KR20130139439A - Novel mannosidase derived from microbial in intestinal of blacksoldier fly - Google Patents
Novel mannosidase derived from microbial in intestinal of blacksoldier fly Download PDFInfo
- Publication number
- KR20130139439A KR20130139439A KR1020120060434A KR20120060434A KR20130139439A KR 20130139439 A KR20130139439 A KR 20130139439A KR 1020120060434 A KR1020120060434 A KR 1020120060434A KR 20120060434 A KR20120060434 A KR 20120060434A KR 20130139439 A KR20130139439 A KR 20130139439A
- Authority
- KR
- South Korea
- Prior art keywords
- mannosidase
- gly
- leu
- asp
- lys
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2477—Hemicellulases not provided in a preceding group
- C12N9/2488—Mannanases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Abstract
Description
본 발명은 동애등에(Blacksoldier fly: BSF) 장 내 미생물 유래의 신규 만노시다제, 상기 만노시다제 유전자, 상기 유전자를 포함하는 재조합벡터, 상기 재조합벡터로 형질전환된 형질전환체에 관한 것이다.The present invention relates to a novel mannosidase derived from a microorganism in the intestine of Blacksoldier fly (BSF), the mannosidase gene, a recombinant vector comprising the gene, and a transformant transformed with the recombinant vector.
식물의 세포벽은 주로 셀룰로오스, 헤미셀룰로오스나 펙틴 등의 다당류, 효모는 글루칸, 만난-단백질 복합체와 키틴, 곰팡이는 글루칸, 셀룰로오스, 키틴, 키토산 등으로 이루어지고 있다. 그래서 이들을 분해하는 베타-글루카나아제(베타-glucanase), 만나아제(mannase), 키티나아제(chitinase), 프로테아제(protease) 등의 활성을 갖는 효소를 세포벽 용해효소라고 부른다. 만나아제는 베타-D-만노시드를 비환원 말단에서 가수분해하여 만노오스를 유리하는 엑소형 효소이다. 베타-만노시다제는 종래, 베타-D-만난(mannan)의 비환원 말단으로부터 만노스(mannose) 단위로 가수분해되는 효소로서 알려져 있다. 분자 내에 베타-만노시도 결합을 가지는 저분자, 베타-D-만난(mannan), 글루코만난(glucomannan), 갈락토 만난(galacto mannan), 갈락토 글루코만난(galacto glucomannan))에 작용하고, 비환원 말단 부위로부터 순차적으로 가수분해하여 만노스(mannose)를 생성한다. 이는 동물, 식물, 미생물에서 발견되고 있다. Asp. niger 유래의 효소는 최적 pH 3.5, 분자량은 130,000으로 폴리펩티드 사슬의 80%는 베타-sheat 구조를 갖는다.The cell wall of the plant is mainly composed of polysaccharides such as cellulose, hemicellulose and pectin, yeast for glucan, met-protein complexes and chitin, and mold for glucan, cellulose, chitin and chitosan. Therefore, enzymes having activities such as beta-glucanase, beta-glucanase, mannase, chitinase, and protease that degrade these are called cell wall lytic enzymes. Mannases are exo-type enzymes that hydrolyze beta-D-mannose at the non-reducing end to release mannose. Beta-mannosidase is conventionally known as an enzyme that hydrolyzes in mannose units from the non-reducing end of beta-D-mannan. It acts on small molecules, beta-D-mannan, glucomannan, galacto mannan, galacto glucomannan, which have beta-mannosido bonds in the molecule, and non-reducing terminal sites. Hydrolysis from the sequential to produce mannose. It is found in animals, plants and microorganisms. Asp. Niger-derived enzyme had an optimal pH of 3.5 and a molecular weight of 130,000, with 80% of the polypeptide chains having a beta-sheat structure.
또 곤약 만난(konjak mannan) 중의 베타-1,4 결합을 엔도형으로 분해하는 효소로서는 엔도-1, 4-베타-D-만나아제(endo-1,4-베타-D-mannase. EC 3.2.1.78)가 있다. 또한 효모 세포벽 만난 중의 알파-1, 2-만노시도 결합, 알파-1,3-만노시드 결합을 가수분해하는 효소로서는 엑소-1,2-1,3-만노시다아제(EC 3.2.1. 77)가 있다.
In addition, as enzymes that break down beta-1,4 bonds in konjak mannan into endo forms, endo-1,4-beta-D-manase (endo-1,4-beta-D-mannase.EC 3.2. 1.78). Let us also as alpha-1,2-man-shi FIG enzyme that hydrolyzes the bond, the alpha-1,3 linkage of the manno met yeast cell wall manno exo -1,2-1,3- kinase (EC 3.2.1. 77).
동물, 식물, 미생물 등에 기원을 가지는 종래 제안된 베타-만노시다제는, 공업에 대규모로 이용하기에는 그 효소의 생산성이 낮고, 그 제법, 정제법도 복잡하므로 실용화하기에는 여전히 한계가 있었다. 따라서, 제조·정제가 용이하고, 게다가 높은 안정성을 가지는 이런 종류의 효소를 새롭게 개발하는 것은, 전분(starch)과 동시에 천연계에 대량으로 존재하는 재생 이용 가능한 베타-만난(mannan)을 분해하고, 분해 생성물(만노스(mannose), 갈락토오스(galactose), 글루코스(glucose) 등)을 회수·이용하는 점에서 의의를 갖는다.
Beta-mannosidase, which has a origin in animals, plants, microorganisms, and the like, has a limited productivity for its use because of its low productivity, its preparation, and its purification method. Therefore, newly developing this kind of enzyme which is easy to manufacture and purify, and which has high stability, can decompose and degrade beta-mannan, which is a starch and a regenerating beta-mannan present in nature in large quantities. It is significant in terms of recovering and using a product (mannose, galactose, glucose, etc.).
본 발명은 동애등에 장 내 미생물 유래의 신규 만노시다제, 상기 만노시다제를 코딩하는 유전자, 상기 유전자를 포함하는 재조합벡터, 상기 재조합벡터로 형질전환된 형질전환체를 제공하는 것이다.The present invention provides a new mannosidase derived from intestinal microorganisms, a gene encoding the mannosidase, a recombinant vector comprising the gene, and a transformant transformed with the recombinant vector.
본 발명은 서열번호 3의 아미노산서열로 표시되는 만노시다제 단백질, 서열번호 4의 아미노산서열로 표시되는 만노시다제 단백질을 제공한다. The present invention provides a mannosidase protein represented by an amino acid sequence of SEQ ID NO: 3, a mannosidase protein represented by an amino acid sequence of SEQ ID NO: 4.
또한, 본 발명은 서열번호 1의 핵산서열로 표시되는 만노시다제 유전자, 서열번호 2의 핵산서열로 표시되는 만노시다제 유전자를 제공한다.The present invention also provides a mannosidase gene represented by the nucleic acid sequence of SEQ ID NO: 1, a mannosidase gene represented by the nucleic acid sequence of SEQ ID NO: 2.
또한, 본 발명은 서열번호 1의 유전자를 포함하는 재조합 벡터, 서열번호 2의 유전자를 포함하는 재조합 벡터를 제공한다. The present invention also provides a recombinant vector comprising the gene of SEQ ID NO: 1, a recombinant vector comprising the gene of SEQ ID NO: 2.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 형질전환체를 제공한다. The present invention also provides a transformant transformed with the recombinant vector.
본 발명은 동애등에 장 내 미생물 유래의 메타게놈 유전자은행으로부터 종래의 기술로 배양하기 힘든 동애등에 장 내 미생물 유래의 신규 만노시다제 유전자를 발현할 경우에 수용성 베타-만노시다제 효소의 생산성이 탁월하여 대량생산이 가능하며, 일부는 배양액으로 분비되는 특성이 있으므로 농업, 식품, 바이오 연료 등의 다양한 분야에서 상업적인 용도로 활용이 가능하다.The present invention is excellent in the productivity of water-soluble beta-mannosidase enzymes when expressing a novel mannosidase gene derived from intestinal microorganisms from Dongae et al. It can be mass-produced, and some of them have a characteristic of being secreted into the culture solution, which can be used for commercial purposes in various fields such as agriculture, food, and biofuels.
도 1은 DDML5 만노시다제의 아미노산 핵산서열과 BlastP 검색에서 유의성을 가진 것으로 보인 만노시다제 계열 효소들과의 계통분석를 나타낸 것이다. 각 branch에 있는 숫자는 Bootstrap 분석치(1,000 resampling)이다(Bar, 0.2 substitutions per amino acid position).
도 2는 단백질 과발현용 신규 베타만노시다제의 재조합 플라스미드(pEML5과 pEMD5)의 제작도를 나타낸다.
도 3(A)는 pEM5과 pEMD5의 대장균에서의 이종 대량발현 및 정제 결과 46 kDa의 목적단백질인 베타 만노시다제가 과다 발현된 것을 나타낸 것이다. 도 3(B)는 시그날펩타이드가 제거된 pEMD5의 세포외 발현(배지내 분비)을 확인한 것이다.
도 4는 pEMD5 발현 베타 글루코시다제의 최적 온도 및 pH 분석을 나타낸 것이다.
도 5(A)는 pEMD5 발현 DDMD5베타 만노시다제의 기질특이성을 나타낸 것이고, 도 5(B)는 금속이온, 유기용매, 여러 케미칼에 대한 pNPG 분해활성을 나타낸 것이다.
도 6은 pEMD5의 단백질 발현 및 Ni-NTA affinity 칼럼에 의한 신규 베타 만노시다제 정제, 효소활성 및 생산성 분석 (LB배지 배양액 250ml 기준)을 나타낸 것이다.Figure 1 shows the phylogenetic analysis of amino acid nucleic acid sequence of DDML5 mannosidase and mannosidase family enzymes that appeared to have significance in BlastP search. The number in each branch is the Bootstrap assay (1,000 resampling) (Bar, 0.2 substitutions per amino acid position).
Figure 2 shows the preparation of recombinant plasmids (pEML5 and pEMD5) of novel beta-mannosidase for protein overexpression.
3 (A) shows that overexpression of beta mannosidase, a target protein of 46 kDa, as a result of large-scale heterogeneous expression and purification of pEM5 and pEMD5 in E. coli. Figure 3 (B) confirms the extracellular expression (secretion in the medium) of pEMD5 from which the signal peptide is removed.
4 shows the optimal temperature and pH analysis of pEMD5 expressing beta glucosidase.
Figure 5 (A) shows the substrate specificity of pEMD5 expressing DDMD5 beta mannosidase, Figure 5 (B) shows the pNPG degradation activity for metal ions, organic solvents, and various chemicals.
Figure 6 shows the protein expression of pEMD5 and novel beta mannosidase purification by Ni-NTA affinity column, enzyme activity and productivity analysis (based on 250 ml LB medium).
본 발명은 동애등에 장 내 미생물 유래의 만노시다제 단백질을 코딩하는 유전자에 관한 것이다. 본 발명의 유전자는 만노시다제 단백질을 코딩하는 게놈DNA와 cDNA를 모두 포함한다. 본 발명의 유전자는 서열번호 1로 표시되는 핵산서열을 포함할 수 있다. 본 발명에 따른 만노시다제 유전자는 총 1278bp의 뉴클레오티드를 포함하며, 총 426개의 아미노산을 코딩하고 있다. 또한 본 발명에 따른 만노시다제 코딩 유전자의 아미노산 서열을 기존의 유전자 데이터베이스 및 BlastP를 검색한 결과, 본 발명의 유전자는 기존의 보고된 만노시다제와 아미노산 수준에서 최대 61%의 상동성을 보여 신규 유전자로 밝혀졌다. 이 유전자를 'DDML5'이라 명명하였다.The present invention relates to a gene encoding a mannosidase protein derived from intestinal microorganisms in Dongae et al. The gene of the present invention includes both genomic DNA and cDNA encoding mannosidase protein. The gene of the present invention may include a nucleic acid sequence represented by SEQ ID NO: 1. The mannosidase gene according to the present invention comprises a total of 1278 bp and encodes a total of 426 amino acids. In addition, as a result of searching the existing gene database and BlastP for the amino acid sequence of the mannosidase coding gene according to the present invention, the gene of the present invention shows homology of up to 61% at the amino acid level with the existing reported mannosidase. Turned out to be a gene. This gene was named 'DDML5'.
또한, 상기 핵산서열의 변이체가 본 발명의 범위 내에 포함된다. 구체적으로 상기 유전자는 서열번호 1의 핵산서열과 각각 70%이상, 80%이상, 90% 이상, 95% 이상의 서열 상동성을 가지는 핵산서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 “서열 상동성의 %”는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
In addition, variants of the nucleic acid sequences are included within the scope of the present invention. Specifically, the gene may include a nucleic acid sequence having a sequence homology of 70% or more, 80% or more, 90% or more, 95% or more with the nucleic acid sequence of SEQ ID NO: 1, respectively. The “% sequence homology” for a polynucleotide is determined by comparing the two optimally arranged sequences with the comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
또한, 본 발명은 동애등에 장 내 미생물 유래의 만노시다제 단백질을 코딩하는 유전자를 제공한다. 본 발명의 유전자는 만노시다제 단백질을 코딩하는 게놈DNA와 cDNA를 모두 포함한다. 본 발명의 유전자는 서열번호 2로 표시되는 핵산서열을 포함할 수 있다. 본 발명에 따른 만노시다제 유전자는 이 효소의 N말단부 26개의 아미노산으로 이루어진 signal peptide를 코딩하는 부분을 제거한 총 1200bp의 뉴클레오티드로 구성되어 있으며, 총 400개의 아미노산을 코딩하고 있다. 이 유전자를 'DDMD5'이라고 명명하였다.The present invention also provides a gene encoding a mannosidase protein derived from intestinal microorganisms in Dongae et al. The gene of the present invention includes both genomic DNA and cDNA encoding mannosidase protein. The gene of the present invention may include a nucleic acid sequence represented by SEQ ID NO: 2. The mannosidase gene according to the present invention is composed of a total of 1200 nucleotides nucleotides removed from the N-terminal portion of the enzyme encoding a signal peptide consisting of 26 amino acids, and encodes a total of 400 amino acids. This gene was named 'DDMD5'.
또한 상기 핵산서열의 변이체가 본 발명의 범위 내에 포함된다. 구체적으로 상기 유전자는 서열번호 2의 핵산서열과 각각 70%이상, 80%이상, 90% 이상, 95% 이상의 서열 상동성을 가지는 핵산서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 “서열 상동성의 %”는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다. Variants of the nucleic acid sequences are also included within the scope of the present invention. Specifically, the gene may include a nucleic acid sequence having a sequence homology of at least 70%, at least 80%, at least 90%, or at least 95% with the nucleic acid sequence of SEQ ID NO: 2. The “% sequence homology” for a polynucleotide is determined by comparing the two optimally arranged sequences with the comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
하기 표 1은 서열번호 1 및 2에 관한 것이다.Table 1 below relates to SEQ ID NOs: 1 and 2.
[표 1][Table 1]
또한, 본 발명은 동애등에 장 내 미생물 유래의 만노시다제 단백질을 제공한다. 상기 동애등에 장 내 미생물 유래의 만노시다제 단백질은 서열번호 3의 아미노산 서열을 포함한다. 본 발명에 따른 만노시다제 단백질의 범위는 서열번호3으로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. In addition, the present invention provides a mannosidase protein derived from intestinal microorganisms in Dongae et al. The mannosidase protein derived from intestinal microorganisms in Dongae et al. Comprises the amino acid sequence of SEQ ID NO. The range of mannosidase proteins according to the present invention includes proteins having the amino acid sequence represented by SEQ ID NO: 3 and functional equivalents of such proteins.
상기 “기능적 동등물”이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 3로 표시되는 아미노산 서열과 적어도 50%이상, 70%이상, 90% 이상의 서열 상동성을 갖는 것으로, 서열번호 3로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. “실질적으로 동질의 생리활성”이란 생물체 내에서 가수분해 능이 우수한 만노시다제의 활성을 의미한다.
The "functional equivalent" is a sequence homology of at least 50%, 70%, 90% or more of the amino acid sequence represented by SEQ ID NO: 3 as a result of the addition, substitution, or deletion of amino acids. Refers to a protein that exhibits substantially the same physiological activity as the displayed protein. "Substantially homogeneous physiological activity" refers to the activity of mannosidase with excellent hydrolytic ability in living organisms.
또한, 본 발명은 동애등에 장 내 미생물 유래의 만노시다제 단백질을 제공한다. 상기 동애등에 장 내 미생물 유래의 만노시다제 단백질은 서열번호 4의 아미노산 서열을 포함한다. 본 발명에 따른 만노시다제 단백질의 범위는 서열번호 4으로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. 이는 서열번호 3의 만노시다제를 코딩하는 것으로 추정되는 유전자에서 세포외 분비와 관련하는 singnal peptide를 코딩하는 하는 부분을 제거하여 총400개의 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다.In addition, the present invention provides a mannosidase protein derived from intestinal microorganisms in Dongae et al. The mannosidase protein derived from intestinal microorganisms in Dongae et al. Comprises the amino acid sequence of SEQ ID NO. The range of mannosidase proteins according to the present invention includes proteins having the amino acid sequence represented by SEQ ID NO: 4 and functional equivalents of such proteins. This includes a protein having a total of 400 amino acid sequences and a functional equivalent of the protein by removing a portion encoding a singnal peptide associated with extracellular secretion in a gene that is supposed to encode a mannose oxidase of SEQ ID NO: 3 .
상기 “기능적 동등물”이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 4로 표시되는 아미노산 서열과 적어도 50%이상, 70%이상, 90% 이상의 서열 상동성을 갖는 것으로, 서열번호 4로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. “실질적으로 동질의 생리활성”이란 생물체 내에서 가수분해 능이 우수한 만노시다제의 활성을 의미한다.The term "functional equivalent" has at least 50%, 70%, 90% or more sequence homology with the amino acid sequence represented by SEQ ID NO: 4 as a result of the addition, substitution, or deletion of the amino acid. Refers to a protein that exhibits substantially the same physiological activity as the displayed protein. "Substantially homogeneous physiological activity" refers to the activity of mannosidase with excellent hydrolytic ability in living organisms.
하기 표 2는 서열번호 3 및 4에 관한 것이다.Table 2 below relates to SEQ ID NOs: 3 and 4.
[표 2][Table 2]
또한, 본 발명은 동애등에 장 내 미생물 유래의 만노시다제 유전자를 포함하는 재조합 벡터를 제공한다. 상기 재조합 벡터는 대장균 발현 벡터 또는 효모 발현 벡터일 수 있으나, 이제 제한되지 않는다. 대장균 발현 벡터로는 pET21a 벡터를 예로 들 수 있으며, 효모 발현 벡터로는 pKBN-IFN벡터를 예로 들 수 있으나, 이에 제한되지 않는다. 본 발명은 DDML5유전자를 단백질 발현벡터인 pET21a에 클로닝하여 재조합 벡터 pEM5을 제조하였다. 또한 본 발명은 DDMD5유전자를 단백질 발현 벡터인 pET21a에 클로닝하여 재조합 벡터 pEMD5을 제조하였다.
The present invention also provides a recombinant vector comprising a mannosidase gene derived from intestinal microorganisms in Dongae et al. The recombinant vector may be an E. coli expression vector or a yeast expression vector, but is not limited thereto. As an E. coli expression vector, pET21a vector may be exemplified. As a yeast expression vector, pKBN-IFN vector may be exemplified, but is not limited thereto. The present invention cloned the DDML5 gene into pET21a, a protein expression vector, to prepare a recombinant vector pEM5. The present invention also cloned the DDMD5 gene into pET21a, a protein expression vector, to prepare a recombinant vector pEMD5.
용어 “재조합”은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 코딩된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내로 재도입된 것이다.
The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their native form. Recombinant cells can also express genes found in natural cells, but the genes have been modified and reintroduced into cells by artificial means.
용어 ”벡터”는 세포 내로 전달하는 DNA단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 용어 “전달체”는 흔히 “벡터”와 호환하여 사용된다. 용어 “발현벡터”는 목적한 코딩 서열과, 특정 숙주 생물에서 작동 가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다.
The term “vector” is used to refer to a DNA fragment (s), a nucleic acid molecule, that is delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells. The term “carrier” is often used interchangeably with “vector”. The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism.
본 발명의 유전자는 전형적으로 클로닝 또는 단백질발현을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 예를 들어, 본 발명에 이용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드(예를 들면, pSC101, ColE1,pBR322, pUC8/9, pHC79, pGEX 시리즈, pET 시리즈 및 pUC19 등), 파지(예를 들면, λgt4.λB, λ-Charon및 M13 등) 또는 바이러스(예를 들면, SV40 등)를 조작하여 제작될 수 있다. 한편, 본 발명의 유전자가 식물에 최적화된 코돈으로 전환하여, 식물 세포를 숙주로 하는 경우에는 당 업계에서 통용적으로 사용되는 벡터(예를 들면, pBI vectors, pCAMBIA vectors, pSB vectors)를 조작하여 제작될 수 있다.
The genes of the invention can typically be constructed as vectors for cloning or protein expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. For example, vectors that can be used in the present invention include plasmids (eg, pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series and pUC19, etc.) that are often used in the art, For example, it can be produced by manipulating [lambda] gt4. [Lambda] B, [lambda] -Charon, M13, etc.) or a virus (for example, SV40, etc.). Meanwhile, when the gene of the present invention is converted into a plant optimized codon, and a plant cell is used as a host, vectors (eg, pBI vectors, pCAMBIA vectors, and pSB vectors) commonly used in the art are manipulated. Can be made.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 형질전환체를 제공한다. 본 발명의 벡터를 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주 세포는 당 업계에 공지된 어떠한 숙주세포도 이용할 수 있으며, 예를 들면 E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, 바실러스 서브틸리스(Bacillus subtilis), 바실러스 츄런겐시스(Bacillus thuringiensis) 와 같은 바실러스 속 균주, 그리고 살모낼라 티피무리움(Samonella typhimurium), 세라티아 마르세슨스(Serratia marcescens) 및 다양한 슈도모나스 종과 같은 장내균과 균주 등이 있다. 상기 숙주세포는 바람직하게는 대장균이다. The present invention also provides a transformant transformed with the recombinant vector. The host cell capable of continuously cloning and expressing the vector of the present invention in a stable manner may be any host cell known in the art, for example, E. coli JM109, E. coli BL21, E. coli RR1, E coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus sp. Enterobacteria and strains such as Samonella typhimurium, Serratia marcescens and various Pseudomonas species. The host cell is preferably Escherichia coli.
또한, 본 발명의 벡터를 진핵 세포에 형질전환시키는 경우에는 숙주세포로서 효모, 곤충세포, 사람세포 (예컨대, CHO(Chinese hamster ovary) 세포주, W138, BHK, COS-7, 293, HepG2, 3T3, RIN 및 MDCK 세포주) 식물세포 등이 이용될 수 있으며, 사카로마이세스 세레비지애(Saccharomyce cerevisiae)일 수 있다.
In addition, when transforming a vector of the present invention into eukaryotic cells, yeast, insect cells, and human cells (e.g., CHO (Chinese hamster ovary) cell lines, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines) plant cells and the like can be used, and may be Saccharomyce cerevisiae.
본 발명의 벡터를 숙주세포 내로 운반하는 방법은, 숙주 세포가 원핵 세포인 경우, CaC 방법(Cohen, S.N. et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), 하나한 방법(Hanahan, D., J. Mol. Biol., 166:557580(1983)) 및 전기천공 방법(Dower, W.J. et al., Nucleic. Acids Res., 16:6127-6145(1988)) 등에 의해 실시 될 수 있다. 또한, 숙주세포가 진핵세포인 경우에는, 미세주입법(Capecchi, M.R., Cell, 22:479(1980)), 칼슘 포스페이트 침전법 (Graham, F.L. et al., Virology, 52:456(1973)), 전기천공법(Neumann, E. et al., EMBO J., 1:841(1982)), 리포좀-매개 형질감염법(Wong, T.K. et al., Gene, 10:87(1980)), DEAE-텍스트란 처리법 (Gopal, Mol. Cell Biol., 5:1188-1190(1985)), 및 유전자 밤바드먼트(Yang et al., Proc.Natl. Acad. Sci.,87.9568-9572(1990))등에 의해 벡터를 숙주세포 내로 주입할 수 있다.
The method of transporting the vector of the present invention into a host cell may include the CaC method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973)) when the host cell is a prokaryotic cell. , Hanahan (D., J. Mol. Biol., 166: 557580 (1983)) and electroporation (Dower, WJ et al., Nucleic. Acids Res., 16: 6127-6145 (1988) It may be carried out by). In addition, when the host cell is a eukaryotic cell, microinjection method (Capecchi, MR, Cell, 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et al., Virology, 52: 456 (1973)), Electroporation (Neumann, E. et al., EMBO J., 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87 (1980)), DEAE- Text field treatment (Gopal, Mol. Cell Biol., 5: 1188-1190 (1985)), and gene balm (Yang et al., Proc. Natl. Acad. Sci., 87.9568-9572 (1990)). The vector can be injected into the host cell.
상기 형질전환체를 이용하여 재조합 베타 글루코시다아제를 생산할 수 있으며, 그 방법은 형질전환체를 공지된 기술을 이용하여 재조합 단백질의 생산에 적합한 배지에서 배양한다. 예를 들어, 세포들은 적합한 배지와 단백질이 발현 또는 분리되는 것을 허용하는 조건 하에 실시된 실험실 또는 산업용 발효기에서 소규모 또는 대규모 발효, 쉐이크 플라스크 배양에 의해서 배양될 수 있다. 배양은 공지기술을 사용하여 탄소,질소원 및 무기염을 포함하는 적합한 배지에서 일어난다. 적합한 배지는 상업적으로 입수하거나 예를 들면, American Type Culture Collection의 카탈로그와 같은 간행물에 기재된 성분 및 조성비에 따라 제조할 수 있다. The transformant can be used to produce recombinant beta glucosidase, the method culturing the transformant in a medium suitable for the production of the recombinant protein using known techniques. For example, the cells can be cultured by small or large scale fermentation, shake flask culture in a laboratory or industrial fermentor carried out under conditions that allow for the expression or isolation of the appropriate medium and protein. Cultivation takes place in a suitable medium containing carbon, nitrogen sources and inorganic salts using known techniques. Suitable media can be obtained commercially or according to the components and compositional ratios described in publications such as, for example, the catalog of the American Type Culture Collection.
상기 베타-만노시다제는 목적 유전자에 의해 발현된 단백질을 당 업계에 공지된 단백질 분리방법을 이용하여 회수할 수 있다. 예를 들어 단백질은 원심분리, 초음파파쇄, 여과, 추출, 분무 건조, 증발 또는 침전을 포함하는 통상적인 방법에 의해서 영양배지로부터 분리될 수 있지만, 이에 제한되는 것은 아니다. 더 나아가 단백질은 크로마토그래피(예를 들면 이온 교환, 친화성, 소수성 및 크기별 배제), 전기영동, 분별염석(예를 들면 암모늄 설페이트 침전), SDS-PAGE 또는 추출을 포함하여 공지된 다양한 방법을 통해서 정제될 수 있다.
The beta-mannosidase can be recovered by using a protein isolation method known in the art for the protein expressed by the target gene. For example, proteins may be separated from nutrient media by conventional methods, including but not limited to centrifugation, sonication, filtration, extraction, spray drying, evaporation, or precipitation. Furthermore, proteins can be purified through a variety of known methods, including chromatography (e.g. ion exchange, affinity, hydrophobicity and size exclusion), electrophoresis, fractional salts (e.g. ammonium sulfate precipitation), SDS-PAGE or extraction. It can be purified.
이하, 본 발명을 실시 예에 의해 상세히 설명한다. 단,하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시 예에 한정되는 것은 아니다. Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely to illustrate the present invention, the content of the present invention is not limited to the following examples.
<< 실시예Example >>
1. One. 동애등에In love 메타게놈Meta genome 은행 구축 Bank building
동애등에의 유충은 국립농업과학원 곤충산업과에서 분양 받았다. 1,000여 마리 이상 유충으로부터 유충을 고정한 뒤 핀셋으로 장을 분리하였다. 분리한 장에서 장내 미생물을 분리하기 위하여 조직을 막자 사발에서 적절하게 파쇄한 뒤 percoll gradient 방식을 통하여 미생물을 분리하였다(Current Protocols in Molecular Biology, Cold Spring Harbor Laboratories Ed.). 분리한 동애등에 유충 장내 미생물로부터 메타게놈 라이브러리를 제작하기 위하여, 분리 정제한 전체 DNA를 1% Low-melting-point agarose gel에 CHEF DR-III전기영동 장치(Biorad사)에 6V/cm로 14℃, 120° 각도로 11초간 ramping 하여 13시간 전기영동하고 SybrGreen Gold Dye로 염색한 후 UV illuminator 상에서 확인하고 40 kb 이상의 DNA를 포함하는 agarose block 만을 자른 다음 agarase 효소를 넣어 1시간 동안 반응시킨 후 70℃에서 10분간 agarase를 비활성화 시켰다. 여기에 에탄올로 침전, 세척하여 순수한 DNA를 분리하여 준비하였다. Fosmid library 제작은 정제한 장내 미생물 DNA 25 μl (5 μg)에 5 unit의 T4 polymerase (Takara Co.)와 2 unit T4 polynucleotide kinase (Takara Co.) 그리고 6 units의 Klenow fragment (Takara Co.)를 가한 후 반응액량을 50 μl로 조절한 후 37℃에서 30분간 반응시켜 DNA 말단을 평활화하여 제작하였다. 반응이 끝난 후 동량의 phenol/chloroform/isoamylalcohol (25:24:1,v/v/v)을 첨가하여 섞은 다음 10분간 원심분리하고 상등액을 모아서 동량의 chloroform/isoamylalchohol (24:1, v/v)을 첨가하여 혼합한 후에 12,000 rpm에서 10분간 원심분리하여 상등액 만을 취하고 2.5배의 100% ethanol을 넣어 1시간 동안 상온에서 방치한 다음 원심분리하여 상등액은 버리고 70% 에탄올로 DNA를 세척하여 DNA를 준비하였다. EpiFOS fosmid vector (pCC1/2, Epicentre, USA)에 end-repaired DNA를 첨가하여 16℃에서 16시간 ligation 반응시켰다.Caterpillars to Dongae and others were distributed by the Insect Industry Division, National Academy of Agricultural Science. After the larvae were fixed from more than 1,000 larvae, the intestines were separated with tweezers. In order to separate the intestinal microorganisms from the separated intestine, the tissues were crushed in a bowl with a pestle, and the microorganisms were separated by a percoll gradient method (Current Protocols in Molecular Biology, Cold Spring Harbor Laboratories Ed.). To prepare a metagenome library from larvae intestinal microorganisms isolated from the larvae, 14 ° C at 6V / cm on a CHEF DR-III electrophoresis device (Biorad) on 1% low-melting-point agarose gel After electrophoresis for 13 hours by ramping at 120 ° for 11 seconds, stained with SybrGreen Gold Dye, confirmed on UV illuminator, cut only agarose block containing 40 kb or more of DNA, and reacted for 1 hour with agarase enzyme. Inactivated agarase for 10 minutes at. Precipitated with ethanol, washed and prepared by separating the pure DNA. Fosmid library was prepared by adding 5 units of T4 polymerase (Takara Co.), 2 units T4 polynucleotide kinase (Takara Co.), and 6 units of Klenow fragment (Takara Co.) to 25 μl (5 μg) of purified gut microbial DNA. After adjusting the amount of the reaction solution to 50 μl and reacted for 30 minutes at 37 ℃ was prepared by smoothing the DNA terminal. After the reaction is completed, add an equal amount of phenol / chloroform / isoamylalcohol (25: 24: 1, v / v / v), mix, and centrifuge for 10 minutes. ), Mix, and centrifuge at 12,000 rpm for 10 minutes to take only the supernatant, add 2.5
In vitro packaging을 위해 16℃에서 16시간 반응한 시료들을 70℃에서 10분간 열처리하여 ligase 효소를 불활성화시켰다. Ligation한 반응액 7.5 μl에 MAX lambda packaging extracts kit (Epicentre, USA)의 extracts 25 μl를 넣어 pipette을 사용해 공기방울이 생기지 않게 조심스레 섞어 준 다음 30℃에서 1시간 30분간 반응시켰다. 여기에 다시 extracts 25 μl를 넣어 pipette을 사용해 공기방울이 생기지 않게 조심스레 섞어 준 다음 30℃에서 1시간 30분간 반응시켜 in vitro packaging을 수행하였다. SM 완충용액을 1 ml 첨가하여 위아래로 잘 섞어 준 다음 여기에 25 μl의 chloroform을 넣어 다시 packaging 되지 않은 물질들을 불활성화 시켰다. 원심분리를 조심스럽게 하여 정치한 다음 4℃에 보관하였고 상등액을 대장균에 형질전환하여 library로 사용하였다. 대장균에 클로닝된 유전자 형태로 구축한 메타게놈 유전자은행은 LB-Chloramphenicol-glycerol 배지를 기본배지로 하여 384-well plate에 개별 클론으로 접종하여 메타게놈 유전자은행을 작성하고 -70℃에 장기 보존하였다.
In For in vitro packaging, the samples reacted at 16 ° C. for 16 hours were heat treated at 70 ° C. for 10 minutes to inactivate the ligase enzyme. 25 μl of the extract of MAX lambda packaging extracts kit (Epicentre, USA) was added to 7.5 μl of the ligated reaction solution and carefully mixed with a pipette to prevent air bubbles, and then reacted at 30 ° C. for 1 hour and 30 minutes. Add 25 μl of extracts to the mixture and carefully mix it with a pipette to prevent air bubbles, and then react at 30 ℃ for 1 hour and 30 minutes in vitro packaging. 1 ml of SM buffer was added and mixed well up and down, and then 25 μl of chloroform was added to inactivate unpackaged materials. After centrifugation was carefully carried out and stored at 4 ℃ and the supernatant was transformed into E. coli was used as a library. Metagenome gene bank constructed in the form of gene cloned in E. coli was inoculated in 384-well plate as individual clone using LB-Chloramphenicol-glycerol medium as a base medium, and the metagenome gene bank was prepared and stored for a long time at -70 ℃.
2. 2. 동애등에In love 메타게놈Meta genome 라이브러리에서 베타 Beta from the library 만노시다제Mannoshidase 유전자 선발 및 신규성 분석 Gene selection and novelty analysis
동애등에 장내 미생물 메타게놈 라이브러리로부터 셀루라아제 분해 클론을 선발하기 위해 선별 agar 배지(LB+0.5% carboxymethylcellulose)에서 28℃에서 5일간 배양하여 0.1% Congo red액에 10분간 염색시키고 이어서 1M NaCl로 수 차례 세척하여 콜로니 주변에 환이 생긴 즉 셀루라아제를 외부로 분비하는 클론을 선발하고 이로부터 Fosmid를 분리해 삽입단편을 확인하였다. 음성 반응 대조군으로 메타게놈 유전자은행을 구축한 대장균 숙주(host)에 fosmid 벡터만 들어간 것을 사용하여 동일한 조건에서 배양하여 background 시그널을 확인하였다.To select cellulase-degrading clones from the intestinal microbial metagenome library, Dongae et al. Incubated for 5 days at 28 ° C. in selective agar medium (LB + 0.5% carboxymethylcellulose) and stained with 0.1% Congo red solution for 10 minutes. After washing several times, a clone was formed around the colonies, that is, a clone that secreted cellulase to the outside was selected, and Fosmid was separated therefrom to confirm the insertion fragment. As a negative response control, the background signal was confirmed by culturing under the same conditions using only the fosmid vector in the E. coli host constructing the metagenome gene bank.
상기 1의 제작된 메타게놈을 당 분해효소 유전자를 가진 것으로 추정되는 DDHC3클론을 기질이용 선택배지로 최종 선발하였으며 이들에서 삽입 DNA단편(약 36kb)에 대한 염기서열 분석을 수행하였다. 양성을 보인 클론들에서 pUC-universal primer과 BigDye system을 사용하여 염기서열을 결정하여 분석하였다. Sequencing은 ABI BigDye-terminator (ver. 3.1)로 반응하였고, 사용한 PCR primer는 각 벡터에서 제공되는 5‘- 또는 3’-end universal primer를 사용하였다(EpiCentre, USA). Sequencing PCR 반응은 DNA 4μl, BigDye 0.5μl, primer 3pmol, 5XBuffer 1.75μl, Sterile water 3.45μl를 넣고 94℃, 4min→[96℃, 10sec→50℃, 6 sec→60℃, 4min] X 25 cycle→4℃, Hold 방식으로 수행하였다. Dye peak가 분명하게 분리되는 약 500bp partial sequence를 이용하여 GenBank(National Center for Biotechnology Information)의 BlastX 알고리즘을 사용하여 가장 유사성이 높은 유전자를 검색하였다. 전체 염기서열은 VectorNTI 프로그램을 통하여 contig으로 작성하여 가수분해 효소 역할을 수행하는 ORF를 검출하였다. 검출된 ORF는 GenBank의 BlastX 알고리즘으로 검색하여 기능을 추정하였다.DDHC3 clone, which is presumed to have the glycozyme gene, was selected as a substrate-use selective medium, and sequencing of the inserted DNA fragment (about 36 kb) was performed. Positive sequences were analyzed by pUC-universal primer and BigDye system. Sequencing was performed with ABI BigDye-terminator (ver. 3.1), and the PCR primers used were 5'- or 3'-end universal primers (EpiCentre, USA). For sequencing PCR reaction, add 4μl DNA, 0.5μl BigDye, 3pmol primer, 575 Buffer 1.75μl, and 3.45μl Sterile water. 94 ℃, 4min → [96 ℃, 10sec → 50 ℃, 6sec → 60 ℃, 4min]
이들 결과로부터 베타 만노시다제로 추정되는 1281bp의 전사해독프레임 ORF(Open Reading Frame)을 가지고 있는 것을 확인하였다. 이 전사해독 프레임을 DDML5라 명명하였다. 또한 GenBank의 BlastX 알고리즘으로 검색하여 기능을 추정하였다. 유연관계 분석은 Blast P검색을 사용하여 기존 보고된 베타 만노시다제의 아미노산 배열에서 본 발명의 만노시다제와 상동성이 높은 자료를 모으고 이를 MEGA 5.1과 ClustalX program으로 분석하였다. N-J법(neighbor-joining tree, NJ)으로 tree작성을 실시하여 비교하였으며, 분류군의 가지에 대한 Bootstrap 분석은 1,000회 반복법으로 실시하였다. 본 발명의 베타 만노시다제는 비교적 독립된 클러스트에 위치함을 보여준다(도 1). 따라서DDML5나 DDMD5만노시다제가 아미노산 수준에서 최대 61%의 상동성을 보여 기존의 보고된 만노시다제와는 다른 아직까지 전혀 알려지지 않은 미생물에서 유래한 신규한 만노시다제임을 보여준다.
From these results, it was confirmed that it has a transcription decoding frame ORF (Open Reading Frame) of 1281bp estimated to beta mannosidase. This transcription decoding frame was named DDML5. In addition, the function was estimated by searching with BlastX algorithm of GenBank. In the flexible relationship analysis, the Blast P search was used to collect data having high homology with the mannosidase of the present invention in the amino acid sequence of beta mannosidase, which was previously reported, and analyzed by MEGA 5.1 and ClustalX program. NJ method (neighbor-joining tree, NJ) was used to create a tree and to compare. Beta mannosidase of the present invention is shown to be located in a relatively independent cluster (Fig. 1). Thus, DDML5 or DDMD5 mannosidase shows up to 61% homology at the amino acid level, indicating that it is a novel mannosidase derived from a microorganism not yet known, which is different from the previously reported mannosidase.
3. 베타 3. Beta 만노시다제Mannoshidase 유전자의 과다발현을 위한 형질전환체의 제조 Preparation of transformant for overexpression of gene
본 발명의 베타-만노시다제를 발현하는데 있어서, 상기 2의 DDML5(핵산서열: 서열번호 1) 핵산서열에서 signal peptide가 포함된 원래 유전자 DDML5와 DDMD5의 N말단에서 signal peptide에 해당되는 26개의 아미노산이 결실된 DDMD5를 아래와 같이 프라이머를 디자인하여 중합효소 증폭반응을 통해 증폭하였다. 각각의 ORF만을 증폭하기 위하여 PCR primer를 제작하였고, fosmid/cosmid DNA를 template로 하여 HighPrime Taq polymerase(Takara, Japan)을 사용하여 PCR 반응을 수행하였다. 증폭된 산물은 각 ORF의 reading-frame에 따라 Hig-Tag을 가진 대장균 발현 벡터인 pET21a 에 frame 별로 directional in-fusion 하였다(In-Fusion cloning kit, Clone Tech, USA). PCR 증폭산물이 발현벡터에 적절하게 삽입된 것은 junction 부위의 염기서열을 결정하여 확인하였다.
In expressing the beta-mannosidase of the present invention, 26 amino acids corresponding to the signal peptide at the N-terminal of the original genes DDML5 and DDMD5 containing a signal peptide in the DDML5 nucleic acid sequence of 2 This deleted DDMD5 was amplified by polymerase amplification by designing a primer as follows. PCR primers were prepared to amplify each ORF only, and PCR reaction was performed using HighPrime Taq polymerase (Takara, Japan) using fosmid / cosmid DNA as a template. The amplified products were directional in-fusion frame by frame to pET21a, an E. coli expression vector with Hig-Tag, according to the reading-frame of each ORF (In-Fusion cloning kit, Clone Tech, USA). Insertion of the PCR amplification product into the expression vector was confirmed by determining the nucleotide sequence of the junction site.
<< PrimersPrimers usedused >>
*pEML5 ('With' the leader sequence, without TAA stop codon at the 3'-end)pEML5 ('With' the leader sequence, without TAA stop codon at the 3'-end)
Forward (BamHI site included); CGCGGATCCATGAAAAAACTGATTCTATTForward (BamHI site included); CGC GGATCC ATGAAAAAACTGATTCTATT
Reverse (XhoI site included) ; CCGCTCGAGTAGTTTTTGAGTATAGCTTT
Reverse (XhoI site included); CCG CTCGAG TAGTTTTTGAGTATAGCTTT
*pEMD5 ('Without' the leader sequence, without TAA stop codon at the 3'-end)pEMD5 ('Without' the leader sequence, without TAA stop codon at the 3'-end)
Forward (BamHI site included); CGCGGATCCTCTTTCGTAAAGCAGAAGGAForward (BamHI site included); CGC GGATCC TCTTTCGTAAAGCAGAAGGA
Reverse (XhoI site included) ; CCGCTCGAGTAGTTTTTGAGTATAGCTTT
Reverse (XhoI site included); CCG CTCGAG TAGTTTTTGAGTATAGCTTT
추정되는 Protein size : pEML5 48kDa, pEMD5 46kDa
Presumed Protein size: pEML5 48kDa, pEMD5 46kDa
증폭된 단편들을 제한효소 BamH I과 Xho I으로 절단한 후, 이와 동일한 효소로 절단된 pET21a벡터에 삽입, DDML5과 DDMD5의 ORF(Open Reading Frame)를 pET21a(Novagene, USA)에 각각 클로닝하여 E. coli DH5알파의 competent cell에 형질전환하여 엠피실린이 함유된 배지(100ug/ml)에서 선발하고 이로부터 재조합 플라스미드(pEML5 과 pEMD5)를 분리하였다. 이 플라스미드는 단백질과 발현 숙주세포인 E. coli BL21(DE3)에 재형질전환하고 이를 한국농용미생물센타에 기탁하여(2012. 5. 10일) KACC95116P(pEMD5)와 KACC95117P(pEML5)의 기탁번호를 부여 받았다. 이 균주는 베타 만노시다아제의 대량 발현 및 정제를 위한 균주로 사용하였다.
Amplified Fragments Restriction Enzyme BamH I and Xho After digestion with I, the enzyme was inserted into the pET21a vector digested with the same enzyme. The ORF (Open Reading Frame) of DDML5 and DDMD5 was cloned into pET21a (Novagene, USA) and transformed into competent cells of E. coli DH5 alpha. Empicillin-containing medium (100ug / ml) was selected and recombinant plasmids (pEML5 and pEMD5) were separated therefrom. The plasmid was retransformed into E. coli BL21 (DE3), a protein and expression host cell, and deposited in the Korea Agricultural Microorganism Center (May 10, 2012) to obtain the access numbers of KACC95116P (pEMD5) and KACC95117P (pEML5). Granted. This strain was used as a strain for mass expression and purification of beta mannosidase.
4. 4. 재조합단백질(신규 베타-만노시다제)의Of recombinant protein (new beta-mannosidase) 발현 및 정제 Expression and purification
pEML5 및 pEMD5를 형질전환 시킨 KACC95116P(pEMD5)와 KACC95117P(pEML5)를 250ml LB(Luria-Bertani, Gibco-BRL사) 액체 배지에 ampicillin(100 μg/mL)과 함께 접종하여, OD600nm값 0.6에서 0.5 mM IPTG(이소프로필-B-D-티오갈락토피라노시드)를 첨가하여 37℃에서 4시간 동안 발현시킨 다음, 6,000 rpm, 10분간 원심분리후 cell pellet을 회수하였다. 여기서 효소가 균체 외로 분비되는가를 보기 위해 균체가 제거된 배양액은 암모늄설페이트 분말을 포화되도록(700g/리터) 서서히 실온에서 첨가하여 혼합해주었다. 포화된 용액은 원심분리하여(6,000rpm, 10분) 그 침전물을 멸균증류수로 5ml 녹인 뒤 투석막(분자량 6,000 cut-off, 스펙트럼사)에 넣고 증류수로 여러 차례 투석하고 그것을 활성 분석 또는 SDS-PAGE의 시료로 사용하였다. 원심분리로 세포침전물을 제거한 cell lysate를 nickel-nitrotriacetic acid (Ni-NTA) agarose resin(Qiagen, Germany)에 binding 시킨 후, 동일한 완충액으로 2회 세척 하고, 100~250mM imidazole 함유 elution buffer로 6His-tagged protein을 용출하였다. 용출한 단백질은 dialysis buffer [20 mM Tris-HCl, pH 7.5]로 충분히 투석하여 사용하였다.KACC95116P (pEMD5) and KACC95117P (pEML5) transformed with pEML5 and pEMD5 were inoculated with 250 ml LB (Luria-Bertani, Gibco-BRL) liquid medium with ampicillin (100 μg / mL), 0.5 mM at an OD600 nm of 0.6. IPTG (isopropyl-BD-thiogalactopyranoside) was added and expressed at 37 ° C. for 4 hours, and then cell pellet was recovered after centrifugation at 6,000 rpm for 10 minutes. In order to see if the enzyme is secreted out of the cells, the culture medium from which the cells were removed was slowly added at room temperature to mix the ammonium sulfate powder (700 g / liter) and mixed. The saturated solution was centrifuged (6,000 rpm, 10 minutes), and the precipitate was dissolved in 5 ml of sterile distilled water, placed in a dialysis membrane (molecular weight: 6,000 cut-off, spectroscopic), and dialyzed several times with distilled water. Used as a sample. Cell lysate from which cell precipitates were removed by centrifugation was bound to nickel-nitrotriacetic acid (Ni-NTA) agarose resin (Qiagen, Germany), washed twice with the same buffer, and 6His-tagged with 100-250 mM imidazole-containing elution buffer. Protein was eluted. The eluted protein was sufficiently dialyzed with dialysis buffer [20 mM Tris-HCl, pH 7.5].
한편 회수된 균체는 Lysis buffer(20%(W/V) sucrose, 30mM Tris-HCl, 1mM EDTA, pH 8.0) 25ml로 현탁시키고 초음파로 파쇄(Pulse on 15초, Pulse off 30초, 3회 실시)하여 다시 원심분리(13,000×rpm, 10 min)하여 회수한 상등액을 조효소액으로 사용하고 이를 정제하기 위해서 Ni-NTA(Qiagen, Germany) 10ml로 충진된 칼럼에 로딩하여 결합시키고 10 volume의 washing buffer(50mM NaH2PO4 (pH8.0), 300mM NaCl, 20mM Imidazole)로 씻어주고 단백질을 마지막으로 5 volume의 elutioin buffer(50mM NaH2PO4 (pH8.0), 300mM NaCl, 100mM Imidazole)로 용출시켜 순수 분리하였다(Qiagen U.S.A). 이들 분획은 분자량 10kDa 이상을 농축할 수 있는 Centrifugal filter(Amicon Ultracell -10K, Millipore Co.)을 이용하여 정제하였다. 최종 정제된 단백질은 활성 분석 또는 SDS-PAGE의 시료로 사용하였다. The recovered cells were suspended in 25 ml of Lysis buffer (20% (W / V) sucrose, 30 mM Tris-HCl, 1 mM EDTA, pH 8.0) and crushed by ultrasound (pulse on 15 seconds, pulse off 30 seconds, 3 times). After centrifugation (13,000 × rpm, 10 min), the supernatant recovered was used as a coenzyme solution, and loaded into a column filled with 10 ml of Ni-NTA (Qiagen, Germany) for purification. 50mM NaH was eluted with 2 PO 4 (pH8.0), 300mM NaCl, 20mM Imidazole) Finally, the 5 volume elutioin buffer (50mM NaH 2 PO 4 (pH8.0) of the washed protein, 300mM NaCl, 100mM Imidazole) Pure separation (Qiagen USA). These fractions were purified using a Centrifugal filter (Amicon Ultracell-10K, Millipore Co.) capable of concentrating at least 10 kDa molecular weight. The final purified protein was used as a sample of activity assay or SDS-PAGE.
효소활성은 50mM sodium phosphate buffer(pH 7.0)에 p-nitrophenyl-β-D-mannoside를 10 mM이 되도록 각각 제조한 후, 10 μL의 기질용액에 조효소액이나 Ni-NTA칼럼으로 분획한 정제액을 각각 100배 희석한 시료10μL씩 첨가하여 55℃에서 60분간 반응시킨 후 1M Na2CO3 용액 100 μL를 첨가하여 반응을 중지시켜 유리된 ρ-nitrophenol(pNP, Sigma, USA)의 양을 405 nm에서 흡광도로 측정하였다. 효소활성 단위는 1분 동안에 1 mole의 pNP를 유리시키는데 필요한 효소량을 1 unit로 정의하였다.For enzymatic activity, p-nitrophenyl-β-D-mannoside was prepared in 50 mM sodium phosphate buffer (pH 7.0) to 10 mM, respectively, and purified solution fractionated with co-enzyme solution or Ni-NTA column in 10 μL of substrate solution. 10 μL of each 100-fold diluted sample was added and reacted at 55 ° C. for 60 minutes. Then, 100 μL of 1M Na 2 CO 3 solution was added to stop the reaction. The amount of free ρ-nitrophenol (pNP, Sigma, USA) was 405 nm. Absorbance was measured at. The enzyme activity unit was defined as 1 unit of the amount of enzyme required to release 1 mole of pNP in 1 minute.
발현된 단백질은 SDS-PAGE(Lamni 법)에 의해 확인하였다. 상기의 분석 결과 pEML5 및 pEMD5의 48 및46kDa 크기의 재조합 단백질이 발현되었음을 확인할 수 있었다(도3: lane3, lane6). 또한, 이들 유전자의 발현 균주 배양액으로부터 암모늄설페이트 침전물을 비교하였다(도3의 lane 4, lane 7). 그 결과 26개 아미노산의 signal sequence를 제거한 pEMD5형질전환 대장균이 pEML5형질전환주와 달리 세포외로 베타 만노시다제를 분비함을 확인하였다. 즉, DDHC3 클론 내 베타 만노시다제를 코딩하는 것으로 추정되는 유전자에서 세포외 분비와 관련하는 signal peptide 존재가 확인되었다. 상세하게는 예측한 베타-만노시다제의 N말단 부위 약 26개 아미노산의 signal sequence의 제거가 오히려 세포외 분비에 중요한 역할을 하고 있음을 확인시켜주는 것으로 판단된다. 균체의 경우에도 단지 초음파 처리에서도 DDMD5-만노시다제가 예측된 분자량 위치에 단백질 밴드가 진하게 나타나고 강한 활성을 보임으로서 이들이 과 발현에서 흔히 나타나는 불용성 단백질체(인글루전바디)가 전혀 형성되지 않은 매우 수용성이 높은 만노시다제가 다량으로 발현됨을 확인하였다.
The expressed protein was confirmed by SDS-PAGE (Lamni method). As a result of the analysis, it was confirmed that recombinant proteins of 48 and 46 kDa sizes of pEML5 and pEMD5 were expressed (FIG. 3:
5. 신규 베타- 5. New Beta 만노시다제의Mannoshida 최적활성 조건과 열 안정성 분석 Optimum Activity and Thermal Stability Analysis
pH별 활성 측정에 사용된 버퍼는 pH 4~6, Sodium acetate; pH 6~7.5, Potasium phosphate; pH 7.5~9, Tris?Cl buffer를 사용하였다. 발현단백질을 pNP-베타-D-mannooside를 기질로 사용하여 각 온도와 pH별로 만노시다제 활성을 측정하였다. pEMD5의 산물인 DDMD5 베타-만노시다제는 60℃와 pH 7.0에서 최적 활성을 나타내었으며(도 4), 특이하게도 pH 9.0에서도 70% 이상의 활성을 유지하였다. 이 효소는 70℃이상의 고온과 산성 조건(pH5이하)에서는 활성이 급속히 감소하였다. Buffers used for pH-specific activity measurements were pH 4-6, Sodium acetate; pH 6-7.5, Potasium phosphate; pH 7.5-9, Tris Cl buffer was used. The expression protein, pNP-beta-D-mannooside, was used as a substrate to measure the mannosidase activity at each temperature and pH. DDMD5 beta-mannosidase, a product of pEMD5, showed optimal activity at 60 ° C. and pH 7.0 (FIG. 4), and specifically maintained at least 70% activity even at pH 9.0. The enzyme rapidly decreased its activity at high temperature above 70 ℃ and acidic condition (below pH5).
또한 발현단백질을 pNP-베타-1,4-D-mannoside를 기질로 사용하여 각 온도(25℃, 35℃, 45℃, 55℃, 65℃)로 1시간 처리 후, DDMD5베타-D-만노시다제는 60℃와 pH 7.0에서 시간 별로 활성을 측정하였다. 이 효소는 35℃까지 열 안정성이 있으나 55℃에서는 급격히 열안정성이 감소됨을 보여주었다. 또한 35℃에서 시간 별로 효소의 안정성 분석을 하였고, 이 분석의 조건은 60℃. pH 7.0에서 60분 반응 후 기질pNPG에 대한 효소활성을 최적조건을 100으로 하고 상대적 활성을 나타내었다. 시간 별로 효소안정성을 분석한 결과 이 효소는 14시간반응에도 효소활성이 80%이상 유지하였으므로 이는 비교적 열에 안정함으로 비교적 산업적 응용에 유리한 것으로 기대된다(도 4).
In addition, the expression protein was treated with pNP-beta-1,4-D-mannoside as a substrate for 1 hour at each temperature (25 ° C, 35 ° C, 45 ° C, 55 ° C, 65 ° C), and then DDMD5beta-D-manno Sidase was measured for activity at 60 ℃ and pH 7.0 over time . The enzyme showed thermal stability up to 35 ° C but rapidly decreased at 55 ° C. In addition, the stability of the enzyme was analyzed by time at 35 ℃, the conditions of this analysis is 60 ℃. After 60 minutes of reaction at pH 7.0, the enzyme activity for substrate pNPG was set to 100 as the optimal condition and showed relative activity. As a result of analyzing the enzyme stability by time, the enzyme maintained more than 80% of the enzyme activity even after 14 hours of reaction, which is relatively thermally stable and is expected to be advantageous for a relatively industrial application (FIG. 4).
6. 신규 베타 6. New Beta 만노시다제의Mannoshida 기질 특이성 및 다양한 화합물에 대한 활성 영향 분석 Substrate specificity and activity impact analysis on various compounds
상기4에서 설명한 방법대로 이들 발현된 유전자의 산물인 효소의 활성과 기질특이성을 검정한 결과는 도5에서 보는 바와 같다. 핵산서열 분석 상 만노시다제로 추정되는 유전자(pEMD5)의 발현단백질의 활성 검정에서, 재조합단백질은 예상한대로 주 활성이 베타-1,4 D-만노시다제 임이 최종 확인되었으며 이것은 기타 다른 당에서는 전혀 작동하지 않으므로 매우 베타 만노시드 결합에 특이적인 분해능을 가지는 만노시다제임을 보여준다. As shown in FIG. 4, the results of assaying the activity and substrate specificity of enzymes, which are products of these expressed genes, are as shown in FIG. In nucleic acid sequencing analysis of the activity of the expression protein of the gene (pEMD5) presumed to be mannosidase, the recombinant protein was finally confirmed to have a major activity of beta-1,4 D-mannosidase as expected, and this did not work at all in other sugars. It does not show that it is a mannosidase having a specific resolution for the beta mannosidic bond.
또한, 금속이온은 10mM, 기타 케미칼은 3%, 유기용매는 실온에서 1시간 노출 후 55℃. pH 7.0에서 60분 반응 후 기질pNPG에 대한 효소활성을 무처리를 대조구로 하여 상대적 활성을 분석하였다.In addition, the metal ion is 10mM,
다양한 금속이온에 대한 이 효소의 활성도를 분석한 결과, 니켈, 구리에는 심각하게 활성을 저해하였고 마그네슘은 오히려 5%정도 활성을 증가시켰다. 한편 유기용매나 다양한 케미칼에 대한 본 효소의 활성에 대한 영향을 분석한 결과, 3%의 DTT 조건에서 오히려 활성이 약간 증가경향이 있는 반면에, 대부분의 유기용매에서(에탄올 제외) 1시간 노출 시, 또는 트윈계 화합물, 트리톤X-100, SDS, EDTA, 글리세롤에서는 심각한 활성 저해가 보였다. 보다 특기할 사항은 본 효소가 10mM만노오즈에 의해 활성이 저해받지만 기질을 증가시키면 활성이 회복되는 것으로 보아 이 반응의 산물인 만노오즈가 경쟁적 저해제로 작용한다. 이와 같이 본 발명의 신규 만노시다제는 기존 보고된 것과는 매우 다른 생화학적 특성을 보이고 있다(도 5).Analysis of the enzyme's activity on various metal ions significantly inhibited the activity of nickel and copper, while magnesium increased the activity by 5%. On the other hand, after analyzing the effect on the activity of the enzyme on organic solvents or various chemicals, the activity tended to increase slightly at 3% of DTT, whereas in most organic solvents (except ethanol) for 1 hour exposure , Or twin compounds, Triton X-100, SDS, EDTA, glycerol showed severe activity inhibition. More specifically, the enzyme is inhibited by 10 mM mannose activity, but the activity is restored by increasing the substrate, the product of this reaction mannose is a competitive inhibitor. As such, the novel mannosidase of the present invention shows very different biochemical properties from those previously reported (FIG. 5).
본 발명의 베타 만노시다제는 단지 베타 만노시드 결합에만 작용하는 기질특이성을 가지며 정제된 효소의 비활성(specific activity)은 약 100unit/단백질mg으로 다른 생물에서 정제된 것 보다 우수하였다.
The beta mannosidase of the present invention had substrate specificity acting only on beta mannoside binding and the specific activity of the purified enzyme was about 100 units / mg of protein, which was superior to that purified in other organisms.
7. 신규 7. New DDMD5DDMD5 -베타 -beta 만노시다제의Mannoshida 생산성 분석 및 경제적 가치 Productivity Analysis and Economic Value
KACC95116P(pEMD5)에 의한 DDMD5-만노시다제의 생산량과 총 효소활성을 보기 위해 250ml의 LB 배지에 OD600nm에서 0.6되도록 배양한 뒤 1mM IPTG로 4시간 동안 유전자를 발현유도하고 그것의 세포 잔사를 모은 뒤 Lysis buffer(20%(W/V) sucrose, 30mM Tris-HCl, 1mM EDTA, pH 8.0) 15ml로 현탁시키고 초음파로 파쇄(Pulse on 15초, Pulse off 30초, 3회)하여 원심분리하였다. 그 상층을 단백질 정량하고 이를 Ni-NTA affinity column으로 결합시킨 뒤 20-100mM imidazole 완충액으로 용출하여 각 분획의 단백질 양과 효소활성을 분석하였다(도 6). 한편 단백질의 양을 측정하기 위해서 Bradford 분석법을 이용하였다. BSA(bovine serum albumin, New Englnad BioLab)를 표준품으로 이용하여 표준검량곡선을 작성한 후 측정하였다. 1:5 비율로 dilution한 protein assay dye reagent(Bio-Rad) 1ml에 시료 10ul를 상온에서 5분 동안 incubation 시킨 후, 595nm에서 흡광도를 측정하였다.To see the production and total enzyme activity of DDMD5-mannosidase by KACC95116P (pEMD5), incubate at 250nm LB medium at 0.6 OD600nm and induce gene expression for 4 hours with 1mM IPTG and collect its cell residue. Lysis buffer (20% (W / V) sucrose, 30mM Tris-HCl, 1mM EDTA, pH 8.0) was suspended in 15ml and pulverized by ultrasonication (Pulse on 15 seconds, Pulse off 30 seconds, 3 times) and centrifuged. Proteins were quantified in the upper layer and bound to a Ni-NTA affinity column and eluted with 20-100 mM imidazole buffer to analyze the protein amount and enzyme activity of each fraction (FIG. 6). Bradford assay was used to measure protein levels. BSA (bovine serum albumin, New Englnad BioLab) was used as a standard to prepare a standard calibration curve. After incubating 10ul of the sample in 1ml of protein assay dye reagent (Bio-Rad) diluted 1: 5 at room temperature for 5 minutes, absorbance was measured at 595 nm.
초음파처리로 파쇄된 수용성 단백질 총량에 목표된 효소의 정제도는 75%이상이었으며 이를 정제한 분획(정제도 98%)에서는 specific 효소활성도가 100 unit/단백질mg 정도였다. 이는 통상적인 배양조건에도 리터당 정제 효소가 적어도80mg, 총 8,000unit이상 생산되는 것으로 산정된다. 이는 대장균에서 기존의 보고된 어떠한 재조합 만노시다제 보다도 탁월한 생산성을 보인 것이며 특히 숙주인 대장균에서 세포 외로도 수용성 효소를 분비하였기 때문에 생산단가를 획기적으로 절감할 수 있을 것이다. 이 효소는 식품 및 연구용 시약효소 생산의 적용에 기여할 것이다.
Purification of the target enzyme was more than 75% in the total amount of soluble protein crushed by sonication, and the specific enzyme activity was about 100 units / mg of protein in the purified fraction (98% tablets). This is estimated to produce at least 80 mg of purified enzyme per liter, totaling more than 8,000 units, even under normal culture conditions. This resulted in greater productivity than any previously reported recombinant mannosidase in Escherichia coli, and especially the host E. coli secreted water-soluble enzymes extracellularly, thereby significantly reducing the production cost. This enzyme will contribute to the application of enzyme and food reagent production.
<110> Foundation of Agri.Tech. Commercialization & Transfer <120> Novel mannosidase derived from microbial in intestinal of blacksoldier fly <130> p120284 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 1281 <212> DNA <213> Artificial Sequence <220> <223> DDML5 <400> 1 atgaaaaaac tgattctatt tgcagcttta gctttaagcc tattctcctg caccgagaag 60 aaagcggtaa ctgctccctc tttcgtaaag cagaaggaag gcaagcttac gataaacgac 120 aagccttact actttatcgg cactaacttt tggttcgggg ctatattggg ttccgaaggg 180 caaggcggta accgtgaacg attacttaaa gagcttgatt ttatgaaaga aaacggcatc 240 aataatcttc gggttcttgt aggtgccgac ggcccaagcg gacaaaaggt aaaagttatg 300 ccgactcttc aaatagagcc gggagtgtat aacgatacta ttttcgacgg attagatttc 360 ctcatggcgg aactgggtaa acgggatatg tatgcggtac tttatcttaa caacagttgg 420 gaatggagtg gcggatacgg acagtatctc aattgggcag gacgtggtga tgtacccgaa 480 gcaggagttc aggactggcc tgtatttgta aagcatgttg cccaatatgc cgattgcgac 540 agttgccata ccttgtttct gaatcatgta aagcacgtta ttaccagaac caaccgatat 600 acgggaaaga aatatattga cgatacggca atcatgtcat ggcaggtagg gaacgagcct 660 cgctcattca gcgatgaggg taaacctgca ttcgtaaaat ggttgaaaga aactacagct 720 cttatccgct ctcttgatcc taatcacctc atctcattgg gtaatgaggg tactaaggga 780 tgtgaagaag atatgaatct tttcgaacaa atcaattcag accccaatgt cgattatctg 840 accattcata tctggcctaa aaactggagc tggattgatc ccacccaagt agtagcatcc 900 gtagatacag caatcaccga aactgataaa tacattgata atcatctggc tattgccaaa 960 aagctaaaca agcctatggt tatcgaagag tttggatatc cgcgcgataa tcacaaatat 1020 acactggagg atactacagt tgcacgtgat acatattact ccaatatctt ctcgaaaata 1080 ataagttcga aagaaaacaa tggtctgatt gcaggatgca acttctggac atggggagga 1140 ttcggaagac ctgctcacac attctgggaa ccgtgggacg attatgtagg tgatccatcg 1200 caagaagaac aaggtttaaa ctctgttttc gatacagata cgaccatcaa agtcatcaaa 1260 agctatactc aaaaactata a 1281 <210> 2 <211> 1203 <212> DNA <213> Artificial Sequence <220> <223> DDMD5 <400> 2 tctttcgtaa agcagaagga aggcaagctt acgataaacg acaagcctta ctactttatc 60 ggcactaact tttggttcgg ggctatattg ggttccgaag ggcaaggcgg taaccgtgaa 120 cgattactta aagagcttga ttttatgaaa gaaaacggca tcaataatct tcgggttctt 180 gtaggtgccg acggcccaag cggacaaaag gtaaaagtta tgccgactct tcaaatagag 240 ccgggagtgt ataacgatac tattttcgac ggattagatt tcctcatggc ggaactgggt 300 aaacgggata tgtatgcggt actttatctt aacaacagtt gggaatggag tggcggatac 360 ggacagtatc tcaattgggc aggacgtggt gatgtacccg aagcaggagt tcaggactgg 420 cctgtatttg taaagcatgt tgcccaatat gccgattgcg acagttgcca taccttgttt 480 ctgaatcatg taaagcacgt tattaccaga accaaccgat atacgggaaa gaaatatatt 540 gacgatacgg caatcatgtc atggcaggta gggaacgagc ctcgctcatt cagcgatgag 600 ggtaaacctg cattcgtaaa atggttgaaa gaaactacag ctcttatccg ctctcttgat 660 cctaatcacc tcatctcatt gggtaatgag ggtactaagg gatgtgaaga agatatgaat 720 cttttcgaac aaatcaattc agaccccaat gtcgattatc tgaccattca tatctggcct 780 aaaaactgga gctggattga tcccacccaa gtagtagcat ccgtagatac agcaatcacc 840 gaaactgata aatacattga taatcatctg gctattgcca aaaagctaaa caagcctatg 900 gttatcgaag agtttggata tccgcgcgat aatcacaaat atacactgga ggatactaca 960 gttgcacgtg atacatatta ctccaatatc ttctcgaaaa taataagttc gaaagaaaac 1020 aatggtctga ttgcaggatg caacttctgg acatggggag gattcggaag acctgctcac 1080 acattctggg aaccgtggga cgattatgta ggtgatccat cgcaagaaga acaaggttta 1140 aactctgttt tcgatacaga tacgaccatc aaagtcatca aaagctatac tcaaaaacta 1200 taa 1203 <210> 3 <211> 426 <212> PRT <213> Artificial Sequence <220> <223> DDML5 <400> 3 Met Lys Lys Leu Ile Leu Phe Ala Ala Leu Ala Leu Ser Leu Phe Ser 1 5 10 15 Cys Thr Glu Lys Lys Ala Val Thr Ala Pro Ser Phe Val Lys Gln Lys 20 25 30 Glu Gly Lys Leu Thr Ile Asn Asp Lys Pro Tyr Tyr Phe Ile Gly Thr 35 40 45 Asn Phe Trp Phe Gly Ala Ile Leu Gly Ser Glu Gly Gln Gly Gly Asn 50 55 60 Arg Glu Arg Leu Leu Lys Glu Leu Asp Phe Met Lys Glu Asn Gly Ile 65 70 75 80 Asn Asn Leu Arg Val Leu Val Gly Ala Asp Gly Pro Ser Gly Gln Lys 85 90 95 Val Lys Val Met Pro Thr Leu Gln Ile Glu Pro Gly Val Tyr Asn Asp 100 105 110 Thr Ile Phe Asp Gly Leu Asp Phe Leu Met Ala Glu Leu Gly Lys Arg 115 120 125 Asp Met Tyr Ala Val Leu Tyr Leu Asn Asn Ser Trp Glu Trp Ser Gly 130 135 140 Gly Tyr Gly Gln Tyr Leu Asn Trp Ala Gly Arg Gly Asp Val Pro Glu 145 150 155 160 Ala Gly Val Gln Asp Trp Pro Val Phe Val Lys His Val Ala Gln Tyr 165 170 175 Ala Asp Cys Asp Ser Cys His Thr Leu Phe Leu Asn His Val Lys His 180 185 190 Val Ile Thr Arg Thr Asn Arg Tyr Thr Gly Lys Lys Tyr Ile Asp Asp 195 200 205 Thr Ala Ile Met Ser Trp Gln Val Gly Asn Glu Pro Arg Ser Phe Ser 210 215 220 Asp Glu Gly Lys Pro Ala Phe Val Lys Trp Leu Lys Glu Thr Thr Ala 225 230 235 240 Leu Ile Arg Ser Leu Asp Pro Asn His Leu Ile Ser Leu Gly Asn Glu 245 250 255 Gly Thr Lys Gly Cys Glu Glu Asp Met Asn Leu Phe Glu Gln Ile Asn 260 265 270 Ser Asp Pro Asn Val Asp Tyr Leu Thr Ile His Ile Trp Pro Lys Asn 275 280 285 Trp Ser Trp Ile Asp Pro Thr Gln Val Val Ala Ser Val Asp Thr Ala 290 295 300 Ile Thr Glu Thr Asp Lys Tyr Ile Asp Asn His Leu Ala Ile Ala Lys 305 310 315 320 Lys Leu Asn Lys Pro Met Val Ile Glu Glu Phe Gly Tyr Pro Arg Asp 325 330 335 Asn His Lys Tyr Thr Leu Glu Asp Thr Thr Val Ala Arg Asp Thr Tyr 340 345 350 Tyr Ser Asn Ile Phe Ser Lys Ile Ile Ser Ser Lys Glu Asn Asn Gly 355 360 365 Leu Ile Ala Gly Cys Asn Phe Trp Thr Trp Gly Gly Phe Gly Arg Pro 370 375 380 Ala His Thr Phe Trp Glu Pro Trp Asp Asp Tyr Val Gly Asp Pro Ser 385 390 395 400 Gln Glu Glu Gln Gly Leu Asn Ser Val Phe Asp Thr Asp Thr Thr Ile 405 410 415 Lys Val Ile Lys Ser Tyr Thr Gln Lys Leu 420 425 <210> 4 <211> 400 <212> PRT <213> Artificial Sequence <220> <223> DDMD5 <400> 4 Ser Phe Val Lys Gln Lys Glu Gly Lys Leu Thr Ile Asn Asp Lys Pro 1 5 10 15 Tyr Tyr Phe Ile Gly Thr Asn Phe Trp Phe Gly Ala Ile Leu Gly Ser 20 25 30 Glu Gly Gln Gly Gly Asn Arg Glu Arg Leu Leu Lys Glu Leu Asp Phe 35 40 45 Met Lys Glu Asn Gly Ile Asn Asn Leu Arg Val Leu Val Gly Ala Asp 50 55 60 Gly Pro Ser Gly Gln Lys Val Lys Val Met Pro Thr Leu Gln Ile Glu 65 70 75 80 Pro Gly Val Tyr Asn Asp Thr Ile Phe Asp Gly Leu Asp Phe Leu Met 85 90 95 Ala Glu Leu Gly Lys Arg Asp Met Tyr Ala Val Leu Tyr Leu Asn Asn 100 105 110 Ser Trp Glu Trp Ser Gly Gly Tyr Gly Gln Tyr Leu Asn Trp Ala Gly 115 120 125 Arg Gly Asp Val Pro Glu Ala Gly Val Gln Asp Trp Pro Val Phe Val 130 135 140 Lys His Val Ala Gln Tyr Ala Asp Cys Asp Ser Cys His Thr Leu Phe 145 150 155 160 Leu Asn His Val Lys His Val Ile Thr Arg Thr Asn Arg Tyr Thr Gly 165 170 175 Lys Lys Tyr Ile Asp Asp Thr Ala Ile Met Ser Trp Gln Val Gly Asn 180 185 190 Glu Pro Arg Ser Phe Ser Asp Glu Gly Lys Pro Ala Phe Val Lys Trp 195 200 205 Leu Lys Glu Thr Thr Ala Leu Ile Arg Ser Leu Asp Pro Asn His Leu 210 215 220 Ile Ser Leu Gly Asn Glu Gly Thr Lys Gly Cys Glu Glu Asp Met Asn 225 230 235 240 Leu Phe Glu Gln Ile Asn Ser Asp Pro Asn Val Asp Tyr Leu Thr Ile 245 250 255 His Ile Trp Pro Lys Asn Trp Ser Trp Ile Asp Pro Thr Gln Val Val 260 265 270 Ala Ser Val Asp Thr Ala Ile Thr Glu Thr Asp Lys Tyr Ile Asp Asn 275 280 285 His Leu Ala Ile Ala Lys Lys Leu Asn Lys Pro Met Val Ile Glu Glu 290 295 300 Phe Gly Tyr Pro Arg Asp Asn His Lys Tyr Thr Leu Glu Asp Thr Thr 305 310 315 320 Val Ala Arg Asp Thr Tyr Tyr Ser Asn Ile Phe Ser Lys Ile Ile Ser 325 330 335 Ser Lys Glu Asn Asn Gly Leu Ile Ala Gly Cys Asn Phe Trp Thr Trp 340 345 350 Gly Gly Phe Gly Arg Pro Ala His Thr Phe Trp Glu Pro Trp Asp Asp 355 360 365 Tyr Val Gly Asp Pro Ser Gln Glu Glu Gln Gly Leu Asn Ser Val Phe 370 375 380 Asp Thr Asp Thr Thr Ile Lys Val Ile Lys Ser Tyr Thr Gln Lys Leu 385 390 395 400 <110> Foundation of Agri.Tech. Commercialization & Transfer <120> Novel mannosidase derived from microbial in intestinal of blacksoldier fly <130> p120284 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 1281 <212> DNA <213> Artificial Sequence <220> <223> DDML5 <400> 1 atgaaaaaac tgattctatt tgcagcttta gctttaagcc tattctcctg caccgagaag 60 aaagcggtaa ctgctccctc tttcgtaaag cagaaggaag gcaagcttac gataaacgac 120 aagccttact actttatcgg cactaacttt tggttcgggg ctatattggg ttccgaaggg 180 caaggcggta accgtgaacg attacttaaa gagcttgatt ttatgaaaga aaacggcatc 240 aataatcttc gggttcttgt aggtgccgac ggcccaagcg gacaaaaggt aaaagttatg 300 ccgactcttc aaatagagcc gggagtgtat aacgatacta ttttcgacgg attagatttc 360 ctcatggcgg aactgggtaa acgggatatg tatgcggtac tttatcttaa caacagttgg 420 gaatggagtg gcggatacgg acagtatctc aattgggcag gacgtggtga tgtacccgaa 480 gcaggagttc aggactggcc tgtatttgta aagcatgttg cccaatatgc cgattgcgac 540 agttgccata ccttgtttct gaatcatgta aagcacgtta ttaccagaac caaccgatat 600 acgggaaaga aatatattga cgatacggca atcatgtcat ggcaggtagg gaacgagcct 660 cgctcattca gcgatgaggg taaacctgca ttcgtaaaat ggttgaaaga aactacagct 720 cttatccgct ctcttgatcc taatcacctc atctcattgg gtaatgaggg tactaaggga 780 tgtgaagaag atatgaatct tttcgaacaa atcaattcag accccaatgt cgattatctg 840 accattcata tctggcctaa aaactggagc tggattgatc ccacccaagt agtagcatcc 900 gtagatacag caatcaccga aactgataaa tacattgata atcatctggc tattgccaaa 960 aagctaaaca agcctatggt tatcgaagag tttggatatc cgcgcgataa tcacaaatat 1020 acactggagg atactacagt tgcacgtgat acatattact ccaatatctt ctcgaaaata 1080 ataagttcga aagaaaacaa tggtctgatt gcaggatgca acttctggac atggggagga 1140 ttcggaagac ctgctcacac attctgggaa ccgtgggacg attatgtagg tgatccatcg 1200 caagaagaac aaggtttaaa ctctgttttc gatacagata cgaccatcaa agtcatcaaa 1260 agctatactc aaaaactata a 1281 <210> 2 <211> 1203 <212> DNA <213> Artificial Sequence <220> <223> DDMD5 <400> 2 tctttcgtaa agcagaagga aggcaagctt acgataaacg acaagcctta ctactttatc 60 ggcactaact tttggttcgg ggctatattg ggttccgaag ggcaaggcgg taaccgtgaa 120 cgattactta aagagcttga ttttatgaaa gaaaacggca tcaataatct tcgggttctt 180 gtaggtgccg acggcccaag cggacaaaag gtaaaagtta tgccgactct tcaaatagag 240 ccgggagtgt ataacgatac tattttcgac ggattagatt tcctcatggc ggaactgggt 300 aaacgggata tgtatgcggt actttatctt aacaacagtt gggaatggag tggcggatac 360 ggacagtatc tcaattgggc aggacgtggt gatgtacccg aagcaggagt tcaggactgg 420 cctgtatttg taaagcatgt tgcccaatat gccgattgcg acagttgcca taccttgttt 480 ctgaatcatg taaagcacgt tattaccaga accaaccgat atacgggaaa gaaatatatt 540 gacgatacgg caatcatgtc atggcaggta gggaacgagc ctcgctcatt cagcgatgag 600 ggtaaacctg cattcgtaaa atggttgaaa gaaactacag ctcttatccg ctctcttgat 660 cctaatcacc tcatctcatt gggtaatgag ggtactaagg gatgtgaaga agatatgaat 720 cttttcgaac aaatcaattc agaccccaat gtcgattatc tgaccattca tatctggcct 780 aaaaactgga gctggattga tcccacccaa gtagtagcat ccgtagatac agcaatcacc 840 gaaactgata aatacattga taatcatctg gctattgcca aaaagctaaa caagcctatg 900 gttatcgaag agtttggata tccgcgcgat aatcacaaat atacactgga ggatactaca 960 gttgcacgtg atacatatta ctccaatatc ttctcgaaaa taataagttc gaaagaaaac 1020 aatggtctga ttgcaggatg caacttctgg acatggggag gattcggaag acctgctcac 1080 acattctggg aaccgtggga cgattatgta ggtgatccat cgcaagaaga acaaggttta 1140 aactctgttt tcgatacaga tacgaccatc aaagtcatca aaagctatac tcaaaaacta 1200 taa 1203 <210> 3 <211> 426 <212> PRT <213> Artificial Sequence <220> <223> DDML5 <400> 3 Met Lys Lys Leu Ile Leu Phe Ala Ala Leu Ala Leu Ser Leu Phe Ser 1 5 10 15 Cys Thr Glu Lys Lys Ala Val Thr Ala Pro Ser Phe Val Lys Gln Lys 20 25 30 Glu Gly Lys Leu Thr Ile Asn Asp Lys Pro Tyr Tyr Phe Ile Gly Thr 35 40 45 Asn Phe Trp Phe Gly Ala Ile Leu Gly Ser Glu Gly Gln Gly Gly Asn 50 55 60 Arg Glu Arg Leu Leu Lys Glu Leu Asp Phe Met Lys Glu Asn Gly Ile 65 70 75 80 Asn Asn Leu Arg Val Leu Val Gly Ala Asp Gly Pro Ser Gly Gln Lys 85 90 95 Val Lys Val Met Pro Thr Leu Gln Ile Glu Pro Gly Val Tyr Asn Asp 100 105 110 Thr Ile Phe Asp Gly Leu Asp Phe Leu Met Ala Glu Leu Gly Lys Arg 115 120 125 Asp Met Tyr Ala Val Leu Tyr Leu Asn Asn Ser Trp Glu Trp Ser Gly 130 135 140 Gly Tyr Gly Gln Tyr Leu Asn Trp Ala Gly Arg Gly Asp Val Pro Glu 145 150 155 160 Ala Gly Val Gln Asp Trp Pro Val Phe Val Lys His Val Ala Gln Tyr 165 170 175 Ala Asp Cys Asp Ser Cys His Thr Leu Phe Leu Asn His Val Lys His 180 185 190 Val Ile Thr Arg Thr Asn Arg Tyr Thr Gly Lys Lys Tyr Ile Asp Asp 195 200 205 Thr Ala Ile Met Ser Trp Gln Val Gly Asn Glu Pro Arg Ser Phe Ser 210 215 220 Asp Glu Gly Lys Pro Ala Phe Val Lys Trp Leu Lys Glu Thr Thr Ala 225 230 235 240 Leu Ile Arg Ser Leu Asp Pro Asn His Leu Ile Ser Leu Gly Asn Glu 245 250 255 Gly Thr Lys Gly Cys Glu Glu Asp Met Asn Leu Phe Glu Gln Ile Asn 260 265 270 Ser Asp Pro Asn Val Asp Tyr Leu Thr Ile His Ile Trp Pro Lys Asn 275 280 285 Trp Ser Trp Ile Asp Pro Thr Gln Val Val Ala Ser Val Asp Thr Ala 290 295 300 Ile Thr Glu Thr Asp Lys Tyr Ile Asp Asn His Leu Ala Ile Ala Lys 305 310 315 320 Lys Leu Asn Lys Pro Met Val Ile Glu Glu Phe Gly Tyr Pro Arg Asp 325 330 335 Asn His Lys Tyr Thr Leu Glu Asp Thr Thr Val Ala Arg Asp Thr Tyr 340 345 350 Tyr Ser Asn Ile Phe Ser Lys Ile Ile Ser Ser Lys Glu Asn Asn Gly 355 360 365 Leu Ile Ala Gly Cys Asn Phe Trp Thr Trp Gly Gly Phe Gly Arg Pro 370 375 380 Ala His Thr Phe Trp Glu Pro Trp Asp Asp Tyr Val Gly Asp Pro Ser 385 390 395 400 Gln Glu Glu Gln Gly Leu Asn Ser Val Phe Asp Thr Asp Thr Thr Ile 405 410 415 Lys Val Ile Lys Ser Tyr Thr Gln Lys Leu 420 425 <210> 4 <211> 400 <212> PRT <213> Artificial Sequence <220> <223> DDMD5 <400> 4 Ser Phe Val Lys Gln Lys Glu Gly Lys Leu Thr Ile Asn Asp Lys Pro 1 5 10 15 Tyr Tyr Phe Ile Gly Thr Asn Phe Trp Phe Gly Ala Ile Leu Gly Ser 20 25 30 Glu Gly Gln Gly Gly Asn Arg Glu Arg Leu Leu Lys Glu Leu Asp Phe 35 40 45 Met Lys Glu Asn Gly Ile Asn Asn Leu Arg Val Leu Val Gly Ala Asp 50 55 60 Gly Pro Ser Gly Gln Lys Val Lys Val Met Pro Thr Leu Gln Ile Glu 65 70 75 80 Pro Gly Val Tyr Asn Asp Thr Ile Phe Asp Gly Leu Asp Phe Leu Met 85 90 95 Ala Glu Leu Gly Lys Arg Asp Met Tyr Ala Val Leu Tyr Leu Asn Asn 100 105 110 Ser Trp Glu Trp Ser Gly Gly Tyr Gly Gln Tyr Leu Asn Trp Ala Gly 115 120 125 Arg Gly Asp Val Pro Glu Ala Gly Val Gln Asp Trp Pro Val Phe Val 130 135 140 Lys His Val Ala Gln Tyr Ala Asp Cys Asp Ser Cys His Thr Leu Phe 145 150 155 160 Leu Asn His Val Lys His Val Ile Thr Arg Thr Asn Arg Tyr Thr Gly 165 170 175 Lys Lys Tyr Ile Asp Asp Thr Ala Ile Met Ser Trp Gln Val Gly Asn 180 185 190 Glu Pro Arg Ser Phe Ser Asp Glu Gly Lys Pro Ala Phe Val Lys Trp 195 200 205 Leu Lys Glu Thr Thr Ala Leu Ile Arg Ser Leu Asp Pro Asn His Leu 210 215 220 Ile Ser Leu Gly Asn Glu Gly Thr Lys Gly Cys Glu Glu Asp Met Asn 225 230 235 240 Leu Phe Glu Gln Ile Asn Ser Asp Pro Asn Val Asp Tyr Leu Thr Ile 245 250 255 His Ile Trp Pro Lys Asn Trp Ser Trp Ile Asp Pro Thr Gln Val Val 260 265 270 Ala Ser Val Asp Thr Ala Ile Thr Glu Thr Asp Lys Tyr Ile Asp Asn 275 280 285 His Leu Ala Ile Ala Lys Lys Leu Asn Lys Pro Met Val Ile Glu Glu 290 295 300 Phe Gly Tyr Pro Arg Asp Asn His Lys Tyr Thr Leu Glu Asp Thr Thr 305 310 315 320 Val Ala Arg Asp Thr Tyr Tyr Ser Asn Ile Phe Ser Lys Ile Ile Ser 325 330 335 Ser Lys Glu Asn Asn Gly Leu Ile Ala Gly Cys Asn Phe Trp Thr Trp 340 345 350 Gly Gly Phe Gly Arg Pro Ala His Thr Phe Trp Glu Pro Trp Asp Asp 355 360 365 Tyr Val Gly Asp Pro Ser Gln Glu Glu Gln Gly Leu Asn Ser Val Phe 370 375 380 Asp Thr Asp Thr Thr Ile Lys Val Ile Lys Ser Tyr Thr Gln Lys Leu 385 390 395 400
Claims (7)
The transformant of claim 6, wherein the host cell is Escherichia coli.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120060434A KR101388457B1 (en) | 2012-06-05 | 2012-06-05 | Novel mannosidase derived from microbial in intestinal of blacksoldier fly |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120060434A KR101388457B1 (en) | 2012-06-05 | 2012-06-05 | Novel mannosidase derived from microbial in intestinal of blacksoldier fly |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20130139439A true KR20130139439A (en) | 2013-12-23 |
KR101388457B1 KR101388457B1 (en) | 2014-04-25 |
Family
ID=49984616
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020120060434A KR101388457B1 (en) | 2012-06-05 | 2012-06-05 | Novel mannosidase derived from microbial in intestinal of blacksoldier fly |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101388457B1 (en) |
-
2012
- 2012-06-05 KR KR1020120060434A patent/KR101388457B1/en active IP Right Grant
Also Published As
Publication number | Publication date |
---|---|
KR101388457B1 (en) | 2014-04-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112813051B (en) | Low Wen Waiqie inulase mutant MutP124G with improved thermal adaptability and application | |
CN112852782B (en) | Low-temperature adaptive improved low Wen Waiqie inulase mutant MutDL121EK5 and application thereof | |
KR101104068B1 (en) | Endo-1,4-ß-glucanase from garlic and uses thereof | |
CN111088183B (en) | Marine vibrio and application thereof in preparation of iota-carrageenase with thermal stability | |
CN113969290B (en) | Deep sea bacteria-derived alpha-glucosidase QsGH97a and encoding gene and application thereof | |
JP6340647B2 (en) | Super thermostable cellobiohydrolase | |
CN107164346B (en) | A kind of alkalinity salt tolerant Pullulanase PulA and its gene and application | |
JP5709222B2 (en) | Cellulase enzyme and process for producing the same | |
JP4815219B2 (en) | DNA containing an alkalophilic cyclodextran synthase gene, recombinant DNA, and method for producing an alkalophilic cyclodextran synthase | |
CN110846301A (en) | Recombinant chitin deacetylase and preparation method and application thereof | |
CN114015708B (en) | Deep sea bacteria-derived alpha-glucosidase QsGH13 and encoding gene and application thereof | |
CN111808836B (en) | Heat-resistant mutant enzyme of pullulanase I and preparation method and application thereof | |
KR101388457B1 (en) | Novel mannosidase derived from microbial in intestinal of blacksoldier fly | |
Wu et al. | Molecular cloning of maltooligosyltrehalose trehalohydrolase gene from Nostoc flagelliforme and trehalose-related response to stresses | |
KR102084065B1 (en) | Thermostable recombinant cellulase b protein derived from thermotoga maritima and the uses thereof | |
CN109628429B (en) | Extreme-halophilic surfactant-resistant non-calcium ion-dependent alpha-amylase and gene and application thereof | |
CN103602646B (en) | The beta-glucoside enzyme mutant that a kind of optimal reactive temperature improves and application thereof | |
CN109517811B (en) | beta-ketoacyl-ACP synthetase mutant | |
CN108018266B (en) | Marine-derived superoxide dismutase and coding gene and application thereof | |
KR101183114B1 (en) | -Glucosidase gene from Phanerochate chrysosporium, expression vector containing gene, transformant transformed by the vector, and method for preparation of transformant | |
US7662606B1 (en) | β-agarase isolated from Thalassomonas agarivorans, preparation process and uses thereof | |
KR101388460B1 (en) | Novel β-glucosidases derived from microbial in intestinal of blacksoldier fly | |
KR20160014818A (en) | Mutated sucrose isomerase and process for preparing the same | |
CN109750021A (en) | A kind of scallop carotenoid oxicracking enzyme gene and its application | |
CN113088505B (en) | Application of polysaccharide lyase coding gene 04147 in preparation of recombinant peach gum polysaccharide hydrolase |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |