KR101388460B1 - Novel β-glucosidases derived from microbial in intestinal of blacksoldier fly - Google Patents
Novel β-glucosidases derived from microbial in intestinal of blacksoldier fly Download PDFInfo
- Publication number
- KR101388460B1 KR101388460B1 KR1020120060428A KR20120060428A KR101388460B1 KR 101388460 B1 KR101388460 B1 KR 101388460B1 KR 1020120060428 A KR1020120060428 A KR 1020120060428A KR 20120060428 A KR20120060428 A KR 20120060428A KR 101388460 B1 KR101388460 B1 KR 101388460B1
- Authority
- KR
- South Korea
- Prior art keywords
- glucosidase
- beta
- gene
- protein
- activity
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/02—Monosaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
Abstract
본 발명은 동애등에 장 내 미생물 유래의 신규 베타-글루코시다제, 상기 베타-글루코시다제를 코딩하는 유전자, 상기 유전자를 포함하는 재조합 벡터, 상기 재조합벡터로 형질전환된 형질전환체에 관한 것이다. 본 발명에 의한 재조합 베타-글루코시다제를 대량 생산하여 농업, 식품, 바이오연료 산업에 실질적으로 이용함으로써 경제성을 제고시킬 수 있다.The present invention relates to a novel beta-glucosidase derived from intestinal microorganisms, a gene encoding the beta-glucosidase, a recombinant vector comprising the gene, and a transformant transformed with the recombinant vector. By mass-producing the recombinant beta-glucosidase according to the present invention and practical use in the agricultural, food, and biofuel industries, it is possible to improve economics.
Description
본 발명은 동애등에(Blacksoldier fly: BSF) 장 내 미생물 유래의 신규 베타-글루코시다제, 상기 베타-글루코시다제 유전자, 상기 유전자를 포함하는 재조합벡터, 상기 재조합벡터로 형질전환된 형질전환체에 관한 것이다.The present invention provides a novel beta-glucosidase, the beta-glucosidase gene, a recombinant vector comprising the gene, and a transformant transformed with the recombinant vector from a microorganism in the blacksoldier fly (BSF) intestine. It is about.
셀룰로오스(cellulose)는 지구상에 존재하는 가장 풍부한 유기물질로 석탄이나 석유처럼 고갈에 대하여 걱정할 필요가 없는 재생 가능한 자원이다. 또한 이들 자원은 농산 폐기물이 범람하는 현재에 있어 주요한 환경 오염원으로 작용하고 있다. 그러므로 이들 다당류에 대한 효율적인 당화공정의 개발은 식량, 에너지 환경문제에 큰 도움이 될 것으로 판단된다. 따라서 오랫동안 셀룰로오스를 당화시키기 위한 연구가 이루어져 왔으며, 이중 특히 당화효소의 개발에 초점을 맞추어 많은 연구가 이루어져 왔다. 그 결과 현재에는 많은 당화효소의 용도가 다양하게 개발되어 섬유, 세제, 사료사업 등에서 상업화가 이루어졌고 새로운 응용분야에 대한 연구도 활발하게 이루어지고 있다.Cellulose is the most abundant organic substance on earth and is a renewable resource that you don't have to worry about depletion like coal or oil. These resources also serve as major environmental pollutants in the current flooding of agricultural waste. Therefore, the development of efficient saccharification process for these polysaccharides will be a great help for food and energy environment. Therefore, research has been made for glycosylation for a long time, and a lot of research has been made, especially focusing on the development of glycosylase. As a result, many uses of glycosylation enzymes have been developed in various ways and commercialized in textile, detergent, feed business, etc., and new application fields are being actively researched.
셀룰라아제는 복합효소로서 기질에 따른 가수분해 특성에 따라 엔도글루카나아제(endoglucanase, EG), 엑소글루카나아제(exoglucanase, CBH) 및 베타-글루코시다아제(β-glucosidase)의 3종으로 분류되는데, 섬유소의 분해에는 이들 세 종류의 효소가 관여한다고 얄려져 있다. Cellulase is a complex enzyme and is classified into three types according to the hydrolysis characteristics according to substrates: endoglucanase (EG), exoglucanase (CBH) and beta-glucosidase (β-glucosidase). It is said that these three types of enzymes are involved in the breakdown of cellulose.
엔도글루카나아제는 셀룰로오스를 무작위로 공격하여 비환원성 말단기를 만드는데, 저분자량의 수용성 섬유소, 인산 가수분해된 섬유소 등은 쉽게 분해하나, 결정성 섬유소를 단독으로 분해하지는 못한다. 엑소글루카나아제는 섬유소 사슬의 비환원성 말단기를 공격하여 셀로비오스(cellobiose)를 생성시키며, 특히 기질이 결정상으로 존재할 때 이 효소의 존재는 커다란 의미를 갖는다. 즉,셀룰로오스의 분자는 많은 글루코오스가 탈수축합하여 셀로비오스 모양으로 결합하여 생긴 고분자로 추정되는데 이와 같은 결 합을 β-1,4-글루코시드 결합이라 한다. 마지막으로 베타-글루코시다아제는 저 분자량의 수용성 섬유소를 분해하여 글루코오스(glucose)를 생성한다. 셀룰라아제의 이러한 특성 때문에, 이를 이용하고자 다양한 생물체로부터 분리된 셀룰라아제 및 그 유전자가 보고되고 있다. 지금까지 셀룰라아제 및 그 유전자는 주로 세균과 곰팡이 등의 미생물로부터 분리된 것들이 많이 알려져 왔다Endoglucanases attack cellulose randomly to form non-reducing end groups. Low molecular weight water-soluble fibers, phosphate-hydrolyzed fibers, etc. are easily degraded, but they cannot degrade crystalline fibers alone. Exoglucanase attacks the non-reducing end groups of the fibrin chain to produce cellobiose, especially when the substrate is in the crystalline phase. In other words, the molecule of cellulose is estimated to be a polymer formed by dehydrogenation of a large number of glucose to form a cellobiose. Such a bond is called β-1,4-glucoside bond. Finally, beta-glucosidase breaks down low molecular weight soluble fibrin to produce glucose. Because of this characteristic of cellulase, cellulase and its gene isolated from various organisms have been reported to utilize it. Until now, cellulase and its genes have been known for their isolation from microorganisms such as bacteria and fungi.
본 발명은 동애등에 장 내 미생물 유래의 신규 베타-글루코시다제, 상기 베타-글루코시다제를 코딩하는 유전자, 상기 유전자를 포함하는 재조합 벡터, 상기 재조합벡터로 형질전환된 형질전환체를 제공한다.The present invention provides a novel beta-glucosidase derived from intestinal microorganisms, a gene encoding the beta-glucosidase, a recombinant vector comprising the gene, and a transformant transformed with the recombinant vector.
본 발명은 서열번호 3의 아미노산서열로 표시되는 베타-글루코시다제 단백질, 서열번호 4의 아미노산서열로 표시되는 베타-글루코시다제 단백질을 제공한다. The present invention provides a beta-glucosidase protein represented by the amino acid sequence of SEQ ID NO: 3, and a beta-glucosidase protein represented by the amino acid sequence of SEQ ID NO: 4.
또한, 본 발명은 서열번호 1의 핵산서열로 표시되는 베타-글루코시다제 유전자, 서열번호 2의 핵산서열로 표시되는 베타-글루코시다제 유전자를 제공한다.The present invention also provides a beta-glucosidase gene represented by the nucleic acid sequence of SEQ ID NO: 1, a beta-glucosidase gene represented by the nucleic acid sequence of SEQ ID NO: 2.
또한, 본 발명은 서열번호 1의 유전자를 포함하는 재조합 벡터, 서열번호 2의 유전자를 포함하는 재조합 벡터를 제공한다. The present invention also provides a recombinant vector comprising the gene of SEQ ID NO: 1, a recombinant vector comprising the gene of SEQ ID NO: 2.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 형질전환체를 제공한다. The present invention also provides a transformant transformed with the recombinant vector.
본 발명은 동애등에 장 내 미생물 유래의 메타게놈 유전자은행으로부터 종래의 기술로 배양하기 힘든 동애등에 장 내 미생물 유래의 신규 베타-글루코시다제 유전자를 발현할 경우에 수용성 베타-글루코시다제 효소의 생산성이 탁월하여 대량생산이 가능하며, 일부는 배양액으로 분비되는 특성이 있으므로 농업, 식품. 바이오 연료 등의 다양한 분야에서 상업적인 용도로 활용이 가능하다.The present invention is the productivity of water-soluble beta-glucosidase enzyme when expressing a novel beta-glucosidase gene derived from enteric microorganisms in Dongae et al. It is excellent in mass production, and some of them are secreted into culture, so agriculture, food. It can be used for commercial purposes in various fields such as biofuels.
도 1은 DDGL7 글루코시다제의 아미노산 핵산서열과 BlastP 검색에서 유의성을 가진 것으로 보인 글루코시다제 계열 효소들과의 계통분석을 나타낸 것이다. 각 branch에 있는 숫자는 Bootstrap 분석치(1,000 resampling)이다(Bar, 0.2 substitutions per amino acid position).
