CN109517811A - A kind of β -one acyl-ACP synthase mutant - Google Patents

A kind of β -one acyl-ACP synthase mutant Download PDF

Info

Publication number
CN109517811A
CN109517811A CN201811443458.9A CN201811443458A CN109517811A CN 109517811 A CN109517811 A CN 109517811A CN 201811443458 A CN201811443458 A CN 201811443458A CN 109517811 A CN109517811 A CN 109517811A
Authority
CN
China
Prior art keywords
ala
acyl
val
gly
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811443458.9A
Other languages
Chinese (zh)
Other versions
CN109517811B (en
Inventor
耿枫
代现平
李孟顺
刘明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Binzhou Medical College
Original Assignee
Binzhou Medical College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Binzhou Medical College filed Critical Binzhou Medical College
Priority to CN201811443458.9A priority Critical patent/CN109517811B/en
Publication of CN109517811A publication Critical patent/CN109517811A/en
Application granted granted Critical
Publication of CN109517811B publication Critical patent/CN109517811B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01179—Beta-ketoacyl-acyl-carrier-protein synthase II (2.3.1.179)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to be specifically related to a kind of β -one acyl-ACP synthase mutant and its application, the β -one acyl-ACP synzyme (fabH) of enterobacteriaceae is originated from by transformation, can non-natural catalysis reaction, in enterobacteria realize novel fatty acid a large amount of accumulation.It is characterized in that, the transformation is 189 sites in β -one acyl-ACP synzyme (fabH) to be sported serine by leucine, and/or 157 sites are sported aspartic acid by phenylalanine.The present invention can be catalyzed non-natural reaction by the way that β -one acyl-ACP synzyme is carried out site mutation by the method for structure biology.The gene of above-mentioned mutation is connected on plasmid, and the overexpression in the Escherichia coli of wild type, substantially increases the yield of fatty acid in enterobacteria.

Description

A kind of β -one acyl-ACP synthase mutant
Technical field
The invention belongs to the design and rational fields of metabolic engineering and enzyme, and in particular to a kind of β -one acyl-ACP synzyme is prominent Variant and its application are originated from the β -one acyl-ACP synzyme (fabH) of enterobacteriaceae by transformation, can non-natural Catalysis reaction, realizes a large amount of accumulation of fatty acid in enterobacteria.
Background technique
In vivo, fatty acid synthesis (FAS) approach includes two types: FAS I and FAS II.I type of FAS is present in the food in one's mouth In newborn animal body, belong to high-effect but single product fatty acid synthesis pathway；FAS II is present in animals and plants, bacterium, fungi etc. In vivo, this approach is the protein system of a dispersion, and each step of fatty acid synthesis is closed by different single function enzymatics At metabolite multiplicity, target spot is abundant, is very helpful for research to the novel antibacterial drug of antibacterial resistance.β- Ketoacyl-ACP synzyme III (fabH or KAS III) is one of single function enzyme in II type approach of bacterium FAS.Why the target is selected The advantage of point is: thus 1. first condensation reaction of FabH enzymatic bacterium FAS approach, the extension of chain start, control The starting of bacterial fatty acid synthesis, and the extension for chain below provides substrate, is the key enzyme in reaction process；2. bacterium The difference of fatty acid synthetase system and human body, without homology.Therefore, press down by novel antibacterial drug target target of fabH enzyme The research of preparation becomes hot spot both domestic and external.Currently, the domestic and international reported compound for having inhibiting effect for fabH target spot Have: cerulenin；Sulphur moldin；Plate mycin；Sulfur-containing compound；Cinnamic acid derivative etc..
By overexpression ketoacyl-ACP synzyme, it can be achieved that a large amount of accumulation of the fatty acid in enterobacteria.β -one Acyl-ACP synzyme is widely present in bacterium as key enzyme in fatty acid synthesis process, and with human body without homology.So And fabH can only be catalyzed acetyl coenzyme A and be reacted, therefore significantly limit the type and yield of the product being able to produce, Currently, being to realize the key technology of novel fatty acid production and high yield fatty acid to the transformation of β -one acyl-ACP synzyme.
Summary of the invention
The object of the present invention is to provide a kind of β -one acyl-ACP synthase mutant and its applications.To from enterobacteria The fabH gene of section and other Gram-negative bacteria bacteriums carries out rite-directed mutagenesis, can be catalyzed novel substrate；It will be with prominent The plasmid of modification fabH gene imports in the bacterium that angstrom Xi Shi belongs to and carries out fermenting and producing, the accumulation of fatty acid is realized, to make up The deficiencies in the prior art.
β -one acyl-ACP synthase mutant of the invention, which is characterized in that the transformation is to carry out Escherichia coli 189 sites in the β -one acyl-ACP synzyme in source have leucine to sport serine, and/or by 157 sites by phenylpropyl alcohol ammonia Acid mutation is aspartic acid.
The amino acid sequence of above-mentioned β -one acyl-ACP synthase mutant is any in SEQ IDNO:1-3.
Another aspect of the present invention relates to the gene of coding β -one acyl-ACP synthase mutant, the nucleotide of the gene Sequence is any in SEQ ID NO:4-6.
In view of the degeneracy of codon, the gene order for encoding β -one acyl-ACP synthase mutant of the present invention can be with There are many, but the preferred codons that preferably angstrom Xi Shi belongs to.
The invention also includes the recombinant plasmids for having expression β -one acyl-ACP synthase mutant.
The present invention can be catalyzed non-natural bottom by the way that β -one acyl-ACP synthetase-coding gene is carried out point mutation The acylation reaction of object butyryl coenzyme A.
Specific embodiment
Below with reference to example, the present invention will be further described, in embodiment test method without specific conditions, Usually can routinely condition, item described in " Molecular Cloning:A Laboratory guide " write such as Pehanorm Brooker (J.Sambrook) etc. Part, or run according to condition proposed by equipment or reagent production firm.
The acquisition of embodiment 1, FABH mutant
The acquisition of 1.FABH wild gene
By E.coli MG1655 in LB culture medium, 37 DEG C, 200rpm, after cultivating 12-16h, cell is collected, is used The small extraction reagent kit of Biomiga genome, extracts the genomic DNA of cell.Use following primer pair: forward primer GCGCCATATGTCGCGATTGAACAGG (SEQ ID NO:7), reverse primer 5`-3`CTCACTCGAGCTTCAGCAAACGTT TCTTCGACA (SEQ IDNO:8) expands fabH gene from E.coli MG1655 genomic DNA.Wherein forward primer introduces Nde1 restriction enzyme site, reverse primer introduce the restriction enzyme site of Xho1.Enzyme is carried out to amplified fragments with Nde1 enzyme and Xho1 enzyme It cuts, cuts the plasmid pET21a+ for expression using identical restriction enzyme site, obtain common cohesive end, pass through ligase It is attached.Connection product is transferred in Escherichia coli by way of electrotransformation, such as E.coli BL21 (DE3), obtains plasmid pGFB1.PGFB1 plasmid introduces 6 histidine tags in the C-terminal of fabH gene.
2. the realization of rite-directed mutagenesis
Utilize Stratagene seriesII site-directed mutagenesis kit of XL-, passes through primer Leu189Ser-F/Leu189Ser-R (being shown in Table 1) carries out PCR to plasmid pGFB1 and introduces mutational site Leu189Ser, i.e., will The leucine that fabH is 189 replaces with serine.The plasmid of acquisition by PCR product recycle, remove PCR system in enzyme and After salt ion in buffer system, using Dpn1 digestion 1h, except the template plasmid DNA of demethylation.Treated, and plasmid carries out Chemical conversion is transferred to competent cell Tran10.Correct mutant plasmid is named as pGFB5, the fabH mutant nucleotide of carrying Sequence is SEQ ID NO:5, and the amino acid sequence of translation is SEQ ID NO:1.
Plasmid pGFB1 is carried out using identical method by primer Phe157Asp F/Phe157Asp R (being shown in Table 1) PCR introduces mutational site Phe157Asp, i.e., fabH 157 phenylalanines is replaced with aspartic acid.And it is transformed into impression In state cell Tran10.Correct mutant plasmid is named as pGFB6, and the fabH mutant nucleotides sequence of carrying is classified as SEQ IDNO: 4, the amino acid sequence of translation is SEQ ID NO:2.
Similarly, PCR is carried out to the plasmid pGFB5 for carrying fabH gene with Phe157Asp F/Phe157Asp R to be had There is the fabH gene in double mutational sites (Leu189Ser/Phe157Asp), be named as pGFB7, nucleotides sequence is classified as SEQ ID NO:6, amino acid sequence are SEQ ID NO:3, are the fabH mutant with double mutational sites.Finally by electrotransformation method PGFB5, pGFB6, pGFB7 are transferred in expressive host E.coli BL21 (DE3) respectively.
Table 1: point mutation the primer table
Embodiment 2, the detection of the in vitro effects of FABH mutant
1, the expression and purifying of albumen
It is chosen from plate first BL21 (DE3) (pGFB1) (containing fabH), BL21 (DE3) (pGFB5) (189* containing fabH), BL21 (DE3) (pGFB6) (157* containing fabH), BL21 (DE3) (pGFB7) (189* containing fabH/157*) single colonie be connected to In LB culture medium of the 5ml containing 100 μ g/ml ampicillins, 37 degree 200rpm cultivate 5 hours to OD600 be 1.0 or so.Take 2ml The primary seed solution that OD is 1.0 or so is transferred in fresh LB of the 100ml containing 100 μ g/ml ampicillins, is used 20 degree of overnight incubations.After collecting thallus, ultrasonic disruption thalline 10 minutes, ultrasound was stopped 3 seconds for 1 second, was carried out with nickel column to albumen pure Change.Protein quantification is carried out by BCA (Bicinchoninic Acid) method, determines purity of protein with the method for SDS-PAGE.Knot Fruit shows that purity of protein is all larger than 90%.
2, experiment in vitro (fabH vitality test)
Enzyme assay is carried out using following reaction system, such as the following table 2:
2 enzyme activity determination reaction system of table
Mutant strain be by 189 amino acids of Escherichia coli fabH from leucine sport serine (Leu189Ser, Amino acid sequence is SEQ ID NO:1), become phenylpropyl alcohol for 157 and sports aspartic acid (Phe157Asp, amino acid sequence are SEQ ID NO:2).Wherein, protein content (mg) needed for an enzyme-activity unit is defined as 1 minute consumption 1mM substrate.
Table 3: wild type and the absolute enzyme activity of saltant type compare (enzyme-activity unit that 1mg albumen is included)
Embodiment 3: the application of mutant
1, fermentation process
The plasmid of above-mentioned building is transferred in Escherichia coli MG1655 and is cultivated in shaking flask, medium component is as follows:
Table 4: the recipe ingredient of culture medium
Wherein glucose and CaCO3Individually sterilizing.
Fermentation liquid passes through in the HCl that 0.5M is added and CaCO3Afterwards, OD600 value is measured.50-100 μ can be added every 3 hours L ammonium hydroxide adjusts pH >=7.Shaken cultivation is about 0.8 to OD600 under conditions of 37 DEG C and 200rpm, and inducer IPTG is added extremely Dense 1mmolL eventually-1, continue culture 32 hours, thalline were collected by centrifugation.
2, fermentation results:
Under identical fermentation condition, three plants of bacterium of overexpression fabH gene, growth and the sugared situation of consumption are almost the same, but When residual sugar exhausts within 32 hours, the fabH that overexpression is mutated 189 amino acids can produce fatty acid (the mixing production of 1.255g/L Object), and the fabH of overexpresses wild-type can only produce the acid of 0.631g/L, mutant is improved than wild-type strain aliphatic acid yield Nearly 50%.If it is close with single mutation to be produced sour effect for two site simultaneous mutations.
Table 5: aliphatic acid yield when fermentation 32h
After the above results show that the recombinant plasmid of three kinds of mutant of the invention is transferred to Escherichia coli, all has and significantly mention The effect of high fatty acid yield, the yield for improving fatty acid are to improve the basis for other compound productions that fatty acid is precursor, Thus have a good application prospect.
Sequence table
<110>Binzhou Medical College
<120>a kind of β -one acyl-ACP synthase mutant
<130> 1
<141> 2018-11-29
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 317
<212> PRT
<213> Artificial Sequence
<400> 1
Met Tyr Thr Lys Ile Ile Gly Thr Gly Ser Tyr Leu Pro Glu Gln Val
1 5 10 15
Arg Thr Asn Ala Asp Leu Glu Lys Met Val Asp Thr Ser Asp Glu Trp
20 25 30
Ile Val Thr Arg Thr Gly Ile Arg Glu Arg His Ile Ala Ala Pro Asn
35 40 45
Glu Thr Val Ser Thr Met Gly Phe Glu Ala Ala Thr Arg Ala Ile Glu
50 55 60
Met Ala Gly Ile Glu Lys Asp Gln Ile Gly Leu Ile Val Val Ala Thr
65 70 75 80
Thr Ser Ala Thr His Ala Phe Pro Ser Ala Ala Cys Gln Ile Gln Ser
85 90 95
Met Leu Gly Ile Lys Gly Cys Pro Ala Phe Asp Val Ala Ala Ala Cys
100 105 110
Ala Gly Phe Thr Tyr Ala Leu Ser Val Ala Asp Gln Tyr Val Lys Ser
115 120 125
Gly Ala Val Lys Tyr Ala Leu Val Val Gly Ser Asp Val Leu Ala Arg
130 135 140
Thr Cys Asp Pro Thr Asp Arg Gly Thr Ile Ile Ile Phe Gly Asp Gly
145 150 155 160
Ala Gly Ala Ala Val Leu Ala Ala Ser Glu Glu Pro Gly Ile Ile Ser
165 170 175
Thr His Leu His Ala Asp Gly Ser Tyr Gly Glu Leu Leu Thr Leu Pro
180 185 190
Asn Ala Asp Arg Val Asn Pro Glu Asn Ser Ile His Leu Thr Met Ala
195 200 205
Gly Asn Glu Val Phe Lys Val Ala Val Thr Glu Leu Ala His Ile Val
210 215 220
Asp Glu Thr Leu Ala Ala Asn Asn Leu Asp Arg Ser Gln Leu Asp Trp
225 230 235 240
Leu Val Pro His Gln Ala Asn Leu Arg Ile Ile Ser Ala Thr Ala Lys
245 250 255
Lys Leu Gly Met Ser Met Asp Asn Val Val Val Thr Leu Asp Arg His
260 265 270
Gly Asn Thr Ser Ala Ala Ser Val Pro Cys Ala Leu Asp Glu Ala Val
275 280 285
Arg Asp Gly Arg Ile Lys Pro Gly Gln Leu Val Leu Leu Glu Ala Phe
290 295 300
Gly Gly Gly Phe Thr Trp Gly Ser Ala Leu Val Arg Phe
305 310 315
<210> 2
<211> 317
<212> PRT
<213> Artificial Sequence
<400> 2
Met Tyr Thr Lys Ile Ile Gly Thr Gly Ser Tyr Leu Pro Glu Gln Val
1 5 10 15
Arg Thr Asn Ala Asp Leu Glu Lys Met Val Asp Thr Ser Asp Glu Trp
20 25 30
Ile Val Thr Arg Thr Gly Ile Arg Glu Arg His Ile Ala Ala Pro Asn
35 40 45
Glu Thr Val Ser Thr Met Gly Phe Glu Ala Ala Thr Arg Ala Ile Glu
50 55 60
Met Ala Gly Ile Glu Lys Asp Gln Ile Gly Leu Ile Val Val Ala Thr
65 70 75 80
Thr Ser Ala Thr His Ala Phe Pro Ser Ala Ala Cys Gln Ile Gln Ser
85 90 95
Met Leu Gly Ile Lys Gly Cys Pro Ala Phe Asp Val Ala Ala Ala Cys
100 105 110
Ala Gly Phe Thr Tyr Ala Leu Ser Val Ala Asp Gln Tyr Val Lys Ser
115 120 125
Gly Ala Val Lys Tyr Ala Leu Val Val Gly Ser Asp Val Leu Ala Arg
130 135 140
Thr Cys Asp Pro Thr Asp Arg Gly Thr Ile Ile Ile Asp Gly Asp Gly
145 150 155 160
Ala Gly Ala Ala Val Leu Ala Ala Ser Glu Glu Pro Gly Ile Ile Ser
165 170 175
Thr His Leu His Ala Asp Gly Ser Tyr Gly Glu Leu Leu Thr Leu Pro
180 185 190
Asn Ala Asp Arg Val Asn Pro Glu Asn Ser Ile His Leu Thr Met Ala
195 200 205
Gly Asn Glu Val Phe Lys Val Ala Val Thr Glu Leu Ala His Ile Val
210 215 220
Asp Glu Thr Leu Ala Ala Asn Asn Leu Asp Arg Ser Gln Leu Asp Trp
225 230 235 240
Leu Val Pro His Gln Ala Asn Leu Arg Ile Ile Ser Ala Thr Ala Lys
245 250 255
Lys Leu Gly Met Ser Met Asp Asn Val Val Val Thr Leu Asp Arg His
260 265 270
Gly Asn Thr Ser Ala Ala Ser Val Pro Cys Ala Leu Asp Glu Ala Val
275 280 285
Arg Asp Gly Arg Ile Lys Pro Gly Gln Leu Val Leu Leu Glu Ala Phe
290 295 300
Gly Gly Gly Phe Thr Trp Gly Ser Ala Leu Val Arg Phe
305 310 315
<210> 3
<211> 317
<212> PRT
<213> Artificial Sequence
<400> 3
Met Tyr Thr Lys Ile Ile Gly Thr Gly Ser Tyr Leu Pro Glu Gln Val
1 5 10 15
Arg Thr Asn Ala Asp Leu Glu Lys Met Val Asp Thr Ser Asp Glu Trp
20 25 30
Ile Val Thr Arg Thr Gly Ile Arg Glu Arg His Ile Ala Ala Pro Asn
35 40 45
Glu Thr Val Ser Thr Met Gly Phe Glu Ala Ala Thr Arg Ala Ile Glu
50 55 60
Met Ala Gly Ile Glu Lys Asp Gln Ile Gly Leu Ile Val Val Ala Thr
65 70 75 80
Thr Ser Ala Thr His Ala Phe Pro Ser Ala Ala Cys Gln Ile Gln Ser
85 90 95
Met Leu Gly Ile Lys Gly Cys Pro Ala Phe Asp Val Ala Ala Ala Cys
100 105 110
Ala Gly Phe Thr Tyr Ala Leu Ser Val Ala Asp Gln Tyr Val Lys Ser
115 120 125
Gly Ala Val Lys Tyr Ala Leu Val Val Gly Ser Asp Val Leu Ala Arg
130 135 140
Thr Cys Asp Pro Thr Asp Arg Gly Thr Ile Ile Ile Asp Gly Asp Gly
145 150 155 160
Ala Gly Ala Ala Val Leu Ala Ala Ser Glu Glu Pro Gly Ile Ile Ser
165 170 175
Thr His Leu His Ala Asp Gly Ser Tyr Gly Glu Leu Leu Thr Leu Pro
180 185 190
Asn Ala Asp Arg Val Asn Pro Glu Asn Ser Ile His Leu Thr Met Ala
195 200 205
Gly Asn Glu Val Phe Lys Val Ala Val Thr Glu Leu Ala His Ile Val
210 215 220
Asp Glu Thr Leu Ala Ala Asn Asn Leu Asp Arg Ser Gln Leu Asp Trp
225 230 235 240
Leu Val Pro His Gln Ala Asn Leu Arg Ile Ile Ser Ala Thr Ala Lys
245 250 255
Lys Leu Gly Met Ser Met Asp Asn Val Val Val Thr Leu Asp Arg His
260 265 270
Gly Asn Thr Ser Ala Ala Ser Val Pro Cys Ala Leu Asp Glu Ala Val
275 280 285
Arg Asp Gly Arg Ile Lys Pro Gly Gln Leu Val Leu Leu Glu Ala Phe
290 295 300
Gly Gly Gly Phe Thr Trp Gly Ser Ala Leu Val Arg Phe
305 310 315
<210> 4
<211> 1273
<212> DNA
<213> Artificial Sequence
<400> 4
tcgcgattga acaggcagtg caggcggtgc agcgacaagt tcctcagcga attgccgctc 60
gcctggaatc tgtataccca gctggttttg agctgctgga cggtggcaaa agcggaactc 120
tgcggtagca ggacgctgcc agcgaactcg cagtttgcaa gtgacggtat ataaccgaaa 180
agtgactgag cgtacatgta tacgaagatt attggtactg gcagctatct gcccgaacaa 240
gtgcggacaa acgccgattt ggaaaaaatg gtggacacct ctgacgagtg gattgtcact 300
cgtaccggta tccgcgaacg ccacattgcc gcgccaaacg aaaccgtttc aaccatgggc 360
tttgaagcgg cgacacgcgc aattgagatg gcgggcattg agaaagacca gattggcctg 420
atcgttgtgg caacgacttc tgctacgcac gctttcccga gcgcagcttg tcagattcaa 480
agcatgttgg gcattaaagg ttgcccggca tttgacgttg cagcagcctg cgcaggtttc 540
acctatgcat taagcgtagc cgatcaatac gtgaaatctg gggcggtgaa gtatgctctg 600
gtcgtcggtt ccgatgtact ggcgcgcacc tgcgatccaa ccgatcgtgg gactattatt 660
attattggcg atggcgcggg cgctgcggtg ctggctgcct ctgaagagcc gggaatcatt 720
tccacccatc tgcatgccga cggtagttat ggtgaattgc tgacgctgcc aaacgccgac 780
cgcgtgaatc cagagaattc aattcatctg acgatggcgg gcaacgaagt cttcaaggtt 840
gcggtaacgg aactggcgca catcgttgat gagacgctgg cggcgaataa tcttgaccgt 900
tctcaactgg actggctggt tccgcatcag gctaacctgc gtattatcag tgcaacggcg 960
aaaaaactcg gtatgtctat ggataatgtc gtggtgacgc tggatcgcca cggtaatacc 1020
tctgcggcct ctgtcccgtg cgcgctggat gaagctgtac gcgacgggcg cattaagccg 1080
gggcagttgg ttctgcttga agcctttggc ggtggattca cctggggctc cgcgctggtt 1140
cgtttctagg ataaggatta aaacatgacg caatttgcat ttgtgttccc tggacagggt 1200
tctcaaaccg ttggaatgct ggctgatatg gcggcgagct atccaattgt cgaagaaacg 1260
tttgctgaag ctt 1273
<210> 5
<211> 1273
<212> DNA
<213> Artificial Sequence
<400> 5
tcgcgattga acaggcagtg caggcggtgc agcgacaagt tcctcagcga attgccgctc 60
gcctggaatc tgtataccca gctggttttg agctgctgga cggtggcaaa agcggaactc 120
tgcggtagca ggacgctgcc agcgaactcg cagtttgcaa gtgacggtat ataaccgaaa 180
agtgactgag cgtacatgta tacgaagatt attggtactg gcagctatct gcccgaacaa 240
gtgcggacaa acgccgattt ggaaaaaatg gtggacacct ctgacgagtg gattgtcact 300
cgtaccggta tccgcgaacg ccacattgcc gcgccaaacg aaaccgtttc aaccatgggc 360
tttgaagcgg cgacacgcgc aattgagatg gcgggcattg agaaagacca gattggcctg 420
atcgttgtgg caacgacttc tgctacgcac gctttcccga gcgcagcttg tcagattcaa 480
agcatgttgg gcattaaagg ttgcccggca tttgacgttg cagcagcctg cgcaggtttc 540
acctatgcat taagcgtagc cgatcaatac gtgaaatctg gggcggtgaa gtatgctctg 600
gtcgtcggtt ccgatgtact ggcgcgcacc tgcgatccaa ccgatcgtgg gactattatt 660
atttttggcg atggcgcggg cgctgcggtg ctggctgcct ctgaagagcc gggaatcatt 720
tccacccatc tgcatgccga cggtagttat ggtgaattgg ctacgctgcc aaacgccgac 780
cgcgtgaatc cagagaattc aattcatctg acgatggcgg gcaacgaagt cttcaaggtt 840
gcggtaacgg aactggcgca catcgttgat gagacgctgg cggcgaataa tcttgaccgt 900
tctcaactgg actggctggt tccgcatcag gctaacctgc gtattatcag tgcaacggcg 960
aaaaaactcg gtatgtctat ggataatgtc gtggtgacgc tggatcgcca cggtaatacc 1020
tctgcggcct ctgtcccgtg cgcgctggat gaagctgtac gcgacgggcg cattaagccg 1080
gggcagttgg ttctgcttga agcctttggc ggtggattca cctggggctc cgcgctggtt 1140
cgtttctagg ataaggatta aaacatgacg caatttgcat ttgtgttccc tggacagggt 1200
tctcaaaccg ttggaatgct ggctgatatg gcggcgagct atccaattgt cgaagaaacg 1260
tttgctgaag ctt 1273
<210> 6
<211> 1273
<212> DNA
<213> Artificial Sequence
<400> 6
tcgcgattga acaggcagtg caggcggtgc agcgacaagt tcctcagcga attgccgctc 60
gcctggaatc tgtataccca gctggttttg agctgctgga cggtggcaaa agcggaactc 120
tgcggtagca ggacgctgcc agcgaactcg cagtttgcaa gtgacggtat ataaccgaaa 180
agtgactgag cgtacatgta tacgaagatt attggtactg gcagctatct gcccgaacaa 240
gtgcggacaa acgccgattt ggaaaaaatg gtggacacct ctgacgagtg gattgtcact 300
cgtaccggta tccgcgaacg ccacattgcc gcgccaaacg aaaccgtttc aaccatgggc 360
tttgaagcgg cgacacgcgc aattgagatg gcgggcattg agaaagacca gattggcctg 420
atcgttgtgg caacgacttc tgctacgcac gctttcccga gcgcagcttg tcagattcaa 480
agcatgttgg gcattaaagg ttgcccggca tttgacgttg cagcagcctg cgcaggtttc 540
acctatgcat taagcgtagc cgatcaatac gtgaaatctg gggcggtgaa gtatgctctg 600
gtcgtcggtt ccgatgtact ggcgcgcacc tgcgatccaa ccgatcgtgg gactattatt 660
attattggcg atggcgcggg cgctgcggtg ctggctgcct ctgaagagcc gggaatcatt 720
tccacccatc tgcatgccga cggtagttat ggtgaattgg ctacgctgcc aaacgccgac 780
cgcgtgaatc cagagaattc aattcatctg acgatggcgg gcaacgaagt cttcaaggtt 840
gcggtaacgg aactggcgca catcgttgat gagacgctgg cggcgaataa tcttgaccgt 900
tctcaactgg actggctggt tccgcatcag gctaacctgc gtattatcag tgcaacggcg 960
aaaaaactcg gtatgtctat ggataatgtc gtggtgacgc tggatcgcca cggtaatacc 1020
tctgcggcct ctgtcccgtg cgcgctggat gaagctgtac gcgacgggcg cattaagccg 1080
gggcagttgg ttctgcttga agcctttggc ggtggattca cctggggctc cgcgctggtt 1140
cgtttctagg ataaggatta aaacatgacg caatttgcat ttgtgttccc tggacagggt 1200
tctcaaaccg ttggaatgct ggctgatatg gcggcgagct atccaattgt cgaagaaacg 1260
tttgctgaag ctt 1273
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 7
gcgccatatg tcgcgattga acagg 25
<210> 8
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 8
ctcactcgag cttcagcaaa cgtttcttcg aca 33
<210> 9
<211> 33
<212> DNA
<213> Artificial Sequence
<400> 9
ctcactcgag cttcagcaaa cgtttcttcg aca 33
<210> 10
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 10
gaattggcta cgctgccaaa cgccgac 27
<210> 11
<211> 32
<212> DNA
<213> Artificial Sequence
<400> 11
catcgccaat aataataata gtcccacgat cg 32
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 12
tattattatt ggcgatggcg cgggc 25

Claims (11)

1. a kind of β -one acyl-ACP synthase mutant is to carry out genetic modification to β -one acyl-ACP synthase mutant to obtain , which is characterized in that the transformation is 189 sites in the β -one acyl-ACP synzyme by Escherichia coli by bright Histidine mutations are serine, and/or 157 sites are sported aspartic acid by phenylalanine.
2. mutant as described in claim 1, it is characterised in that the β -one acyl-ACP synzyme derives from angstrom Xi Shi The bacterium of category.
3. mutant as claimed in claim 2, it is characterised in that the bacterium that angstrom Xi Shi belongs to is Escherichia coli.
4. mutant as described in claim 1, amino acid sequence is any of SEQ ID NO:1-3.
5. a kind of gene, the gene is for encoding β -one acyl-ACP synthase mutant described in claim 1.
6. gene as claimed in claim 5, nucleotides sequence is classified as any of SEQ ID NO:4-6.
7. a kind of recombinant plasmid, it is characterised in that the recombinant plasmid is for expressing β -one acyl-described in claim 1 ACP synzyme.
8. a kind of method for improving aliphatic acid yield, is to express β -one acyl-described in claim 1 in fatty acid synthesis bacterium ACP synzyme.
9. a kind of method for improving unsaturated fat acid yield, is to express β -one described in claim 1 in associated production bacterium Acyl-ACP synzyme.
10. method according to claim 8, it is characterised in that be that recombinant plasmid as claimed in claim 7 is transferred to fatty acid It produces in bacterium.
11. such as claim 8, method described in 9, it is characterised in that the fatty acid synthesis bacterium or other associated production bacterium are used To be metabolized production fatty acid, unsaturated fatty acid.
CN201811443458.9A 2018-11-29 2018-11-29 beta-ketoacyl-ACP synthetase mutant Active CN109517811B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811443458.9A CN109517811B (en) 2018-11-29 2018-11-29 beta-ketoacyl-ACP synthetase mutant

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811443458.9A CN109517811B (en) 2018-11-29 2018-11-29 beta-ketoacyl-ACP synthetase mutant

Publications (2)

Publication Number Publication Date
CN109517811A true CN109517811A (en) 2019-03-26
CN109517811B CN109517811B (en) 2022-11-11

Family

ID=65794507

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811443458.9A Active CN109517811B (en) 2018-11-29 2018-11-29 beta-ketoacyl-ACP synthetase mutant

Country Status (1)

Country Link
CN (1) CN109517811B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110408603A (en) * 2019-08-01 2019-11-05 上海交通大学 The A54145C1 mutant and its building and application that acyl selection sexually revises

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040181038A1 (en) * 1999-06-07 2004-09-16 Smithkline Beecham Corporation Novel fabh enzyme, compositions capable of binding to said enzyme and methods of use thereof
CN103906845A (en) * 2010-09-15 2014-07-02 Ls9公司 Production of odd chain fatty acid derivatives in recombinant microbial cells
CN106795483A (en) * 2013-07-19 2017-05-31 嘉吉公司 Microorganism and method for producing aliphatic acid and fatty acid derived product

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040181038A1 (en) * 1999-06-07 2004-09-16 Smithkline Beecham Corporation Novel fabh enzyme, compositions capable of binding to said enzyme and methods of use thereof
CN103906845A (en) * 2010-09-15 2014-07-02 Ls9公司 Production of odd chain fatty acid derivatives in recombinant microbial cells
CN106795483A (en) * 2013-07-19 2017-05-31 嘉吉公司 Microorganism and method for producing aliphatic acid and fatty acid derived product

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110408603A (en) * 2019-08-01 2019-11-05 上海交通大学 The A54145C1 mutant and its building and application that acyl selection sexually revises
CN110408603B (en) * 2019-08-01 2022-09-23 上海交通大学 A54145C1 mutant with changed fatty acyl selectivity as well as construction and application thereof

Also Published As

Publication number Publication date
CN109517811B (en) 2022-11-11

Similar Documents

Publication Publication Date Title
CN108239633B (en) Mutant of D-psicose-3-epimerase with improved catalytic activity and application thereof
CN112553178B (en) Nicotinamide ribokinase mutant with enhanced thermal stability and activity and coding gene and application thereof
CN110714002B (en) Plant nitrilase mutant, coding gene and application thereof
RU2669996C2 (en) Novel mutant ornithine decarboxylase protein and use thereof
CN114507658B (en) Enzyme coexpression system and application thereof in synthesizing sialic acid
KR20210153650A (en) Biosynthesis of vanillin from isoeugenol
CN109517811A (en) A kind of β -one acyl-ACP synthase mutant
CN108239632A (en) A kind of mutant for the D-Psicose -3- epimerases that thermal stability is improved and its application
KR101708974B1 (en) Novel sucrose isomerase and process for preparing the same
KR101836719B1 (en) A modified 0-acetylhomoserine sulfhydrylase and method of producing L-methionine using the same
TW200426218A (en) Method for the fermentative production of R-α-lipoic acid
KR20240032944A (en) Rhamnose highly specific glycosyltransferase and its applications
CN113980880B (en) Genetically engineered bacterium and application thereof, and method for producing psicose by taking glucose as raw material
CN109337882A (en) A kind of application in α -1,2- fucosyltransferase and preparation human milk oligosaccharides
CN113151199B (en) Gamma-glutamine synthetase mutant with thermal stability, coding gene, amino acid sequence and application thereof
KR102084065B1 (en) Thermostable recombinant cellulase b protein derived from thermotoga maritima and the uses thereof
CN109852601B (en) N-glycosylation alginate lyase mutant capable of being efficiently applied and construction method of genetic engineering bacteria
KR101940785B1 (en) Hexuronate C4-epimerase mutant from Thermotoga petrophila and uses thereof
CN113736762A (en) alpha-L-rhamnosidase mutant and application thereof in preparation of praonine
CN111849933A (en) Leucine dehydrogenase mutant and construction method and application thereof
CN111849953B (en) Construction and application of threonine dehydratase mutant
KR101076066B1 (en) A beta-agarase and a use of the same
CN109517814A (en) The mutant of organic phosphorus degrading enzyme and its application
CN113817701B (en) Alpha-1, 2-fucosyltransferase mutant and application thereof
CN114317494B (en) alpha-L-rhamnosidase mutant and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant