COI_2)Octopus / COI
(Om_COI_2)
(서열번호 9)5'-tctgcagctgttgaaagaggagta-3 '
(SEQ ID NO: 9)
(서열번호 10)5'-ttgctaggtctacagatggtcctg-3 '
(SEQ ID NO: 10)
(Tp_COI_3)Squid / COI
(Tp_COI_3)
(서열번호 11)5'-ctccttaccagtgctagcaggtg-3 '
(SEQ ID NO: 11)
(서열번호 12)5'-tcgggatgcccaaagaatcaaaata-3 '
(SEQ ID NO: 12)
한편, 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어 품종의 판별을 위한 PCR 반응 혼합물(20 ㎕)의 조성은 다음과 같다: AccuPower ® PCR PreMix (reaction volume 20㎕, Bioneer, Korea)에 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어의 게놈 DNA 20ng, 각 프라이머 10 pmole 2㎕를 첨가하고 멸균 3차 증류수로 최종 20㎕에 맞추어 사용하였다. Meanwhile, the composition of the PCR reaction mixture (20 μl) for discrimination of Tuskin juku, one skin jukumi, octopus, and squid varieties was as follows: AccuPower ® PCR PreMix (
PCR 반응은 SimpliAmp Thermal Cycler(ThermoFisher scientific, USA)를 이용하여 94℃에서 5 분간 초기변성 후, 94℃ 30 초 변성, 62℃ 30초 결합 및 72℃ 30초 신장을 총 35회 반복 수행하였고, 마지막으로 72℃에서 5 분간 최종 신장 반응을 수행하였다. 증폭된 PCR산물은 2% 아가로스 겔에서 전기영동 한 후 EtBr로 염색하여 이미지분석기에서 각 품종의 유전자 증폭산물을 확인하였으며, 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어 품종에 대한 PCR 산물들을 유전자 클로닝한 후, 품종 간의 염기서열을 비교 분석하였다. 이러한 결과는 도 1에 나타내었고, 도 1의 사진에서 숫자 1, 2, 3 및 4는 순차적으로 각각 투스킨 주꾸미(1), 원스킨 주꾸미(2), 낙지(3), 살오징어(4)로부터 채취한 게놈 DNA 시료를 사용하였음을 나타낸다. The PCR reaction was performed at 94 ° C for 5 minutes, followed by denaturation at 94 ° C for 30 seconds, binding at 62 ° C for 30 seconds, and extension at 72 ° C for 30 seconds, using a SimpliAmp Thermal Cycler (ThermoFisher Scientific, USA) Lt; RTI ID = 0.0 > 72 C < / RTI > for 5 minutes. The amplified PCR product was electrophoresed on 2% agarose gel and stained with EtBr. The amplification product of each strain was confirmed by an image analyzer. PCR products of Tuskin jukumi, one skin jukumi, octopus, After gene cloning, the nucleotide sequences of the cultivars were compared and analyzed. 1, the
도 1을 참고하면, 투스킨 주꾸미에서는 Am_COI_2-1 프라이머를 이용하여 PCR을 수행한 결과 85 bp 크기의 DNA 단편이 관찰되며, 원스킨 주꾸미에서는 Af_COI_2-1 프라이머를 이용하여 PCR을 수행한 결과 97 bp 크기의 DNA 단편이 관찰된다. 낙지에서는 Om_COI_2 프라이머를 이용하여 PCR을 수행한 결과 100 bp 크기의 DNA 단편이 확인되며, 살오징어에서는 Tp_COI_3 프라이머를 이용하여 PCR을 수행한 결과 135 bp 크기의 DNA 단편이 확인된다. Referring to FIG. 1, PCR was carried out using Am_COI_2-1 primer in Tuskin jukumi. As a result, a DNA fragment of 85 bp in size was observed. In the case of one-skin junk medicine, PCR was performed using Af_COI_2-1 primer, Sized DNA fragments are observed. In octopus, 100 bp DNA fragments were confirmed by Om_COI_2 primer and 135 bp DNA fragments were confirmed by PCR using Tp_COI_3 primer.
