KR20120129519A - Method for culturing rhizopus microsporus var oliggosporus using rice - Google Patents

Abstract

PURPOSE: A culturing method of rhizopus spawn using rice is provided to multiply the utility of spawn by culturing the spawn using white rice. CONSTITUTION: A culturing method of rhizopus spawn using rice comprises the following steps: washing rice and swelling the same; boiling the swollen rice; cooling the rice at 26-34 deg. Celsius; inoculating the identity cultured at the temperature of 26-34 deg. Celsius into 1kg of rice; rooting the rhizopus mycelium by culturing at 30-35 deg. Celsius for 3-7 days; crushing the spawn bunch with a cutter by drying at room temperature and manufacturing rhizopus spawn which is crushed into a range of 60-100 meshes; and swelling the rice for 15-30 minutes. A step of removing moisture from the surface for 10-30 minutes is additionally included.

Description

Cultivation method of seed of R. coy using rice {METHOD FOR CULTURING RHIZOPUS MICROSPORUS VAR OLIGGOSPORUS USING RICE}

The present invention relates to a method for culturing lycopene seed using rice.

In the case of conventional seed culture, soybean-based methods were used.

Soybean is one of the representative foods of Korean people, it contains abundant protein and bioactive substances, it is known to have a good effect in the prevention of adult diseases. Soybean contains carbohydrates and lipids as well as protein, which is the main component. It has various vitamins and minerals such as calcium, phosphorus, iron and potassium. Examples of soy foods are so diverse that it is difficult to enumerate them, such as tofu, miso, soy sauce, bean sprouts, and soy milk.

That is, a method of inoculating and incubating the mushroom spawn having the characteristics of producing antioxidant substances in addition to the conventional edible or medicinal mushrooms in a soybean medium composed of soybean proved to be useful as described above was used.

The present inventors can cultivate the spawn using the rice, for example, brown rice, glutinous rice, white rice, etc., instead of the above-mentioned soybean, to increase the usefulness of the spawn, and have excellent starch decomposition ability and increase the glycosylation titer. The purpose is to provide a method for culturing.

In the cultivation method of Ryzopus spawn using rice according to the present invention, the step of washing the rice, called, steaming the soaked rice, cooling the steamed rice at a temperature of 30 to 45 degrees, and a temperature of 35 to 45 degrees Removing the identification from the mycelium cultured in the step of inoculating about 0.1 to 1.5g per 1Kg of the chilled rice, incubated for 3 days to 7 days at a temperature of 30 to 35 degrees and lysing the Lysopus mycelium and dried at room temperature It provides a method for culturing lycopene seed using a rice, characterized in that it comprises the step of crushing the mycelium mass with a cutter and pulverized in the range of 60 to 100 mesh.

After the rice is called for 15 to 30 minutes, further comprising the step of removing the water on the surface for 10 to 30 minutes by holding the soaked rice.

The rice is put in a pot, characterized in that steamed for 10 to 20 minutes.

After the hyphae inoculation step, the seed is inoculated in the air through the container is characterized in that it further comprises the step of covering the container with a plurality of perforated bags.

As described above, the present invention can culture the spawn using brown rice, glutinous rice brown rice, white rice, etc. to double the usefulness of the spawn, and can cultivate the rhizopus spawn which has excellent biostarch degrading ability and can increase the glycosylation titer. have.

Hereinafter, the specific production method of the present invention will be described step by step with examples, the scope of the present invention is not limited to these examples.

Example

The Ryzopus spawn of the present invention is a bacterium having high starch decomposition ability and a bacterium having a higher glycosylation titer.

The above Lysopus spawn seed was obtained by using the Ryzopus spawn grown in Meju.

A culture medium was prepared to culture the spawns so obtained.

To this end, first wash the spicy rice and settle in water for 15 to 30 minutes to work called spicy rice. At this time, the amount of spicy rice was within the range of 1Kg. At this time, when the time called the rice is less than 15 minutes the spores are not smoothed, if the time is older than 30 minutes, the problem that the rice is crushed.

In this case, glutinous rice (or brown rice, white rice, etc.) may be used instead of the spicy rice.

Subsequently, the rice so called is supported by a rice paddle and drained for 10 to 30 minutes. By removing the water within the time range, the water on the outer surface of the rice can be drained and the water is soaked in the rice.

Subsequently, drain the rice into the bowler and steam for 10 to 20 minutes. At this time, when the steaming time of the rice is less than 10 minutes, or more than 20 minutes, the problem is that the rice is crushed or spores are not formed.

Subsequently, the steamed rice is supported by a foil and cooled at room temperature for 10 to 20 minutes at a temperature of 26 to 34 degrees. Preferably it is effective to cool at a temperature of 28 to 32 degrees. At this time, when the cooling temperature is 28 degrees or more or 32 degrees or more, a problem arises that bacteria are attached.

Subsequently, the identification is removed from the hyphae cultured at a temperature of 28 to 32 degrees and inoculated with 0.1 to 1.5 g per 1 kg of chilled rice. At this time, it is also possible to use mycelia cultured by the existing culture method.

Here, when the temperature is 32 degrees or more or 28 degrees C or less, there are disadvantages in that various bacteria are attached.

Subsequently, the seeded inoculated rice is placed in an airy container (ie, a breathing container) and the container is covered with a bag. At this time, it is effective to use an envelope having a plurality of holes. This is to allow the mycelium to breathe at a certain temperature and steamed rice itself.

Subsequently, 3 to 7 days of incubation at a temperature of 30 to 35 degrees incubate the Lysopus mycelium.

Here, if the temperature is above 35 degrees, there is a problem that the Lysopsis mycelia do not survive, and when the temperature is less than 30 degrees, the mycelium is not activated.

Through such cultivation, there is water, air, temperature in the rice itself, so that the Lysopus mycelium can stick.

After culturing for 3 to 7 days in this way to dry at room temperature to break the mycelium mass with a cutter to prepare a Rhizopus microsporus ( Rhizopus microsporus var. Oligosporus ) pulverized in the range of 60 to 100 mesh with a grinder.

As mentioned above, the deposit of spawn from the rice was deposited on February 13, 2004 with the application number KCPC 10597BP to the Biotechnology Research Institute Gene Bank (KCTC) located at 52, Eeun-dong, Yuseong-gu, Daejeon. , And the base sequence is as follows.

     Rhizopus microsporus var. oligosprous (KCPC 10597BP):

5 '-

TAACAATGATTTCCTTAGTAACGGCGAGTGAACAGGAAAAAGCTCAAAGTTGGAACCTGTT

TGGCCTAGCTAAACCGGATTGTAAACTGTAGAAGTGTTTTCCAGGCAAGCCGGACCGATAA

GTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTCGGTCTGAGCATTTGCCTT

TTGCGATACACTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAATTGGGTGGTAAATC

TCACCTAAAGCTAAATATTGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATG

AAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAACCGTTTGG

AGCCAGACTGGCTTGTCTGTAATCAGTCTAAGCTTCGGCTTGGATGCACTTGCAGGCTATGC

CTGCCAACGACAATTTGGCTTGAGGGAAAAAACTAAGGGAAATGTGGCCCATCCGCGGGT

GTTATAGTCCCTTAGAAAATACCTTGGGCTGGATTGAGGTACGCAGCGAATGCTATTTGGCG

AGTTGGCTGGGAATATTTTCTGAGGTGCTTTGGTACTGAGGTTGATATTCCTAGTTACACTTC

TATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGACCCGTCTTGAAACACGGAC-3 '

Although the present invention has been described in connection with the above-mentioned preferred embodiments, it will be apparent to those skilled in the art that various modifications and variations can be made without departing from the spirit and scope of the invention, It is obvious that the claims fall within the scope of the claims.

Korea Biotechnology Research Institute KCTC10597BP 20040213

<110> CHO, Bu Hyun <120> METHOD FOR CULTURING RHIZOPUS MICROSPORUS VAR OLIGGOSPORUS USING          RICE <130> 1917 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 670 <212> DNA <213> Rhizopus microsporus var. oligosporus <220> <221> iDNA (222) (60) .. (670) <400> 1 taacaatgat ttccttagta acggcgagtg aacaggaaaa agctcaaagt tggaacctgt 60 ttggcctagc taaaccggat tgtaaactgt agaagtgttt tccaggcaag ccggaccgat 120 aagtcctttg gaacagggca tcatagaggg tgagaatccc gtcttcggtc tgagcatttg 180 ccttttgcga tacactttca aagagtcagg ttgtttggga atgcagccta aattgggtgg 240 taaatctcac ctaaagctaa atattggcga gaaaccgata gcgaacaagt accgtgaggg 300 aaagatgaaa agaactttga aaagagagtt aaacagtatg tgaaattgtt aaaagggaac 360 cgtttggagc cagactggct tgtctgtaat cagtctaagc ttcggcttgg atgcacttgc 420 aggctatgcc tgccaacgac aatttggctt gagggaaaaa actaagggaa atgtggccca 480 tccgcgggtg ttatagtccc ttagaaaata ccttgggctg gattgaggta cgcagcgaat 540 gctatttggc gagttggctg ggaatatttt ctgaggtgct ttggtactga ggttgatatt 600 cctagttaca cttctattcg cttaggttgt tggcttaatg actctaaatg acccgtcttg 660 aaacacggac 670

Claims (4)

In the cultivation method of Ryzopus spawn using rice,
Called rice washing;
Steaming the soaked rice;
Cooling the steamed rice at a temperature of 26 to 34 degrees;
Removing the identification from the hyphae cultured at a temperature of 26 to 34 degrees and inoculating about 0.1 to 1.5 g per 1 kg of chilled rice;
Culturing the Lysopus mycelium by culturing for 3 to 7 days at a temperature of 30 to 35 degrees; And
Drying at room temperature to crush the mycelium mass with a cutter and crushed in the range of 60 to 100 mesh with a grinder to produce a lycopene spawn comprising the step of culturing the lycopene spawn using rice. The method of claim 1,
After the rice is called for 15 to 30 minutes,
The method of culturing lycopene seed using a rice, characterized in that further comprising the step of supporting the soaked rice to remove the water on the surface for 10 to 30 minutes. The method of claim 1,
Method of culturing lycopene spawn using rice, characterized in that the rice is put in a yeonggi steamer for 10 to 20 minutes. The method of claim 1,
After the hyphae inoculation step,
Putting the seed inoculated rice in the air-contained container, the method of cultivating lycopene spawn using rice, characterized in that it further comprises the step of covering the container with a plurality of perforated bags.