도 2는 단백질 과발현용 신규 베타글루시코다제의 재조합 플라스미드(pEGL7과 pEGD7)의 제작도이다.
도 3(A)은 pEGL7과 pEGD7의 대장균에서의 이종 대량발현 및 정제 결과, 84 kDa의 목적단백질인 베타 글루코시다제가 과다 발현된 것을 나타낸 것이다. 도 3(B)는 시그날펩타이드가 제거된 pEGD7의 세포외 발현(배지내로 분비)을 확인한 것이다.
도 4는 pEGD7 발현 베타 글루코시다제의 최적 온도 및 pH 분석을 나타낸 것이다.
도 5(A)는 pEGD7 발현 DDGL7효소의 기질특이성을 나타낸 것이고, 도 5(B)는 pEGD7 발현 DDGL7효소의 금속이온, 유기용매, 여러 케미칼에 대한 pNPG 분해활성을 나타낸 것이다.
도 6은 pEGD7의 단백질 발현 및 Ni-NTA affinity 칼럼에 의한 신규 베타 글루코시다제 정제, 효소활성 및 생산성 분석 (LB배지 배양액 250ml 기준)을 나타낸 것이다.Figure 1 shows the phylogenetic analysis of the amino acid nucleic acid sequence of DDGL7 glucosidase and glucosidase family enzymes that appeared to be significant in BlastP search. The number in each branch is the Bootstrap assay (1,000 resampling) (Bar, 0.2 substitutions per amino acid position).
Figure 2 is a production diagram of recombinant plasmids (pEGL7 and pEGD7) of novel beta-glucosidase for protein overexpression.
FIG. 3 (A) shows the overexpression of beta glucosidase, a target protein of 84 kDa, as a result of mass expression and purification of Escherichia coli pEGL7 and pEGD7. Figure 3 (B) confirms the extracellular expression (secretion into the medium) of pEGD7 from which the signal peptide is removed.
4 shows the optimal temperature and pH analysis of pEGD7 expressing beta glucosidase.
FIG. 5 (A) shows the substrate specificity of pEGD7 expressing DDGL7 enzyme, and FIG. 5 (B) shows the pNPG degrading activity of metal ions, organic solvents and various chemicals of pEGD7 expressing DDGL7 enzyme.
Figure 6 shows the protein expression of pEGD7 and novel beta glucosidase purification by Ni-NTA affinity column, enzyme activity and productivity analysis (based on 250 ml of LB medium).
본 발명은 동애등에 장 내 미생물 유래의 베타-글루코시다제 단백질을 코딩하는 유전자에 관한 것이다. 본 발명의 유전자는 베타-글루코시다제 단백질을 코딩하는 게놈 DNA와 cDNA를 모두 포함한다. 본 발명의 유전자는 서열번호 1로 표시되는 핵산서열을 포함할 수 있다. 본 발명에 따른 베타-글루코시다제 유전자는 총 2319bp의 뉴클레오티드를 포함하며, 총 772개의 아미노산을 코딩하고 있다. 또한 본 발명에 따른 베타-글루코시다제 코딩 유전자의 아미노산 서열을 기존의 유전자 데이터베이스와 BlastP 검색한 결과, 본 발명의 유전자는 기존의 보고된 글루코시다제와 아미노산 수준에서 최대 72%의 상동성을 보여 신규 유전자로 밝혀졌다. 이 유전자를 'DDGL7'이라 명명하였다.The present invention relates to a gene encoding beta-glucosidase protein derived from intestinal microorganisms in Dongae et al. Genes of the invention include both genomic DNA and cDNA encoding beta-glucosidase proteins. The gene of the present invention may include a nucleic acid sequence represented by SEQ ID NO: 1. The beta-glucosidase gene according to the present invention comprises a total of 2319 nucleotides and encodes a total of 772 amino acids. In addition, BlastP searches the amino acid sequence of the beta-glucosidase coding gene according to the present invention, the gene of the present invention shows up to 72% homology with the existing reported glucosidase amino acid level New genes were found. This gene was named 'DDGL7'.
또한 상기 핵산서열의 변이체가 본 발명의 범위 내에 포함된다. 구체적으로 상기 유전자는 서열번호 1의 핵산서열과 각각 70%이상, 80%이상, 90% 이상, 95% 이상의 서열 상동성을 가지는 핵산서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 “서열 상동성의 %”는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
Variants of the nucleic acid sequences are also included within the scope of the present invention. Specifically, the gene may include a nucleic acid sequence having a sequence homology of 70% or more, 80% or more, 90% or more, 95% or more with the nucleic acid sequence of SEQ ID NO: 1, respectively. The “% sequence homology” for a polynucleotide is determined by comparing the two optimally arranged sequences with the comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
또한, 본 발명은 동애등에 장 내 미생물 유래의 베타-글루코시다제 단백질을 코딩하는 유전자를 제공한다. 본 발명의 유전자는 베타-글루코시다제 단백질을 코딩하는 게놈DNA와 cDNA를 모두 포함한다. 본 발명의 유전자는 서열번호 2로 표시되는 핵산서열을 포함할 수 있다. 본 발명에 따른 베타-글루코시다제 유전자는 이 효소의 N말단부 20개의 아미노산으로 이루어진 signal peptide를 코딩하는 부분을 제거한 총 2259bp의 뉴클레오티드로 구성되어 있으며, 총 752개의 아미노산을 코딩하고 있다. 이 유전자를 'DDGD7'이라고 명명하였다.The present invention also provides genes encoding beta-glucosidase protein derived from intestinal microorganisms in Dongae et al. Genes of the invention include both genomic DNA and cDNA encoding beta-glucosidase proteins. The gene of the present invention may include a nucleic acid sequence represented by SEQ ID NO: 2. The beta-glucosidase gene according to the present invention is composed of a total of 2259bp of nucleotides removed from a portion encoding a signal peptide consisting of 20 amino acids at the N-terminal end of the enzyme, and encodes a total of 752 amino acids. This gene was named 'DDGD7'.
또한 상기 핵산서열의 변이체가 본 발명의 범위 내에 포함된다. 구체적으로 상기 유전자는 서열번호 2의 핵산서열과 각각 70%이상, 80%이상, 90% 이상, 95% 이상의 서열 상동성을 가지는 핵산서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 “서열 상동성의 %”는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다. Variants of the nucleic acid sequences are also included within the scope of the present invention. Specifically, the gene may include a nucleic acid sequence having a sequence homology of at least 70%, at least 80%, at least 90%, or at least 95% with the nucleic acid sequence of SEQ ID NO: 2. The “% sequence homology” for a polynucleotide is determined by comparing the two optimally arranged sequences with the comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
하기 표 1은 서열번호 1 및 2에 관한 것이다.Table 1 below relates to SEQ ID NOs: 1 and 2.
[표 1][Table 1]
또한, 본 발명은 동애등에 장 내 미생물 유래의 베타-글루코시다제 단백질을 제공한다. 상기 동애등에 장 내 미생물 유래의 베타-글루코시다제 단백질은 서열번호 3의 아미노산 서열을 포함한다. 본 발명에 따른 베타-글루코시다제 단백질의 범위는 서열번호 3으로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. The present invention also provides a beta-glucosidase protein derived from intestinal microorganisms in Dongae et al. The beta-glucosidase protein derived from the gut microorganisms in Dongae et al. Comprises the amino acid sequence of SEQ ID NO. The range of beta-glucosidase proteins according to the present invention includes proteins having the amino acid sequence represented by SEQ ID NO: 3 and functional equivalents of the proteins.
상기 “기능적 동등물”이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 3로 표시되는 아미노산 서열과 적어도 50%이상, 70%이상, 90% 이상의 서열 상동성을 갖는 것으로, 서열번호 3로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. “실질적으로 동질의 생리활성”이란 생물체 내에서 가수분해 능이 우수한 베타-글루코시다제의 활성을 의미한다.
The "functional equivalent" is a sequence homology of at least 50%, 70%, 90% or more of the amino acid sequence represented by SEQ ID NO: 3 as a result of the addition, substitution, or deletion of amino acids. Refers to a protein that exhibits substantially the same physiological activity as the displayed protein. “Substantially homogeneous physiological activity” refers to the activity of beta-glucosidase with good hydrolytic ability in organisms.
또한, 본 발명은 동애등에 장 내 미생물 유래의 베타-글루코시다제 단백질을 제공한다. 상기 동애등에 장 내 미생물 유래의 베타-글루코시다제 단백질은 서열번호 4의 아미노산 서열을 포함한다. 본 발명에 따른 베타-글루코시다제 단백질의 범위는 서열번호 4으로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. 이는 서열번호 3의 베타-글루코시다제를 코딩하는 것으로 추정되는 유전자에서 세포외 분비와 관련하는 singnal peptide를 코딩하는 하는 부분을 제거하여 총752개의 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. The present invention also provides a beta-glucosidase protein derived from intestinal microorganisms in Dongae et al. The beta-glucosidase protein derived from the gut microorganisms in Dongae et al. Comprises the amino acid sequence of SEQ ID NO. The range of beta-glucosidase proteins according to the present invention includes proteins having the amino acid sequence represented by SEQ ID NO: 4 and functional equivalents of such proteins. This eliminates the portion encoding the singnal peptide associated with extracellular secretion in the gene that is supposed to encode beta-glucosidase of SEQ ID NO: 3, thereby removing a protein having a total of 752 amino acid sequences and functional equivalents of the protein. Include.