<실시예 3. 초고속 실시간 PCR 분석을 위한 시료 준비> ≪ Example 3: Preparation of sample for ultra high-speed real-time PCR analysis >
투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어의 조직 시료 50 mg를 취하여 조직 용해액(DLB tube, Gene System) 500㎕에 넣고, 조직 시료가 포함된 조직 용해액을 1분 간격으로 섞어주면서 5분 동안 상온에서 반응하게 하였다. 조직 용해의 상층액 10 ㎕를 취하여 멸균 3차 증류수 90 ㎕ 넣고 섞어주고, 다시 같은 방법으로 희석하여 잘 섞어주었다(최초 조직 용해액을 10-2으로 멸균 3차 증류수에 희석). 이렇게 희석된 조직 용해액에는 실시예 1에서 추출한 각 시료 품종 조직의 게놈 DNA가 포함되어 있다. 이러한 조직 용해액을 이용하여 게놈 DNA를 정제하는 데에 필요한 절차를 번거롭게 수행하지 않고, 바로 초고속 실시간 PCR을 위한 시료로서 사용하였다. 50 mg of a tissue sample of Tuskin juku, one skin juku, octopus, and squid was placed in 500 μl of DLB tube (Gene System), and the tissue solution containing the tissue sample was mixed at 1 minute intervals Min at room temperature. 10 μl of the supernatant of tissue lysis was taken and 90 μl of sterilized tertiary distilled water was added and mixed. The mixture was diluted by the same method and mixed well (diluted with sterilized tertiary distilled water at 10 -2 for the initial tissue lysis solution). The diluted tissue lysate contained the genomic DNA of each sample cultivar extracted in Example 1. The procedure required for purifying the genomic DNA using such a tissue lysate was not performed cumbersome, but was immediately used as a sample for high-speed real-time PCR.
<실시예 4. 초고속 실시간 PCR 및 유전자형 분석><Example 4: High-speed real-time PCR and genotype analysis>
실시간 고속 유전자증폭 반응은 UF-150 GENECHECKER Ultra-Fast PCR system (Gene System, Korea)을 이용하여 수행하였다. PCR 반응 혼합 조성물(10ul)은 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어의 게놈 DNA 또는 조직 용해액(실시예 1 또는 3에서 추출한 것) 1㎕(20ng/㎕), 2X Rapi Master Mix (Gene System) 5㎕, 표 2에서 합성한 각 프라이머 0.5㎕(10pmole/㎕), 멸균 3차 증류수 3㎕를 사용하였으며, PCR 반응 조건은 95℃ 30초 반응 후 95℃ 5초, 62℃ 5초, 72℃ 5초의 3단계로 PCR을 40 사이클 수행하였다. 이 때 게놈 DNA는 실시예 1에서, 조직 용해액은 실시예 3에서 준비한 것을 사용하였다. 상기 2X Rapi Master Mix에는 Eva-green 형광염료가 포함되어 있다. Real-time high-speed gene amplification was performed using UF-150 GENECHECKER Ultra-Fast PCR system (Gene System, Korea). PCR reaction mixture (10ul) was prepared by adding 1 占 퐇 (20 ng / 占 퐇) of genomic DNA or tissue lysate (extracted from Example 1 or 3) of 2-way Rapi Master Mix Gene System), 0.5 μl (10 pmole / μl) of each primer synthesized in Table 2, and 3 μl of sterilized tertiary distilled water were used. The PCR reaction conditions were 95 ° C for 30 seconds, 95 ° C for 5 seconds, , 72 ° C for 5 seconds, and 40 cycles of PCR. The genomic DNA was used in Example 1, and the tissue lysate used in Example 3 was used. The 2X Rapi Master Mix contains Eva-green fluorescent dye.
투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어 품종의 유전자 증폭의 판별 분석은 상기의 초고속 실시간 PCR 조건으로 각 품종 당 1쌍의 프라이머를 이용하여 분석하였는데, 도 2 내지 도 5의 초고속 실시간 PCR 반응 그래프 결과 중, 검은색 선은 양성 대조군으로 각 품종 프라이머 세트에 대해 해당 품종의 게놈 DNA를 주형으로 사용하여 증폭한 결과이고, 빨강색 선은 음성 대조군으로 멸균 3차 증류수를 주형 DNA 대신 첨가한 것의 결과이다. 또한 동일 그래프에서 노란색 선은 원스킨 주꾸미의 조직 용해액, 회색 선은 투스킨 주꾸미의 조직 용해액, 초록색 선은 실시예 3의 방법을 통해 준비된 낙지의 조직 용해액, 파란색 선은 살오징어의 조직 용해액을 주형으로 사용하여 초고속 실시간 PCR 수행한 결과이며, 핑크색 선과 하늘색 선은 시료 샘플이 없는 blank를 나타낸다. The discrimination analysis of the gene amplification of Tuskin juku, one skin jukipi, octopus, and squid varieties was carried out using one pair of primers for each kind under the above-described ultra-high speed real-time PCR conditions. In the graphical results, the black line represents the result of amplification using the genomic DNA of the corresponding strain for each strain primer set as a positive control, and the red line represents the result of addition of the sterilized tertiary distilled water as the template DNA Results. In the same graph, the yellow line represents the tissue dissolving solution of one skin jukumi, the gray line represents the tissue dissolving solution of Tuskin juku, the green line represents the tissue dissolving solution prepared by the method of Example 3, and the blue line represents the tissue of salted squid High-speed real-time PCR was performed using a solution as a template. The pink line and the blue line indicate a blank without a sample.
PCR 수행이 끝난 후 결과는 UF-150 GENECHECKER Ultra-Fast PCR system 기기에 연결되는 PC(labtop)의 Gene recoder(Gene System) 프로그램을 통해 실시간으로 확인하였다. After completion of the PCR, the results were confirmed in real time through the Gene Recorder (Gene System) program of the PC (labtop) connected to the UF-150 Ultra-Fast PCR system.
도 2 내지 도 5를 참고하면, 원스킨 주꾸미 판별용 프라이머를 사용한 결과를 나타내는 도 2에서는, 조직용해액을 시료로 한 초고속 실시간 PCR 수행 결과에서 노란색 선(3)이 증폭되어 원스킨 주꾸미 시료를 사용한 것이 확인된다. 투스킨 주꾸미 판별용 프라이머를 사용한 결과를 나타내는 도 3에서는, 조직용해액을 시료로 한 초고속 실시간 PCR 수행 결과에서 회색 선(4)이 증폭되어 투스킨 주꾸미 시료를 사용한 것이 확인된다. 낙지 판별용 프라이머를 사용한 결과를 나타내는 도 4에서는 조직용해액을 시료로 한 초고속 실시간 PCR 수행 결과에서 초록색 선(5)이 증폭되어 낙지 시료를 사용한 것이 확인된다. 살오징어 판별용 프라이머를 사용한 결과를 나타내는 도 5에서는, 조직용해액을 시료로 한 초고속 실시간 PCR 수행 결과에서 파란색 선(6)이 증폭되어 살오징어 시료를 사용한 것이 확인된다. 이 때 각 그래프에서 프라이머의 판별 대상이 되는 품종의 게놈 DNA 증폭결과인 검은 선도 모두 증폭이 크게 되어 있는 것으로 확인된다. Referring to FIGS. 2 to 5, in FIG. 2 showing the result of using the primer for discriminating one skin jukipan, the yellow line (3) was amplified in a high-speed real-time PCR performed using a tissue lysate as a sample, It is confirmed that it is used. In FIG. 3, which shows the result of using the primer for the determination of the toskin jukipo, it is confirmed that the gray line (4) is amplified in the ultrafast real-time PCR performed using the tissue lysate as a sample to use a toskin jukipan sample. In FIG. 4 showing the result of using the octopus discriminating primer, it is confirmed that the
결론적으로, 본 발명의 각 품종별 프라이머 세트를 이용하여, 투스킨 주꾸미, 원스킨 주꾸미, 낙지, 살오징어 품종의 판별이 빠르고 안전하고 정확하게 수행될 수 있음을 알 수 있다.In conclusion, it can be seen that the discrimination of Tuskin juku, One skin juku, Octopus and Salix varieties can be performed quickly, safely and accurately by using the primer set of each kind of the present invention.
Claims (6)
원스킨 주꾸미(One skin webfoot octopus, Amphioctopus fangsiao)의 판별을 위한, 서열번호 7의 염기서열을 포함하는 프라이머 및 서열번호 8의 염기서열을 포함하는 프라이머로 이루어진 제2 프라이머 세트;
낙지(Long arm octopus, Octopus minor)의 판별을 위한, 서열번호 9의 염기서열을 포함하는 프라이머 및 서열번호 10의 염기서열을 포함하는 프라이머로 이루어진 제3 프라이머 세트; 및,
살오징어(Japanese flying squid, Todarodes pacificus)의 판별을 위한, 서열번호 11의 염기서열을 포함하는 프라이머 및 서열번호 12의 염기서열을 포함하는 프라이머로 이루어진 제4 프라이머 세트;
를 모두 포함하고, Taq DNA 중합효소를 함유하는 것을 특징으로 하는 투스킨 주꾸미, 원스킨 주꾸미, 낙지 및 살오징어로 이루어진 군에서 선택되는 1종 이상 두족류의 품종 판별을 위한 초고속 실시간 PCR(Ultra-Fast polymerase chain reaction)용 조성물.A first primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 5 and a primer comprising the nucleotide sequence of SEQ ID NO: 6 for discrimination of two skin webfoot octopus ( Amphioctopus marginatus );
A second primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 7 and a primer comprising the nucleotide sequence of SEQ ID NO: 8 for the discrimination of One skin webfoot octopus ( Amphioctopus fangsiao );
A third primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 9 and a primer comprising the nucleotide sequence of SEQ ID NO: 10 for the determination of octopus ( Octopus minor ); And
A fourth primer set consisting of a primer comprising the nucleotide sequence of SEQ ID NO: 11 and a primer comprising the nucleotide sequence of SEQ ID NO: 12, for the discrimination of Japanese squid ( Todarodes pacificus );
Ultra-Fast Real-Time PCR for discrimination of at least one kind of cephalopods selected from the group consisting of tsukin juku, one skin juku, octopus and squid, which is characterized by containing Taq DNA polymerase polymerase chain reaction.
제1항의 각각의 프라이머 세트에 Taq DNA 중합효소를 첨가하여, 각각의 프라이머 세트와 Taq DNA 중합효소를 포함하는 조성물을 제조하는 제2단계;
투스킨 주꾸미, 원스킨 주꾸미, 낙지 또는 살오징어의 검체를 각 품종 판별용 프라이머 세트가 포함된 제2단계의 조성물에 각각 첨가하여 반응액을 제조하는 제3단계; 및,
상기 반응액을 이용하여 유전자 증폭 분석을 수행하는 제4단계;
를 포함하는 것을 특징으로 하는 투스킨 주꾸미, 원스킨 주꾸미, 낙지 또는 살오징어로 이루어진 군에서 선택되는 1종 이상 두족류의 품종을 초고속 실시간 PCR(Ultra-Fast polymerase chain reaction)로 판별하는 방법. A first step of preparing a composition for high-speed real-time PCR according to claim 1;
A second step of adding Taq DNA polymerase to each of the primer sets of claim 1 to prepare a composition containing each primer set and a Taq DNA polymerase;
A third step of preparing a reaction solution by adding a sample of Tuskin juku, one skin juku, octopus or squid to a composition of a second stage, each containing a primer set for discriminating each strain; And
A fourth step of performing gene amplification analysis using the reaction solution;
The present invention relates to a method for discriminating a variety of at least one cephalopod selected from the group consisting of Tuskin juku, one skin juku, octopus or squid, by ultra-fast polymerase chain reaction.
상기 검체는 조직 용해액 또는 게놈 DNA인 것을 특징으로 하는 두족류의 품종을 초고속 실시간 PCR(Ultra-Fast polymerase chain reaction)로 판별하는 방법. 6. The method of claim 5,
Wherein the specimen is a tissue lysate or a genomic DNA, and discriminating a variety of cephalopods by ultra-fast polymerase chain reaction (PCR).
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170006042A KR101999813B1 (en) | 2017-01-13 | 2017-01-13 | Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170006042A KR101999813B1 (en) | 2017-01-13 | 2017-01-13 | Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20180083988A KR20180083988A (en) | 2018-07-24 |
KR101999813B1 true KR101999813B1 (en) | 2019-07-15 |
Family
ID=63059270
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020170006042A KR101999813B1 (en) | 2017-01-13 | 2017-01-13 | Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101999813B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102494431B1 (en) * | 2020-12-03 | 2023-02-06 | 주식회사 바이오티엔에스 | Composition for detecting cephalopod |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101151747B1 (en) * | 2009-07-17 | 2012-06-15 | (주)지노첵 | Identifying Method of Marine Species, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same |
KR101196640B1 (en) * | 2009-10-20 | 2012-11-02 | (주)지노첵 | Identifying Method of origin and species about squids, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same |
KR20150052998A (en) * | 2013-11-07 | 2015-05-15 | 윤병수 | Rapid diagnostic method of deformed wing virus by using ultra-fast pcr system |
-
2017
- 2017-01-13 KR KR1020170006042A patent/KR101999813B1/en active IP Right Grant
Non-Patent Citations (4)
Title |
---|
GENBANK ACCESSION NO. KF489433.1 |
JIAN YE ET AL. MOLECULAR AND CELLULAR PROBES, VOL. 30, PP. 22_29, 2016* |
RUBIN CHENG ET AL. MOL BIOL REP, VOL.39, PP. 3461_3470, 2012* |
황희주 등. 한국패류학회지 제32권 제1호 55_62면, 2016* |
Also Published As
Publication number | Publication date |
---|---|
KR20180083988A (en) | 2018-07-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101775219B1 (en) | Probe for identifying sea bream species and tilapia species and identifying method using the same | |
Chen et al. | Differentiation of fish species in Taiwan Strait by PCR-RFLP and lab-on-a-chip system | |
Liu et al. | Rapid identification and differentiation of Theileria sergenti and Theileria sinensis using a loop-mediated isothermal amplification (LAMP) assay | |
Safa et al. | Rapid identification of Echinococcus granulosus and E. canadensis using high-resolution melting (HRM) analysis by focusing on a single nucleotide polymorphism | |
KR101999813B1 (en) | Sets of primers of Ultra-Fast PCR-based assay for discriminating Two skin webfoot octopus from One skin webfoot octopus, Long arm octopus and Japanese flying squid, or method of discriminating species using thereof | |
JP2019062815A (en) | Primer set for amplifying fragment of insect-derived dna, and method for identifying insect type using the same | |
Yu et al. | Rapid identification of Bactrocera latifrons (Dipt., Tephritidae) by real‐time PCR using SYBR Green chemistry | |
KR101999815B1 (en) | Sets of primers of Ultra-Fast PCR-based assay for discriminating red horsehead from yellow horsehead, or method of discriminating species using thereof | |
JP6413122B2 (en) | Mushroom identification method and identification kit | |
JP5566018B2 (en) | Crab detection primer set | |
EP3241909A1 (en) | Pcr-rflp-based method for identifying, and determining the purity of piscirickettsia salmonis | |
JP2007174973A (en) | Method for variety identification by multiplex pcr using ssr primer | |
KR101918124B1 (en) | Primer set for determining identity of crap material in food, method of determining identity of crap material in food using the same and kit comprising the same | |
KR101953574B1 (en) | Identifying method of squid species using dual labeled probe and fluorescence melting curve analysis | |
Yarmohammadi et al. | Identification of bester hybrids (female Huso huso Linnaeus, 1758 and male sterlet Acipenser ruthenus Linnaeus, 1758) using AFLP molecular technique | |
Mackie et al. | Experimental parameters affecting quantitative PCR of Artemia franciscana: a model for a marine zooplanktonic target in natural plankton samples | |
Hürkan | Distinguishing the Protected Designation of Origin Apricot (Prunus armeniaca L. cv. Şalak) from Closely Related Cultivars by High Resolution Melting | |
Gagnaire et al. | RFLP and semi‐multiplex PCR‐based identification of four eel species from the south‐western Indian Ocean region | |
CN107988380B (en) | Method for inter-species molecular identification of Mytilus edulis, Mytilus coruscus and perna viridis | |
KR20160110593A (en) | PCR primer set for classification among Red spotted grouper, Longtooth grouper and Sevenband grouper, and method for classification using the same | |
Liu et al. | Development of a rapid assay to detect the jellyfish Cyanea nozakii using a loop-mediated isothermal amplification method | |
JP6661963B2 (en) | How to detect staphylococci | |
EP3245297B1 (en) | Method and kit for identification of nematodes, forest plant pests, by real-time pcr | |
CN112592982B (en) | Primer, method and kit for identifying tuna mausu based on SNP molecular marker | |
CN112458184B (en) | Primer, method and kit for identifying tuna bluefin based on SNP marker |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E90F | Notification of reason for final refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |