KR20190057225A - A composition having anti-oxidation or anti-inflammation comprising Selaginella tamariscina extracts, fractions thereof or compounds isolated therefrom as an active ingredient - Google Patents

Abstract

The present invention relates to a cosmetic composition, a food composition, and a pharmaceutical composition for anti-oxidation or anti-inflammation comprising Selaginella tamariscina extracts, fractions thereof or compounds isolated therefrom as an active ingredient. According to the present invention, the composition for anti-oxidation or anti-inflammation comprising the Selaginella tamariscina extracts, fractions thereof or compounds isolated therefrom as an active ingredient has an excellent activity of concentration-dependently removing DPPH free radicals, that is, exhibits an excellent antioxidant effect, has an excellent activity of inhibiting generation of nitric oxide (NO) in cells, and has an excellent activity of inhibiting generation of inflammatory cytokines, thereby being effectively used for a cosmetic product, a food, or a medical product for preventing, alleviating, or treating diseases caused by oxidation and inflammation.

Description

{A composition having anti-oxidation or anti-inflammation comprising Selaginella tamariscina extracts, fractions thereof or compounds isolated therefrom as an active ingredient}

The present invention is Selaginella tamariscina ) to an antioxidant or anti-inflammatory cosmetic composition, food composition, and pharmaceutical composition comprising an extract, a fraction thereof, or a compound isolated therefrom as an active ingredient.

Oxygen is an essential element in various metabolic reactions to sustain life, and it is also necessary for detoxification of toxic substances in the human body, but oxygen is not only beneficial to the human body, so various pollutants such as enzyme systems, reduction metabolism, chemicals, photochemical reactions, etc. , When converted into free radicals with very high reactivity such as superoxide radical, hydroxy radical, hydrogen peroxide, and singlet oxygen due to environmental factors, etc. There are two-sided properties that cause fatal oxygen toxicity to the living body ( Korea J. Biotechnol . Bioeng . , 2001, 16(6), 592-602). Synthetic antioxidants such as BHT (butylated hydroxy toluene) and BHA (butylated hydroxy anisole), which are synthetic antioxidants to remove these active oxygen, have been widely used so far because of their excellent antioxidant effect and economical efficiency, but liver enlargement, toxicity of absorbed substances in the body, and carcinogenic potential, etc. Due to the raised issue, the permitted food or consumption is severely restricted. In addition, natural antioxidants such as tocopherol and ascorbic acid have high safety, but have low chain reaction inhibitory ability alone and high cost. For this reason, studies to separate and use safer, more economical, and more effective antioxidants from natural products have been actively conducted. Especially, secondary metabolites of plants as plant-derived substances inhibit the production of free radicals and active oxygen. Because it prevents oxidation by removing it, a lot of research has been conducted on this ( Korean Journal of Plant Res . , 2011, 24(1), 30-39; J. Korean Soc . Food Sci . Nutr . , 2010, 39(9), 1249-1256).

Inflammatory reactions are biological reactions caused by wounds, infections, or autoimmune mechanisms. When inflammation occurs, immune cells penetrate into the inflammatory site and these cells

Produces and secretes chemical substances and cytokines to induce biological defense and inflammatory reactions ( J. Korean Soc . Food Sci . Nutr . , 2010, 39(7), 980-985). LPS (lipopolysaccharide), well known as endotoxin, exists in the outer membrane of Gram-negative bacteria, and is proinflammatory such as TNF-α, IL-6, and IL-1β in macrophages or monocytes such as RAW 264.7. It is known to increase pro-inflammatory cytokines. Furthermore formation of these inflammatory mediators are lead to phospholipase A ₂ (phospholipase A ₂₎ process, and nitrogen monoxide (nitric oxide, NO) formation due to the activity of arachidonic acid (arachidonic acid) is changed into prostaglandin (prostaglandin) of . In the inflammatory process in the body, excessive amounts of NO and _{inflammatory factors such as PGE 2} (prostaglandin E ₂ ) are formed by iNOS (inducible NO synthase) and COX-2 (cyclooxygenase-2). General NO formation plays an important role in killing bacteria or removing tumors, but NO, which is excessively produced by iNOS in an inflammatory state, not only promotes inflammatory reactions such as vascular permeability and edema, but also promotes the biosynthesis of inflammatory mediators, thereby reducing inflammation. It is known to deepen ( Korean Soc . of Food Sci . Techn . , 2007, 39(4), 464-469).

On the other hand, the inflammatory reaction is a normal defense mechanism and is generally recovered quickly as pathogenic stimulants are lost, but local overreaction is caused by excessive inflammatory reactions, or a chronic inflammatory reaction is progressed by excessive inflammatory cytokines and free radicals. do. In particular, reactive oxygen species (ROS) and reactive nitrogen species (RNS), which are excessively generated due to the continuous inflammatory reaction of macrophages, neutrophils, and various immune cells, can prevent tissue damage or permanent genetic modification. It also causes. In addition, when inflammation occurs, the activity of antioxidant enzymes in cells decreases, and exposure to oxidative stress decreases the function of cells in the long term.

In addition, there are numerous causes of inflammation, but biological causes such as bacteria, fungi, and viruses are one of them. Recent research in the field of inflammation has focused on finding natural anti-inflammatory substances that inhibit the production and secretion of inflammatory mediators, because existing anti-inflammatory drugs such as synthetic drugs of cortisol have many side effects ( Korean J. Medicinal Crop). Sci . , 2010, 18(2), 105-112).

Accordingly, in order to alleviate excessive inflammatory reactions and chronic inflammation, it is an important proposition to reduce oxidative stress through direct removal of ROS, including inhibition of the expression of inflammatory cytokines, and many biomaterials have been proposed for this.

Under this background, the present inventors have made diligent efforts to find natural products with less side effects while exhibiting antioxidant or anti-inflammatory effects, and have been prescribed for various bleeding symptoms such as hematopoiesis, stool bleeding, uterine bleeding, etc., and used to relieve pain caused by menstrual pain or bruises Selaginella ( Selaginella The ethyl acetate fraction obtained from the methanol extract of tamariscina) has excellent DPPH (1,1-diphenyl-2-picryl-hydrazyl) free radical scavenging effect, nitric oxide (NO) production inhibitory effect and inflammatory cytotoxicity. The present invention was completed by confirming that the effect of inhibiting kine production was excellent.

Korea J. Biotechnol. Bioeng., 2001, 16(6), 592-602 Korean Journal of Plant Res., 2011, 24(1), 30-39 J. Korean Soc. Food Sci. Nutr., 2010, 39(9), 1249-1256 J. Korean Soc. Food Sci. Nutr., 2010, 39(7), 980-985 Korean Soc. of Food Sci. Techn., 2007, 39(4), 464-469 Korean J. Medicinal Crop Sci., 2010, 18(2), 105-112

The object of the present invention is Selaginella tamariscina ) to provide an antioxidant or anti-inflammatory composition containing the ethyl acetate fraction of methanol extract as an active ingredient.

Another object of the present invention is to provide a cosmetic composition comprising the antioxidant or anti-inflammatory composition.

Another object of the present invention is to provide a food composition comprising the antioxidant or anti-inflammatory composition.

Another object of the present invention is to provide a pharmaceutical composition comprising the antioxidant or anti-inflammatory composition.

In order to achieve the above object, the present invention is a Buddha ( Selaginella tamariscina ) Provides an antioxidant or anti-inflammatory composition containing the ethyl acetate fraction of methanol extract as an active ingredient, a cosmetic composition, a food composition and a pharmaceutical composition containing the antioxidant or anti-inflammatory composition.

Hereinafter, the present invention will be described in detail.

In one aspect, the present invention is a Buddha ( Selaginella tamariscina ) Provides an antioxidant or anti-inflammatory composition containing the ethyl acetate fraction of methanol extract as an active ingredient.

In the present invention, the term "Buddhist Son (Selaginella tamariscina)" is a fern that grows on a sunny rock in the mountainous region, and is sometimes called Gwonbaek. As a medicinal plant belonging to the Selaginellaceae family, it has a unique appearance that resembles the hand of a Buddha.Selaginella tamariscina (P.Beauv.) It is Spring.

Specifically, the leaves are densely grown in 4 rows, ovate, 1.5 to 2 mm long, and have a thread-like protrusion at the end, and there are fine ridges at the edge. Spore leaves are ovate triangular, lateral margins are fine and thin, and sporangia have large and small ones. The sporangia hangs one at the end of the twig, has a square shape, is 5-15 mm long and 2 mm in diameter. The stem reaches a height of 20cm, and the branches are divided into planes and spread, the surface is dark green, and the back side is whiteish green. When wet, the branches spread all over the place, and when dry, they are dried inward to form a ball. Roots grow by spreading branches in all directions at the end formed like a stem due to many damgeun bodies and roots being entangled. The rhizome derived from the bottom is hard and short, and has the characteristic of having many beard roots on the bottom.

It is almost evangelized in Korea, distributed in Japan, Taiwan, China, and Manchuria. It is an evergreen perennial plant growing on the surface of dry and cool rocks or cliffs, and has been used in oriental medicine to treat bloody stools, hematuria, and anal hernias. As blood sugar drops are known, interest in the effective ingredients of Kwonbaek is increasing.

Selaginella tamariscina ) The ethyl acetate fraction of the methanol extract is preferably prepared by a method comprising the following steps, but is not limited thereto:

1) Selaginella extracting by adding methanol to tamariscina);

2) filtering the extract of step 1);

3) preparing a methanol extract of Buchoson by concentrating the filtered extract of step 2) under reduced pressure and drying it; And

4) The step of further extracting the methanol extract from step 3) with ethyl acetate to prepare an ethyl acetate fraction.

In the above method, Selaginella tamariscina ) can be used without limitation, such as grown or commercially available. In addition, although not limited thereto in step 1), the budoson may be extracted including all leaves, branches, or roots.

In the above method, as the extraction method using methanol in step 1), it is preferable to use shaking extraction, Soxhlet extraction, or reflux extraction, but is not limited thereto. It is preferable to extract by adding 1 to 10 times the amount of methanol to the crushed butcherson. The extraction temperature is preferably from 20°C to 100°C, more preferably from 20°C to 60°C, and most preferably from 50°C, but is not limited thereto. In addition, the extraction time is preferably 4 to 24 hours, more preferably 5 to 12 hours, and most preferably 6 hours, but is not limited thereto. In addition, the number of extractions is preferably 1 to 5 times, more preferably 2 to 4 times of repeated extraction, and most preferably 3 times, but is not limited thereto.

In the above method, the vacuum concentration in step 3) is preferably a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto. In addition, the drying is preferably vacuum drying, vacuum drying, boiling drying, spray drying, or freeze drying, but is not limited thereto.

In the above method, the butcherson ethylacetate fraction of step 4) is preferably fractionated by adding an equal amount of ethyl acetate (EtOAc) to the amount of the methanol extract of the butcherson, but is not limited thereto. The fraction may be obtained by repeating the fractionation process 1 to 5 times, preferably 3 times, from the methanol extract of Bucheo-son, and is preferably concentrated under reduced pressure after fractionation, but is not limited thereto.

Meanwhile, although not limited thereto, the ethyl acetate (EtOAc) fraction includes linoleic acid, α-linolenic acid, palmitic acid, stigmastan-3,5-diene. -3,5-dien) and guaiacol compounds may be included.

In addition, although not limited thereto, the compound contains 20 to 25 parts by weight of linoleic acid and 5 to 10 parts by weight of α-linolenic acid, based on 100 parts by weight of the ethyl acetate fraction. 5 to 10 parts by weight of palmitic acid, 1 to 5 parts by weight of stigmastan-3,5-dien, and 0.5 to 4 parts by weight of guaiacol It may be included.

The term "antioxidation" of the present invention refers to an action of inhibiting oxidation, and the human body has a balance between an oxidation promoting substance (prooxidant) and an antioxidant substance (antioxidant). When it is achieved and tilted toward the promotion of oxidation, oxidative stress is induced, leading to potential cell damage and pathological diseases. Reactive oxygen species (ROS), which are the direct cause of oxidative stress, are unstable and highly reactive, so they easily react with various biomaterials and attack macromolecules in the body, causing irreversible damage to cells and tissues, or mutations. It leads to cytotoxicity and carcinogenesis. Reactive nitrogen species (RNS) such as NO, HNO ₂ and ONOO- are produced in large quantities due to the immune response of macrophage neutrophils and other immune cells during the inflammatory reaction, and ROS is also produced at this time. The active oxygen as described above oxidizes and destroys cells in the body, thereby being exposed to various diseases. Therefore, when the methanol extract of the present invention, in particular, the ethyl acetate fraction of the methanol extract of the buddha-son is included in cosmetics, foods, or pharmaceuticals, the antioxidant effect can be achieved, thereby contributing to the prevention of aging and health promotion.

In a specific embodiment of the present invention, in order to confirm the antioxidant effect of the ethyl acetate fraction of the methanol extract of Bucheron-son, DPPH free radical scavenging activity and the metal ion catalyst oxidation inhibition test were performed, as a result, the concentration of the ethyl acetate fraction of the methanolic extract of Bucheo-son It was confirmed that the DPPH free radical scavenging effect and the protein protective effect, that is, a strong antioxidant effect, were shown dependently (FIGS. 3 and 4). Therefore, the antioxidant effect of the present invention may be achieved by free radical scavenging activity.

The term "anti-inflammatory" of the present invention refers to an action of inhibiting inflammation, and the regulation of the inflammatory response is known to be very complex, which is known to enhance and reduce damage to the repair system in vivo. However, if the inflammatory response continues due to repeated tissue damage or regeneration, ROS and RNS are excessively produced in inflammation-related cells, resulting in permanent gene modification. As such, ROS and RNS are deeply related to the inflammatory response that regulates the actions of various cells in vivo. During the inflammatory process, large amounts of pro-inflammatory cytokines, nitric oxide (NO), and prostaglandin E ₂ (PGE ₂ ) are used in inducible nitric oxide synthase (iNOS). And cyclooxygenase (cyclooxygenase-2, COX-2). Inflammation is a cause of various inflammatory diseases, and the composition comprising the ethyl acetate fraction of the methanol extract of Buchoson of the present invention may have a preventive and ameliorating effect on various inflammatory diseases through anti-inflammatory action.

In the present invention, “anti-inflammatory” is meant to include improvement, treatment of inflammatory diseases and inhibition/delay on the onset of such diseases as defined below. The "inflammatory disease" may be defined as any condition specified as a local or systemic biological defense response against external physical and chemical stimuli or infection of external infectious agents such as bacteria, fungi, viruses, and various allergens. These reactions include activation of various inflammatory mediators and enzymes related to immune cells (eg iNOS, COX-2, etc.), secretion of inflammatory mediators (eg, NO, TNF-α, IL-6, IL-1β, PGE ₂₎ . ), body fluid infiltration, cell migration, tissue destruction, etc., and are accompanied by a series of complex physiological reactions, and appear externally by symptoms such as erythema, pain, swelling, fever, deterioration or loss of specific functions of the body. Since the inflammatory disease may be acute, chronic, ulcerative, allergic or necrotic, so long as any disease is included in the definition of such an inflammatory disease, whether it is acute, chronic, ulcerative, allergic, or Regardless of whether it is necrotic or not. Specifically, the inflammatory disease is, but not limited to, atopic dermatitis, psoriasis, rheumatoid arthritis, spondylitis, urethritis, cystitis, nephritis, vasculitis, arteriosclerosis, myocarditis, allergic disease, dermatitis, rhinitis, asthma, tonsillitis, acute pain. , Chronic pain, sepsis, periodontitis, gingivitis, inflammatory bowel disease, gastric ulcer and pancreatitis.

In a specific embodiment of the present invention, in order to confirm the anti-inflammatory effect of the ethyl acetate fraction of the methanol extract of Buchoson, using a mouse macrophage cell line RAW 264.7, nitric oxide (NO) Production inhibitory activity and the inducible nitric oxide synthase (iNOS), cyclooxygenase (COX-2), and the inflammatory cytokines IL-1β (interleukin-1β), IL-6 (interleukin-6) As a result of measuring the production inhibitory activity, the ethyl acetate fraction of the methanol extract of Buchoson was concentration-dependently inhibiting NO production without cytotoxicity, and the production of inflammatory mediators iNOS, COX-2, and inflammatory cytokines IL-1β and IL-6. It was confirmed that the inhibitory activity was shown (FIGS. 5 to 8). Accordingly, the anti-inflammatory effect of the present invention may be achieved by inhibiting NO production, inflammatory mediators iNOS, COX-2, and inflammatory cytokine production inhibitory activities.

As another aspect, the present invention is a Buddha ( Selaginella tamariscina ) Provides a cosmetic composition comprising an antioxidant or anti-inflammatory composition containing the ethyl acetate fraction of methanol extract as an active ingredient.

The ethyl acetate fraction of the methanol extract of the Buddha-son is as described above, and the ethyl acetate fraction of the methanol extract of the Buddha-son of the present invention has an antioxidant effect and an anti-inflammatory effect, so that it can be added to a cosmetic composition for the purpose of antioxidant or anti-inflammatory. have.

The cosmetic composition is effective in preventing or improving any one skin disease selected from the group including acne, atopy, athlete's foot, psoriasis, eczema, and dermatitis, and preventing or improving skin aging, wrinkles, or loss of elasticity.

In a specific embodiment of the present invention, it was confirmed that the ethyl acetate fraction of the methanol extract of Bucheo-son showed excellent antioxidant and anti-inflammatory effects (FIGS. 3, 4, 7 and 8).

The present invention demonstrates that the ethyl acetate fraction of the methanol extract of Buchoson has an excellent anti-inflammatory effect in inhibiting the inflammation-related cytokines IL-6 and IL-1β in macrophages and at the same time inhibiting the production of NO secreted from macrophages after LPS stimulation. to provide. Antibiotics such as tetracycline have side effects and limitations in use, such as the appearance of resistant bacteria, whereas the ethyl acetate fraction of the methanol extract of Buchoson according to the present invention is safe and has no side effects, so it is suitable as a cosmetic composition.

The cosmetic composition of the present invention can be prepared in the form of a general emulsified formulation and a solubilized formulation. The emulsified formulation includes nutrient lotion, cream, essence, and the like, and the solubilized formulation includes softening lotion and the like. Suitable formulations are not limited thereto, for example, solutions, gels, solid or paste anhydrous products, emulsions obtained by dispersing the oil phase in an aqueous phase, suspensions, microemulsions, microcapsules, microgranules or ionic (liposomes), bionic types. It may be in the form of a vesicle dispersant, cream, skin, lotion, powder, ointment, spray or conceal stick. In addition, it may be in the form of a foam or an aerosol composition further containing a compressed propellant.

The cosmetic composition may additionally contain fatty substances, organic solvents, solubilizers, thickening and gelling agents, softening agents, antioxidants, suspending agents, stabilizers, blowing agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, fillers, metals Commonly used adjuvants such as sequestering agents, chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic actives, lipid vesicles or any other ingredients commonly used in cosmetic compositions. It may contain.

As yet another aspect, the present invention is a Buddha ( Selaginella tamariscina ) Provides a food composition comprising an antioxidant or anti-inflammatory composition containing the ethyl acetate fraction of methanol extract as an active ingredient.

Regarding the ethyl acetate fraction of the methanol extract of Bucheron-son is as described above, and when the composition of the present invention is used as a food additive, the ethyl acetate fraction of the methanolic extract of Bucheol-son may be added as it is or used with other foods or food ingredients. , It can be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment), and may further include food additives acceptable for food. Since the composition of the present invention uses an extract derived from a natural product and a fraction thereof as an active ingredient, there is no problem in terms of stability, so there is no large limitation on the mixing amount.

The food composition of the present invention may include all foods in a conventional sense, and may be mixed with terms known in the art, such as functional foods and health functional foods.

The term "functional food" of the present invention refers to a food manufactured and processed using raw materials or ingredients having functions useful for the human body according to the Health Functional Food Act No. 6727, and the term "functional" refers to the structure of the human body. And it means ingestion for the purpose of obtaining useful effects for health use such as controlling nutrients for function or physiological action.

In addition, the term "health functional food" of the present invention refers to a food manufactured and processed by extracting, concentrating, refining, mixing, or extracting, concentrating, refining, and mixing specific ingredients contained in food ingredients as raw materials for the purpose of health supplementation It refers to foods designed and processed to sufficiently exert biological control functions such as biological defense, biological rhythm control, disease prevention and recovery, etc. by the above ingredients, and the health food composition is used to prevent diseases and prevent diseases. Can perform functions related to recovery, etc.

There is no limitation on the kind of food in which the composition of the present invention can be used. In addition, the composition comprising the ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention as an active ingredient may be prepared by mixing suitable other auxiliary ingredients and known additives that may be contained in food according to the choice of a person skilled in the art. Examples of foods that can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and There are vitamin complexes and the like, and can be prepared by adding the extract according to the present invention and a fraction thereof as a main component, such as juice, tea, jelly, and juice.

In addition, foods that can be applied to the present invention include, for example, special nutritional foods (e.g., formulas, infant foods, etc.), processed meat products, fish meat products, tofu, rice cakes, noodles (e.g., ramen, noodles, etc.), health supplement foods. , Seasoned foods (e.g. soy sauce, miso, red pepper paste, mixed sauce, etc.), sauces, sweets (e.g. snacks), dairy products (e.g. fermented milk, cheese, etc.), other processed foods, kimchi, pickles (various kimchi, pickles, etc.) ), beverages (eg, fruit, vegetable beverages, soy milk, fermented beverages, etc.), natural seasonings (eg, ramen soup, etc.).

When the health functional food composition of the present invention is used in the form of a beverage, it may contain various sweetening agents, flavoring agents, natural carbohydrates, and the like as an additional component, as in ordinary beverages. In addition to the above, the health functional food composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin. , Alcohol, carbonated beverages, etc. may contain. In addition, it may contain flesh for the manufacture of natural fruit juice, fruit juice beverage and vegetable beverage.

As yet another aspect, the present invention is a Buddha ( Selaginella tamariscina ) It provides a pharmaceutical composition comprising an antioxidant or anti-inflammatory composition containing the ethyl acetate fraction of methanol extract as an active ingredient.

Regarding the ethyl acetate fraction of the methanol extract of Bucheo-son, as described above, the ethyl acetate fraction of the methanol extract of Bu-cheol-son of the present invention has an antioxidant effect and anti-inflammatory effect of scavenging free radicals (active oxygen), so it is used as a pharmaceutical composition. Thus, it can be included in medicines for preventing, improving, and treating diseases and inflammatory diseases caused by free radicals.

The antioxidant is as described above, and accordingly, may be included in a pharmaceutical composition for the purpose of antioxidant, and may have an effect of preventing or treating diseases caused by free radicals. Diseases caused by the free radicals are not limited thereto, but degenerative neurological diseases including arteriosclerosis, Lou Gehrig's disease, Parkinson's disease, Alzheimer's, amyotrophic and Huntington's disease, myocardial infarction, angina, coronary artery disease, ischemic heart Cardiovascular diseases including diseases, ischemic brain diseases including stroke, digestive system diseases including diabetes, gastritis and gastric cancer, cancer, leukemia, aging, rheumatoid arthritis, hepatitis, atopic dermatitis, etc. Preferably, it may be aging caused by active oxygen.

In addition, the anti-inflammatory is as described above, and accordingly, it may be included in a pharmaceutical composition for preventing or treating anti-inflammatory, that is, an inflammatory disease. The inflammatory disease refers to a disease having inflammation as the main lesion, and is not limited thereto, but allergic diseases including allergic asthma, allergic rhinitis, allergic mucositis, urticaria and anaphylax, Myopathy including systemic sclerosis, dermatomyositis and inclusion body myositis, arthritis, atopic dermatitis, psoriasis, asthma, multiple sclerosis, ssRNA and dsRNA virus infections, sepsis, multiple chondritis, scleroderma , Eczema, gout, periodontal disease, Behcet's syndrome, edema, vasculitis, Kawasaki disease, diabetic retinitis, autoimmune pancreatitis, vasculitis, glomerulonephritis, acute and chronic bronchitis, and influenza infection.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" of the present invention means exhibiting properties that are not toxic to cells or humans exposed to the composition. The carrier may be used without limitation as long as it is known in the art such as a buffering agent, a preservative, a painless agent, a solubilizing agent, an isotonic agent, a stabilizer, a base agent, an excipient, and a lubricant.

In addition, the pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to conventional methods. have. Further, it may be used in the form of an ointment, lotion, spray, patch, cream, powder, suspension, gel or gel for external skin. Carriers, excipients and diluents that may be included in the composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oils. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient, such as starch, calcium carbonate, in the ethyl acetate fraction of the methanol extract of Buchoson. ), sucrose or lactose, gelatin, etc. are mixed and prepared. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include water and liquid paraffin, which are simple diluents commonly used for suspensions, liquid solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweetening agents, fragrances, and preservatives. have. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

On the other hand, the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. The term "administration" of the present invention means introducing a predetermined substance to an individual by an appropriate method, and the route of administration of the composition may be administered through any general route as long as it can reach the target tissue. Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, and rectal administration may be administered, but are not limited thereto.

The term "individual" refers to all animals including humans, such as rats, mice, and domestic animals. Preferably, it may be a mammal including a human.

The term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment and does not cause side effects, and the effective dose level is the sex, age, and weight of the patient. , Health condition, type of disease, severity, activity of the drug, sensitivity to the drug, method of administration, time of administration, route of administration, and rate of excretion, duration of treatment, factors including drugs used in combination or simultaneously, and other medical fields. It can be readily determined by a person skilled in the art according to known factors. Administration may be administered once a day at the recommended dosage, or may be divided several times.

Since the ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention is a natural medicinal plant as a raw material, even when used as a cosmetic composition, food composition, or pharmaceutical composition, side effects may be less than that of general synthetic compounds, so it can be safely included and used usefully.

Selaginella of the present invention tamariscina ) extract, a fraction thereof, or a composition for antioxidant or anti-inflammatory containing as an active ingredient a compound isolated therefrom has excellent activity to scavenging DPPH free radicals in a concentration-dependent manner, that is, excellent antioxidant effect, and In addition to its excellent activity to inhibit the production of nitric oxide (NO) in the body, it has excellent properties that inhibit the production of inflammatory cytokines, so it prevents, improves, or treats diseases caused by oxidation and inflammatory effects. It can be usefully used for cosmetics, foods and medicines.

1 is a Buddha son (Selaginella) of the present invention tamariscina ) is a diagram schematically showing the manufacturing process of methanol extract (STME) and its ethyl acetate fraction (STEA).
Figure 2 is a diagram showing the results of GC / MS (gas chromatograph-mass spectrometer) analysis of the ethyl acetate fraction of the present invention.
Figure 3 is a graph showing the concentration-dependent DPPH free radical scavenging effect of the ethyl acetate fraction of the present invention. Here, Asc is ascorbic acid used as a positive control group, and Veh is a DMSO (dimethyl sulfoxide) treatment group, which is a solvent used for dissolving the ethyl acetate fraction from Buchoson.
FIG. 4 is an electrophoretic photograph showing the effect of metal ion catalyst oxidation (BSA decomposition), that is, the protein protection effect, according to the concentration of the ethyl acetate fraction of the present invention. Here, Asc is ascorbic acid used as a positive control group, and Veh is a DMSO (dimethyl sulfoxide) treatment group, which is a solvent used for dissolving the ethyl acetate fraction from Buchoson.
Figure 5 is a graph showing the results of the cell activity inhibition experiment according to the concentration of the ethyl acetate fraction of the present invention. Here, Ctrl (control) is an untreated group, and Veh is a DMSO (dimethyl sulfoxide) treated group.
Figure 6 is a graph showing the results of a cytotoxicity test (LDH assay) for mouse splenocytes according to the treatment according to the concentration of the ethyl acetate fraction of the present invention. Here, hydrogen peroxide (H ₂ O ₂ ), which induces strong cell inhibition, was used as a negative control group, Ctrl (control) was an untreated group, and Veh was a DMSO (dimethyl sulfoxide) treated group.
7 is a graph showing the effect of inhibiting the production of nitric oxide (NO) according to the treatment according to the concentration of the ethyl acetate fraction of the present invention.
8 is a graph showing the effect of inhibiting the expression of major inflammation-inducing cytokines according to the concentration of the ethyl acetate fraction of the present invention.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Example 1: Methanol extract of Buddhason and ethyl acetate thereof Fraction Produce

Shredded Buddha Hand (Selaginella tamariscina ) 100 g was immersed in 1 liter of methanol 3 times and extracted at 50° C. for 6 hours, filtered with filter paper (Whatmann International Ltd., Maidstone, UK) and the solvent was evaporated ( Rotary evaporator, N-1110, Eyela, Tokyo, Japan) extract was obtained. Methanol extract (STME; Selaginella tamariscina metanol extract) was confirmed in a yield of about 12.9%, and the fraction obtained by fractionating methanol extract and ethyl acetate at a ratio of 1:1 (STEA) showed a 9.77% ratio of methanol extract (FIG. 1) .

Example 2: Buddhason ethyl acetate Fraction Identification of major ingredients and content analysis

In order to analyze the main constituents and contents contained in the butcherson ethyl acetate fraction obtained in Example 1, a gas chromatograph-mass spectrometer (GC/MS) equipped with a CTC CombiPAL autosampler system (Palo Alto, CA, USA) ; Agilent Technologies 5975C) was used. At this time, the column used for sample analysis is an HP-5 column (Agilent Technologies, 250 µm × 0.25 µm × 30 m), and the analysis conditions are 10°C per minute after holding at 50°C for 5 minutes. It was increased by increments, and analyzed by holding at 310° C. for 5 minutes. Samples were dissolved in ethanol at 10 mg/ml and then splitless injection at 5 µl.

As a result of GC/MS analysis, the main components contained in the ethyl acetate fraction of Buchoson are linoleic acid (syn. 9,12-Octadecadienoic acid), 22.66%, and α-linolenic acid (syn. 9,12). ,15-Octadecatrienoic acid) 8.82%, palmitic acid (syn. Hexadecanoic acid) 8.63%, Stigmastan-3,5-dien 3.95%, Guiacol (guaiacol) was found to contain 1.99% (Table 1 and Figure 2).

No. RT
(retention time, min) Area% Library ID Qual.
(qualitative) One 24.72 13.15 9,12-Octadecadienoic acid (Z,Z)- 99 2 24.22 9.51 9,12-Octadecadienoic acid, methyl ester 99 3 24.28 8.82 9,12,15-Octadecatrienoic acid, methyl ester 98 4 24.08 6.41 Tricyclo[5.2.1.0(2,6)]decane, 4-methyl- 70 5 26.25 5.71 (1R,2R)-1-[(Z)-hex-1-enyl]-2-hydroxymethylcyclopropan 49 6 23.09 4.68 Hexadecanoic acid 99 7 22.63 3.95 Hexadecanoic acid, methyl ester 99 8 31.99 3.95 Stigmastan-3,5-dien 78 9 12.96 1.99 Phenol, 2-methoxy-
(Guaiacol) 95

Example 3: Buddhason ethyl acetate Fraction Antioxidant effect analysis

DPPH radical scavenging efficacy test and metal ion catalyzed oxidation inhibition test were performed to analyze the antioxidant effect of the ethyl acetate fraction of Buchoson.

Example 3-1: DPPH Radical scavenging efficacy test ( DPPH radical scavenging assay ) Through Ethyl Acetate Fraction Antioxidant activity assay

In order to confirm the direct radical scavenging ability of the ethyl acetate fraction of Buchoson, a DDPH radical scavenging efficacy test was performed. 1,1-Diphenyl-2-picrylhydrazyl (DPPH, Sigma-Aldrich, MO, USA) is a chemically stabilized water-soluble free radical that exhibits characteristic light absorption at 517 nm. It is very stable, and when it encounters a substance with antioxidant activity, it gives electrons and radicals (DPPH) disappear, and the color changes from purple to yellow in the first solution, so that the oxidizing activity can be easily observed with the naked eye, so it is used in antioxidant activity experiments. It is a representative material that is becoming.

Specifically, after preparing a methanol (methanol) solution containing DPPH at a concentration of 0.3 mM and mixing the serial dilution of the ethyl acetate fraction from 100 µg to 1.56 µg in a double ratio, room temperature After reacting for 10 minutes at, the absorbance was measured at 517 nm to compare and analyze the radical scavenging ability. At this time, ascorbic acid (10 mM) having an excellent antioxidant effect was used as a positive control group.

As a result of conducting DPPH radical scavenging efficacy test, high radical scavenging activity was observed from 1.56 μg, the lowest test concentration of the Buchoson ethyl acetate fraction, and especially at the test concentration of 50 μg or more, compared with ascorbic acid used as a positive control. Thus, an effect equal to or higher than was shown (Fig. 3).

Therefore, through the above results, it was confirmed that the antioxidative activity of the ethyl acetate fraction from Buchoson was excellent, and based on this, it is predicted that the ethyl acetate fraction from Buchoson will have an excellent effect in removing reactive oxygen species (ROS) involved in the inflammatory reaction. Could.

Example 3-2: Metal ion catalyst oxidation inhibition test ( Protein protection test ) Through Ethyl Acetate Fraction Antioxidant activity assay

Since strong oxidation causes direct or indirect tissue damage, the efficacy of effectively removing them is important for anti-inflammatory action. The metal ion catalytic oxidation inhibition test is a method of confirming the effect of an antioxidant that protects proteins or enzymes from damage caused by reactive oxygen species (ROS) using a metal ion catalytic reaction.

Specifically, 0.5 µg/ml of bovine serum albumin (BSA) was used as a target protein, and as a first reaction, Cu ^{2 +} (100 µM) and H ₂ O ₂ (1 mM) were added to obtain hydroxyl. After generating a radical (hydroxyl radical), a secondary reaction was carried out after mixing BSA and a fraction of Buchoson ethyl acetate diluted with each concentration (0.625 ㎍, 1.25 ㎍, 2.5 ㎍, 5 ㎍, 10 ㎍). Each concentration-specific experimental group after the reaction was subjected to electrophoresis on 10% SDS polyacrylamide gel (sodium dedoxyl sulfate polyacrylamide gel) to confirm the level of inhibition of BSA protein degradation by the ethyl acetate fraction at each concentration. At this time, ascorbic acid (10 μM) was used as a positive control.

As a result of the metal ion catalyst oxidation inhibition test, a significant protein protection effect was confirmed even in the reaction of a mixture of 2.5 ㎍ of Buchoson ethyl acetate fraction and BSA, and a mixture of Buchoson ethyl acetate fraction and BSA at a test concentration of 5 ㎍ or more. In the reaction, it was found to have an effect equal to or higher than that of ascorbic acid used as a positive control. Accordingly, it was confirmed that the ethyl acetate fraction of Bucheo-son had a strong antioxidant effect (FIG. 4).

Therefore, through the above results, it was found that the antioxidative activity of the budoson ethyl acetate fraction was excellent, and in addition, it could be predicted that the budoson ethylacetate fraction could have a high protective effect against tissue damage.

Example 4: Buddhason ethyl acetate In the fraction Cell activity ( cell viability ) Inhibition and cytotoxicity ( cytotoxicity ) evaluation

In the case of extracts derived from natural products, it is often difficult to develop materials due to their strong efficacy and accompanying toxicity. Accordingly, cell viability (CCK) and cytotoxicity (LDH) were checked to evaluate the effect of the ethyl acetate fraction on the cells.

Example 4-1: Buddhason ethyl acetate Fraction Analysis of cell activity according to treatment (cell viability assay )

In the case of extracts derived from natural products, it is often difficult to develop a material due to its strong efficacy and accompanying toxicity, so a cell activity test was conducted on the ethyl acetate fraction from Buchoson. At this time, the cells were used as a mouse macrophage cell line Raw 264.7 (mouse macrophage cell line RAW 264.7). The Raw 264.7 cells were adjusted _{to 37° C., 5% CO 2} using DMEM complete medium (DMEM (Dulbecco's Modified Eagle's Medium) complete medium; Hyclone, Logan, UT, USA) containing 10% FBS (fetal bovine serum). Incubated in a CO ₂ incubator (incubator).

Cells produce necessary energy through the process of the mitochondrial electron transport system. In this process, succinate dehydrogenase (SDH) in the electron transport system decomposes the tetrazolium salt to decompose the insoluble formazan (formazan). ) Will be created. According to this principle, cell viability was measured by measuring the amount of formazan produced using Cell counting kit-8 (CCK-8; Dojindo, Kumamoto, Japan).

Specifically, in raw 264.7 cells, a mouse macrophage cell line, by concentration (1.56 µg/ml, 3.12 µg/ml, 6.25 µg/ml, 12.5 µg/ml, 25 µg/ml, 50 µg/ml, 100 µg/ml) After the treatment of the ethyl acetate fraction isolated from the methanol extract (STME) of the budo-son, the CCK solution was added at 1:10 within 24 hours to analyze the mitochondrial activity of the cells.

As a result, compared to the hydrogen peroxide (H ₂ O ₂ ) treatment group, which induces strong cell inhibition as a negative control, no change in cell activity was observed even when the ethyl acetate fraction was treated with the highest treatment concentration of 100 µg/ml. It was confirmed that there was no effect on cells even at high concentrations showing strong antioxidant efficacy (FIG. 5).

Example 4-2: Buddhason ethyl acetate Fraction Cytotoxicity evaluation according to treatment ((Lactate dehydrogenase ( LDH ) release assay )

In order to determine whether the cell viability was inhibited against the mouse macrophage cell line Raw 264.7 as immortalized macrophages, as well as to determine whether direct cytotoxicity to primary cells, the splenocytes were removed after the mouse spleen was removed. ) Was isolated to perform a cytotoxicity test. The cytotoxicity test measures the content of LDH released from damaged cells, and a non-radioactive LDH assay kit, CytoTox 96 ^® (Promega, Madison, WI, USA) was used.

Cytotoxicity test was 1.56 ㎍ / ㎖, 3.12 ㎍ / ㎖, 6.25 ㎍ / ㎖, 12.5 ㎍ / ㎖, 25 ㎍ / ㎖, 50 ㎍ / ㎖, 100 ㎍ / in the same manner as in the cell activity analysis of Example 4-1. It was measured by treating the splenocytes with the ethyl acetate fraction of Buchoson at a concentration of ml.

Specifically, after treating the splenocytes extracted from mice with the ethyl acetate fraction by concentration, LDH solution was added at a ratio of 1:1 within 24 hours to analyze the level of LDH discharged from the dead cells.

As a result, it was confirmed that even when the budoson ethyl acetate fraction was treated with the highest concentration of 100 μg/ml, it did not induce direct cytotoxicity, and thus the budoson ethyl acetate fraction was confirmed to have very low cytotoxicity (FIG. 6).

Example 5: Buddhason ethyl acetate Fraction Anti-inflammatory effect analysis

Linoleic acid (linoleic acid; syn. 9,12-Octadecadienoic acid, containing 22.66% in the Buchoson ethyl acetate fraction), α-linolenic acid (α-linolenic acid), identified as the main component contained in the Buchoson ethyl acetate fraction in Example 2 above. ; syn.9,12,15-Octadecatrienoic acid, 8.82% contained in the Butcherson ethyl acetate fraction), palmitic acid (syn. Hexadecanoic acid, contained 8.63% in the Butcherson ethyl acetate fraction), Stigmastan-3,5 -Diene (Stigmastan-3,5-dien, containing 3.95% in the Bucherson ethyl acetate fraction), and guaiacol (Containing 1.99% in the Bucherson ethyl acetate fraction), etc. Was known (Apama et al ., Chem Biol Drug Des . , 2012; Azuma et al ., J Dent Res . , 1986; Park et al ., Inflammation , 2016; Reifen et al ., J Nutr Biochem. , 2015).

Accordingly, a substance corresponding to 46.05% of the components contained in the Buchoson ethyl acetate fraction has an anti-inflammatory effect, and if the Buchoson ethyl acetate fraction through Examples 3 and 4 does not affect the cell viability, As a result, it was confirmed that it has excellent antioxidant activity, and based on this, it is judged that it can be developed as a highly effective anti-inflammatory material. Accordingly, the anti-inflammatory effect of the ethyl acetate fraction of Buchoson was confirmed.

Example 5-1: Buddhason ethyl acetate Fraction NO Measurement of production inhibitory activity

Nitric oxide (NO) is made from L-arginine by NOS (nitric oxide synthase), and as an endothelium derived relaxing factor (EDRF), a vascular relaxation factor, it induces erection and antithrombosis in addition to vascular homeostasis. , Antibacterial, memory enhancement, etc. It represents various physiological abuses. However, during the inflammatory reaction process, NO released in large quantities from iNOS (inducible NOS) causes damage to cells and tissues.

In order to confirm the NO production inhibitory efficacy of the Buchoson ethyl acetate fraction, first, the mouse macrophage cell line RAW 264.7 was treated with a macrophage stimulating factor LPS (lipopolysaccharide) to induce NO production, an inflammatory substance. Then, 1 ㎍ / ㎖, 10 ㎍ / ㎖, 100 ㎍ / ㎖ concentration of the ethyl acetate fraction was treated for 24 hours. Thereafter, a grease reagent was added and reacted for 10 minutes, and then NO production was measured at a wavelength of 540 nm using a microplate-ELISA reader.

As a result, significant NO generation inhibitory effect was confirmed from the case of treating the Buchoson ethyl acetate fraction at a concentration of 10 μg/ml or more, and when the Buchoson ethyl acetate fraction was treated at a concentration of 100 μg/ml, the untreated group was used as a control group. It was found to show the level of NO production equivalent to that of the normal cell group.

Therefore, through the above results, it was found that the ethyl acetate fraction of Buchoson could effectively inhibit NO generation.

Example 5-2: Buddhason ethyl acetate Fraction Analysis of inhibitory effect on expression of inflammatory mediator

In order to check the level of expression of proinflammatory cytokine, iNOS (inducible nitric oxide synthase), and COX-2 (Prostaglandin-endoperoxide synthase 2) as inflammatory mediators, RT. Quantitative analysis was performed based on the PCR (Reverse-Transcription Polymerase Chain Reaction) method. RNA was quantified using the TRIzol method, and after quantification, cDNA was synthesized with 2 µl of 10 × Topscrip buffer, 0.8 µl of RTase, 2 µl of dNTP, 0.5 µl of RNase inhibitor, and 10 µl of distilled water (DW). Using cDNA and ReddyMixPCR master mix (Thermo scientific, USA), DNA was amplified with a primer of β-actin (52°C, 20 cycles), and 1.0% agarose gel After electrophoresis, the expression level was confirmed using EtBr (Ethidium bromide; Amresco, USA). In the PCR experiment, amplify using ReddyMixPCR master mix, electrophoresis with 1.0% agarose gel, and then use EtBr (Ethidium bromide) to check the gene expression level, and the amplified inflammation-related gene expression level is β- It was standardized by comparison based on the level of actin (β-actin) expression. The primers used in the experiment are shown in Table 2 below.

Primer sequence used in PCR (polymerase chain reaction) Gene Primer Sequence, 5'→3' Sequence number β-actin
(β-actin) Forward direction tacagcttcaccaccacagc One Reverse aaggaaggctggaaaagagc 2 IL-1β
Forward direction gtgtctttcccgtggacctt 3 Reverse atgggaacgtcacacaccag 4 IL-6 Forward direction tccatccagttgccttcttg 5 Reverse ccacgatttcccagagaaca 6 iNOS Forward direction tgcccctggaagtttctctt 7 Reverse actgccccagtttttgatcc 8 COX-2 Forward direction ttgctgtacaagcagtggca 9 Reverse gcagccatttccttctctcc 10

Specifically, stimulation by LPS was induced to induce an inflammatory response in RAW 264.7 cell line, and the expression patterns of inflammation-related mRNA genes were compared by treatment with an ethylacetate fraction before LPS treatment. Treatment concentrations were 1 µg/ml, 10 µg/ml, and 100 µg/ml. LPS was treated 1 hour after treatment with the Buchoson ethyl acetate fraction to induce an inflammatory response, and the gene expression level was quantified by incubation for 20 hours after LPS treatment. Analyzed.

Among the major inflammatory mediators, iNOS (inducible nitric oxide synthase) and COX-2 (Prostaglandin-endoperoxide synthase 2) promote the secretion of NO and PGE2 (Prostaglandin E2), which are known to accelerate the inflammatory response (Posadas et al. al. , Naunyn - Schmiedeberg's Arch . Pharmacol . , 2000), it was found that both iNOS and COX-2 were significantly inhibited by treatment of the buchoson ethyl acetate fraction. These results are the same as the concentration-dependent NO generation inhibition phenomenon found in the NO generation inhibition test, and it was found that the generation of NO is regulated through the genetic control of iNOS and COX-2 (Fig. 8A and B ). In addition, IL-1β, a pro-inflammatory cytokine, affects the activity of immune cells according to the inflammatory response, differentiation, and diffusion, and it was confirmed that the expression pattern was significantly lower in the group treated with the ethyl acetate fraction from Buchoson (Fig. 8). C). In addition, IL-6 is not only a major cytokine in the acute inflammatory response, but is also known to affect the induction of chronic immune response by causing stimulation of T-cells and B-cells. There is (Gabay, Arthritis Res Ther . , 2006), IL-6 was also confirmed to have a clear expression inhibition pattern by the treatment of the ethyl acetate fraction of the budo-son (Fig. 8D).

Therefore, from the above results, it was found that the Buchoson ethyl acetate fraction can effectively inhibit the expression of pro-inflammatory cytokines such as IL-1β and IL-6, as well as the expression levels of iNOS and COX-2, which are mediators related to inflammation. Could.

Therefore, through the above series of results, the Buchoson ethyl acetate fraction inhibits the expression of inflammation-inducing cytokines, including strong reactive oxygen species (ROS) scavenging ability and protein protection, thereby inhibiting NO production and at the same time to other immune cells. It was verified to regulate the signal transduction of, and it was found that it can be usefully used as a natural biological material effective for acute and chronic inflammation.

Manufacturing example 1: Ethyl acetate of the methanol extract of Bucheo-son Fraction For antioxidant or anti-inflammatory containing as an active ingredient Cosmetic Produce

Manufacturing example 1-1: Preparation of flexible lotion

A flexible lotion containing the ethyl acetate fraction of the methanol extract of Bucheo-son as an active ingredient was prepared as shown in Table 3 below.

Raw material content( Parts by weight ) Ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention 10.00 1,3-butylene glycol 1.00 Disodium EDTA 0.05 Allantoin 0.10 Dipotassium glycyrrhizate 0.05 Citric Acid 0.01 Sodium citrate 0.02 Glyceres-26 1.00 Arbutin 2.00 Hydrogenated Castor Oil 1.00 ethanol 30.00 Preservative a very small amount coloring agent a very small amount Flavoring agent a very small amount Purified water Balance

Manufacturing example 1-2: Preparation of nourishing cream

* A soft nutrient cream containing the ethyl acetate fraction of the methanol extract of Bucheo-son as an active ingredient was prepared as shown in Table 4 below.

Raw material content( Parts by weight ) Ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention 10.0 1,3-butylene glycol 7.0 glycerin 1.0 D-panthenol 0.1 Plant extract 3.2 Magnesium aluminum silicate 0.3 PEG-40 stearate 1.2 Stearic Acid 2.0 Polysorbate 60 1.5 Lipophilic glyceryl stearate 2.0 Sorbitansquioleate 1.5 Cetearyl alcohol 3.0 Mineral oil 4.0 Squalane 3.8 Carlylic/capric triglyceride 2.8 vegetable oil 1.8 Dimethicone 0.4 Dipotassium glycyrrhizate a very small amount Allantoil a very small amount Sodium hyaluronate a very small amount Tocopheryl acetate Appropriate amount Triethanolamine Appropriate amount Preservative Appropriate amount Flavoring agent Appropriate amount Purified water Balance

Manufacturing example 2: Ethyl acetate from the methanol extract of Bucheo-son Fraction Manufacture of antioxidant or anti-inflammatory food containing as an active ingredient

Manufacturing example 2-1: Preparation of flour food

0.5 to 5.0 parts by weight of the ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention was added to flour, and bread, cakes, cookies, crackers, and noodles were prepared using this mixture.

Manufacturing example 2-2: soup And juicy ( gravies ) Of the manufacture

0.1 to 5.0 parts by weight of the ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention was added to soups and juices to prepare health-promoting meat products, noodles soup, and broth.

Manufacturing example 2-3: ground Of ground beef Produce

Ground beef for health promotion was prepared by adding 10 parts by weight of the ethyl acetate fraction of the methanol extract of the present invention to ground beef.

Manufacturing example 2-4: Dairy products ( dairy products ) Of the manufacture

5 to 10 parts by weight of the ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention was added to milk, and various dairy products such as butter and ice cream were prepared using the milk.

Manufacturing example 2-5: Linear Produce

Brown rice, barley, glutinous rice, and adlay were gelatinized and dried by a known method, and then roasted, and then prepared into a powder having a particle size of 60 mesh with a grinder.

Black soybeans, black sesame seeds, and perilla seeds were also steamed and dried by a known method, and then roasted, and then prepared into powder having a particle size of 60 mesh by a grinder.

The ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention was concentrated under reduced pressure in a vacuum concentrator, and the dried product obtained by spraying and drying with a hot air dryer was pulverized with a grinder to a particle size of 60 mesh to obtain a dry powder.

The grains, seeds and ethyl acetate fractions of the methanol extract of the present invention were prepared by blending in the following ratio:

Cereals (30 parts by weight of brown rice, 15 parts by weight of barley, 20 parts by weight of barley), seeds (7 parts by weight of perilla, 8 parts by weight of black beans, 7 parts by weight of black sesame), ethyl acetate fraction (3 Parts by weight), Ganoderma lucidum (0.5 parts by weight), Rehmannia (0.5 parts by weight).

Manufacturing example 2-6: Manufacturing of health drinks

Homogeneously blended subsidiary materials such as liquid fructose (0.5%), oligosaccharide (2%), sugar (2%), salt (0.5%), and water (75%) and 5 g of the ethyl acetate fraction of the methanol extract of the present invention After the instant sterilization was carried out, it was prepared by packaging it in a small container such as a glass bottle or a plastic bottle.

Manufacturing example 2-7: Preparation of vegetable juice

Vegetable juice was prepared by adding 5 g of the ethyl acetate fraction of the methanol extract of the present invention to 1,000 ml of tomato or carrot juice.

Manufacturing example 2-8: Preparation of fruit juice

Fruit juice was prepared by adding 1 g of the ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention to 1,000 ml of apple or grape juice.

Manufacturing example 3: Ethyl acetate from the methanol extract of Bucheo-son Fraction Preparation of a pharmaceutical composition for antioxidant or anti-inflammatory containing as an active ingredient

Manufacturing example 3-1: Powdery Produce

1 g of lactose was mixed with 2 g of the ethyl acetate fraction of the methanol extract of Bucheo-son of the present invention, and then filled in an airtight bag to prepare a powder.

Manufacturing example 3-2: Preparation of tablets

Tablets were prepared by mixing 100 mg of ethyl acetate fraction, 100 mg of corn starch, 100 mg of lactose, and 2 mg of magnesium stearate from the methanol extract of the present invention.

Manufacturing example 3-3: Preparation of capsules

After mixing the ethyl acetate fraction 100 mg, corn starch 100 mg, lactose 100 mg, and magnesium stearate 2 mg of the methanol extract of the present invention, the capsules were prepared by filling in gelatin capsules according to a conventional capsule preparation method. .

Manufacturing example 3-4: Preparation of the ring

After mixing 1 g of ethyl acetate fraction, 1.5 g of lactose, 1 g of glycerin, and 0.5 g of xylitol of the methanol extract of Bucheo-son of the present invention, it was prepared so as to be 4 g per pill according to a conventional method.

Manufacturing example 3-5: Preparation of granules

After mixing 150 mg of ethyl acetate fraction, 50 mg of soybean extract, 200 mg of glucose, and 600 mg of starch of the methanol extract of the present invention, 100 mg of 30% ethanol was added and dried at 60°C to form granules. Filled in.

<110> GANGNEUNG WONJU NAT UNIVERSITY INDUSTRY ACADEMY COOPERATION GROUP <120> A composition having anti-oxidation or anti-inflammation comprising Selaginella tamariscina extracts, fractions thereof or compounds isolated therefrom as an active ingredient <130> P17U12C0222 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_F <400> 1 tacagcttca ccaccacagc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_R <400> 2 aaggaaggct ggaaaagagc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_F <400> 3 gtgtctttcc cgtggacctt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_R <400> 4 atgggaacgt cacacaccag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-6_F <400> 5 tccatccagt tgccttcttg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-6_R <400> 6 ccacgatttc ccagagaaca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> iNOS_F <400> 7 tgcccctgga agtttctctt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> iNOS_R <400> 8 actgccccag tttttgatcc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX-2_F <400> 9 ttgctgtaca agcagtggca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX-2_R <400> 10 gcagccattt ccttctctcc 20

Claims (5)

Selaginella tamariscina ) methanol extract as an active ingredient.
2. The method of claim 1, wherein the skin inflammation relief is selected from the group consisting of nitric oxide (NO) production inhibition, cyclooxygenase (COX-2), inducible nitric oxide synthase (iNOS) or proinflammatory cytokines cytokines). &lt; / RTI &gt;
The method according to claim 1, wherein the ethyl acetate fraction of the methanol extract of Buchoeson is selected from the group consisting of linoleic acid,? -Linolenic acid, palmitic acid, Stigmastan- 3,5-dien) and a guaiacol compound. &Lt; RTI ID = 0.0 &gt; 5. &lt; / RTI &gt;
[Claim 4] The method according to claim 3, wherein the compound is selected from the group consisting of 20 to 25 parts by weight of linoleic acid, 5 to 10 parts by weight of [alpha] -linolenic acid, 100 parts by weight of [ 5 to 10 parts by weight of palmitic acid, 1 to 5 parts by weight of stigmastan-3,5-dien, and 0.5 to 4 parts by weight of guaiacol, By weight, based on the total weight of the cosmetic composition.
Selaginella tamariscina ) methanol extract as an active ingredient.

Images