상기 “기능적 동등물”이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 4로 표시되는 아미노산 서열과 적어도 50%이상, 70%이상, 90% 이상의 서열 상동성을 갖는 것으로, 서열번호 3로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. “실질적으로 동질의 생리활성”이란 생물체 내에서 가수분해 능이 우수한 베타-글루코시다제의 활성을 의미한다.The term "functional equivalent" has at least 50%, 70%, 90% or more sequence homology with the amino acid sequence represented by SEQ ID NO. 4 as a result of the addition, substitution, or deletion of the amino acid. Refers to a protein that exhibits substantially the same physiological activity as the displayed protein. “Substantially homogeneous physiological activity” refers to the activity of beta-glucosidase with good hydrolytic ability in organisms.
하기 표 2는 서열번호 3 및 4에 관한 것이다.Table 2 below relates to SEQ ID NOs: 3 and 4.
[표 2][Table 2]
또한, 본 발명은 동애등에 장 내 미생물 유래의 베타-글루코시다제 유전자를 포함하는 재조합 벡터를 제공한다. 상기 재조합 벡터는 대장균 발현 벡터 또는 효모 발현 벡터일 수 있으나, 이제 제한되지 않는다. 대장균 발현 벡터로는 pET21b 벡터를 예로 들 수 있으며, 효모 발현 벡터로는 pKBN-IFN벡터를 예로 들 수 있으나, 이에 제한되지 않는다. 본 발명은 DDGL7유전자를 단백질 발현벡터인 pET21b에 클로닝하여 재조합 벡터 pEG7을 제조하였다. 또한 본 발명은 DDGD7유전자를 단백질 발현 벡터인 pET21b에 클로닝하여 재조합 벡터 pEGD7을 제조하였다.
The present invention also provides a recombinant vector comprising a beta-glucosidase gene derived from intestinal microorganisms in Dongae et al. The recombinant vector may be an E. coli expression vector or a yeast expression vector, but is not limited thereto. As an E. coli expression vector, pET21b vector may be mentioned, and as a yeast expression vector, pKBN-IFN vector may be exemplified, but is not limited thereto. The present invention cloned the DDGL7 gene into pET21b, a protein expression vector, to prepare a recombinant vector pEG7. In addition, the present invention cloned the DDGD7 gene into pET21b, a protein expression vector, to prepare a recombinant vector pEGD7.
용어 “재조합”은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 코딩된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 제도입된 것이다.
The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes are modified and intracellularly reintroduced by artificial means.
용어 ”벡터”는 세포 내로 전달하는 DNA단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 용어 “전달체”는 흔히 “벡터”와 호환하여 사용된다. 용어 “발현벡터”는 목적한 코딩 서열과, 특정 숙주 생물에서 작동 가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다.The term “vector” is used to refer to a DNA fragment (s), a nucleic acid molecule, that is delivered into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term “carrier” is often used interchangeably with “vector”. The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism.
본 발명의 유전자는 전형적으로 클로닝 또는 단백질발현을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 예를 들어, 본 발명에 이용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드(예를 들면, pSC101, ColE1,pBR322, pUC8/9, pHC79, pGEX 시리즈, pET 시리즈 및 pUC19 등), 파지(예를 들면, λgt4.λB, λ-Charon및 M13 등) 또는 바이러스(예를 들면, SV40 등)를 조작하여 제작될 수 있다. 한편, 본 발명의 유전자가 식물에 최적화된 코돈으로 전환하여, 식물 세포를 숙주로 하는 경우에는 당 업계에서 통용적으로 사용되는 벡터(예를 들면, pBI vectors, pCAMBIA vectors, pSB vectors)를 조작하여 제작될 수 있다. The gene of the present invention can be typically constructed as a vector for cloning or protein expression. Further, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. For example, vectors that can be used in the present invention include plasmids (eg, pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series and pUC19, etc.) that are often used in the art, For example, it can be produced by manipulating [lambda] gt4. [Lambda] B, [lambda] -Charon, M13, etc.) or a virus (for example, SV40, etc.). Meanwhile, when the gene of the present invention is converted into a plant optimized codon, and a plant cell is used as a host, vectors (eg, pBI vectors, pCAMBIA vectors, and pSB vectors) commonly used in the art are manipulated. Can be made.
또한, 본 발명은 상기 재조합 벡터로 형질전환된 형질전환체를 제공한다. 본 발명의 벡터를 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주 세포는 당 업계에 공지된 어떠한 숙주세포도 이용할 수 있으며, 예를 들면 E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, 바실러스 서브틸리스(Bacillus subtilis), 바실러스 츄런겐시스(Bacillus thuringiensis) 와 같은 바실러스 속 균주, 그리고 살모낼라 티피무리움(Samonella typhimurium), 세라티아 마르세슨스(Serratia marcescens) 및 다양한 슈도모나스 종과 같은 장내균과 균주 등이 있다. 상기 숙주세포는 바람직하게는 대장균이다. The present invention also provides a transformant transformed with the recombinant vector. Host cells capable of continuously cloning and expressing the vector of the present invention in a stable manner can be any host cell known in the art, for example, E. coli JM109, E. coli BL21, E. coli RR1, E Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium (Bacillus subtilis, Bacillus subtilis, Bacillus thuringiensis), and E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, Samonella typhimurium, Serratia marcescens, and various Pseudomonas species. The host cell is preferably Escherichia coli.
또한, 본 발명의 벡터를 진핵 세포에 형질전환시키는 경우에는 숙주세포로서 효모, 곤충세포, 사람세포 (예컨대, CHO(Chinese hamster ovary) 세포주, W138, BHK, COS-7, 293, HepG2, 3T3, RIN 및 MDCK 세포주) 식물세포 등이 이용될 수 있으며, 사카로마이세스 세레비지애(Saccharomyce cerevisiae)일 수 있다.In addition, when transforming a vector of the present invention into eukaryotic cells, yeast, insect cells, and human cells (e.g., CHO (Chinese hamster ovary) cell lines, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines) plant cells and the like can be used, and may be Saccharomyce cerevisiae.
본 발명의 벡터를 숙주세포 내로 운반하는 방법은, 숙주 세포가 원핵 세포인 경우, CaC 방법(Cohen, S.N. et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), 하나한 방법(Hanahan, D., J. Mol. Biol., 166:557580(1983)) 및 전기천공 방법(Dower, W.J. et al., Nucleic. Acids Res., 16:6127-6145(1988)) 등에 의해 실시 될 수 있다. 또한, 숙주세포가 진핵세포인 경우에는, 미세주입법(Capecchi, M.R., Cell, 22:479(1980)), 칼슘 포스페이트 침전법 (Graham, F.L. et al., Virology, 52:456(1973)), 전기천공법(Neumann, E. et al., EMBO J., 1:841(1982)), 리포좀-매개 형질감염법(Wong, T.K. et al., Gene, 10:87(1980)), DEAE-텍스트란 처리법 (Gopal, Mol. Cell Biol., 5:1188-1190(1985)), 및 유전자 밤바드먼트(Yang et al., Proc.Natl. Acad. Sci.,87.9568-9572(1990)) 등에 의해 벡터를 숙주세포 내로 주입할 수 있다.
The method of transporting the vector of the present invention into a host cell may include the CaC method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973)) when the host cell is a prokaryotic cell. , Hanahan (D., J. Mol. Biol., 166: 557580 (1983)) and electroporation (Dower, WJ et al., Nucleic. Acids Res., 16: 6127-6145 (1988) It may be carried out by). In addition, when the host cell is a eukaryotic cell, microinjection method (Capecchi, MR, Cell, 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et al., Virology, 52: 456 (1973)), Electroporation (Neumann, E. et al., EMBO J., 1: 841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87 (1980)), DEAE- Textlan treatment (Gopal, Mol. Cell Biol., 5: 1188-1190 (1985)), and gene balm (Yang et al., Proc. Natl. Acad. Sci., 87.9568-9572 (1990)), etc. The vector can be injected into the host cell.
상기 형질전환체를 이용하여 재조합 베타 글루코시다아제를 생산할 수 있으며, 그 방법은 형질전환체를 공지된 기술을 이용하여 재조합 단백질의 생산에 적합한 배지에서 배양한다. 예를 들어, 세포들은 적합한 배지와 단백질이 발현 또는 분리되는 것을 허용하는 조건 하에 실시된 실험실 또는 산업용 발효기에서 소규모 또는 대규모 발효, 쉐이크 플라스크 배양에 의해서 배양될 수 있다. 배양은 공지기술을 사용하여 탄소,질소원 및 무기염을 포함하는 적합한 배지에서 일어난다. 적합한 배지는 상업적으로 입수하거나 예를 들면, American Type Culture Collection의 카탈로그와 같은 간행물에 기재된 성분 및 조성비에 따라 제조할 수 있다. The transformant can be used to produce recombinant beta glucosidase, the method culturing the transformant in a medium suitable for the production of the recombinant protein using known techniques. For example, the cells can be cultured by small or large scale fermentation, shake flask culture in a laboratory or industrial fermentor carried out under conditions that allow for the expression or isolation of the appropriate medium and protein. The cultivation takes place in a suitable medium containing carbon, nitrogen source and inorganic salt using well known techniques. Suitable media can be obtained commercially or according to the components and compositional ratios described in publications such as, for example, the catalog of the American Type Culture Collection.
상기 베타-글루코시다제는 목적 유전자에 의해 발현된 단백질을 당업계에 공지된 단백질 분리방법을 이용하여 회수할 수 있다. 예를 들어 단백질은 원심분리, 초음파파쇄, 여과, 추출, 분무 건조, 증발 또는 침전을 포함하는 통상적인 방법에 의해서 영양배지로부터 분리될 수 있지만, 이에 제한되는 것은 아니다. 더 나아가 단백질은 크로마토그래피(예를 들면 이온 교환, 친화성, 소수성 및 크기별 배제), 전기영동, 분별염석(예를 들면 암모늄 설페이트 침전), SDS-PAGE 또는 추출을 포함하여 공지된 다양한 방법을 통해서 정제될 수 있다. The beta-glucosidase can be recovered using a protein isolation method known in the art for the protein expressed by the gene of interest. For example, proteins may be separated from nutrient media by conventional methods, including but not limited to centrifugation, sonication, filtration, extraction, spray drying, evaporation, or precipitation. Furthermore, proteins can be purified through a variety of known methods, including chromatography (e.g. ion exchange, affinity, hydrophobicity and size exclusion), electrophoresis, fractional salts (e.g. ammonium sulfate precipitation), SDS-PAGE or extraction. It can be purified.
이하, 본 발명을 실시 예에 의해 상세히 설명한다. 단,하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시 예에 한정되는 것은 아니다. Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely to illustrate the present invention, the content of the present invention is not limited to the following examples.
<< 실시예Example >>
1. One. 동애등에In love 메타게놈Meta genome 은행 구축 Bank building
동애등에의 유충은 국립농업과학원 곤충산업과에서 분양 받았다. 1,000여 마리 이상 유충으로부터 유충을 고정한 뒤 핀셋으로 장을 분리하였다. 분리한 장에서 장내 미생물을 분리하기 위하여 조직을 막자 사발에서 적절하게 파쇄한 뒤 percoll gradient 방식을 통하여 미생물을 분리하였다(Current Protocols in Molecular Biology, Cold Spring Harbor Laboratories Ed.). 분리한 동애등에 유충 장내 미생물로부터 메타게놈 라이브러리를 제작하기 위하여, 분리 정제한 전체 DNA를 1% Low-melting-point agarose gel에 CHEF DR-III전기영동 장치(Biorad사)에 6V/cm로 14℃, 120° 각도로 11초간 ramping 하여 13시간 전기영동하고 SybrGreen Gold Dye로 염색한 후 UV illuminator 상에서 확인하고 40 kb 이상의 DNA를 포함하는 agarose block 만을 자른 다음 agarase 효소를 넣어 1시간 동안 반응시킨 후 70℃에서 10분간 agarase를 비활성화시켰다. 여기에 에탄올로 침전, 세척하여 순수한 DNA를 분리하여 준비하였다. Fosmid library 제작은 정제한 장내 미생물 DNA 25 μl (5 μg)에 5 unit의 T4 polymerase (Takara Co.)와 2 unit T4 polynucleotide kinase (Takara Co.) 그리고 6 units의 Klenow fragment (Takara Co.)를 가한 후 반응액량을 50 μl로 조절한 후 37℃에서 30분간 반응시켜 DNA 말단을 평활화하여 제작하였다. 반응이 끝난 후 동량의 phenol/chloroform/isoamylalcohol (25:24:1,v/v/v)을 첨가하여 섞은 다음 10분간 원심분리하고 상등액을 모아서 동량의 chloroform/isoamylalchohol(24:1, v/v)을 첨가하여 혼합한 후에 12,000 rpm에서 10분간 원심분리하여 상등액만을 취하고 2.5배의 100% 에탄올을 넣어 1시간 동안 상온에서 방치한 다음 원심분리하여 상등액은 버리고 70% 에탄올로 DNA를 세척하여 DNA를 준비하였다. EpiFOS fosmid vector (pCC1/2, Epicentre, USA)에 end-repaired DNA를 첨가하여 16℃에서 16시간 ligation 반응시켰다.Caterpillars to Dongae and others were distributed by the Insect Industry Division, National Academy of Agricultural Science. After the larvae were fixed from more than 1,000 larvae, the leaves were separated by tweezers. In order to isolate the intestinal microorganisms from the separated intestines, the microorganisms were separated by a percoll gradient method after appropriately disrupting the tissues in a mortar bowl (Current Protocols in Molecular Biology, Cold Spring Harbor Laboratories Ed.). To prepare a metagenome library from larvae intestinal microorganisms isolated from the larvae, 14 ° C at 6V / cm on a CHEF DR-III electrophoresis device (Biorad) on 1% low-melting-point agarose gel After electrophoresis for 13 hours by ramping at 120 ° for 11 seconds, stained with SybrGreen Gold Dye, confirmed on UV illuminator, cut only agarose block containing 40 kb or more of DNA, and reacted for 1 hour with agarase enzyme. Inactivated agarase for 10 minutes at. This was precipitated with ethanol and washed to prepare pure DNA. Fosmid library was prepared by adding 5 units of T4 polymerase (Takara Co.), 2 units of T4 polynucleotide kinase (Takara Co.) and 6 units of Klenow fragment (Takara Co.) to 25 μl of purified microorganism DNA After adjusting the amount of the reaction solution to 50 μl, the DNA was reacted at 37 ° C for 30 minutes to smooth the DNA ends. After the reaction is completed, add an equal amount of phenol / chloroform / isoamylalcohol (25: 24: 1, v / v / v), mix, and centrifuge for 10 minutes and collect the same amount of chloroform / isoamylalchohol (24: 1, v / v). ) Was added and mixed, followed by centrifugation at 12,000 rpm for 10 minutes to obtain only the supernatant, and 2.5 times of 100% ethanol was added and allowed to stand at room temperature for 1 hour. Centrifugation was discarded and DNA was washed with 70% ethanol to wash DNA. Ready. End-repaired DNA was added to the EpiFOS fosmid vector (pCC1 / 2, Epicenter, USA) and ligation reaction was performed at 16 ° C for 16 hours.
In vitro packaging을 위해 16℃에서 16시간 반응한 시료들을 70℃에서 10분간 열처리하여 ligase 효소를 불활성화시켰다. Ligation한 반응액 7.5 μl에 MAX lambda packaging extracts kit (Epicentre, USA)의 extracts 25 μl를 넣어 pipette을 사용해 공기방울이 생기지 않게 조심스레 섞어 준 다음 30℃에서 1시간 30분간 반응시켰다. 여기에 다시 extracts 25 μl를 넣어 pipette을 사용해 공기방울이 생기지 않게 조심스레 섞어 준 다음 30℃에서 1시간 30분간 반응시켜 in vitro packaging을 수행하였다. SM 완충용액을 1 ml 첨가하여 위아래로 잘 섞어 준 다음 여기에 25 μl의 chloroform을 넣어 다시 packaging 되지 않은 물질들을 불활성화 시켰다. 원심분리를 조심스럽게 하여 정치한 다음 4℃에 보관하였고 상등액을 대장균에 형질전환하여 library로 사용하였다. 대장균에 클로닝된 유전자 형태로 구축한 메타게놈 유전자은행은 LB-Chloramphenicol-glycerol 배지를 기본배지로 하여 384-well plate에 개별 클론으로 접종하여 메타게놈 유전자은행을 작성하고 -70℃에 장기 보존하였다.
In For in vitro packaging, the samples reacted at 16 ℃ for 16 hours were heat treated at 70 ℃ for 10 minutes to inactivate the ligase enzyme. To the 7.5 μl of the ligation reaction, 25 μl of extracts from MAX lambda packaging extracts kit (Epicenter, USA) was added, carefully mixed with a pipette to avoid air bubbles, and reacted at 30 ° C for 1 hour and 30 minutes. Add 25 μl of extracts to the mixture and carefully mix it with a pipette to prevent air bubbles, and then react at 30 ℃ for 1 hour and 30 minutes in vitro packaging. Add 1 ml of SM buffer solution, mix well up and down, and then add 25 μl of chloroform to inactivate the unpackaged material. Centrifugation was carefully performed, and the mixture was stored at 4 ° C. The supernatant was transformed into E. coli and used as a library. The metagenomic gene bank constructed in the form of a cloned gene in Escherichia coli was inoculated into a 384-well plate using LB-Chloramphenicol-glycerol medium as a basic medium, and a metagenomic gene bank was prepared and stored at -70 ° C for a long time.
2. 2. 동애등에In love 메타게놈Meta genome 라이브러리 에서In the library 베타글루코시다제Betaglucosidase 유전자 선발 및 신규성 분석 Gene selection and novelty analysis
동애등에 장내 미생물 메타게놈 라이브러리로부터 셀루라아제 분해 클론을 선발하기 위해 선별 agar 배지(LB+0.5% carboxymethylcellulose)에서 28℃에서 5일간 배양하여 0.1% Congo red액에 10분간 염색시키고 이어서 1M NaCl로 수 차례 세척하여 콜로니 주변에 환이 생긴 즉 셀루라아제를 외부로 분비하는 클론을 선발하고 이로부터 Fosmid를 분리해 삽입단편을 확인하였다. 음성 반응 대조군으로 메타게놈 유전자은행을 구축한 대장균 숙주(host)에 fosmid 벡터만 들어간 것을 사용하여 동일한 조건에서 배양하여 background 시그널을 확인하였다.To select cellulase-degrading clones from the intestinal microbial metagenome library, Dongae et al. Incubated for 5 days at 28 ° C. in selective agar medium (LB + 0.5% carboxymethylcellulose) and stained with 0.1% Congo red solution for 10 minutes. After washing several times, a clone was formed around the colonies, that is, a clone that secreted cellulase to the outside was selected, and Fosmid was separated therefrom to confirm the insertion fragment. As a negative response control, the background signal was confirmed by culturing under the same conditions using only the fosmid vector in the E. coli host constructing the metagenome gene bank.
상기 1의 제작된 메타게놈을 당 분해효소 유전자를 가진 것으로 추정되는 DDHC3클론을 기질이용 선택배지로 최종 선발하였으며, 이들에서 삽입 DNA단편(약 36kb)에 대한 염기서열 분석을 수행하였다. 양성을 보인 클론들에서 pUC-universal primer과 BigDye system을 사용하여 염기서열을 결정하여 분석하였다. Sequencing은 ABI BigDye-terminator (ver. 3.1)로 반응하였고, 사용한 PCR primer는 각 벡터에서 제공되는 5‘- 또는 3’-end universal primer를 사용하였다 (EpiCentre, USA). Sequencing PCR 반응은 DNA 4μl, BigDye 0.5μl, primer 3pmol, 5XBuffer 1.75μl, Sterile water 3.45μl를 넣고 94℃, 4min→[96℃, 10sec→50℃, 6 sec→60℃, 4min] X 25 cycle→4℃, Hold 방식으로 수행하였다. Dye peak가 분명하게 분리되는 약 500bp partial sequence를 이용하여 GenBank(National Center for Biotechnology Information)의 BlastX 알고리즘을 사용하여 가장 유사성이 높은 유전자를 검색하였다. 전체 염기서열은 VectorNTI 프로그램을 통하여 contig으로 작성하여 가수분해 효소 역할을 수행하는 ORF를 검출하였다. 검출된 ORF는 GenBank의 BlastX 알고리즘으로 검색하여 기능을 추정하였다.The prepared metagenome of 1 was finally selected as a substrate-use selective medium, which is estimated to have a glycolytic gene, and sequence analysis was performed on the inserted DNA fragment (about 36 kb). Positive sequences were analyzed by pUC-universal primer and BigDye system. Sequencing was performed with ABI BigDye-terminator (ver. 3.1), and the PCR primers used were 5'- or 3'-end universal primers (EpiCentre, USA). For sequencing PCR reaction, add 4μl DNA, 0.5μl BigDye, 3pmol primer, 575 Buffer 1.75μl, and 3.45μl Sterile water. 94 ℃, 4min → [96 ℃, 10sec → 50 ℃, 6sec → 60 ℃, 4min]
이들 결과로부터 베타 글루코시다제로 추정되는 2319bp의 전사해독프레임 ORF(Open Reading Frame)을 가지고 있는 것을 확인하였다. 이 전사해독 프레임을 DDGL7이라 명명하였다. 또한 GenBank의 BlastX 알고리즘으로 검색하여 기능을 추정하였다. 유연관계 분석은 Blast P검색을 사용하여 기존 보고된 베타 글루코시다제의 아미노산 배열에서 본 글루코시다제와 상동성이 높은 자료를 모으고 이를 MEGA 5.1과 ClustalX program으로 분석하였다. N-J법(neighbor-joining tree, NJ)으로 tree작성을 실시하여 비교하였으며, 분류군의 가지에 대한 Bootstrap 분석은 1,000회 반복법으로 실시하였다. 본 발명의 베타 글루코시다제는 비교적 독립된 클러스트에 위치함을 보여준다(도 1). 따라서DDGL7 이나 DDGD7글루코시다제가 아미노산 수준에서 최대 72%의 상동성을 보여 기존의 보고된 글루코시다제와는 다른 아직까지 전혀 알려지지 않은 미생물에서 유래한 신규한 글루코시다제임을 보여준다.
From these results, it was confirmed that it has a 2319bp transcription decoding frame ORF (Open Reading Frame) estimated as beta glucosidase. This transcription decoding frame was named DDGL7. In addition, the function was estimated by searching with BlastX algorithm of GenBank. The flexible relationship analysis was performed using the Blast P search to collect data with high homology with the glucosidase from the previously reported amino acid sequence of beta glucosidase, which was analyzed by MEGA 5.1 and ClustalX program. NJ method (neighbor-joining tree, NJ) was used to create a tree and to compare. Beta glucosidase of the present invention is shown to be located in a relatively independent cluster (FIG. 1). Thus, DDGL7 or DDGD7 glucosidase exhibits up to 72% homology at the amino acid level, indicating that it is a novel glucosidase derived from a microorganism that is yet unknown at all, different from previously reported glucosidase.
3. 베타 3. Beta 글루코시다제Glucosidase 유전자의 과다발현을 위한 형질전환체의 제조 Preparation of transformant for overexpression of gene
본 발명의 베타-글루코시다제를 발현하는데 있어서, 상기 2의 DDGL7(핵산서열: 서열번호 1) 핵산서열에서 signal peptide가 포함된 원래유전자 DDGL7와 DDGL7의 N말단에서 signal peptide에 해당되는 20개의 아미노산이 결실된 DDGD7을 아래와 같이 프라이머를 디자인하여 중합효소 증폭반응을 통해 증폭하였다. 각각의 ORF만을 증폭하기 위하여 PCR primer를 제작하였고, fosmid/cosmid DNA를 template로 하여 HighPrime Taq polymerase (Takara, Japan)을 사용하여 PCR 반응을 수행하였다. 증폭된 산물은 각 ORF의 reading-frame에 따라 Hig-Tag을 가진 대장균 발현 벡터인 pET21b 에 frame 별로 directional in-fusion 하였다 (In-Fusion cloning kit, Clone Tech, USA). PCR 증폭산물이 발현벡터에 적절하게 삽입된 것은 junction 부위의 염기서열을 결정하여 확인하였다.In expressing beta-glucosidase of the present invention, 20 amino acids corresponding to the signal peptide at the N-terminal of the original genes DDGL7 and DDGL7 containing a signal peptide in the DDGL7 (nucleic acid sequence: SEQ ID NO: 1) nucleic acid sequence of 2 This deleted DDGD7 was amplified by polymerase amplification by designing a primer as follows. PCR primers were prepared to amplify each ORF, and PCR reactions were performed using HighPrime Taq polymerase (Takara, Japan) using fosmid / cosmid DNA as a template. The amplified product was directional in-fusion frame by frame to pET21b, an E. coli expression vector with Hig-Tag, according to the reading-frame of each ORF (In-Fusion cloning kit, Clone Tech, USA). Insertion of the PCR amplification product into the expression vector was confirmed by determining the nucleotide sequence of the junction site.
** pEGL7pEGL7 (' (' With'With ' thethe leaderleader sequencesequence , , withoutwithout TAATAA stopstop codoncodon atat thethe 3'- 3'- endend ))
Forward (SalI site included);Forward (SalI site included);
TCGAGCTCCGTCGACATGAAAAAAACGGTATTATTAATGGTCGAGCTCC GTCGAC ATGAAAAAAACGGTATTATTAATGG
Reverse (XhoI site included) ; Reverse (XhoI site included);
GTGGTGGTGCTCGAGCAAAACCGTGATAACCGTCTGTGGTGGTG CTCGAG CAAAACCGTGATAACCGTCT
** pEGD7pEGD7 (' (' Without'Without ' thethe leaderleader sequencesequence , , withoutwithout TAATAA stopstop codoncodon atat thethe 3'- 3'- endend ))
Forward (SalI site included); Forward (SalI site included);
TCGAGCTCCGTCGACCAAACCAACAACGATATGAATCGAGCTCC GTCGAC CAAACCAACAACGATATGAA
Reverse (XhoI site included); Reverse (XhoI site included);
GTGGTGGTGCTCGAGCAAAACCGTGATAACCGTCT
GTGGTGGTG CTCGAG CAAAACCGTGATAACCGTCT
증폭된 단편들을 제한효소 SalI과 XhoI으로 절단한 후, 이와 동일한 효소로 절단된 pET21b벡터에 삽입, DDGL7과 DDGD7의 ORF(Open Reading Frame)를 pET21b(Novagene, USA)에 각각 클로닝하여 E. coli DH5알파의 competent cell에 형질전환하여 엠피실린이 함유된 배지(100ug/ml)에서 선발하고 이로부터 재조합 플라스미드(pEGL7 과 pEGD7)를 분리하였다. 이 플라스미드는 단백질과 발현 숙주세포인 E. coli BL21(DE3)에 재형질전환하고 이를 한국농용미생물센타에 기탁하여(2012. 5. 10일) KACC95119P(pEGL7)와 KACC95118P(pEGD7) 기탁번호를 부여 받았다. 이 균주는 글루코시다아제의 대량 발현 및 정제를 위한 균주로 사용하였다.
Cutting the amplified fragments with a restriction enzyme Sal I and Xho I and then, on the other inserted in the pET21b vector digested with the same enzymes, and cloned into each of the DDGL7 and DDGD7 ORF (Open Reading Frame) of the (Novagene, USA) pET21b E. coli Transformed competent cells of DH5alpha were selected from medium (100ug / ml) containing empicillin to isolate recombinant plasmids (pEGL7 and pEGD7). This plasmid is a protein and expression host cell E. coli Retransformed to BL21 (DE3) and deposited it with Korea Agricultural Microorganism Center (May 10, 2012) and received accession number of KACC95119P (pEGL7) and KACC95118P (pEGD7). This strain was used as a strain for mass expression and purification of glucosidase.
4. 4. 재조합단백질(신규 베타-글루코시다제)의Of recombinant protein (new beta-glucosidase) 발현 및 정제 Expression and purification
pEGL7 및 pEGD7을 형질전환 시킨 E. coli BL21(DE3)를 250ml LB(Luria-Bertani, Gibco-BRL사) 액체 배지에 ampicillin(100 μg/mL)과 함께 접종하여, OD600nm값 0.6에서 0.5 mM IPTG(이소프로필-B-D-티오갈락토피라노시드)를 첨가하여 37℃에서 4시간 동안 발현시킨 다음, 6,000 rpm, 10분간 원심분리후 cell pellet을 회수하였다. 여기서 효소가 균체 외로 분비되는가를 보기 위해 균체가 제거된 배양액은 암모늄설페이트 분말을 포화되도록(700g/리터) 서서히 실온에서 첨가하여 혼합해준다. 포화된 용액은 원심분리하여(6,000rpm, 10분) 그 침전물을 멸균증류수로 5ml 녹인 뒤 투석막(분자량 6,000 cut-off, 스펙트럼사) 에 넣고 증류수로 여러 차례 투석하고 그것을 활성 분석또는 SDS-PAGE의 시료로 사용하였다. 원심분리로 세포침전물을 제거한 cell lysate를 nickel-nitrotriacetic acid (Ni-NTA) agarose resin(Qiagen, Germany)에 binding 시킨 후, 동일한 완충액으로 2회 세척 하고, 100~250mM imidazole 함유 elution buffer로 6His-tagged protein을 용출하였다. 용출한 단백질은 dialysis buffer [20 mM Tris-HCl, pH 7.5]로 충분히 투석하여 사용하였다. E. coli BL21 (DE3) transformed with pEGL7 and pEGD7 was inoculated with ampicillin (100 μg / mL) in 250 ml LB (Luria-Bertani, Gibco-BRL) liquid medium, and 0.5 mM IPTG (0.6 600 nm) at an OD600 nm of 0.6. Isopropyl-BD-thiogalactopyranoside) was added and expressed at 37 ° C. for 4 hours, and then cell pellet was recovered after centrifugation at 6,000 rpm for 10 minutes. In order to see if the enzyme is secreted out of the cells, the culture medium from which the cells are removed is slowly added to the ammonium sulfate powder (700 g / liter) and mixed at room temperature. The saturated solution was centrifuged (6,000 rpm, 10 minutes), and the precipitate was dissolved in 5 ml of sterile distilled water, placed in a dialysis membrane (molecular weight: 6,000 cut-off, spectroscopy), and dialyzed several times with distilled water. Used as a sample. Cell lysate from which cell precipitates were removed by centrifugation was bound to nickel-nitrotriacetic acid (Ni-NTA) agarose resin (Qiagen, Germany), washed twice with the same buffer, and 6His-tagged with 100-250 mM imidazole-containing elution buffer. Protein was eluted. The eluted protein was sufficiently dialyzed with dialysis buffer [20 mM Tris-HCl, pH 7.5].
한편 회수된 균체는 Lysis buffer(20%(W/V) sucrose, 30mM Tris-HCl, 1mM EDTA, pH 8.0) 25ml로 현탁시키고 초음파로 파쇄(Pulse on 15초, Pulse off 30초, 3회 실시)하여 다시 원심분리(13,000×rpm, 10 min)하여 회수한 상등액을 조효소액으로 사용하고 이를 정제하기 위해서 Ni-NTA(Qiagen, Germany)10ml로 충진된 칼럼에 로딩하여 결합시키고 10 volume의 washing buffer (50mM NaH2PO4 (pH8.0), 300mM NaCl, 20mM Imidazole)로 씻어주고 단백질을 마지막으로 5 volume의 elutioin buffer(50mM NaH2PO4 (pH8.0), 300mM NaCl, 100mM Imidazole)로 용출시켜 순수 분리하였다(Qiagen U.S.A). 이들 분획은 분자량 10kDa 이상을 농축할 수 있는 Centrifugal filter(Amicon Ultracell -10K, Millipore Co.)을 이용하여 정제하였다. 최종 정제된 단백질은 활성 분석 또는 SDS-PAGE의 시료로 사용하였다. The recovered cells were suspended in 25 ml of Lysis buffer (20% (W / V) sucrose, 30 mM Tris-HCl, 1 mM EDTA, pH 8.0) and crushed by ultrasound (pulse on 15 seconds, pulse off 30 seconds, 3 times). Centrifugation (13,000 × rpm, 10 min) to recover the supernatant and use it as a coenzyme solution to load and purify the column packed with 10 ml of Ni-NTA (Qiagen, Germany) and bind to 10 volumes of washing buffer ( 50mM NaH was eluted with 2 PO 4 (pH8.0), 300mM NaCl, 20mM Imidazole) Finally, the 5 volume elutioin buffer (50mM NaH 2 PO 4 (pH8.0) of the washed protein, 300mM NaCl, 100mM Imidazole) Pure separation (Qiagen USA). These fractions were purified using a Centrifugal filter (Amicon Ultracell-10K, Millipore Co.) capable of concentrating at least 10 kDa molecular weight. The final purified protein was used as a sample of activity assay or SDS-PAGE.
효소활성은 50mM sodium phosphate buffer(pH 7.0)에 p-nitrophenyl-β-D-glucoside 를 10 mM이 되도록 각각 제조한 후, 10 μL의 기질용액에 조효소액이나 Ni-NTA칼럼으로 분획한 정제액을 각각 100배 희석한 시료10μL씩 첨가하여 55℃에서 60분간 반응시킨 후 1M Na2CO3 용액 100 μL를 첨가하여 반응을 중지시켜 유리된 ρ-nitrophenol(pNP, Sigma, USA)의 양을 405 nm에서 흡광도로 측정하였다. 효소활성 단위는 1분 동안에 1 mole의 pNP를 유리시키는데 필요한 효소량을 1 unit로 정의하였다.For enzymatic activity, p-nitrophenyl-β-D-glucoside was prepared in 50 mM sodium phosphate buffer (pH 7.0) to 10 mM, respectively, and purified solution fractionated with co-enzyme solution or Ni-NTA column in 10 μL of substrate solution. 10 μL of each 100-fold diluted sample was added and reacted at 55 ° C. for 60 minutes. Then, 100 μL of 1M Na 2 CO 3 solution was added to stop the reaction. The amount of free ρ-nitrophenol (pNP, Sigma, USA) was 405 nm. Absorbance was measured at. The enzyme activity unit was defined as 1 unit of the amount of enzyme required to release 1 mole of pNP in 1 minute.
발현된 단백질은 SDS-PAGE(Lamni 법)에 의해 확인하였다. 상기의 분석 결과 pEGL7, pEGD7의 대장균에서 발현된 단백질은 SDS-PAGE(Lamni 법)에 의해 확인하였다. 상기의 분석 결과 pEGL7, pEGD7의 84 및 83kDa 크기의 재조합 단백질이 발현되었음을 확인할 수 있었다 (도 3: lane3, lane6). 또한, 이들 유전자의 발현 균주 배양액으로부터 암모늄설페이트 침전물을 비교하였다(도 3의 lane 4, lane 7). 83kDa 크기의 재조합 단백질이 발현되었음을 확인할 수 있었다(도 3: lane3, lane6). 또한, 제작된 발현벡터 pEGL7과 pEGD7를 대장균에 형질전환 유도 후, 암모늄설페이트 침전물을 비교하였다(도 3의 lane 4, lane 7). 그 결과 20 아미노산의 signal sequence를 제거한 pEGD7형질전환 대장균이 pEGL7형질전환주와 달리 세포외로 베타 글루코시다제를 분비함을 확인하였다. 즉, DDHC3 클론 내 베타 글루코시다제를 코딩하는 것으로 추정되는 유전자에서 세포외 분비와 관련하는 signal peptide 존재가 확인되었다. 상세하게는 예측한 베타-글루코시다제의 N말단 부위 약 20 아미노산의 signal sequence의 제거가 오히려 세포외 분비에 중요한 역할을 하고 있음을 확인시켜주는 것으로 판단된다. 균체의 경우에도 단지 초음파 처리에서도 DDGD-글루코시다제가 예측된 분자량 위치에 단백질 밴드가 진하게 나타나고 강한 활성을 보임으로서 이들이 과 발현에서 흔히 나타나는 불용성 단백질체(인글루전바디)가 전혀 형성되지 않은 매우 수용성이 높은 글루코시다제가 다량으로 발현됨을 확인하였다.
The expressed protein was confirmed by SDS-PAGE (Lamni method). As a result of the above analysis, proteins expressed in pEGL7 and pEGD7 Escherichia coli were identified by SDS-PAGE (Lamni method). As a result of the analysis, it was confirmed that recombinant proteins of 84 and 83 kDa sizes of pEGL7 and pEGD7 were expressed (FIG. 3: lane3 and lane6). In addition, ammonium sulfate precipitates were compared from the expression strain cultures of these genes (
5. 신규 베타- 5. New Beta 글루코시다제의Glucosidase 최적활성 조건과 열 안정성 분석 Optimum Activity and Thermal Stability Analysis
pH별 활성 측정에 사용된 버퍼는 pH 4~6, Sodium acetate; pH 6~7.5, Potasium phosphate; pH 7.5~9, Tris.Cl buffer를 사용하였다. 발현단백질을 pNP-베타-D-glucoside를 기질로 사용하여 각 온도와 pH별로 글루코시다제 활성을 측정하였다. pEGD7의 산물인 DDGD7 베타-D-글루코시다제는 55℃와 pH 7.0에서 최적 활성을 나타내었으며(도 4), 특이하게도 pH 9.0에서도 70% 이상의 활성을 유지하였다. 이 효소는 70℃이상의 고온과 산성 조건(pH 5이하)에서는 활성이 급속히 감소하였다. Buffers used for pH-specific activity measurements were pH 4-6, Sodium acetate; pH 6-7.5, Potasium phosphate; pH 7.5-9, Tris.Cl buffer was used. Glucosidase activity was measured at each temperature and pH using pNP-beta-D-glucoside as a substrate. DDGD7 beta-D-glucosidase, a product of pEGD7, showed optimal activity at 55 ° C. and pH 7.0 (FIG. 4), and specifically maintained at least 70% activity even at pH 9.0. The enzyme rapidly decreased its activity at high temperature above 70 ℃ and acidic condition (below pH 5).
또한 발현단백질을 pNP-베타-1,4-D-glucoside를 기질로 사용하여 각 온도(25℃, 35℃, 45℃, 55℃, 65℃)로 1시간 처리 후, DDGD7베타-D-글루코시다제는 55℃와 pH 7.0에서 시간별로 활성을 측정하였다. 이 효소는 35℃까지 열 안정성이 있으나 55℃에서는 급격히 열안정성이 감소됨을 보여주었다. 또한 35℃에서 시간별로 효소의 안정성 분석을 하였고, 이 분석의 조건은 55℃. pH 7.0에서 60분 반응 후 기질 pNPG에 대한 효소활성을 최적조건을 100으로 하고 상대적 활성을 나타내었다. 시간별로 효소안정성을 분석한 결과 이 효소는 14시간 반응에도 효소활성이 80%이상 유지하였으므로 이는 비교적 열에 안정함으로 비교적 산업적 응용에 유리한 것으로 기대된다(도 4).
The expression protein was treated with pNP-beta-1,4-D-glucoside as a substrate for 1 hour at each temperature (25 ° C, 35 ° C, 45 ° C, 55 ° C, 65 ° C), followed by DDGD7beta-D-glucose. Cidase was measured for activity at 55 ° C. and pH 7.0 over time . The enzyme showed thermal stability up to 35 ° C but rapidly decreased at 55 ° C. In addition, the enzyme stability analysis was performed at 35 ° C. over time, and the condition of the assay was 55 ° C. After 60 minutes of reaction at pH 7.0, the enzyme activity for substrate pNPG was set to 100 as the optimal condition and showed relative activity. As a result of analyzing the enzyme stability by time, the enzyme maintained more than 80% of the enzyme activity even after 14 hours of reaction, which is relatively thermally stable and is expected to be advantageous for a relatively industrial application (FIG. 4).
6. 신규 6. New 베타글루코시다제의Betaglucosidase 기질 특이성 및 다양한 화합물에 대한 활성 영향 분석 Substrate specificity and activity impact analysis on various compounds
상기 4에서 설명한 방법대로 이들 발현된 유전자의 산물인 효소의 활성과 기질특이성을 검정한 결과는 도 5에서 보는 바와 같다. 핵산서열 분석 상 글루코시다제로 추정되는 유전자(pEGD7)의 발현단백질의 활성 검정에서, 재조합단백질은 예상한대로 주 활성이 베타-1,4 D-글루코시다제 임이 최종 확인되었으며 이것이 베타-D-cellobiose, -cellotriose,-cellopentose의 베타 1,4 글루코시드결합과 sorphorose의 베타 1,2 글루코시드결합을 절단하여 이들을 글루코오즈로 분해하는 활성이 있음도 확인하였다. 그리고 천연 셀루비오즈계열이나 아릴 글루코시드 화합물의 활성은 환원당을 정량하는 Dinitrosalicylate (DNS) assay방법에 준해 행하였다. 먼저 환원당 정량에 사용될 DNS 시약은 NaOH (16g/L), 3,5-dinitrosalicylate (10g/L), sodium potassium tartarate (300g/L)을 함유하도록 제조하였다. 먼저 glucose solution을 이용하여 그린 표준곡선을 이용하여 정량분석 하였다. substrate 10mM, 정제된 DDGD-글루코시다제 17.7ug을 55℃에서 1시간 반응시킨다. 반응액 100ul와 DNS reagent 1,000ul을 혼합한 후 100℃에서 10분 동안 boiling한다. 10분 뒤 ice에서 즉각 냉각시킨 후, 570nm에서 흡광도를 측정하였다. 상대활성은 셀루비오스를 100으로 하여 상대치를 나타냈다.As shown in FIG. 4, the results of assaying the activity and substrate specificity of enzymes, which are products of these expressed genes, are as shown in FIG. 5. In nucleic acid sequencing analysis, the activity of the expression protein of the gene (pEGD7) presumed to be glucosidase, the recombinant protein was finally confirmed that the main activity is beta-1,4 D-glucosidase as expected, which is beta-D-cellobiose, It was also confirmed that the
또한, 금속이온은 10mM, 기타 케미칼은 3%, 그리고 유기용매는 실온에서 1시간 노출 후 55℃. pH 7.0에서 60분 반응 후 기질pNPG에 대한 효소활성을 무처리를 대조구로 하여 상대적 활성을 분석하였다.In addition, the metal ion is 10 mM,
다양한 금속이온에 대한 이 효소의 활성도를 분석한 결과, 니켈, 구리, 철은 심각하게 활성을 저해하였고 마그네슘이나 망간은 오히려 10%정도 활성을 증가시켰다. 한편 유기용매나 다양한 케미칼에 대한 본 효소의 활성에 대한 영향을 분석한 결과, isopropanol에서 1시간 노출 시, 또는 3%의, DTT, urea 조건에서 오히려 활성이 약간 증가경향이 있는 반면에, 메탄올, 트윈계, 트리톤X-100, SDS, EDTA, 글리세롤에서는 심각한 활성 저해가 보였다. 보다 특기할 사항은 본 효소가 10mM글루코오즈에 의해 활성이 경쟁적으로 저해받지만 10mM 만노오즈에는 오히려 활성을 최대 60%까지 증가되는 사실을 관찰할 수 있었다. 이와 같이 본 발명의 신규 글루코시다제는 기존 보고된 것과는 매우 다른 생화학적 특성을 보이고 있다(도 5).Analysis of the enzyme's activity on various metal ions showed that nickel, copper and iron severely inhibited activity, whereas magnesium and manganese increased their activity by 10%. On the other hand, the effect of enzyme activity on organic solvents and various chemicals was analyzed. After 1 hour of exposure to isopropanol, or 3% of DTT, urea conditions tended to increase slightly, whereas methanol, Tween, Triton X-100, SDS, EDTA, and glycerol showed severe activity inhibition. It should be noted that the enzyme was competitively inhibited by 10 mM glucose, but the activity was increased up to 60% in 10 mM mannose. As such, the novel glucosidase of the present invention shows very different biochemical properties from those previously reported (FIG. 5).
이외에도 화장품의 미백제로 사용되는 알부틴에 있는 글루코오사이드 결합도 절단함을 확인하였다(도 5). 본 발명의 베타 글루코시다제는 단지 글루코시드 결합에만 작용하는 기질특이성을 가지고 천연-글리코시드나 천연 아릴-글리코시드 화합물에도 우수한 활성을 보여 산업적 응용의 가치가 매우 기대된다고 할 수 있다. 또한 정제된 효소의 비활성(specific activity)은 약 180unit/단백질mg 이었다.
In addition, it was confirmed that cleavage of the glucose side bond in arbutin used as a whitening agent of cosmetics (FIG. 5). Beta glucosidase of the present invention has a substrate specificity that acts only on glucoside linkages and shows excellent activity against natural-glycosides or natural aryl-glycoside compounds, which can be said to be of great value for industrial applications. In addition, the specific activity of the purified enzyme was about 180 units / mg of protein.
7. 7. DDGD7DDGD7 -베타 -beta 글루코시다제의Glucosidase 생산성 분석 및 경제적 가치 Productivity Analysis and Economic Value
대장균(KACC95118P)에 의한 DDGD7-글루코시다제의 생산량과 총 효소활성을 보기 위해 250ml의 LB 배지에 OD600nm에서 0.6되도록 배양한 뒤 1mM IPTG로 4시간 동안 유전자를 발현유도하고, 그것의 세포잔사를 모은 뒤 Lysis buffer(20%(W/V) sucrose, 30mM Tris-HCl,1mM EDTA, pH 8.0) 15ml로 현탁시키고 초음파로 파쇄 (Pulse on 15초, Pulse off 30초 , 3회)하여 원심분리하였다. 그 상층을 단백질 정량하고 이를 Ni-NTA affinity column으로 결합시킨 뒤 20-100mM imidazole 완충액으로 용출하여 각 분획의 단백질 양과 효소활성을 분석하였다(도 6).In order to see the production and total enzymatic activity of DDGD7-glucosidase by E. coli (KACC95118P), it was incubated in 250 ml of LB medium at 0.6 OD600nm for 4 hours with 1 mM IPTG, and the cell residues were collected. Lysis buffer (20% (W / V) sucrose, 30mM Tris-HCl, 1mM EDTA, pH 8.0) was suspended in 15ml and pulverized by ultrasonication (Pulse on 15 seconds, Pulse off 30 seconds, 3 times) and centrifuged. Proteins were quantified in the upper layer and bound to a Ni-NTA affinity column and eluted with 20-100 mM imidazole buffer to analyze the protein amount and enzyme activity of each fraction (FIG. 6).
한편 단백질의 양을 측정하기 위해서 Bradford 분석법을 이용하였다. BSA(bovine serum albumin, New Englnad BioLab)를 표준품으로 이용하여 표준검량곡선을 작성한 후 측정하였다. 1:5 비율로 dilution한 protein assay dye reagent(Bio-Rad) 1ml에 시료 10ul를 상온에서 5분 동안 incubation 시킨 후, 595nm에서 흡광도를 측정하였다.Bradford assay was used to measure protein levels. BSA (bovine serum albumin, New Englnad BioLab) was used as a standard to prepare a standard calibration curve. After incubating 10ul of the sample in 1ml of protein assay dye reagent (Bio-Rad) diluted 1: 5 at room temperature for 5 minutes, absorbance was measured at 595 nm.
초음파처리로 파쇄된 수용성 단백질 총량에 목표된 효소의 정제도는 60%이상 이었으며 이를 정제한 분획(정제도 98%)에서는 specific 효소활성도가 180 unit/단백질mg 정도였다. 이는 통상적인 배양조건에도 리터당 정제 효소가 적어도 120mg, 총 20,000unit이상 생산되는 것으로 산정된다. 이는 대장균에서 기존의 어떠한 재조합 글루코시다제 보다도 탁월한 생산성을 보인 것이며 특히 숙주인 대장균에서 세포 외로도 수용성 효소를 분비하였기 때문에 생산단가를 획기적으로 절감할 수 있을 것이다. 이 효소는 식품 및 의약 산업의 적용 외에도 셀루로오즈로부터 에탄올의 생산에서 주요 3단계의 마지막 단계인 cellobiose에서 글루코오즈로 분해하는 핵심효소이므로 바이오연료의 실용화를 앞당기는데 기여할 것이다.
The solubility of the enzyme in the total amount of water-soluble protein crushed by sonication was more than 60%, and the specific enzyme activity of the purified fraction (98% tablet) was about 180 units / mg of protein. This is estimated to produce at least 120 mg of purified enzyme per liter, totaling more than 20,000 units, even under normal culture conditions. This shows an excellent productivity than any other recombinant glucosidase in Escherichia coli, and in particular, the production cost can be drastically reduced because the host E. coli secreted water-soluble enzymes extracellularly. In addition to applications in the food and pharmaceutical industries, the enzyme is a key enzyme that breaks down cellobiose into glucose, the last three major steps in the production of ethanol from cellulose, thus contributing to the advancement of biofuels.
서열목록 전자파일 첨부Attach an electronic file to a sequence list
Claims (7)
A transformant transformed with the recombinant vector of claim 5.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120060428A KR101388460B1 (en) | 2012-06-05 | 2012-06-05 | Novel β-glucosidases derived from microbial in intestinal of blacksoldier fly |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120060428A KR101388460B1 (en) | 2012-06-05 | 2012-06-05 | Novel β-glucosidases derived from microbial in intestinal of blacksoldier fly |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20130136759A KR20130136759A (en) | 2013-12-13 |
KR101388460B1 true KR101388460B1 (en) | 2014-04-23 |
Family
ID=49983356
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020120060428A KR101388460B1 (en) | 2012-06-05 | 2012-06-05 | Novel β-glucosidases derived from microbial in intestinal of blacksoldier fly |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101388460B1 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20100121361A (en) * | 2009-05-08 | 2010-11-17 | 대한민국(농촌진흥청장) | β-GLUCOSIDASE GENE FROM PHANEROCHATE CHRYSOSPORIUM, EXPRESSION VECTOR CONTAINING GENE, TRANSFORMANT TRANSFORMED BY THE VECTOR, AND METHOD FOR PREPARATION OF TRANSFORMANT |
-
2012
- 2012-06-05 KR KR1020120060428A patent/KR101388460B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20100121361A (en) * | 2009-05-08 | 2010-11-17 | 대한민국(농촌진흥청장) | β-GLUCOSIDASE GENE FROM PHANEROCHATE CHRYSOSPORIUM, EXPRESSION VECTOR CONTAINING GENE, TRANSFORMANT TRANSFORMED BY THE VECTOR, AND METHOD FOR PREPARATION OF TRANSFORMANT |
Non-Patent Citations (1)
Title |
---|
GenBank Accession Number ZP_08470172 (2011.05.18.) * |
Also Published As
Publication number | Publication date |
---|---|
KR20130136759A (en) | 2013-12-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110438136B (en) | Beta-glucosidase and mutant gene, amino acid sequence and application thereof | |
KR101104068B1 (en) | Endo-1,4-ß-glucanase from garlic and uses thereof | |
JP6340647B2 (en) | Super thermostable cellobiohydrolase | |
EP2982749B1 (en) | Thermostable beta-xylosidase belonging to gh family 3 | |
KR101547296B1 (en) | A Novel Cellulase from Metagenomic Resources and Method for Preparing the Same | |
CN107236719B (en) | Thermostable cellobiohydrolase | |
KR101388460B1 (en) | Novel β-glucosidases derived from microbial in intestinal of blacksoldier fly | |
JP6364662B2 (en) | Thermostable β-xylosidase belonging to GH family 3 | |
KR101278608B1 (en) | Cellulase gene CS10 from Hermetia illucens and uses thereof | |
AU2012207132A2 (en) | Enhanced fermentation of cellodextrins and beta-D-glucose | |
EP3225688B1 (en) | Thermostable cellobiohydrolase | |
WO2015099169A1 (en) | Method for manufacturing sugar having fructose added thereto | |
KR101183114B1 (en) | -Glucosidase gene from Phanerochate chrysosporium, expression vector containing gene, transformant transformed by the vector, and method for preparation of transformant | |
US9752135B2 (en) | Thermostable β-glucosidase | |
KR101388457B1 (en) | Novel mannosidase derived from microbial in intestinal of blacksoldier fly | |
US9708594B2 (en) | Thermostable β-glucosidase | |
CN116042579A (en) | Acidic cellulase resistant to ionic liquid and alcohols and application thereof | |
US20180245060A1 (en) | Thermostable cellulases |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |