KR20120095559A - Diagnosis method of high meat producing hanwoo using the dna marker associated with marbling score - Google Patents

Abstract

PURPOSE: A method for diagnosing Hanwoo of high quality meat using DNA marker related to marbling score is provided to identify meat quality property and to early diagnose Hanwoo of high quality. CONSTITUTION: A method for diagnosing Hanwoo of high quality meat using DNA marker related to marbling score comprises: a step of detecting individual DNA marker by 130th base substitution(A to G) of Hanwoo PDE1B(phosphodiesterase 1B) gene through PCR-RFLP(restriction fragment length polymorphism) analysis; a step of analyzing SNP genotype(AA, AG, and GG); and a step of predicting and determining Hanwoo with genetically high marbling score.

Description

Diagnosis method of high meat producing Hanwoo using the DNA marker associated with marbling score}

The present invention utilizes this by developing molecular markers related to Hanwoo meat quality using a specific monobasic polymorphism (SNP) of PDE1B (phosphodiesterase 1B) gene, which is closely related to Hanwoo meat quality through PCR-RFLP analysis. It provides a technique for early diagnosis of genetically superior Hanwoo.

Due to the development of molecular genetics and genetic analysis technology, the development of molecular labeling technology for diagnosis of genetic traits due to specific DNA sequence variation of candidate genes closely related to specific traits of livestock at the DNA molecule level is being actively developed. . Recently, a variety of DNA analysis methods, such as random amplified polymorphic DNA (RAPD), single strand conformation polymorphisms (SSCP), and microsatellite using PCR techniques, are used for early diagnosis and selection using molecular markers related to the major economic traits of livestock. This technology is being used in various industries. In particular, PCR-RFLP (restriction fragment length polymorphism) analysis, which uses restriction enzymes to PCR products of specific genes and shows DNA fragments differently according to differences in the corresponding nucleotide variation sites, is more reproducible and accurate than other analytical methods. This is an excellent technique for genetic testing.

In line with the trend of the times, several high-capacity Korean beef early diagnosis technologies using molecular markers related to economic quality of Korean cattle using molecular genetic techniques have been developed and patented / registered with the Korean Intellectual Property Office. As a representative example, the intramuscular fat-related primer of Hanwoo and the method of testing the intramuscular fat profile using the same (Application No .: 10-2000-0065925), the microsatellite DNA and its analysis primer set (Application No. : Patent No. 10-2004-0091892) and a novel primer set and a method for diagnosing Hanwoo economic traits using DNA molecular labels, such as a method of selecting Korean beef using the same method (application number: 10-2003-0093288).

However, the existing inventions described above, unlike the analysis method of the present invention using a gene that is closely associated with a specific expression, the genetic polymorphism of the individual according to the number of DNA base repeats of about 2-7 bp size Molecular markers using a distinctive microsatellite analysis technique have a disadvantage in that the accuracy of the molecular label is significantly lower than that of the PCR-RFLP analysis method used in the present invention. In contrast, in the present invention, the molecular marker was developed by PCR-RFLP using a specific SNP region of the PDE1B candidate gene, which is closely related to the Hanwoo economic trait, and thus could provide a gene molecular marker more related to the Hanwoo economic trait. In addition, the RFLP marker has a higher reproducibility than other analytical methods, and thus has an advantage of providing more accurate molecular molecular markers.

In order to protect and develop domestic Korean beef cattle farmers in response to the recent opening of the Korea-US FTA negotiations, it is necessary to increase the quality competitiveness by differentiating them from imported beef by enhancing the quality of beef cattle. In order to achieve this, it is important to create an optimal breeding environment, but by developing a state-of-the-art breeding and breeding model that diagnoses and selects Korean cattle with excellent genetic qualities early, it is safe for consumers by producing high-quality, high-quality Korean cattle. Delicious high-quality beef Hanwoo will be available at a lower price. Korean livestock grading is based on carcass grades such as marbling, meat color, fat color, texture and maturity in the case of Korean beef grade. The grade of meat grade is 1 ++, 1+, 1, 2, 3 grade. Among these items, intramuscular fat is one of the most significant factors in determining meat grade. Therefore, in order to enhance quality competitiveness through the quality improvement of the beef, it is important to diagnose and select individuals genetically excellent in intramuscular fat early and manage the breeding in the optimal environment.

Conventional quantitative genetic methods for livestock breeding have relied on the phenotypic record of livestock. In other words, candidate cows are selected first by the current records such as pedigree records and body development, breeding and slaughtering subsequent black cattle produced by crossbreeding, recording carcass and meat traits, and excluding the environmental factors in which livestock is raised as much as possible. In order to estimate the true breeding value of livestock, we devised the most appropriate statistical model to select breeders, which takes much time to measure phenotypic observations, delaying the selection of breeders, resulting in longer generation intervals and many head counts. Since the breeder is raising a breeder's breeder, it costs economic and excessive labor such as feed, facility investment, maintenance and labor costs. As such, there is a limit to expecting a high improvement effect only by the conventional quantitative genetic method. Therefore, the latest breeding method using marker assisted selection (MAS) has recently been in the spotlight. The MAS method is a method that enables early diagnosis and selection of individuals with high specific traits such as meat quality and meat quantity through genetic testing, DNA marker analysis, before livestock is slaughtered. In addition to increasing the speed of the process, higher efficiency can be expected. Therefore, the present invention was carried out to develop a technique that can be utilized for early diagnosis and selection of high-quality meat-producing Hanwoo by using the molecular markers of genes closely related to meat quality of Hanwoo.

Therefore, the present inventors have researched and developed to improve the above problems, and selected PDE1B gene present in bovine chromosome as a candidate gene related to meat quality of Hanwoo to discover molecular markers that are closely related to intramuscular fat of Hanwoo. And invented a high-quality meat-producing Korean beef diagnostic method. The Hanwoo PDE1B gene used in the present invention is categorized into 11 families according to the regulation of amino acid sequence, substrate specificity, and mechanism, and they are classified by numbers. Among them, phosphodiesterase 1B, which is dependent on calcium and calmodulin, catalyzes the conversion to cAMP, cGMP, AMP and GMP. According to previous studies, phosphodiesterase 1B is a gene related to adipose tissue and is known to be involved in the formation of carcass fat. That is, cAMP and cGMP act on hormones such as adrenaline, ACTH, and glucagon, and these hormones act on adipose tissues to break down fat. When phosphodiesterase is increased, cAMP and cGMP are converted to AMP and GMP to increase fat breakdown. Inhibition of fat accumulation and reduction of phosphodiesterase resulted in a decrease in conversion of cAMP and cGMP to AMP and GMP. Therefore, in the present invention, the PDE1B gene related to fat accumulation and fat metabolism in the body is finally selected as a candidate gene for Hanwoo meat quality, PCR-RFLP analysis using specific SNP of PDE1B gene, and correlation statistics with meat and meat-related traits. Through the analysis, we developed a DNA marker that is closely related to meat quality, and developed a DNA molecule label that can be used for early diagnosis and selection of high-quality meat produced with high genetically superior muscle fat.

More specifically, genomic DNA is isolated from the blood of Hanwoo, amplified by PCR using a primer containing the intron 3 region of the PDE1B gene, and Mbi I restriction enzyme is added to the amplified PCR product. DNA fragments were electrophoresed on an agarose gel to determine DNA markers for each genotype, and the DNA markers associated with intramuscular fat were analyzed through statistical analysis of the association between carcass quality and meat quality of Hanwoo. By exploiting this, it provides a genetically superior meat quality early diagnosis method.

Using the DNA genotype markers (AA, AG and GG types) resulting from the 130th A↔G base substitution in the amplification region of the Hanwoo PDE1B gene intron 3 region, the carcass quality characteristics of the intramuscular fat of Hanwoo could be identified. Based on these results, early diagnosis and selection of high-capacity Hanwoo cattle and industrial utilization of useful genetic resources are possible. In other words, early diagnosis and selection of individuals carrying the AG genotype of the PDE1B gene maximizes the efficiency and improvement of the Hanwoo Breeding Improvement Project, and at the same time improves and preserves Korea's unique Hanwoo genetic resources. Can be.

  In addition, the present invention is a state-of-the-art molecular breeding technique using PCR-RFLP analysis method for genomic DNA of Hanwoo, the PCR-RFLP analysis technique used in the present invention can maximize the efficiency and practicality of selection since it is fast, simple and accurate. In addition, there is an advantage that the DNA marker genotype can be more easily, quickly and accurately determined in a large number of samples.

Figure 1 shows the SNP genotype (DNA marker) of each individual due to the 130th A↔G monobasic polymorphism (SNP) in the Hanwoo PDE1B gene amplification region of SEQ ID NO: 1 detected by PCR-RFLP analysis in the present invention Yeongdong pictures
Figure 2 shows the base sequence of each SNP genotype (DNA marker) for the 130th A↔G monobasic polymorphism (SNP) in the Hanwoo PDE1B gene amplification region of SEQ ID NO: 1 detected by the PCR-RFLP analysis technique in the present invention Analytical chromatogram

In order to achieve the above object, the present invention will be described in more detail with reference to the following non-limiting examples.

Example 1 Hanwoo PDE1B  Gene SNP  Genotype detection

1. Test material and DNA separation and purification

Hanwoo, used in the present invention, was registered with the National Hospitality Assurance Project and selected 309 headed cattle cattle populations with lineage records and carcass scores through the Subsequent Test. Separation and purification of genomic DNA from each coaxial blood was partially purified by some modification of Miller et al. (1988). After measuring DNA concentration using spectrophotometer, TE buffer (10 mM Tris-HCl, pH 7.4; 1 mM EDTA), stored in -20 ℃ freezer and used as a test material.

2. PCR Amplification and SNP Detection of Hanwoo PDE1B Gene

For primers for amplifying the 800 bp DNA fragment shown in SEQ ID NO: 1 including the intron 3 to intron 5 regions of the Hanwoo PDE1B gene, refer to the nucleotide sequence information registered in GenBank Accession No. NC_007303.4. By designing and manufacturing as shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively, the primer base sequence used in the present invention is shown in Table 1.

Primer Sequences for PCR Amplification of the Hanwoo PDE1B Gene Gene name Seat Primer Sequence (5'-3 ') SEQ ID NO: PDE1B intron 3-
intron 5 Forward F-AGCAAAAGAAAGTCAAGGGAG 2 Reverse R-ACACATGGGAAGCAGGAAAATA 3

Reaction conditions for PCR amplification of the PDE1B gene were performed using the GeneAmp System 9700 (GenAmp PE Applied Biosystem, USA) under the following conditions. In other words, the composition of the reaction solution was prepared by adding 50 ng of template DNA, 0.1 μM of primer, 250 μM of dNTP, 2 μl of 10X PCR buffer, and 1 unit of Taq DNA polymerase to a 0.2 ml tube. Adjust to μl. PCR reaction conditions were pre-heated for 5 minutes at 94 ° C, followed by a total of 35 cycles of 30 seconds at 94 ° C, 30 seconds at 55 ° C, and 1 minute at 72 ° C, and finally amplified DNA by heating at 72 ° C for 5 minutes. The process was terminated. PCR amplification products were electrophoresed on 2% agarose gel to verify DNA amplification success. As a result of sequencing by direct sequencing technique using PCR amplification products of the Hanwoo PDE1B gene, a total of 800 bp of bases were detected as shown in SEQ ID NO: 1. A base polymorphism (SNP) site was detected. That is, the SNP was detected according to A↔G base substitution at the 17,122 th base (SEQ ID NO: 130) of NCBI GenBank Accession No. NC_007303.4, and the A↔C base at the 17,507 th base (515 th of SEQ ID NO: 1). SNPs were detected by substitution, and SNPs were detected by A↔G base substitution at the 17,575 th base (SEQ ID NO: 583). In addition, SNP was detected according to T↔C base substitution at the 17,607th base (615th of SEQ ID NO: 1), and SNP was detected according to C↔A base substitution at the 17,609th base (617th of SEQ ID NO: 1). SNP was detected according to C↔T base substitution in the fourth (700th sequence of SEQ ID NO: 1). Finally, the SNP was detected at the 17,707 th base (785 th of SEQ ID NO: 1) according to C↔G base substitution. Of the seven SNPs detected, RFLP analysis was performed using Mbi I restriction enzyme for SNP genotyping of individual Hanwoo subjects for SNPs according to A-G base substitution of the 17,122 th (SEQ ID NO: 1) 130 Was performed.

3. Analysis of SNP Genotype Marker of Hanwoo PDE1B Gene by PCR-RFLP Technique

My 130th SNP site A↔G amplified region of the detected beef PDE1B gene Mbi Ⅰ restriction enzyme recognition sites ^{(5'-GAG ↓ CGG-3} ') is present in three kinds of SNP genotypes of bovine PDE1B gene by RFLP technique (AA , DNA markers corresponding to AG and GG) were detected (Fig. 1 and Fig. 2).

RFLP analysis of the Hanwoo PDE1B gene was digested by adding 2 units of Mbi I restriction enzyme to 5 μl of PCR amplification products and then reacting at 37 ° C. for at least 3 hours. DNA fragments obtained by cleaving each PCR amplification product with restriction enzymes were electrophoresed for 2 hours at 100 volt voltage on 2% agarose gel using TBE buffer (90 mM Tris-borate, 2 mM EDTA, pH 8.0). After staining with EtBr (ethidium bromide), the DNA fragments were observed to determine the SNP genotype of each assay individual. In other words, two restriction enzyme recognition sites existed in AA homo genotypes, resulting in a total of three DNA fragments of 62, 263 and 475 bp size, and three restriction enzyme recognition in GG homo genotypes. A total of four DNA fragments with sites 62, 130, 133 and 475 bp in size were detected. Individuals with the AG hetero genotype detected all five DNA fragments and detected DNA bands with sizes 62, 130, 133, 263 and 475 bp (Fig. 1). However, DNA fragments of 130 and 133 bp whose molecular weights were very similar in size were expressed as one fragment on 2% agarose gel and detected.

  As a result of analyzing the occurrence frequency of the 130th SNP allele and genotype in the amplification region of the PDE1B gene, which was analyzed in a total of 309 Korean cattle cows, the allele frequency was 58.2%. , G allele was about 41.8%, A allele frequency was higher than G allele, SNP marker genotype frequency was 44.0% (136 heads), AG type 28.5% (88 heads), and The GG genotype was 27.5% (85 eyes) with the lowest GG genotype and the highest AA genotype.

Example 2 Hanwoo PDE1B  Gene DNA marker  Genotype and meat quality Flesh  Statistical analysis of association with traits

In order to estimate the effect of the SNP genotype of the Hanwoo PDE1B gene detected through the present invention on the carcass quality and carcass quality related carcass quality and breeding value of Hanwoo, it was statistically processed by PROC GLM method using SASⓐ8.2 Package / PC program. Among the traits of which genotype effects were recognized, significance test was performed by the Duncan's Multiple Range Test (DMRT) method.

As a result, the genotype of the SNP site (SEQ ID No. 130) by A↔G base substitution in the intron 3 region of the Hanwoo PDE1B gene was proved to be significantly correlated with the estimated myocardial fat breeding value of Hanwoo (P <.05). ). That is, as shown in Table 2, the individuals with AG genotype were significantly higher than those with AA and GG genotypes by 0.047 and 0.013, respectively (P <.05).

DNA marker genotype of Hanwoo PDE1B gene and its association with meat mass and meat quality Meat and meat quality SNP genotype P-value AA AG GG Birth weight / kg 535.179 ± 6.997 556.217 ± 8.624 545.060 ± 9.183 0.160 Conductor weight / kg 305.524 ± 4.465 318.201 ± 5.503 312.383 ± 5.860 0.194 Conductor Rate /% 57.048 ± 0.0221 57.154 ± 0.272 057.267 ± 0.290 0.840 Back fat thickness / cm 0.586 ± 0.032 0.747 ± 0.040 0.683 ± 0.042 0.017 Longest root area / cm² 73.855 ± 1.076 75.912 ± 1.327 76.187 ± 1.413 0.342 Local muscle degree / 1-7 2.049 ± 0.183 1.737 ± 0.225 2.230 ± 0.240 0.258 Carcass breeder estimate 1.623 ± 1.106 4.390 ± 1.363 3.677 ± 1.451 0.258 Estimates of breeding value 0.156 ± 0.311 0.706 ± 0.384 0.799 ± 0.409 0.388 Intramuscular fat breeding estimate -0.046 ± 0.011 ^b 0.001 ± 0.013 ^a -0.012 ± 0.014 ^ab 0.026 Back fat thickness breeding estimate 0.043 ± 0.078 -0.084 ± 0.096 0.125 ± 0.102 0.267

a, b: There is significant difference between different codes (p <.05).

In conclusion, the 130th A↔G SNP genotype in the amplification region of the Hanwoo PDE1B gene of the present invention has a significant correlation with the estimated myocardial fat breeding value, which is a very important item in determining the quality of Korean beef. It is proved that this molecular label can be used as a DNA molecule marker for early diagnosis and selection of Hanwoo, which is genetically superior in intramuscular fat.

In Figure 1, M: 100 bp DNA size marker; 1 to 5: Hanwoo individual numbers; AA, AG, GG: Each DNA marker genotype by the PDE1B gene SNP of the present invention. 62, 130, 133, 263, 475 bp: Size of DNA fragment
In Figure 2, AA, AG, GG: DNA marker genotypes for each sequencing chromatogram by the PDE1B gene SNP of the present invention.

<110> SANGJI UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Diagnosis method of high meat producing Hanwoo using the DNA          marker associated with marbling score <160> 3 <170> Kopatentin 1.71 <210> 1 <211> 800 <212> DNA <213> Bos taurus <220> <221> gene (222) (1) .. (800) <223> PCR product of PDE1B gene in Hanwoo <220> <221> primer_bind (222) (1) .. (21) <223> Forward primer binding site <220> <221> primer_bind <222> (779) .. (800) <223> Reverse primer binding site <220> <221> intron (222) (1) .. (144) <223> intron 3 <220> <221> exon 222 (145) .. (327) <223> exon 4 <220> <221> intron (328) (328) .. (507) <223> intron 4 <220> <221> exon (222) (508) .. (574) <223> exon 5 <220> <221> intron <222> (575) .. (800) <223> intron 5 <220> <221> variation <222> (130) <223> SNP: A / G <220> <221> variation <222> (515) <223> SNP: A / C <220> <221> variation <222> (583) <223> SNP: A / G <220> <221> variation <222> (615) <223> SNP: T / C <220> <221> variation <222> (617) SNP: C / A <220> <221> variation <222> (700) SNP: C / T <220> <221> variation <222> (785) <223> SNP: C / G <400> 1 agcaaaagaa agtcaaggga gggtcagcga agggagaggc tggtgtgaga gtttccgggg 60 tgtggggtgt ggctgggccc agggtctcca ggctgtggaa gcgcctgcag cctttcctct 120 gtgactccca ctctggggcc tcaggcaaat cctggacacg gaggatgagc tgcaggagct 180 gcggtctgat gcggtgcctt cagaggtgcg ggactggctg gcctccacct tcacccagca 240 gacccgggcc aaaggccgcc gagcggaaga gaagcccaag ttccggagca tcgtgcacgc 300 ggtgcaggct ggcatctttg tggagcggtg aggctcccca cgtcctgcct ccctcggccc 360 ctggcggtgg ccctctttcc caggggtgtc ttccaggact ccactgtatc accagcccat 420 gtgcccctgg cccaaccgcc cagccccgcc tgatcagacc ccatgatcag acctcactca 480 ggggctcctt tccttcttct ccctcaggat gttcaggaga acgtacacct ctgtgggccc 540 cacctactcc actgccgtcc tcaactgtct caaggtgatc ccagggagaa ggttaggggt 600 gggggatgga atagtcctca ggactttcag actcctctgg ggtgattttt acttcctttt 660 ttaattgtca tttccttggt tctcaaaaca actttgaccc acttaagagg caaactcctg 720 acttcttgtc tctcccatac tgaatgatat ccaggaagaa agaggcctgt ttactactta 780 ttttcctgct tcccatgtgt 800 <210> 2 <211> 21 <212> DNA <213> Bos taurus <220> <221> primer_bind (222) (1) .. (21) <223> Forward primer sequence <400> 2 agcaaaagaa agtcaaggga g 21 <210> 3 <211> 22 <212> DNA <213> Bos taurus <220> <221> primer_bind (222) (1) .. (22) Reverse primer sequence <400> 3 acacatggga agcaggaaaa ta 22

Claims (3)

PCR- comprising a process of treating Mbi I restriction enzyme on a Hanwoo PDE1B (phosphodiesterase 1B) gene amplification product amplified by polymerase chain reaction (PCR) amplification by primers of SEQ ID NO: 2 and SEQ ID NO: 3 Restriction Fragment Length Polymorphism (RFLP) analysis was used to detect individual DNA markers according to the 130th A↔G nucleotide substitution of the Hanwoo PDE1B gene sequence shown in SEQ ID NO: 1, and each SNP genotype. (AA, AG and GG) analysis to predict and determine the genetically high-margin Hanwoo cattle, characterized in that the high-quality meat production Hanwoo diagnostic method using the molecular label associated with Hanwoo muscle fatness The method according to claim 1,
A forward primer of SEQ ID NO: 2 having a nucleotide sequence structure of AGCAAAAGAAAGTCAAGGGAG in the 5 'to 3' direction and a reverse primer of SEQ ID NO: 3 having the nucleotide sequence structure of ACACATGGGAAGCAGGAAAATA in the 5 'to 3' direction A method for diagnosing high-quality meat produced using high-molecular meat-related molecular markers characterized by amplifying the Hanwoo PDE1B gene by PCR using The method according to claim 1,
Among the three DNA marker genotypes (AA, AG, and GG) of the Hanwoo PDE1B gene detected by PCR-RFLP analysis, Hanwoo individuals with AG genotype were genetically compared to Hanwoo individuals with AA and GG genotypes. A method of diagnosing high-quality meat produced using high molecular meat markers related to intramuscular fat, characterized in that it is predicted and determined by high-preferred Korean cattle.

Images