KR20120051928A - Extracts from acorn having potent anti-inflammatory activity and the pharmaceutical compositions containing the same - Google Patents

Abstract

PURPOSE: A pharmacological composition containing acorn extract is provided to reduce production of iNOS, COX-2 and nitric oxide and to ensure anti-inflammatory effect. CONSTITUTION: A composition with an anti-inflammatory activity contains 0.1-250 ug/ml of water or alcohol extract of acorn. The composition is used for treating or preventing rhinitis, bronchitis, hepatitis, pleurisy, peritonitis, arthritis(rheumatoid arthritis, psoriatic arthritis, cute gouty arthritis), asthma, chondromalacia, and coalescing spondylitis. The composition further contains pharmaceutically or sitologically acceptable carrier, excipient, or diluents.

Description

Extracts from Acorn Having Potent Anti-Inflammatory Activity and the Pharmaceutical Compositions Containing the Same}

The present invention relates to a composition containing an acorn extract, and more particularly to a composition comprising an acorn ethanol extract having an anti-inflammatory effect and a pharmacological composition containing the same as an active ingredient.

Acorns (acorn, Quercus acutissima CARR) are the fruits of oak, brown oak, sol oak, oak, and so on. In Korea, starch of acorns is used as jelly, but in many countries, porridge, rice cake as well as various It is used in the field. Although acorns vary depending on the type of tree the acorns are held on, acorns are very nutritious crops because they contain large amounts of proteins, carbohydrates and fats, as well as vitamins such as calcium, phosphorus, potassium and niacin. to be.

Gallic acid, digallic acid and gallotannin contained in acorns are known as antioxidants, and physicochemical, physical and organoleptic properties of acorn starch and acorn jelly have been reported.

For example, it has been reported that administration of extracts from acorn pulp and endothelium powder to rats reduces the level of total fat in plasma while also reducing the concentration of lipid peroxide in plasma and liver, but has virtually no antithrombotic effect ( Yuk Geun-jung et al. 2002. Korean Journal of Nutrition 35 (2): 171 ~ 182, Non-Patent Literature 1), When the acorn powder is extracted using a polar solvent such as water, the antioxidant effect is good, so it is a traditional symbol food or health functional food. It suggests the utility as a material (Shim TH. Et al. 2004. Korean J. Food Sci . Technol . 36 (5): 800-803, nonpatent literature 2)

When acorn powder was administered to mice that caused memory-learning disorders, the synthesis of acetylcholine (Ach), a major neurotransmitter in the brain, increased, and the activity of Ach degrading enzymes It has been confirmed that acorn powder is effective in preventing dementia such as senile dementia by confirming that the activity of the enzyme involved in the destruction of the transporter is inhibited (Lee SH. Et al. 2005. J. Korean Soc. Food Sci. Nutr. 34 (5) .738-742 , Non-Patent Document 3).

In addition, Korean Patent Registration No. 10-0453608 (Patent Document 1) proposes a process for manufacturing a health functional food using acorns from which the shell is removed, and Republic of Korea Patent Publication No. 10-2000-0048440 (Patent Document 2) ) Discloses a health functional food composition and a manufacturing method having an anticancer function in the form of a powdered and tableted mixture of olives, leeks, figs and the like in addition to acorns. In addition, Korean Patent No. 10-0567564 (Patent Document 3) proposes a method for extracting the obesity control substance as an active ingredient of acorns and a beverage containing the extract.

However, there is still a need to find ways to utilize acorns that can be obtained relatively easily from trees widely in Korea.

1. Republic of Korea Patent No. 10-0453608 2. Republic of Korea Patent Publication No. 10-2000-0048440 3. Republic of Korea Patent No. 10-0567564

Muscle root, etc. 2002. Korean Nutrition Society 35 (2): 171 ~ 182 2. Shim TH. et al. 2004. Korean J. Food Sci. Technol. 36 (5): 800-803 3. Lee SH. et al. 2005. J. Korean Soc. Food Sci. Nutr. 34 (5). 738-742

The present invention has been proposed to solve the above problems, the present invention is to identify the pharmacological effect of the extract of acorns.

That is, the present invention relates to the anti-inflammatory effect of the acorn ethanol extract, the object of the present invention is to invent the anti-inflammatory effect of the acorn ethanol extract that is not yet known for the use of acorn medicinal and industrial fields.

Eventually, the object of the present invention is to identify anti-inflammatory effects such as rhinitis, keratitis, bronchitis, hepatitis, pleurisy, peritonitis, arthritis (rheumatic arthritis, psoriatic arthritis, acute gouty arthritis), It is an object of the present invention to provide a pharmacological composition containing an acorn extract as an active ingredient having the effect of preventing or treating diseases such as asthma, chondrogenic softening, spondylitis spondylitis, otitis media and atopic dermatitis.

Other objects and advantages of the present invention will become more apparent with reference to the following detailed description and drawings.

As mentioned above, it is necessary to examine the possibility of using it as a pharmaceutically active ingredient or health functional food using acorns that can be easily purchased in Korea.

Accordingly, the present invention is a composition, for example, a pharmaceutical composition or a food engineering composition containing an alcohol extract of acorns having anti-inflammatory activity as an active ingredient. In order to obtain acorn extracts having anti-inflammatory activity, preferably nonpolar organic solvents such as alcohols having 1 to 4 carbon atoms can be used.

At this time, the acorn extract is involved in anti-inflammatory activity by inhibiting the expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS). Preferably, the acorn extract may be contained in the composition at a concentration of 0.1 ~ 250 ㎍ / ㎖.

By using the acorn extract having an anti-inflammatory activity according to the present invention as an active ingredient, rhinitis, keratitis, bronchitis, hepatitis, pleurisy, peritonitis, arthritis (rheumatic arthritis, psoriatic arthritis, acute gouty arthritis), asthma, cartilage softening, Inflammatory spondylitis, otitis media, atopic dermatitis can be prevented or treated inflammatory diseases selected.

In this case, the above-mentioned composition may further include a pharmaceutically or food engineering acceptable carrier, excipient or diluent.

In the present invention, it was found that the acorn ethanol extract has an anti-inflammatory effect, and accordingly, it is expected that the acorn can be used in various industrial fields such as medicine and food industry through a simple extraction method.

Specifically, the acorn ethanol extract used in the present invention was proved to be an anti-inflammatory material that can regulate the expression and production of COX-2, iNOS and nitrites which are closely related to the inflammatory response in macrophages.

Accordingly, the acorn extract having anti-inflammatory activity and the pharmacological composition containing the extract can be utilized as a prophylactic and therapeutic agent for inflammatory diseases, and in some cases, it is expected to receive attention from health functional foods and health drinks.

In particular, since the acorns used in the present invention have been edible since ancient times and ethanol, which is an extraction solvent, is also an edible solvent, the acorn ethanol extract may be used as a functional food material without safety evaluation, and may also be used as a functional material in various fields. .

As a result, the present invention on the anti-inflammatory effect on acorns will further expand the use of acorns as medicine and dietary supplements. Anti-inflammatory drugs currently used as pharmaceuticals have various side effects, but acorn ethanol extract, which is a natural plant material, can be used as an anti-inflammatory functional material to minimize these side effects, so rhinitis, bronchitis, hepatitis, asthma, ulcers requiring anti-inflammatory drugs It can be used as a functional material for the prevention and treatment of colitis and rheumatoid arthritis.

1 is a graph measuring the cell viability according to the concentration of acorn ethanol extract in cells treated with lipopolysaccharide (LPS) according to an embodiment of the present invention, the acorn ethanol extract is cytotoxic up to approximately 250 ㎍ / ㎖ However, at concentrations above this, it can be seen that cytotoxicity appeared.
2 is a view showing the effect of acorn ethanol extract on COX-2 mRNA expression induced in LPS-treated macrophages according to an embodiment of the present invention, (a) is a gel photograph after electrophoresis, (b) is a graph showing the band thickness and concentration of the gel photograph shown in (a).
3 is a view showing the effect of acorn ethanol extract on iNOS mRNA expression induced in LPS-treated macrophages according to an embodiment of the present invention, (a) is a gel photograph after electrophoresis, (b ) Is a graph showing the band thickness and concentration of the gel photograph shown in (a).
Figure 4 is a graph showing the effect of measuring the effect of acorn ethanol extract on nitrite production induced by LPS in macrophages according to an embodiment of the present invention.

The present invention relates to the anti-inflammatory effect of the acorn ethanol extract, the object of the present invention is to identify the anti-inflammatory effect of acorn ethanol extract that is not yet known for the use of acorn medicinal and industrial fields.

1. Anti-inflammatory Effects of Acorn Ethanol Extracts

However, there is no invention on whether the acorn extract has an anti-inflammatory effect and which mechanism has an anti-inflammatory effect. Therefore, the present invention has developed a new bioactive function of acorns. As a natural vegetable physiologically active material that can be applied to health functional foods, medicines, and cosmetics that exhibit anti-inflammatory effects, it has been identified that acorn ethanol extract is a suitable material. Inflammatory reactions also cause rhinitis, bronchitis, hepatitis, arthritis, asthma and atopic dermatitis. Therefore, the invention has been invented a pharmacological composition effective in the prevention and treatment of inflammatory diseases using acorn ethanol extract, the present invention will be described in detail.

An inflammatory response is a complex biological immune response in which organisms remove these stimuli against external harmful stimuli, such as pathogens or damaged cells, which damage the damaged tissues against external stimuli and ultimately respond to survival. Inflammation can be divided into acute and chronic inflammation. Acute inflammation is an initial response to harmful infectious agents, a series of immune responses that occur in tissues in which immune cells such as macrophage or leukocytes are damaged. Causes symptoms such as edema, fever, and pain, and chronic inflammation refers to the destruction and treatment of damaged tissue after the initial inflammatory response.

In particular, chronic inflammatory reactions include rheumatoid arthritis, autoimmune diseases such as cancer, atherosclerosis, asthma, rheumatoid arthritis, chronic prostatitis, and glomerulonephritis ( inflammatory response because it can cause diseases such as glomerulonephritis, vasculitis, interstitial cystitis, rhinitis, keratitis, bronchitis, hepatitis, pleurisy, peritonitis, cartilage, adhesion spondylitis, otitis media and atopic dermatitis The silver needs to be appropriately controlled by the host.

In particular, various cell-derived factors are involved in inflammatory responses in vivo, including interferon-gamma (IFN-γ), tumor necrosis factor-α (TNF-α), In addition to common immune factors such as cytokines or chemokines such as interleukin-1 (IL1) and interleukin-4 (IL4), in particular nitric oxide and prostaglandin ) Is also known to be involved in the inflammatory response.

Specifically, in relation to the inflammatory response in vivo, nitric oxide synthase (NOS) and arachidonic acid, which synthesize nitric oxide (NO) from L-arginine, are precursors of prostaglandins. As an enzyme for converting to phosphorus prostaglandin H2 (PGH2), it is important to suppress the expression of cyclooxygenase (COX), also called prostaglandin synthase.

There are several types of nitric oxide synthase (NOS), nNOS (neuronal NOS, NOS1) present in calcium-dependent activated neuronal cells and eNOS (endothelial NOS, NOS3) activated in calcium-dependent endothelial cells. It is expressed at a certain level in the body and is involved in maintaining homeostasis of the body, while iNOS (inducibile NOS, NOS2) is synthesized and induced independently of calcium by various cytokines such as lipopolysaccharide, TNF-α, and IL-1β. ). Among them, iNOS rapidly produces NO in cytotoxicity and various inflammatory reactions. Chronic inflammation is closely related to increased activity of iNOS.

In addition, there are two kinds of cyclooxygenase (COX). Cyclooxygenase-1 (COX-1) is continuously synthesized in cells and participates in the synthesis of prostaglandins necessary for cell protective action, Sigenase-2 (COX-2) is closely related to the inflammatory response, with a continuous increase in cells in the inflammatory response. However, inflammatory factors such as iNOS and COX-2, which increase the synthesis of NO and prostaglandins, are also the cause of chronic diseases such as various sclerosis, Alzheimer's and colon cancer.

In addition, it is known to rely on the activity of Nuclear factor kappa beta (F-kB) with respect to the activity of iNOS. NF-kB is a complex protein that controls the transcription of various proteins by participating in cellular responses to various stimuli such as various cytokines, free radicals, ultraviolet rays, LDLs, or antigens. Immune responses and autoimmune diseases, immune responses in viral infections may not occur. In the cytoplasm, NF-kB remains in an inactive state by binding to a substance called IK-Ba, but when an appropriate ligand binds to a receptor on the cell surface, it generates a signal, which activates when IK-Ba phosphatase is activated and IK-Bark is removed. Move to the nucleus to promote expression of genes that cause inflammatory responses, such as the iNOS gene.

Based on these points, the present invention showed that the expression and production of COX-2, iNOS and nitric oxide, which are closely related to the inflammatory response in macrophages activated by endotoxin stimulation, were inhibited by acorn ethanol extract. On the basis of these results, an acorn extract having anti-inflammatory activity and a pharmacological composition containing the extract were invented. That is, the present invention is acorn ethanol extract is involved in the expression and production of COX-2, iNOS and nitric oxide that is closely related to the inflammatory response, so it can be used as a natural plant material for the prevention and treatment of inflammatory diseases, containing acorn extract One pharmaceutical composition or food engineering composition.

Specifically, in the present invention, acorns (Acorn of Quercus acutissima ), acorns (Acorn of Quercus acutissima ) purchased from Sinpyeong Nongseong, Uiseong-gun, Gyeongsangbuk-do, inflammatory response to oxidative stress induced by treating endotoxin lipopolysaccharide (LPS) in macrophages To determine whether this activity is anti-inflammatory, the expression of the nuclear factor-kappa (NF-kB) -dependent gene cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) and the production of nitric oxide (NO) The anti-inflammatory effect was measured by the change. According to the present invention, the acorn ethanol extract is selected from rhinitis, keratitis, bronchitis, hepatitis, pleurisy, peritonitis, arthritis (rheumatic arthritis, psoriatic arthritis, acute gouty arthritis), asthma, chondritis, adhesion spondylitis, otitis media atopic dermatitis It may be contained as an active ingredient in a composition for preventing or treating an inflammatory disease, for example, in a food engineering composition such as a pharmaceutical composition or a dietary supplement.

Endotoxin stimulation contributes to the elimination of endotoxins by reacting with macrophages, but when macrophages are excessively stimulated, inflammatory reactions and oxidative stress are increased through the production of endotoxin mediators such as inflammatory cytokine, protease and reactive oxygen species. Let's go. Inflammation causes various biochemical phenomena, but especially nitric oxide synthase (NOS), an enzyme that produces nitric oxide (NO), and COX, an enzyme that mediates the biosynthesis of various prostaglandins (PGs) It is known as an important mediator of inflammatory responses.

As NO and PGs are closely related to inflammatory reactions, substances that can regulate the production and expression of enzymes involved in the production of these are attracting attention as preventive and therapeutic agents for inflammatory diseases. In particular, the substances separated and purified from foods are relatively toxic and are safe for long-term intake compared to pharmaceuticals, and thus are attracting attention as treatment agents and treatment aids for various inflammatory diseases. Therefore, the activity of acorn ethanol extract was confirmed as a substance to alleviate the inflammatory response by inhibiting the production of NO, PGE2, IL-6, a mediator of the inflammatory response produced by LPS treatment in macrophages.

According to the present invention, iNOS, COX-2 and NO production increased by LPS treatment on macrophages (Raw 264.7) were found to have an anti-inflammatory effect of acorn ethanol extract by acorn ethanol extract inhibits these production. That is, the present invention relates to an acorn extract having anti-inflammatory activity capable of preventing and treating an inflammatory disease and a pharmacological composition containing the extract.

Specifically, in order to obtain an acorn extract in which anti-inflammatory activity is confirmed according to the present invention, an appropriate solvent may be used after removing and crushing the acorn shell. At this time, the acorn used as a sample to obtain an extract having anti-inflammatory activity is about 2 to 20 times, preferably 5 to 15 times the volume of water, or 1 to 4 carbon atoms (C1 to C1, such as methanol, ethanol, butanol) Non-polar solvents such as lower alcohols of C4) can be used. According to an embodiment of the present invention, edible ethanol, which is an edible extracting solvent, may be used, and acorn ethanol extract was used as a sample to examine an anti-inflammatory effect. If ethanol is used, 50 to 90% of ethanol can be used.

Before examining the anti-inflammatory effect of the acorn extract obtained according to this method, the effect of this extract on the toxicity of immune cells, for example, macrophages was confirmed. According to an embodiment of the present invention, no cytotoxicity was found even when using acorn extract at a concentration of approximately 250 μg / ml (see FIG. 1). Therefore, the acorn ethanol extract of the present invention can be administered into cells at a concentration of 0.1 to 250 μg / ml, preferably 1 to 250 μg / ml, more preferably 10 to 250 μg / ml to achieve an anti-inflammatory effect. have.

On the other hand, macrophages activate NF-κB, a transcription factor of the inflammatory response by endotoxin stimulation, and as a result, iNOS and COX-2 are expressed to cause inflammation. In addition, iNOS is an enzyme that produces nitric oxide. As iNOS increases, nitric oxide increases. In other words, iNOS, an enzyme that produces nitric oxide, and COX-2, an enzyme that mediates the biosynthesis of various prostaglandins (PGs), are known as important mediators of inflammatory reactions. In the present invention, it was confirmed whether the inhibitory production of nitric oxide, iNOS and COX was increased in macrophages treated with endotoxin lipopolysaccharide (LPS).

To this end, the aforementioned acorn ethanol extract (0, 10, 50, 100 ㎍ / ㎖) was treated with LPS (1 ㎍ / ㎖) endotoxin at the same time and artificially cultured for 18 hours. Administration of acorn ethanol extract to macrophage confirmed inhibition of COX-2 expression (see FIG. 2), iNOS expression inhibition (see FIG. 3), and nitrite production inhibition (see FIG. 4) induced by LPS. It was.

In light of this, it can be estimated that the acorn ethanol extract according to the present invention will be a natural plant material capable of preventing and treating inflammatory diseases by inhibiting the expression of COX-2 and iNOS which are closely related to the inflammatory response. have.

2. Application of Acorn Extract

As described above, the present invention measures the expression of inflammation-related genes and the amount of nitric oxide produced by these expressions that acorn ethanol extract inhibits excessive stimulation of macrophages activated by endotoxin stimulation to cause an inflammatory response. By recognizing.

Macrophages activate NF-κB, a transcription factor of the inflammatory response by endotoxin stimulation, resulting in iNOS, COX-2 expression. In addition, iNOS is an enzyme that produces nitric oxide. As iNOS increases, nitric oxide increases.

Thus, acorn ethanol extracts that reduce the production of iNOS, COX-2 and nitric oxide can be used for rhinitis, keratitis, bronchitis, hepatitis, pleurisy, peritonitis, arthritis (rheumatic arthritis, psoriatic arthritis, acute gouty arthritis), asthma, chondrosis, Anti-inflammatory effect on inflammatory diseases selected from spondylitis spondylitis, otitis media and atopic dermatitis may help prevent and treat the disease. Taken together, the results can be used in pharmaceutical (pharmacological) compositions or food engineering compositions (health functional foods) containing acorn extracts having anti-inflammatory activity as an active ingredient that can prevent and treat inflammatory diseases.

For example, the pharmacological composition containing the acorn ethanol extract having anti-inflammatory activity as an active ingredient according to the present invention may further include appropriate carriers, excipients and diluents commonly used in the preparation of the pharmacological composition. At this time, the pharmaceutical composition for the prevention and treatment of inflammation-related diseases of the present invention may include 0.1 to 50% by weight of the acorn ethanol extract based on the total weight of the composition.

Specifically, the pharmaceutical composition comprising the acorn extract according to the present invention, powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral formulations, external preparations, suppositories, and sterile injection, respectively, according to a conventional method It can be formulated and used in the form of a solution. Carriers, excipients and diluents that may be included in the composition comprising the acorn extract include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium Silicates, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and the solid preparations include at least one excipient such as starch, calcium carbonate, sucrose in the extract. ) Or lactose, gelatin and the like are mixed. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

The pharmacological composition comprising the acorn extract of the present invention can be administered by various routes to mammals such as mice, mice, livestock, humans. All modes of administration may be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine or intracerebroventricular injections.

On the other hand, the acorn extract of the present invention can be utilized as a health functional food as a method of using as a food engineering composition containing as an active ingredient. Examples of the food to which the acorn extract according to the present invention can be added include various foods, beverages, gums, teas, vitamin complexes, and health functional foods. At this time, the amount of the acorn extract of the present invention in food or beverage may be added in 0.01 to 15% by weight of the total food weight, the health beverage composition is added in a ratio of 0.02 to 5g, preferably 0.3 to 1g based on 100ml Can be. Health functional food of the present invention includes the form of tablets, capsules, pills, liquids and the like.

For example, in addition to the acorn extract of the present invention, when used as a dietary supplement, various flavors or food supplements such as natural carbohydrates may be used. Natural carbohydrates that can be used include glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumartin, stevia extract, synthetic sweeteners such as saccharin, aspartame, and the like can be used. In addition to the acorn extract, it can be used in health functional foods, as well as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors such as flavoring agents, coloring and neutralizing agents (cheese, chocolate, etc.), pect Acids and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. In addition, the extract of the present invention may contain natural fruit juice and fruit flesh for the production of fruit juice beverages and vegetable beverages. These components can be used independently or in combination. The proportion of such additives is not so critical but is usually selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the extract of the present invention.

On the other hand, the component that can be included in the health functional beverage composition containing the acorn extract according to the present invention is not particularly limited and may contain various flavors or natural carbohydrates, and the like as an additional component, such as a conventional beverage. For example, examples of natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those mentioned above, natural flavoring agents (tauumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

As a result, the acorn extract of the present invention, which has been found to have iNOS, COX-2 and nitric oxide production, has an anti-inflammatory effect against inflammatory reactions such as rhinitis, bronchitis, hepatitis, arthritis, asthma and atopic dermatitis. Inflammatory effects can help prevent and treat disease. Putting all the results together, acorn extract having anti-inflammatory activity capable of preventing and treating inflammatory diseases and a pharmacological composition containing the extract are invented.

Hereinafter, the present invention will be described in detail based on the illustrative examples, but the present invention is not limited to the following examples.

Example 1: Acorn Ethanol Extract Preparation

Acorns ( Quercus acutissima CARR.) Used in this embodiment were stripped and shredded 400 kg of domestic Acorn of Quercus acutissima purchased from Sinpyeong Nongseong, Uiseong-gun, Gyeongsangbuk-do, to obtain 300 kg of stripped acorns, and 167 kg of freeze-dried acorns. 1,670 L of 80% ethanol, which is 10 times the sample, was pulverized and then refluxed and extracted twice at 78 ° C. Filtered with 2. The obtained supernatant was concentrated (Brix 30%) using a vacuum evaporator (EYELA: Rotary evaporator NE-SERIES, Tokyo, Japan) and freeze-dried (Ilshin Lab. Co., Ltd., Yangju, Korea). % Ethanol extract powder was used as a sample for the present invention.

Example 2 Measurement of the Effect of Acorn Ethanol Extract on Cytotoxicity

In this example, the concentration of acorn ethanol extract on the cytotoxicity was confirmed. To determine the concentrations related to cytotoxicity of acorn ethanol extract, MTT [3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyl tetrazolium bromide) reduction method was used. The cultured cells (Raw 264.7 cells) were mixed well in RPMI-1640 medium, adjusted to 1 × 10 ⁵ cells / ml, and 200 μl of the prepared cells were added to 96-well culture plates, followed by incubation for 24 hours. When the cells grow to some extent, the acorn ethanol extract sample (0, 50, 100, 250, 500, 1000 ㎍ / ml) obtained in Example 1 was added to the medium without fetal bovine serum and antibiotics for 24 hours. Let.

The survival rate of the cultured cells was measured using the MTT reduction method by Chung et al. That is, MTT solution (5 mg / ml) was added to 1/10 of the growth medium to each well, followed by further incubation at 37 ° C for 4 hours to reduce MTT, thereby carefully removing the medium so that the produced formazan did not go out along the medium. It was. In order to completely remove the remaining medium, the sample was allowed to stand at room temperature for 30 minutes and then dissolved using DMSO to measure absorbance at 570 nm. When the absorbance was measured, the test sample was DMSO, and cell viability was calculated as follows.

% Cell viability = [absorbance of sample treated / absorbed of control] x 100

Results of the effect of acorn ethanol extract on the survival rate of Raw 264.7 cells according to the present embodiment is shown in FIG. As shown, the acorn ethanol extract showed no cytotoxicity to the concentration of 250 ㎍ / ml for macrophages, but showed low cytotoxicity at 500 ㎍ / ml and about 50% at 1000 ㎍ / ml Could be confirmed to kill.

Example 3 Inhibition of Inflammation-related Gene Expression of Acorn Ethanol Extract

In this example, it was confirmed that the acorn ethanol extract inhibits the expression of inflammation-related genes. To this end, 1 μg / ml LPS was treated for 30 minutes in Raw 264.7 cells, and then the acorn ethanol extract ((0, 10, 50, 100) exhibited no concentration of cytotoxicity identified in Example 2. ㎍ / ㎖) to determine the production of COX-2, iNOS and nitric oxide by measuring the RT-PCR and absorbance.

(1) RT-PCR

end. Intracellular RNA Extraction

After removing the medium, 1 ml of TRIzol Reagent (Invitrogen, Carlsbad CA, USA) was added to each culture well and mixed several times with a pipette to obtain RNA extraction samples from the cultured cells. After standing at room temperature for 5 minutes, 0.2 ml of chloroform per 1 ml of TRIzol solution was added thereto, shaken well for 15 seconds, and further reacted at room temperature for 2-3 minutes. Centrifugation (12,000 xg) at 4 ° C. for 15 minutes separated the top layer of RNA, the middle layer of DNA, and the bottom layer of protein. Carefully separate the upper layer carefully so as not to contaminate the DNA, transfer to another tube, and 0.5 ml of isopropyl alcohol was added and reacted for 10 minutes to precipitate RNA. Thereafter, after centrifugation (12,000 xg) for 10 minutes at 4 ℃ discarded the supernatant, the precipitate was added 1 ml of 75% DEPC-ethanol and shaken several times, and again centrifuged (12,000 xg) for 5 minutes at 4 ℃. The supernatant separated by centrifugation was discarded again, and the precipitate was dried at room temperature for 5-10 minutes, and then the precipitate was dissolved in RNase-free distilled water or 0.1% DEPC distilled water. 5 μl of RNA was added to 995.0 μl of 0.1% DEPC distilled water and diluted 200 times, and the absorbance was measured at 260 nm and 280 nm. The concentration of RNA was calculated as the absorbance value x 40 μg / ml x (dilution factor) at 260 nm, and when the ratio between 260 nm and 280 nm was 1.6 or more, it was reported as pure RNA.

I. Oligonucleotide primers

Table 1 shows the base sequences of the primers used in PCR to express COX-2, iNOS and GAPDH genes used as comparative examples in this example. In Table 1 all primers are labeled 5 → 3.

Primer sequence order Sense (forward) Antisense (reverse) GAPDH CATTTTCTTCTCCTGCAGCC (SEQ ID NO: 1) TCTCCATGGTGGTGGTGAAGACA (SEQ ID NO: 2) COX-2 CCCCCACAGTCAAAGACACT (SEQ ID NO: 3) GAGTCCATGTTCCAGGAGGA (SEQ ID NO: 4) iNOS CTGCAGCACTTGGATCAGGAACCTG (SEQ ID NO: 5) GGGAGTAGCCTGTGTGCACCTGGAA (SEQ ID NO: 6)

All. cDNA synthesis

Power cDNA synthesis kits (Invitrogen) were used to produce first-stand cDNA in this example. That is, adjust the final volume to 9.5 μl with extracted RNA (2 μg) and RNase-free water in the RNase-free tube, add 1 μl of oligo (dT) ₁₅ primer (500 μg / ml), and then 5 minutes at 75 ° C. After boiling, the solution was collected under a tube and immediately cooled on ice. 1 μl RNase inhibitor (10 U / μl), 4.0 μl 5 × RT buffer, 2 μl dNTP Mix (10 mM: 2.5 mM each), and 0.5 μl AMV RT enzyme (Invitrogen) were added and mixed evenly by pipette. Then, it was made to react at 42 degreeC for 60 minutes and 70 degreeC for 15 minutes.

la. PCR reaction

PCR was performed to determine the expression of each gene. 2 x PCR Master mix Solution (i-StarTaq ^TM ) (iNtRON BIOTECHNOLOGY, Korea) 10 μl, Forward Primer (10 pmol / μl) and Reverse Primer (10 pmol / μl), respectively, 1 μl, distilled water 7 μl and synthesized above 1 μl of first-strand cDNA (DNA template) was added to the PCR tube and mixed well. Each mixture was pre-denatured at 94 ° C. for 2 minutes, followed by 20 seconds at 94 ° C., 30 seconds at annealing temperature (51 ° C .: GAPDH, 53 ° C .: COX-2, 59 ° C .: iNOS), and 40 seconds at 72 ° C. ( Cycles were different for each gene) Cycles were performed and finally extension reaction was performed at 72 ° C for 4 minutes. PCR products were subjected to electrophoresis at 80 V for 30 hours on 2% agarose gel containing 0.002% ethidium bromide, and the gene expression was determined by UV light. The intensity of the band was analyzed and quantified by SigmaGel (Jandel Scientific, San Rafael, Calif., USA) software, and β-actin was used as an internal standard.

(2) Inhibition of Inflammation-related Gene Expression of Acorn Extracts

As a result of measuring the expression of COX-2 and iNOS gene mRNA (Figs. 2 and 3), it was shown that the mRNA expression induced by LPS was inhibited by the acorn ethanol extract treatment. Specifically, the expression of COX-2 gene activated by the treatment of LPS in the mRNA expression of COX-2 gene was significantly reduced by the treatment of the acorn ethanol extract obtained according to the present invention (see Fig. 2), It can be seen that the expression of iNOS also shows a similar pattern (see FIG. 4).

From the above results, the present invention has been shown to inhibit the iNOS and COX increased by LPS production, so it is possible to invent a pharmacological composition containing the acorn extract having anti-inflammatory activity by using the acorn ethanol extract as a natural anti-inflammatory material It could be deduced that

Example 4 Determination of Effect of Acorn Ethanol Extract on Nitric Oxide Production

In order to measure nitric oxide production after LPS and sample treatment, 100 μl of Griess reagent (Sigma Chemical Co. St. Louis, MO, USA) was added to 100 μl of medium, and the absorbance was measured at 540 nm to determine the nitrite content. saw. After the calibration curve was prepared using NaNO ₂ , the amount of nitrite contained in the medium was measured.

As can be seen from the results of measuring the amount of nitrite contained in the medium of LPS and the cells treated with LPS (FIG. 4), the nitrite content was increased by LPS treatment, and the acorn ethanol extract treatment resulted in increased nitrite production by LPS. Appeared to inhibit.

From the above results, the present invention showed that the acorn ethanol extract inhibited the nitric oxide production increased by LPS, and this result was synthesized with the results of iNOS and COX-2, and the acorn ethanol extract was used as a natural anti-inflammatory material. It can be used in acorn extracts having anti-inflammatory activity and pharmacological compositions containing the extracts.

In the above, the present invention has been described based on the preferred embodiments of the present invention, but the present invention is not limited to these examples. Rather, one of ordinary skill in the art to which the present invention pertains will readily conceive various modifications and changes based on the embodiments of the present invention. However, it will be further apparent from the appended claims that such modifications and variations are all within the scope of the present invention.

<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Extracts from Acorn Having Potent Anti-Inflammatory Activity and          the Pharmacological Compositions Containing the Same <160> 6 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for Amplifying GAPDH <400> 1 cattttcttc tcctgcagcc 20 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for Amplifying GAPDH <400> 2 tctccatggt ggtggtgaag aca 23 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for Amplifying COX-2 <400> 3 cccccacagt caaagacact 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for Amplifying COX-2 <400> 4 gagtccatgt tccaggagga 20 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer for Amplifying iNOS <400> 5 ctgcagcact tggatcagga acctg 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer for Amplifying iNOS <400> 6 gggagtagcc tgtgtgcacc tggaa 25

Claims (5)

A composition containing water or an alcohol extract (acorn extract) of an acorn having anti-inflammatory activity as an active ingredient.
The method of claim 1,
The acorn extract is involved in anti-inflammatory activity by inhibiting the expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS). Characterized by a composition.
3. The method according to claim 1 or 2,
The acorn extract is a composition, characterized in that contained in the composition at a concentration of 0.1 ~ 250 ㎍ / ㎖.
3. The method according to claim 1 or 2,
The composition prevents or treats inflammatory diseases selected from rhinitis, keratitis, bronchitis, hepatitis, pleurisy, peritonitis, arthritis (rheumatic arthritis, psoriatic arthritis, acute gouty arthritis), asthma, chondrosis, adherent spondylitis, otitis media atopic dermatitis Composition for treatment.
3. The method according to claim 1 or 2,
A composition further comprising a pharmaceutically or food engineering acceptable carrier, excipient or diluent.

Images