CN109517811B - beta-ketoacyl-ACP synthetase mutant - Google Patents
beta-ketoacyl-ACP synthetase mutant Download PDFInfo
- Publication number
- CN109517811B CN109517811B CN201811443458.9A CN201811443458A CN109517811B CN 109517811 B CN109517811 B CN 109517811B CN 201811443458 A CN201811443458 A CN 201811443458A CN 109517811 B CN109517811 B CN 109517811B
- Authority
- CN
- China
- Prior art keywords
- ala
- ketoacyl
- beta
- val
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6409—Fatty acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6409—Fatty acids
- C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01179—Beta-ketoacyl-acyl-carrier-protein synthase II (2.3.1.179)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a beta-ketoacyl-ACP synthetase mutant and application thereof, namely, a beta-ketoacyl-ACP synthetase (fabH) derived from enterobacteriaceae is modified to enable the mutant to be capable of catalyzing reaction in an unnatural manner and realize large-scale accumulation of novel fatty acid in enterobacteriaceae. The beta-ketoacyl-ACP synthetase is characterized in that the 189 site of the beta-ketoacyl-ACP synthetase (fabH) is mutated from leucine to serine, and/or the 157 site is mutated from phenylalanine to aspartic acid. The invention relates to a method for catalyzing non-natural reaction by site mutation of beta-ketoacyl-ACP synthetase through a structural biological method. The mutated gene is ligated to a plasmid and overexpressed in wild-type E.coli, greatly increasing the yield of fatty acids in enterobacteria.
Description
Technical Field
The invention belongs to the field of metabolic engineering and rational enzyme design, and particularly relates to a beta-ketoacyl-ACP synthetase mutant and application thereof, namely, the beta-ketoacyl-ACP synthetase (fabH) derived from enterobacteriaceae is modified to enable the beta-ketoacyl-ACP synthetase to be capable of non-natural catalytic reaction, so that a large amount of fatty acid is accumulated in enterobacteriaceae.
Background
In vivo, the Fatty Acid Synthesis (FAS) pathway includes two types: FAS I and FAS II. FAS type I is present in mammals and belongs to a high-potency but product-unique fatty acid synthesis pathway; FAS II exists in animals, plants, bacteria, fungi and the like, the way is a dispersed protein system, each step of fatty acid synthesis is catalyzed and synthesized by different monofunctional enzymes, metabolites are various, targets are rich, and the method is of great help for researching novel antibacterial drugs for resisting bacterial drug resistance. beta-ketoacyl-ACP synthase III (fabH or KAS III) is one of the monofunctional enzymes of the bacterial FAS type II pathway. The advantages of selecting the target point are: (1) FabH enzymes catalyze the first condensation reaction of the bacterial FAS pathway, whereby chain elongation is initiated, controlling the initiation of bacterial fatty acid synthesis and providing substrates for the elongation of the following chain, a key enzyme in the reaction process; (2) the bacterial fatty acid synthase system is different from the human body and has no homology. Therefore, the research of the inhibitor taking the fabH enzyme as the action target of the novel antibacterial drug becomes a hot spot at home and abroad. At present, compounds which have been reported at home and abroad and have an inhibitory effect on fabH targets are as follows: cerulenin; thiomycins; platenomycin; a sulfur-containing compound; cinnamic acid derivatives and the like.
By overexpressing ketoacyl-ACP synthase, a large accumulation of fatty acids in Enterobacter can be achieved. The beta-ketoacyl-ACP synthetase, which is a key enzyme in the fatty acid synthesis process, widely exists in bacteria and has no homology with human bodies. However, fabH can only catalyze acetyl-coa to react, thus greatly limiting the types and yields of products that can be produced, and currently, the modification of β -ketoacyl-ACP synthase is a key technology for realizing novel fatty acid production and high fatty acid production.
Disclosure of Invention
The invention aims to provide a beta-ketoacyl-ACP synthetase mutant and application thereof. Site-directed mutagenesis of fabH genes from enterobacteriaceae and other gram-negative bacteria to catalyze novel substrates; the plasmid with mutant fabH gene is introduced into bacteria of the genus Escherichia for fermentation production, so as to realize the accumulation of fatty acid, thereby making up for the defects of the prior art.
The mutant of the beta-ketoacyl-ACP synthetase is characterized in that the site 189 in the beta-ketoacyl-ACP synthetase derived from escherichia coli is mutated from leucine to serine, and/or the site 157 is mutated from phenylalanine to aspartic acid.
The amino acid sequence of the beta-ketoacyl-ACP synthetase mutant is any one of SEQ ID NOs 1-3.
Another aspect of the present invention relates to a gene encoding a mutant β -ketoacyl-ACP synthase, the nucleotide sequence of which is any one of SEQ ID NOS.4 to 6.
The gene sequence encoding the beta-ketoacyl-ACP synthase mutant of the present invention may be variously selected in consideration of codon degeneracy, but preferred is a preferred codon of Escherichia.
The present invention also includes recombinant plasmids expressing the beta-ketoacyl-ACP synthase mutants.
The beta-ketoacyl-ACP synthetase encoding gene is subjected to point mutation, so that the beta-ketoacyl-ACP synthetase encoding gene can catalyze the acylation reaction of an unnatural substrate butyryl-CoA.
Detailed Description
The present invention is further illustrated below with reference to examples, in which experimental procedures not specifying specific conditions may generally be run under conventional conditions, such as those described in molecular cloning, a laboratory manual written by sambrook (j.sambrook), et al, or according to conditions recommended by equipment or reagent manufacturers.
Example 1 obtaining of FABH mutants
Obtaining the wild Gene of FABH
Coli MG1655 was cultured in LB medium at 37 ℃ and 200rpm for 12-16 hours, and then cells were collected and genomic DNA of the cells was extracted using a biomaga genomic miniprep. The following primer pairs were used: forward primer GCGCCATATGTCGATTGAACAGG (SEQ ID NO: 7), reverse primer 5 '-3' -CTCACTCGAGCTTCAGCAAACGTTTCTTCGACA (SEQ ID NO: 8), amplification of fabH gene from E.coli MG1655 genomic DNA. Wherein, nde1 restriction site is introduced into the forward primer, and Xho1 restriction site is introduced into the reverse primer. The amplified fragment was digested with Nde1 enzyme and Xho1 enzyme, and the plasmid pET21a + for expression was cut at the same digestion site to obtain a common cohesive end, which was ligated by ligase. The ligation product was transformed into E.coli, e.g., E.coli BL21 (DE 3), by electrotransformation, to obtain plasmid pGFB1. The pGFB1 plasmid introduced 6 histidine tags at the C-terminus of the fabH gene.
2. Implementation of site-directed mutagenesis
Using Stratagene series
XL-II site-directed mutagenesis kit, which is used for introducing a mutation site Leu189Ser into plasmid pGFB1 by PCR through a primer Leu189Ser-F/Leu189Ser-R (shown in Table 1), namely, leucine at the fabH 189 is replaced by serine. The obtained plasmid is recovered by PCR products, enzyme in a PCR system and salt ions in a buffer system are removed, and then the method is adoptedDpn1 enzyme digestion for 1h, remove the methylated template plasmid DNA. The treated plasmid was chemically transformed into competent cell Tran10. The correct mutant plasmid was named pGFB5, carrying the fabH mutant with the nucleotide sequence SEQ ID NO 5 and the translated amino acid sequence SEQ ID NO 1.
The mutation site Phe157Asp, i.e.the phenylalanine at position fabH 157 is replaced by aspartic acid, was introduced by PCR of plasmid pGFB1 with the same primers Phe157Asp F/Phe157Asp R (see Table 1). And transformed into competent cells Tran10. The correct mutant plasmid was named pGFB6, carrying the fabH mutant with the nucleotide sequence SEQ ID NO. 4 and the translated amino acid sequence SEQ ID NO. 2.
Similarly, plasmid pGFB5 carrying the fabH gene is subjected to PCR by using Phe157Asp F/Phe157Asp R to obtain the fabH gene with double mutation sites (Leu 189Ser/Phe157 Asp), which is named as pGFB7, the nucleotide sequence of which is SEQ ID NO. 6, the amino acid sequence of which is SEQ ID NO. 3, and the fabH gene is a fabH mutant with the double mutation sites. And finally, respectively transferring pGFB5, pGFB6 and pGFB7 into an expression host E.coli BL21 (DE 3) by an electrotransformation method.
Table 1: primer list for point mutation
Example 2 in vitro Effect testing of FABH mutants
1. Expression and purification of proteins
First, single colonies of BL21 (DE 3) (pGFB 1) containing fabH, BL21 (DE 3) (pGFB 5) containing fabH 189, BL21 (DE 3) (pGFB 6) containing fabH 157 and BL21 (DE 3) (pGFB 7) containing fabH 189/157 were inoculated from the plate to 5ml of LB medium containing 100. Mu.g/ml ampicillin, and cultured at 37 ℃ and 200rpm for 5 hours until OD600 became about 1.0. 2ml of the first-order seed liquid with OD of about 1.0 was transferred to 100ml of fresh LB medium containing 100. Mu.g/ml ampicillin and cultured overnight at 20 ℃. After the collection of the cells, the cells were disrupted by ultrasonication for 10 minutes, and the ultrasonication was stopped for 3 seconds for 1 second, and the proteins were purified by a nickel column. Protein quantification was carried out by BCA (Bicinchoninic Acid) method, and protein purity was confirmed by SDS-PAGE method. The results show that the protein purity is more than 90%.
2. In vitro assay (fabH activity assay)
The following reaction system was used for enzyme activity assay, as shown in table 2 below:
TABLE 2 enzyme activity measurement reaction System
The mutant strain is obtained by mutating 189 th amino acid of Escherichia coli fabH from leucine to serine (Leu 189Ser, with amino acid sequence of SEQ ID NO: 1), and 157 th amino acid to phenylalanine to aspartic acid (Phe 157Asp, with amino acid sequence of SEQ ID NO: 2). One unit of enzyme activity is defined herein as the amount of protein (mg) required to consume 1mM substrate in 1 minute.
Table 3: comparison of the absolute enzyme Activity between wild type and mutant (enzyme Activity Unit contained in 1mg protein)
Example 3: use of mutants
1. Fermentation process
The plasmid constructed above is transferred into Escherichia coli MG1655 to be cultured in a shake flask, and the components of the culture medium are as follows:
table 4: formula components of culture medium
Wherein glucose and CaCO 3 And (5) sterilizing separately.
The fermentation broth was neutralized with CaCO by addition of 0.5M HCl 3 Thereafter, the OD600 value was measured. Adding 50-100 mu every 3 hoursAdjusting the pH value to be more than or equal to 7 by using L ammonia water. Shaking and culturing at 37 deg.C and 200rpm until OD600 is about 0.8, adding inducer IPTG to final concentration of 1 mmol. L -1 The culture was continued for 32 hours, and the cells were collected by centrifugation.
2. And (3) fermentation result:
under the same fermentation conditions, the growth and sugar consumption of three strains of bacteria over-expressing the fabH gene are basically consistent, but when the residual sugar is exhausted within 32 hours, the fabH over-expressing the 189 th amino acid can produce 1.255g/L of fatty acid (mixed product), while the fabH over-expressing wild type can only produce 0.631g/L of acid, and the yield of the fatty acid of the mutant is improved by nearly 50 percent compared with that of the wild type strain. If two sites are mutated at the same time, the acid production effect is similar to that of single mutation.
Table 5: fatty acid yield at 32h of fermentation
The results show that the recombinant plasmids of the three mutants have the effect of remarkably improving the yield of the fatty acid after being transferred into the escherichia coli, and the improvement of the yield of the fatty acid is the basis for improving the yield of other compounds taking the fatty acid as a precursor, so the recombinant plasmids have good application prospect.
Sequence listing
<110> Binzhou medical college
<120> a beta-ketoacyl-ACP synthase mutant
<130> 1
<141> 2018-11-29
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 317
<212> PRT
<213> Artificial Sequence
<400> 1
Met Tyr Thr Lys Ile Ile Gly Thr Gly Ser Tyr Leu Pro Glu Gln Val
1 5 10 15
Arg Thr Asn Ala Asp Leu Glu Lys Met Val Asp Thr Ser Asp Glu Trp
20 25 30
Ile Val Thr Arg Thr Gly Ile Arg Glu Arg His Ile Ala Ala Pro Asn
35 40 45
Glu Thr Val Ser Thr Met Gly Phe Glu Ala Ala Thr Arg Ala Ile Glu
50 55 60
Met Ala Gly Ile Glu Lys Asp Gln Ile Gly Leu Ile Val Val Ala Thr
65 70 75 80
Thr Ser Ala Thr His Ala Phe Pro Ser Ala Ala Cys Gln Ile Gln Ser
85 90 95
Met Leu Gly Ile Lys Gly Cys Pro Ala Phe Asp Val Ala Ala Ala Cys
100 105 110
Ala Gly Phe Thr Tyr Ala Leu Ser Val Ala Asp Gln Tyr Val Lys Ser
115 120 125
Gly Ala Val Lys Tyr Ala Leu Val Val Gly Ser Asp Val Leu Ala Arg
130 135 140
Thr Cys Asp Pro Thr Asp Arg Gly Thr Ile Ile Ile Phe Gly Asp Gly
145 150 155 160
Ala Gly Ala Ala Val Leu Ala Ala Ser Glu Glu Pro Gly Ile Ile Ser
165 170 175
Thr His Leu His Ala Asp Gly Ser Tyr Gly Glu Leu Leu Thr Leu Pro
180 185 190
Asn Ala Asp Arg Val Asn Pro Glu Asn Ser Ile His Leu Thr Met Ala
195 200 205
Gly Asn Glu Val Phe Lys Val Ala Val Thr Glu Leu Ala His Ile Val
210 215 220
Asp Glu Thr Leu Ala Ala Asn Asn Leu Asp Arg Ser Gln Leu Asp Trp
225 230 235 240
Leu Val Pro His Gln Ala Asn Leu Arg Ile Ile Ser Ala Thr Ala Lys
245 250 255
Lys Leu Gly Met Ser Met Asp Asn Val Val Val Thr Leu Asp Arg His
260 265 270
Gly Asn Thr Ser Ala Ala Ser Val Pro Cys Ala Leu Asp Glu Ala Val
275 280 285
Arg Asp Gly Arg Ile Lys Pro Gly Gln Leu Val Leu Leu Glu Ala Phe
290 295 300
Gly Gly Gly Phe Thr Trp Gly Ser Ala Leu Val Arg Phe
305 310 315
<210> 2
<211> 317
<212> PRT
<213> Artificial Sequence
<400> 2
Met Tyr Thr Lys Ile Ile Gly Thr Gly Ser Tyr Leu Pro Glu Gln Val
1 5 10 15
Arg Thr Asn Ala Asp Leu Glu Lys Met Val Asp Thr Ser Asp Glu Trp
20 25 30
Ile Val Thr Arg Thr Gly Ile Arg Glu Arg His Ile Ala Ala Pro Asn
35 40 45
Glu Thr Val Ser Thr Met Gly Phe Glu Ala Ala Thr Arg Ala Ile Glu
50 55 60
Met Ala Gly Ile Glu Lys Asp Gln Ile Gly Leu Ile Val Val Ala Thr
65 70 75 80
Thr Ser Ala Thr His Ala Phe Pro Ser Ala Ala Cys Gln Ile Gln Ser
85 90 95
Met Leu Gly Ile Lys Gly Cys Pro Ala Phe Asp Val Ala Ala Ala Cys
100 105 110
Ala Gly Phe Thr Tyr Ala Leu Ser Val Ala Asp Gln Tyr Val Lys Ser
115 120 125
Gly Ala Val Lys Tyr Ala Leu Val Val Gly Ser Asp Val Leu Ala Arg
130 135 140
Thr Cys Asp Pro Thr Asp Arg Gly Thr Ile Ile Ile Asp Gly Asp Gly
145 150 155 160
Ala Gly Ala Ala Val Leu Ala Ala Ser Glu Glu Pro Gly Ile Ile Ser
165 170 175
Thr His Leu His Ala Asp Gly Ser Tyr Gly Glu Leu Leu Thr Leu Pro
180 185 190
Asn Ala Asp Arg Val Asn Pro Glu Asn Ser Ile His Leu Thr Met Ala
195 200 205
Gly Asn Glu Val Phe Lys Val Ala Val Thr Glu Leu Ala His Ile Val
210 215 220
Asp Glu Thr Leu Ala Ala Asn Asn Leu Asp Arg Ser Gln Leu Asp Trp
225 230 235 240
Leu Val Pro His Gln Ala Asn Leu Arg Ile Ile Ser Ala Thr Ala Lys
245 250 255
Lys Leu Gly Met Ser Met Asp Asn Val Val Val Thr Leu Asp Arg His
260 265 270
Gly Asn Thr Ser Ala Ala Ser Val Pro Cys Ala Leu Asp Glu Ala Val
275 280 285
Arg Asp Gly Arg Ile Lys Pro Gly Gln Leu Val Leu Leu Glu Ala Phe
290 295 300
Gly Gly Gly Phe Thr Trp Gly Ser Ala Leu Val Arg Phe
305 310 315
<210> 3
<211> 317
<212> PRT
<213> Artificial Sequence
<400> 3
Met Tyr Thr Lys Ile Ile Gly Thr Gly Ser Tyr Leu Pro Glu Gln Val
1 5 10 15
Arg Thr Asn Ala Asp Leu Glu Lys Met Val Asp Thr Ser Asp Glu Trp
20 25 30
Ile Val Thr Arg Thr Gly Ile Arg Glu Arg His Ile Ala Ala Pro Asn
35 40 45
Glu Thr Val Ser Thr Met Gly Phe Glu Ala Ala Thr Arg Ala Ile Glu
50 55 60
Met Ala Gly Ile Glu Lys Asp Gln Ile Gly Leu Ile Val Val Ala Thr
65 70 75 80
Thr Ser Ala Thr His Ala Phe Pro Ser Ala Ala Cys Gln Ile Gln Ser
85 90 95
Met Leu Gly Ile Lys Gly Cys Pro Ala Phe Asp Val Ala Ala Ala Cys
100 105 110
Ala Gly Phe Thr Tyr Ala Leu Ser Val Ala Asp Gln Tyr Val Lys Ser
115 120 125
Gly Ala Val Lys Tyr Ala Leu Val Val Gly Ser Asp Val Leu Ala Arg
130 135 140
Thr Cys Asp Pro Thr Asp Arg Gly Thr Ile Ile Ile Asp Gly Asp Gly
145 150 155 160
Ala Gly Ala Ala Val Leu Ala Ala Ser Glu Glu Pro Gly Ile Ile Ser
165 170 175
Thr His Leu His Ala Asp Gly Ser Tyr Gly Glu Leu Leu Thr Leu Pro
180 185 190
Asn Ala Asp Arg Val Asn Pro Glu Asn Ser Ile His Leu Thr Met Ala
195 200 205
Gly Asn Glu Val Phe Lys Val Ala Val Thr Glu Leu Ala His Ile Val
210 215 220
Asp Glu Thr Leu Ala Ala Asn Asn Leu Asp Arg Ser Gln Leu Asp Trp
225 230 235 240
Leu Val Pro His Gln Ala Asn Leu Arg Ile Ile Ser Ala Thr Ala Lys
245 250 255
Lys Leu Gly Met Ser Met Asp Asn Val Val Val Thr Leu Asp Arg His
260 265 270
Gly Asn Thr Ser Ala Ala Ser Val Pro Cys Ala Leu Asp Glu Ala Val
275 280 285
Arg Asp Gly Arg Ile Lys Pro Gly Gln Leu Val Leu Leu Glu Ala Phe
290 295 300
Gly Gly Gly Phe Thr Trp Gly Ser Ala Leu Val Arg Phe
305 310 315
<210> 4
<211> 1273
<212> DNA
<213> Artificial Sequence
<400> 4
tcgcgattga acaggcagtg caggcggtgc agcgacaagt tcctcagcga attgccgctc 60
gcctggaatc tgtataccca gctggttttg agctgctgga cggtggcaaa agcggaactc 120
tgcggtagca ggacgctgcc agcgaactcg cagtttgcaa gtgacggtat ataaccgaaa 180
agtgactgag cgtacatgta tacgaagatt attggtactg gcagctatct gcccgaacaa 240
gtgcggacaa acgccgattt ggaaaaaatg gtggacacct ctgacgagtg gattgtcact 300
cgtaccggta tccgcgaacg ccacattgcc gcgccaaacg aaaccgtttc aaccatgggc 360
tttgaagcgg cgacacgcgc aattgagatg gcgggcattg agaaagacca gattggcctg 420
atcgttgtgg caacgacttc tgctacgcac gctttcccga gcgcagcttg tcagattcaa 480
agcatgttgg gcattaaagg ttgcccggca tttgacgttg cagcagcctg cgcaggtttc 540
acctatgcat taagcgtagc cgatcaatac gtgaaatctg gggcggtgaa gtatgctctg 600
gtcgtcggtt ccgatgtact ggcgcgcacc tgcgatccaa ccgatcgtgg gactattatt 660
attattggcg atggcgcggg cgctgcggtg ctggctgcct ctgaagagcc gggaatcatt 720
tccacccatc tgcatgccga cggtagttat ggtgaattgc tgacgctgcc aaacgccgac 780
cgcgtgaatc cagagaattc aattcatctg acgatggcgg gcaacgaagt cttcaaggtt 840
gcggtaacgg aactggcgca catcgttgat gagacgctgg cggcgaataa tcttgaccgt 900
tctcaactgg actggctggt tccgcatcag gctaacctgc gtattatcag tgcaacggcg 960
aaaaaactcg gtatgtctat ggataatgtc gtggtgacgc tggatcgcca cggtaatacc 1020
tctgcggcct ctgtcccgtg cgcgctggat gaagctgtac gcgacgggcg cattaagccg 1080
gggcagttgg ttctgcttga agcctttggc ggtggattca cctggggctc cgcgctggtt 1140
cgtttctagg ataaggatta aaacatgacg caatttgcat ttgtgttccc tggacagggt 1200
tctcaaaccg ttggaatgct ggctgatatg gcggcgagct atccaattgt cgaagaaacg 1260
tttgctgaag ctt 1273
<210> 5
<211> 1273
<212> DNA
<213> Artificial Sequence
<400> 5
tcgcgattga acaggcagtg caggcggtgc agcgacaagt tcctcagcga attgccgctc 60
gcctggaatc tgtataccca gctggttttg agctgctgga cggtggcaaa agcggaactc 120
tgcggtagca ggacgctgcc agcgaactcg cagtttgcaa gtgacggtat ataaccgaaa 180
agtgactgag cgtacatgta tacgaagatt attggtactg gcagctatct gcccgaacaa 240
gtgcggacaa acgccgattt ggaaaaaatg gtggacacct ctgacgagtg gattgtcact 300
cgtaccggta tccgcgaacg ccacattgcc gcgccaaacg aaaccgtttc aaccatgggc 360
tttgaagcgg cgacacgcgc aattgagatg gcgggcattg agaaagacca gattggcctg 420
atcgttgtgg caacgacttc tgctacgcac gctttcccga gcgcagcttg tcagattcaa 480
agcatgttgg gcattaaagg ttgcccggca tttgacgttg cagcagcctg cgcaggtttc 540
acctatgcat taagcgtagc cgatcaatac gtgaaatctg gggcggtgaa gtatgctctg 600
gtcgtcggtt ccgatgtact ggcgcgcacc tgcgatccaa ccgatcgtgg gactattatt 660
atttttggcg atggcgcggg cgctgcggtg ctggctgcct ctgaagagcc gggaatcatt 720
tccacccatc tgcatgccga cggtagttat ggtgaattgg ctacgctgcc aaacgccgac 780
cgcgtgaatc cagagaattc aattcatctg acgatggcgg gcaacgaagt cttcaaggtt 840
gcggtaacgg aactggcgca catcgttgat gagacgctgg cggcgaataa tcttgaccgt 900
tctcaactgg actggctggt tccgcatcag gctaacctgc gtattatcag tgcaacggcg 960
aaaaaactcg gtatgtctat ggataatgtc gtggtgacgc tggatcgcca cggtaatacc 1020
tctgcggcct ctgtcccgtg cgcgctggat gaagctgtac gcgacgggcg cattaagccg 1080
gggcagttgg ttctgcttga agcctttggc ggtggattca cctggggctc cgcgctggtt 1140
cgtttctagg ataaggatta aaacatgacg caatttgcat ttgtgttccc tggacagggt 1200
tctcaaaccg ttggaatgct ggctgatatg gcggcgagct atccaattgt cgaagaaacg 1260
tttgctgaag ctt 1273
<210> 6
<211> 1273
<212> DNA
<213> Artificial Sequence
<400> 6
tcgcgattga acaggcagtg caggcggtgc agcgacaagt tcctcagcga attgccgctc 60
gcctggaatc tgtataccca gctggttttg agctgctgga cggtggcaaa agcggaactc 120
tgcggtagca ggacgctgcc agcgaactcg cagtttgcaa gtgacggtat ataaccgaaa 180
agtgactgag cgtacatgta tacgaagatt attggtactg gcagctatct gcccgaacaa 240
gtgcggacaa acgccgattt ggaaaaaatg gtggacacct ctgacgagtg gattgtcact 300
cgtaccggta tccgcgaacg ccacattgcc gcgccaaacg aaaccgtttc aaccatgggc 360
tttgaagcgg cgacacgcgc aattgagatg gcgggcattg agaaagacca gattggcctg 420
atcgttgtgg caacgacttc tgctacgcac gctttcccga gcgcagcttg tcagattcaa 480
agcatgttgg gcattaaagg ttgcccggca tttgacgttg cagcagcctg cgcaggtttc 540
acctatgcat taagcgtagc cgatcaatac gtgaaatctg gggcggtgaa gtatgctctg 600
gtcgtcggtt ccgatgtact ggcgcgcacc tgcgatccaa ccgatcgtgg gactattatt 660
attattggcg atggcgcggg cgctgcggtg ctggctgcct ctgaagagcc gggaatcatt 720
tccacccatc tgcatgccga cggtagttat ggtgaattgg ctacgctgcc aaacgccgac 780
cgcgtgaatc cagagaattc aattcatctg acgatggcgg gcaacgaagt cttcaaggtt 840
gcggtaacgg aactggcgca catcgttgat gagacgctgg cggcgaataa tcttgaccgt 900
tctcaactgg actggctggt tccgcatcag gctaacctgc gtattatcag tgcaacggcg 960
aaaaaactcg gtatgtctat ggataatgtc gtggtgacgc tggatcgcca cggtaatacc 1020
tctgcggcct ctgtcccgtg cgcgctggat gaagctgtac gcgacgggcg cattaagccg 1080
gggcagttgg ttctgcttga agcctttggc ggtggattca cctggggctc cgcgctggtt 1140
cgtttctagg ataaggatta aaacatgacg caatttgcat ttgtgttccc tggacagggt 1200
tctcaaaccg ttggaatgct ggctgatatg gcggcgagct atccaattgt cgaagaaacg 1260
tttgctgaag ctt 1273
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 7
gcgccatatg tcgcgattga acagg 25
<210> 8
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 8
ctcactcgag cttcagcaaa cgtttcttcg aca 33
<210> 9
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 9
ctcactcgag cttcagcaaa cgtttcttcg aca 33
<210> 10
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 10
gaattggcta cgctgccaaa cgccgac 27
<210> 11
<211> 32
<212> DNA
<213> Artificial Sequence
<400> 11
catcgccaat aataataata gtcccacgat cg 32
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 12
tattattatt ggcgatggcg cgggc 25
Claims (4)
1. A beta-ketoacyl-ACP synthetase mutant is obtained by genetic modification of a beta-ketoacyl-ACP synthetase mutant and is characterized in that,
the genetic modification is to mutate the 189 site of beta-ketoacyl-ACP synthetase derived from escherichia coli from leucine to serine and/or to mutate the 157 site from phenylalanine to aspartic acid;
the Escherichia coli isE.coli MG 1655。
2. A gene encoding the β -ketoacyl-ACP synthase mutant of claim 1.
3. A recombinant plasmid for expressing the β -ketoacyl-ACP synthase of claim 1.
4. A method for improving fatty acid yield is characterized in that a beta-ketoacyl-ACP synthetase mutant is expressed in fatty acid synthesis bacteria, and the beta-ketoacyl-ACP synthetase mutant is any one or two of the following:
(a) The site 189 in beta-ketoacyl-ACP synthetase from escherichia coli is obtained by mutating leucine to serine;
(b) The beta-ketoacyl-ACP synthetase derived from escherichia coli is obtained by mutating 189 site from leucine to serine and 157 site from phenylalanine to aspartic acid;
the Escherichia coli isE.coli MG 1655。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811443458.9A CN109517811B (en) | 2018-11-29 | 2018-11-29 | beta-ketoacyl-ACP synthetase mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811443458.9A CN109517811B (en) | 2018-11-29 | 2018-11-29 | beta-ketoacyl-ACP synthetase mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109517811A CN109517811A (en) | 2019-03-26 |
| CN109517811B true CN109517811B (en) | 2022-11-11 |
Family
ID=65794507
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811443458.9A Active CN109517811B (en) | 2018-11-29 | 2018-11-29 | beta-ketoacyl-ACP synthetase mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109517811B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110408603B (en) * | 2019-08-01 | 2022-09-23 | 上海交通大学 | A54145C1 mutant with changed fatty acyl selectivity as well as construction and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103906845A (en) * | 2010-09-15 | 2014-07-02 | Ls9公司 | Production of odd chain fatty acid derivatives in recombinant microbial cells |
| CN106795483A (en) * | 2013-07-19 | 2017-05-31 | 嘉吉公司 | Microorganism and method for producing aliphatic acid and fatty acid derived product |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040181038A1 (en) * | 1999-06-07 | 2004-09-16 | Smithkline Beecham Corporation | Novel fabh enzyme, compositions capable of binding to said enzyme and methods of use thereof |
-
2018
- 2018-11-29 CN CN201811443458.9A patent/CN109517811B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103906845A (en) * | 2010-09-15 | 2014-07-02 | Ls9公司 | Production of odd chain fatty acid derivatives in recombinant microbial cells |
| CN106795483A (en) * | 2013-07-19 | 2017-05-31 | 嘉吉公司 | Microorganism and method for producing aliphatic acid and fatty acid derived product |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109517811A (en) | 2019-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109750011B (en) | Mannose-6-phosphate phosphatase and biological preparation method of mannose | |
| EP2444486B1 (en) | O-phosphoserine sulfhydrylase mutants and method for production of cysteine using the same | |
| CN110791494A (en) | Aspartic enzyme mutant, recombinant expression vector and recombinant bacterium containing aspartic enzyme mutant and application | |
| CN113151201B (en) | High-thermal-stability and high-activity isoeugenol monooxygenase mutant and application thereof | |
| CN113122490B (en) | Double-gene defective engineering bacterium and application thereof in improving yield of N-acetylglucosamine | |
| CN112626057B (en) | Chimeric plant nitrilase mutant, coding gene and application thereof | |
| CN114507658B (en) | Enzyme coexpression system and application thereof in synthesizing sialic acid | |
| CN105713883B (en) | L-proline-4-hydroxylase and application thereof | |
| US20230024648A1 (en) | Ean B Mutants and Their Uses | |
| WO2018165881A1 (en) | Cephalosporin c acylase mutants and applications thereof | |
| CN109517811B (en) | beta-ketoacyl-ACP synthetase mutant | |
| CN110129305B (en) | Cephalosporin C acylase mutant for preparing 7-ACA | |
| KR101836719B1 (en) | A modified 0-acetylhomoserine sulfhydrylase and method of producing L-methionine using the same | |
| CN111019921B (en) | High-tolerance lipid hydrolase E93 and encoding gene and application thereof | |
| KR102084065B1 (en) | Thermostable recombinant cellulase b protein derived from thermotoga maritima and the uses thereof | |
| CN111849953B (en) | Construction and application of threonine dehydratase mutant | |
| CN114591938B (en) | Carboxylase mutant and preparation method and application thereof | |
| CN110951717B (en) | L-arabinose isomerase isomer and application thereof | |
| CN111057698B (en) | L-arabinose isomerase, mutant and application thereof | |
| CA2542576C (en) | Transgenic organisms with lower growth temperature | |
| CN112391373A (en) | Glutamic acid decarboxylase GADZ1 for high yield of gamma-aminobutyric acid and gene and application thereof | |
| CN115975965A (en) | Lactate dehydrogenase and coding gene, recombinant vector, recombinant bacterium and leavening agent thereof, and application of lactate dehydrogenase and coding gene, recombinant vector, recombinant bacterium and leavening agent | |
| KR101223666B1 (en) | Method for preparing a carboxylic acid using nitrilase ORN | |
| KR101223663B1 (en) | Method for preparing a carboxylic acid using nitrilase VMN1 | |
| KR101223664B1 (en) | Method for preparing a carboxylic acid using nitrilase RMN1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |