KR20110110058A - Method for inhibiting senescence of adult stem cells using inhibition of mirna expression - Google Patents

Abstract

The present invention relates to a method for inhibiting senescence of adult stem cells, and more particularly, an inhibitor specific for expression of any one selected from the group consisting of miRNA-23a, miRNA-26a and miRNA-30a expressed in adult stem cells. The present invention relates to a method of inhibiting senescence of adult stem cells by increasing expression of high mobility group A2 (HMGA2) and decreasing expression of p16 or p21.
In the method for inhibiting aging of adult stem cells according to the present invention, the passage of culturing during adult stem cell culture can solve the problem of rapid cell aging due to rapid aging of cells. As a result, adult stem cells that maintain differentiation and cell regeneration ability can be maintained for a long time, thereby securing more cells that can be used for cell therapy or research.

Description

Method of Inhibiting Senescence of Adult Stem Cells Using Inhibition of miRNA Expression}

The present invention relates to a method for inhibiting senescence of adult stem cells, and more particularly, miRNA-23a, miRNA-26a, and miRNA-30a expressing miRNA-23a expressed in adult stem cells. The present invention relates to a method of inhibiting senescence of adult stem cells by increasing expression of high mobility group A2 (HMGA2) of adult stem cells, and decreasing p16 or p21 expression by inhibiting expression thereof, and a method of proliferating adult stem cells.

Micro RNA (microRNA, miRNA) is a non-cording RNA of less than 22 sequences, and regulates gene expression by degrading target mRNA or inhibiting the translation of the target mRNA. Its regulation of gene expression is involved in cell differentiation and cell proliferation, especially when miRNAs are difficult to capture during embryonic development, which plays an important role at each stage of embryonic development. However, despite the continued discovery of important functions that regulate the differentiation of miRNAs, the exact mechanisms that regulate the expression of miRNAs are still unknown. Recently, the possibility of epigenetic expression of miRNA that functions as an anticancer in human cancer cells has been suggested, and various evidences for epigenetic regulation of miRNA cluster have been reported. In detail, the anti-cancer miRNAs encoding various DNA sites are abnormally hypermethylated in human breast cancer cell lines, resulting in no gene activation, and 5-Asa, a DNA methylatransferase (DNMT) in AGS gastric cancer cell lines. Treatment with -dC (5-Asa-deoxycytidine) suggests that the expression of specific miRNA clusters is restored by demethylation of DNA.

Mesenchymal stem cells are stem cells with multipotent properties derived from various adult cells such as bone marrow, umbilical cord blood, placenta (or placental tissue cells), fat (or adipose tissue cells), and the like. For example, various researches are being conducted for the development of mesenchymal stem cells derived from bone marrow as cell therapeutic agents by the differentiation that can be differentiated into adipose tissue, bone / cartilage tissue, and muscle tissue. On the other hand, mesenchymal stem cells, like other human supercultured cells, are known to rapidly reduce cell division due to senescence mechanism that is independent of telomere shortening in vitro. (Shibata, KR et al . Stem cells , 25; 2371-2382, 2007 ).

Although the mechanism of this aging is not yet clearly understood, the activity of Cdk protein, which is responsible for cell growth by the expression and accumulation of p16 (INK4a), a Cdk inhibitory protein, accumulates due to the accumulation of environmental stress caused by long-term in vitro culture. This suppression phenomenon is pointed out as the main cause. In mesenchymal stem cells, the expression of the oncogene called Bmi-1 inhibited the expression of p16 and inhibited the aging of cells (Zhang, X. et al. Biochemical) . and biophysical research communications 351; 853-859, 2006 ), and also, growth-inhibited mesenchymal stem cells of G1 phase inhibited growth arrest when FGF-2 was inhibited in culture to inhibit mRNA expression of p21 (Cip1), p53, and p16 (INK4a). Have been reported (Ito, T. et. al ., Biochemical and biophysical research communications , 359; 108-114 2007 ). In addition, Korean Patent Publication No. 10-2009-0108141 proposed a method of inhibiting the senescence of mesenchymal stem cells by transforming the gene encoding Wip1 protein into mesenchymal stem cells.

However, because Bmi-1 itself is an oncogene that can cause tumors (Haupt, Y. et. al ., Oncogene , 8; 3161-3164, 1993; Bruggeman, SW et al . Cancer cell 12; 328-341 2007 ), the application of mesenchymal stem cells treated with Bmi-1 and a termorase catalytic subunit (hTERT) as a cell therapy cannot exclude the possibility of tumor formation. In addition, the method of treating FGF-2 during the cultivation should be used continuously during the cultivation of relatively expensive FGF-2, which not only increases the cost, but also increases the temporary cell growth effect rather than suppressing aging due to FGF-2. Since is expected, there is a limit in suppressing aging.

Accordingly, the present inventors have made diligent efforts to solve the above problems, and when the adult stem cell culture inhibits the expression of miRNA-23a, miRNA-26a and miRNA-30a, it was confirmed that cell aging is inhibited and proliferated, The invention was completed.

An object of the present invention is to provide a method for inhibiting senescence of adult stem cells by inhibiting the expression of miRNA-23a, miRNA-26a or miRNA-30a.

It is another object of the present invention to provide a composition for inhibiting aging of adult stem cells comprising the expression inhibitor of the miRNA-23a, miRNA-26a or miRNA-30a.

Another object of the present invention to provide a kit for inhibiting the aging of adult stem cells comprising the composition for inhibiting aging.

Another object of the present invention is to provide a method for regulating senescence of adult stem cells by regulating the expression of high mobility group A2 (HMGA2).

It is another object of the present invention to provide a method for proliferating adult stem cells by suppressing the expression of miRNA-23a, miRNA-26a or miRNA-30a.

It is another object of the present invention to provide a composition for proliferating adult stem cells comprising an expression inhibitor of miRNA-23a, miRNA-26a or miRNA-30a.

Another object of the present invention is to provide a kit for adult stem cell proliferation comprising the composition for proliferation.

As one embodiment for achieving the above object, the present invention is characterized in that the adult stem cell culture characterized in that the suppression of the expression of any one or more miRNA selected from the group consisting of miRNA-23a, miRNA-26a and miRNA-30a It provides a method for inhibiting aging of stem cells.

The base sequences of miRNA-23a, miRNA-26a and miRNA-30a of the present invention are as shown in Table 1 below.

miRNA -23a, miRNA -Nucleotide sequences of -26a and miRNA-30a Gene SEQ ID NO: Sequence miRNA-23a SEQ ID NO: 1 5'- AUCACAUUGCCAGGGAUUUCC -3 ' miRNA-26a SEQ ID NO: 2 5'- UUCAAGUAAUCCAGGAUAGGCU -3 ' miRNA-30a SEQ ID NO: 3 5'- UGUAAACAUCCUCGACUGGAAG -3 '

miRNA-23a has been reported to regulate the expression of Hes1, known as a transcriptional repressor, in NT2 cells induced by retinoic-acid and differentiated into neurons. miRNA-26a is known to be effective in inhibiting liver cancer, and it has been confirmed that the expression of various cancer-related genes is increased when the expression of miRNA-26a is reduced. miRNA-30a was observed to decrease expression in thyroid malignant tumor cells than in normal thyroid cells. However, it is not known yet how miRNA-23a, miRNA-26a and miRNA-30a function specifically in cells. It was first identified by the present inventors that miRNA-23a, miRNA-26a and miRNA-30a could be used to inhibit aging and proliferation of adult stem cells. In one embodiment of the present invention, artificially aged adult stem cells were made using an HDAC inhibitor, and the expression changes of miRNAs in the aged cells were observed using microarray, and as a result, miRNA-23a, miRNA-26a and miRNA-30a. Increasing expression was observed in aged adult stem cells. This confirmed that miRNA-23a, miRNA-26a, and miRNA-30a regulate cell aging, and in another embodiment of the present invention, when miRNA-23a is typically selected to inhibit expression in adult stem cells It was confirmed that the expression of genes involved in cell proliferation is increased and senescence is suppressed. In view of this, if miRNA-26a and miRNA-30a, which have increased expression in senescent stem cells, are suppressed in senescent adult stem cells, the same aging inhibitory effect can be expected as when miRNA-23a is inhibited. . In addition, the present inventors confirmed that miRNA-23a, miRNA-26a, and miRNA-30a regulate HMGA2 in the senescence of cells (FIG. 8). Such a result shows that miRNA of the present invention has the same cell aging inhibitory effect. It is to suggest that there is.

In the present invention, the adult stem cells can be cultured by a conventional method using a stem cell culture medium.

The culture medium is a medium suitable for maintaining and storing the same cell type as adult stem cells, and may be a medium obtained by containing serum in EMEM (Eagle's minimal essential medium). Fetal bovine serum (FBS) may be used as the serum, and the content thereof may be about 10% by weight based on the total weight of the serum medium. If necessary, antibiotics, antifungal agents and mycoplasma inhibitors that cause contamination may be included. As antibiotics, antibiotics used in normal cell culture such as penicillin-streptomycin can be used, and antifungal agents include amphotericin B, mycoplasma inhibitors such as tyrosine, gentamicin, ciprofloxacin, azithromycin, etc. Can be used. In addition, if necessary, oxidative nutrients such as glutamine and energy metabolites such as sodium pyruvate can be further added. Preferably, supplemented with 1-2 mM glutamine, 0.5-1 mM sodium pyruvate, 0.1-10% FBS, 1% antibiotic (100 IU / ml), and 1-4.5 g / L glucose Can be EMEM. Cultivation can be carried out in a CO ₂ incubator of 5 to 10% at a humidity of 90 to 95% and 35 to 39 ℃, if necessary, carbon such as sodium bicarbonate such that the final concentration is 0.17 to 0.22% by weight Regulators can be added and growth can be promoted by treating trypsin-EDTA. The cumulative population doubling time can be maintained until 75-85% confluence of the cells in culture in the flask, and preferably subcultures can be performed by collecting the cells at 80% confluence.

In the present invention, the inhibition of the expression of the miRNA is characterized by using a specific inhibitor of miRNA-23a, miRNA-26a and miRNA-30a, siRNA, aptamers, antisense oligonucleotides and compounds Characterized in that selected from the group consisting. The compound may be any compound that inhibits the expression of miRNA among antioxidants, substances affecting cell growth, and cell signaling substances. However, the present invention is not limited thereto, and any substance that inhibits the expression of one or more miRNAs selected from the group consisting of miRNA-23a, miRNA-26a, and miRNA-30a may be used.

As used herein, the term "siRNA" refers to a small RNA fragment having a size of 21-25 nucleotides produced by cleaving double-stranded RNA by Dicer and specifically binding to mRNA having a complementary sequence to inhibit expression. . For the purpose of the present invention means to specifically bind to miRNA-23a, miRNA-26a or miRNA-30a to inhibit the expression of the miRNA. siRNA can be synthesized chemically or enzymatically. The method for producing siRNA is not particularly limited, and methods known in the art can be used. For example, methods of chemically synthesizing siRNAs directly, methods of synthesizing siRNAs using in vitro transcription, and methods of cleaving long double-stranded RNAs synthesized by in vitro transcription using enzymes. , shRNA expression plasmid or viral vector expression through intracellular delivery and PCR (polymerase chain reaction) induced siRNA expression cassette (cassette) through the expression method through intracellular delivery, but is not limited thereto.

In 1990, Dr. Larry Gold of the University of Colorado, Colorado, discovered that randomly synthesized RNA can bind to target molecules like enzymes, and the RNA structure with this function is called aptamer. This method of producing aptamers is different from the way that RNA is synthesized in a cell, and it is best to randomly synthesize more than 100 trillion RNA and mix them with a target molecule or virus such as a protein that causes cancer. Use "selex" technology to pick out. This process is repeated 10 times or more to pick out the RNA that binds the target molecule best. This RNA is the aptamer. Aptamers have a specific binding force (Kd) that is nanomolar or better and often has very high specificity that does not bind to similar molecules.

In the present invention, the term "antisense oligonucleotide" is a nucleotide sequence that binds to the miRNA complementarily to inhibit expression, but includes, but is not limited to, antisenseRNA, antagonist mRNA.

In the present invention, introduction of the miRNA inhibitor into cells may be performed using a micro-injection method, calcium phosphate co-precipitation method, electroporation method and liposome use method, but is not limited thereto.

In the present invention, by suppressing the expression of the miRNA, it is characterized in that the expression of HMGA2 increases.

High mobolity group AT-hook 2 (HMGA2) is a high mobolity group (HMG) protein family that structurally has a DNA binding domain. The protein also acts as a transcription factor. HMGA2 is strongly expressed in pluripotent embryonic stem cells and most cancer cells and is not observed in normal somatic cells. Based on these findings, HMGA2 is known to regulate stem cell pluripotency and regenerative capacity. In addition, the expression of p16 and p19 is known to be reduced in the process of maintaining pluripotency. The expression of HMGA2 is regulated by HDAC (histon deacetylase). In the present invention, it was confirmed that the expression of HMGA2 is reduced in adult stem cells induced by cellular senescence by treatment with HDAC inhibior. In addition, when the miRNA-23a inhibitor was treated to adult stem cells, it was confirmed that the expression of HMGA2 that regulates the maintenance of cell regeneration capacity is increased.

In the present invention, by suppressing the expression of the miRNA, it is characterized in that the expression of p16 and p21 is reduced.

p16 and p21 are known to be cancer inhibitors, and are known to play an important role in regulating cell cycle. Increased mutations in p16 lead to a variety of cancers, especially in melanoma. p16 and p21 increase the expression in the aged tissue, because the expression of p16 and p21 increases the cell proliferation ability is inhibited. Therefore, when the expression of p16 and p21 in the stem cells increases, the pluripotency that is characteristic of the stem cells decreases and the cells age. In the embodiment of the present invention, when the miRNA-23a inhibitor is treated to adult stem cells, it was confirmed that the expression of p16 and p21 is reduced and cell aging is inhibited.

In the present invention, the adult stem cells may be derived from adult stem cells selected from the group consisting of umbilical cord, cord blood, bone marrow, fat, muscle, nerves, skin, amniotic membrane and placenta, but is not limited thereto. .

As another aspect, the present invention provides a composition for inhibiting senescence of adult stem cells, comprising as an active ingredient an inhibitor of expression of any one or more miRNA selected from the group consisting of miRNA-23a, miRNA-26a and miRNA-30a. do.

The compositions of the present invention may include additional substances that inhibit aging of adult stem cells, and may also include agents that promote intracellular influx of the composition. Formulations that promote intracellular influx of miRNA-23a, miRNA-26a and miRNA-30a expression inhibitors include liposomes (US Pat. Nos. 4,897,355, 4,394,448, 4,235,871, 4,231,877, 4,224,179, 4,753,788). No. 4,673,567, 4,247,411, 4,814,270) or may be combined with one of the lipophilic carriers of many sterols, including cholesterol, cholate and deoxycholic acid. Poly-Llysine, spermine, polysilazane, polyethylenimine, polydihydroimidazolenium, polyallylamine, Cationic polymers such as chitosan may be used, and succinylated PLL, succinylated PEI, polyglutamic acid, and polyaspartic acid may be used. anionic polymers such as acid, polyacrylic acid, polymethacylic acid, dextran sulfate, heparin, hyaluronic acid, etc. may be used. have. When the expression inhibitors of miRNA-23a, miRNA-26a and miRNA-30a are administered in complex form, the residence time and expression duration of genes are significantly increased compared to naked nucleic acids.

The composition of the present invention may be administered with a pharmaceutically acceptable carrier, and when used orally, a binder, a suspending agent, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a perfume, and the like may be used. In the case of injections, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers and the like can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives and the like can be used. The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elesir, suspensions, syrups, wafers, etc., and in the case of injections, may be prepared in unit dosage ampoules or multiple dosage forms.

The composition of the present invention may be administered in a therapeutically or prophylactically effective amount. Dosage may vary depending on a variety of factors, including the type and severity of the patient, age, sex, weight, drug sensitivity, type of current treatment, method of administration, target cells, and can be readily determined by those skilled in the art. Can be. In addition, the composition of the present invention may be administered in combination with a conventional therapeutic agent and may be administered sequentially or simultaneously with the conventional therapeutic agent. It may also be single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.

As used herein, the term "administration" means introducing a predetermined substance into a patient by any suitable method and the route of administration of the composition for inhibiting adult stem cell aging is administered through any general route as long as it can reach the target tissue. Can be. Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, nasal administration, pulmonary administration, rectal administration, but is not limited thereto. In addition, the pharmaceutical composition may be administered by any device in which the active agent may migrate to the target cell.

As another aspect, the present invention provides a kit for inhibiting adult stem cell aging comprising a composition for inhibiting aging of the adult stem cells.

Such a kit may further include a medium necessary for cell culture, instructions for explaining a method of use, and the like, in addition to the anti-aging composition described above.

As another aspect, the present invention provides a method for regulating senescence of adult stem cells, characterized in that the expression of HMGA2 is regulated.

As shown in another embodiment of the present invention, HMGA2 was confirmed that the expression gradually decreases as aging of adult stem cells, and when the aging inhibitor is administered to senescent stem cells, the expression of HMGA2 increases and aging Was confirmed to be suppressed. Based on these results, it can be predicted that HMGA2 inhibits aging, thereby regulating the expression of HMGA2, thereby controlling the senescence of adult stem cells.

In the present invention, the expression control of the HMGA2 is characterized in that using the expression regulator of HMGA2.

In the present invention, the expression regulator of HMGA2 is characterized in that it is selected from the group consisting of siRNA, aptamer (aptamer), antisense oligonucleotides and compounds. However, the present invention is not limited thereto, and any substance that increases the expression of HMGA2 may be used.

The compound may be any compound that inhibits the expression of miRNA among antioxidants, substances affecting cell growth, and cell signaling substances.

As another aspect, the present invention is a method for propagating adult stem cells, characterized in that when the adult stem cell cultures inhibit the expression of any one or more miRNA selected from the group consisting of miRNA-23a, miRNA-26a and miRNA-30a To provide.

Aging of adult stem cells means that as the number of passages increases, the cells die and the number of cells decreases. In one embodiment of the present invention, when inhibiting the expression of miRNA-23a, miRNA-26a and miRNA-30a inhibited the aging of cells, it was confirmed that the expression of genes associated with cell proliferation is increased, typically miRNA- Adult stem cells with 23a inhibition were confirmed by MTT assay to increase cell proliferation compared to adult stem cells without miRNA-23a inhibition. This result supports the same result even when miRNA-26a and miRNA-30a are inhibited.

Inhibition of the expression of the miRNA-23a, miRNA-26a or miRNA-30a can be made using an expression inhibitor of miRNA selected from the group consisting of aptamers, antisense oligonucleotides and compounds, as described above.

Preferably, the adult stem cells are derived from adult stem cells selected from the group consisting of umbilical cord, cord blood, bone marrow, fat, muscle, nerves, skin, amniotic membrane and placenta.

As another aspect, the present invention provides a composition for propagating adult stem cells, comprising as an active ingredient an inhibitor of expression of any one or more miRNA selected from the group consisting of miRNA-23a, miRNA-26a and miRNA-30a.

The compositions of the present invention may include additional substances for the proliferation of adult stem cells, and may also include agents that promote intracellular influx of the composition. The description is as described above.

As another aspect, the present invention provides a kit for adult stem cell proliferation comprising the composition for adult stem cell proliferation.

Such a kit may further include a medium necessary for cell culture, instructions for explaining a method of use, and the like, in addition to the composition for proliferation described above.

In the method for inhibiting senescence of adult stem cells according to the present invention, the passage of culturing during adult stem cell culture can solve the problem of rapid cell aging due to rapid aging of cells. As a result, adult stem cells that maintain differentiation and cell regeneration ability can be maintained for a long time, thereby securing more cells that can be used for cell therapy or research. In addition, it is expected that the phenomena of aging can be identified by discovering the cause of the decrease in the number of stem cells in vivo during the aging process of humans and animals.

1 compares the characteristics of early passage and late passage of adult stem cells. FIG. 1A shows the results of optical microscopy, FIG. 1B shows the result of protein expression using Western blot, and FIG. 1C shows the result of mRNA expression using real-time PCR.
2 is a diagram showing that the HDAC inhibitor down-regulation of HMGA2 and induce aging. Figure 2a is a HDAC inhibitor VPA and after the NB treatment of human cord blood-derived mesenchymal stem cells, HDAC inhibitor concentration on the HMGA2, p16INK4A, p21 ^{CIP1 / WAF1} and p27 ^KIP1 a Real-time analysis of the expression level qPCR analysis a, Figure 2b the results over time, Figure 2c protein expression results confirmed by Western blot according to the time interval and HMGA2 p16 ^INK4A, Figure 2d shows the protein expression confirmed the results of the immunocytochemistry.
3 is a diagram showing that HDAC1 and HDAC2 regulate the expression of HMGA2, and HMGA2 inhibition induces cellular senescence. Figure 3a shows the results of RT-PCR decrease the expression level of HDAC1 and HDAC2 through the specific inhibition of HDAC1 and HDAC2 using siRNA, Figure 3b shows that the specific inhibition of HDAC1 and HDAC2 reduces the expression of HMGA2 3C shows the results of SA β-gal staining indicating that HDAC1, HDAC2 and HMGA2 specific down-regulation are sufficient as a cause of senescence of mesenchymal stem cells.
Figure 4 shows the increased miRNAs in aged adult stem cells using a microarray.
FIG. 5A shows a search for miRNA targeting HMGA2, and FIG. 5B shows a search for miRNA targeting HMGA2 among miRNAs expressed in aged adult stem cells.
Figure 6a shows the expression of miRNA-23a, miRNA-26a and miRNA-30a in aged adult stem cells due to VPA or NB, Figure 6b shows in adult stem cells aged due to siRNA of HDAC1 and siRNA of HDAC2 Expression of miRNA-23a, miRNA-26a and miRNA-30a is shown. Figure 6c is the RT-PCR results showing the expression level of the precursor of miRNA after HDAC inhibitor treatment, Figure 6d shows the RT-PCR results by ImageJ analysis. * And ** indicate statistical significance of p <0.05 and p <0.01, respectively.
Figure 7 shows the characteristics of adult stem cells suppressed miRNA-23a expression. Figure 7a is a result of confirming the expression of miRNA-23a using real-time PCR, Figure 7b is a result of confirming the expression of HMGA2 mRNA using real-time PCR, Figure 7c is an MTT assay result, Figure 7d is an optical microscope observation result 7E shows the results of confirming mRNA expression of p16 and p21 using real-time PCR.
FIG. 8 shows miR-23a, miR-26a and miR-30a miRNA inhibition or overexpression modulates HMGA2 expression and senescence. After transfection of anti-miRNA or mature miRNA, after inhibition or overexpression of miR-23a, miR-26a and miR-30a, the expression level of each miRNA (FIG. 8A) and the expression level of HMGA2 (FIG. 8B) are real. -time qPCR analysis. Figure 8c is also the level of expression of p16 ^INK4A 8d shows the results of analyzing the level of expression of p21 ^{CIP1 / WAF1} as real-time qPCR. Figure 8e is a diagram showing the aging of cells after the inhibition or overexpression of miR-23a, miR-26a and miR-30a as a result of SA β-gal staining.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

Hereinafter, the present invention will be described in more detail with reference to the following examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example  1: cord blood origin Intermediate lobe  Stem Cell Isolation and Culture

1-1: derived from umbilical cord blood Intermediate lobe  Stem Cell Isolation and Culture

Hetasep solution (Stem Cell Technologies, Vancouver, Canada) was mixed with cord blood at a volume ratio of 5: 1 to remove red blood cells of cord blood (Seoul National University Hospital), and then incubated at room temperature for 30 minutes. The supernatant was collected carefully and centrifuged for 20 min at 2500 rpm with the addition of Ficoll solution to collect single cells. Only isolated cells were washed two or three times with PBS, heparin, ascorbic acid, recombinant human epidermal growthth factor (rhEGF), hydrocortisone, vascular endothelial growth factor ( vascular endothelial growth factor (VEGF), recombinant human fibroblast growth factor (rhFGF-B), and recombinant long R insulin-like growth factor-1 (R3-IGF-1) ), Gentamycin sulfate, amphotericin B (GA-1000) and 10% FBS (Gibco) added to EMEM (Gibco) cultures at 2 x 10 ⁵ / cm It was. After 4 days of incubation, non-bottom cells were removed and passaged when the cells were 80% confluent. As a result, stem cells could be isolated and cultured from cord blood.

1-2: Early in cord blood-derived mesenchymal stem cells passage with late passage cells obtained

Early passage (5 passages) of cord blood-derived mesenchymal stem cells In order to obtain the cells were incubated for 3 days at a concentration of 5 × 10 ⁴ / well in 6-well plate, late passage (15 passage) Cells were incubated at a concentration of 1 × 10 ⁵ / well in 6-well plates to obtain cells.

Example  2: derived from aged cord blood Intermediate lobe  Identify the characteristics of stem cells

2-1: SA  β- gal ( Senescence associated beta  - galactosidase ) dyeing

In order to confirm the aging of cord blood-derived mesenchymal stem cells, SA β-gal staining was performed.

Specifically, the cord blood-derived mesenchymal stem cells of the early passage and the late passage cultured in Example 1-2 were washed twice with PBS and fixed by treating 0.5% glutaraldehyde at room temperature for 5 minutes. It was then washed with 1 mM MgCl ₂ and the X-gal solution was treated for overnight at 37 ° C. And washed twice with PBS and observed the image under a microscope (Olympus, IX70).

As a result, as shown in FIG. 1A, X-gal was not stained in early passage cells, but was strongly stained in late passage cells.

2-2: Confirmation of protein expression of aging-related genes

Cell aging is known to occur with decreased expression of HDAC, which decreases the expression of HMGA2 and increases the expression of p16. The aging of cord blood-derived mesenchymal stem cells of the present experiment was confirmed by Western blot whether the expression of such protein appears.

10 μg / ml of quantified whole cell protein of early and late passage umbilical cord blood-derived mesenchymal stem cells cultured in Example 1-2 were loaded on 7.5-15% SDS-PAGE and separated at 350 mA for 5 hours. It was. The separated protein was electrically transferred to nitrocellulose membrane. After blocking with 5% skim milk containing 0.05% Tween-20, HDAC1 (Upstate, USA), HDAC2 (Upstate, USA), HMGA2 (Millipore, USA), p16 ( Abcam, UK) antibody and Second antibody (Amersham Inc., UK). Then, the blot was expressed by ECL detection kit (Amersham Inc., U.K) and confirmed by exposure to hyperfilm (Amersham Inc., U.K).

As a result, as shown in Figure 1b, as the late passage in the early passage, the protein expression of HDAC1, HDAC2, HMGA2 is reduced, it was confirmed that the protein expression of p16 is increased.

2-3: aging-related genes mRNA  Confirmation of expression

Stem cells cultured in Example 1-2 were washed twice with PBS and total RNA was extracted using TRIzol (Invitrogen). Then, cDNA was synthesized using oligo-dt primer and Accupower RT premix (Bioneer, Korea). Synthesized cDNA with the primers of HDAC1, HDAC2, HMGA2, p16, p21, p27 shown in Table 2 (SEQ ID NOs: 1-12) Real-time PCR was performed using Prime 7000 sequence detection system 2.1 software (Applied biosystems) by adding SYBR Green (Applied biosystems).

As a result, as shown in Figure 1c, it was confirmed that the mRNA expression of HDAC1, HDAC2, HMGA2 is reduced, the mRNA expression of p16, p21, p27 is increased from the early passage to the late passage.

SEQ ID NOs: 4-15 Gene SEQ ID NO: Primer sequence HDAC1-sense SEQ ID NO: 4 5'- GAAGAGTTCTCCGATTCTGA -3 ' HDAC1-antisense SEQ ID NO: 5 5'- CTCTTCGGTGACTTCTTTCT -3 ' HDAC2-sense SEQ ID NO: 6 5'- GACAGTGGAGATGAAGATGGA -3 ' HDAC2-antisense SEQ ID NO: 7 5'- TTCTGATTTGGTGCCTTTGG -3 ' HMGA2-sense SEQ ID NO: 8 5'- AGTCCCTCTAAAGCAGCTCAAAAG -3 ' HMGA2-antisense SEQ ID NO: 9 5'- GCCATTTCCTAGGTCTGCCTC -3 ' p16 ^INK4A -sense SEQ ID NO: 10 5'- GAAGGTCCCTCAGACATCCC -3 ' p16 ^INK4A -antisense SEQ ID NO: 11 5'- CCCTGTAGGACCTTCGGTGA -3 ' p21 ^{Cip1 / Waf1} -sense SEQ ID NO: 12 5'- ATTAGCAGCGGAACAAGGAG -3 ' p21 ^{Cip1 / Waf1} -antisense SEQ ID NO: 13 5'- CTGTGAAAGACACAGAACAG -3 ' p27 ^Kip1 -sense SEQ ID NO: 14 5'- AGATGTCAAACGTGCGAGTG -3 ' p27 ^Kip1 -antisense SEQ ID NO: 15 5'- GCGTGTCCTCAGAGTTAGCC -3 '

Example  3: HDAC  Inhibitor HMGA2 down - regulation  And induce aging

In order to determine whether HDAC activity is required for the regulation of HMGA2 during aging of cord blood-derived mesenchymal stem cells, the present inventors used VPA (valproic acid) and NB (sodium butyrate, NaBu) which are inhibitors of HDAC.

After confirming that 4 mM VPA or 2 mM NB was sufficient to induce aging, the present inventors treated mesenchymal stem cells with 4 mM or 8 mM VPA and 2 mM or 4 mM NB for 7 days, followed by HMGA2 and other. The expression levels of related genes were examined. Similar to the method of Example 2-3, real-time qPCR was performed.

As a result, although the expression of HMGA2 is reduced, p16 ^INK4A and p21 ^{CIP1 / WAF1} was increased to VPA and NB concentration dependent. However, the expression of p27 ^KIP1 increased only in the 8 mM VPA treatment group, and the expression of p27 ^KIP1 did not increase significantly in the other treatment groups (FIG. 2A).

In addition, real-time qPCR and Western blot analysis confirmed the time variation of gene changes according to HDAC inhibitor treatment. MRNA and protein levels of HMGA2 increased significantly after 3 days of treatment (FIGS. 2B and 2C). p16 ^INK4A and p21 ^{CIP1 / WAF} increased expression 1 and 3 days after HDAC inhibitor treatment, respectively. In contrast, the expression of p27 ^KIP1 did not significantly increase during the whole treatment period (FIG. 2B).

Since the expression of HMGA2 decreased after 3 days of HDAC inhibitor treatment, the following immunocytochemistry was performed to analyze the expression pattern of HMGA2. HDAC inhibitors were treated with cord blood-derived mesenchymal stem cells for 3 days, 5 days and 7 days, fixed with 4% paraformaldehyde and permeated with 0.2% Triton X-100 (Sigma-Aldrich). Then, after reacting with 10% normal goat serum (Zymed Labortories Inc., San Fransico, Calif.), Staining with anti-HMGA2 (1: 200, Abcam, UK), and then Alexa 488-labeled secondary antibody for 1 hour. (1: 1,000; Molecular Probes, Eugene, OR). Nuclei were stained with Hoechst 33258 (1 μg / ml, 10 minutes) and images were captured by confocal microscopy (Eclipse TE200, Nikon, Japan). As a result, the nuclear position of HMGA2 was confirmed, and it was confirmed that the expression of HMGA2 decreased time-dependently (FIG. 2D).

Example  4: HDAC1  And HDAC2 of HMGA2  Expression regulation and HMGA2  Confirmation of Cell Aging by Inhibition

Since HDAC inhibitors have a wide range of biological activities as well as HDAC inhibition, small interfering RNA (siRNA) was used to specifically inhibit HDAC1 and HDAC2. First, similar to Example 2-3, using real-time qPCR, it was confirmed that the expression level of HDCA1 and HDCA2 after siHDAC1 and siHDAC2 treatment, respectively (Fig. 3a). In addition, both siHDAC1 and siHDAC2 reduced the expression level of HMGA2 (FIG. 3A).

In order to confirm that inhibition of HMGA2 leads to aging of human cord blood-derived mesenchymal stem cells, siRNAs that specifically target HMGA2 were used. After inhibiting HMGA2, real-time qPCR was performed similarly to Example 2-3 to confirm that the expression level of HMGA2 was reduced (FIG. 3B). In conclusion, as shown in the SA β-gal staining results, it was found that senescence of mesenchymal stem cells is caused by inhibition of HMGA2 as well as HDAC1 and HDAC2, and moreover, expression of p21 ^{CIP1 / WAF1} and p16 ^INK4AD . It was found that this significantly increased (FIGS. 3B and 3C).

Example  5: aging cord blood origin Intermediate lobe  Increased expression in stem cells miRNA  Confirm ; Micro array ( Microarray analysis )

Stem cells cultured in Example 1-2 were washed twice with PBS and total RNA was extracted using TRIzol (Invitrogen). 2 μg of the extracted total RNA was labeled and amplified by USL aRNA labeling kit (Kreatech diagnostics, Netherlands). Total RNA labeled Cy5 was hybridized with 10 μl hybridization solution. Agilent human microRNA arrays contain all human miRNA information from probes and Sanger miRBASE public databases. Agilent human whole genome arrays also contain all the genetic information of humans from probes and Genome Reference Consortium Human Build 34 (GRCh34). The Agilent miRNA probe was repeated 20 times in each array and analyzed for miRNA changes using GeneSpring GX software. The miRNA data base was Mirande, Target scan, Pictar.

As a result, as shown in FIG. 4, an increased miRNA was identified in senescent cells, a miRNA targeting HMGA2 in FIG. 5A, and a miRNA targeting HMGA2 in miRNAs related to aging in FIG. 5B. Picked out. Among them, miRNA-23a, miRNA-26a, and miRNA-30a which overlap in common were found.

Example  6: in aged cells miRNA -23a, miRNA -26a and miRNA -30a expression confirmed

6-1: HDAC inhibitor In aged cells due to miRNA -23a, miRNA Expression of -26a and miRNA-30a

In order to confirm whether expression of miRNA-23a, miRNA-26a and miRNA-30a selected in Example 5 is increased in aged cells, artificially aged the cells by treating HDAC inhibitors with cord blood-derived mesenchymal stem cells , miRNA-23a, miRNA-26a and miRNA-30a expression was confirmed using real-time PCR. Inhibitors of VAC (valporic acid) and NaBu (sodium butyrate) were used.

Umbilical cord blood-derived mesenchymal stem cells were treated with 4 mM VPA or 2 mM NaBu for 3 days, and cells were obtained to age the expression of miRNA-23a, miRNA-26a and miRNA-30a in the same manner as in Example 2-3. Expression was compared with other miRNAs related to (miRNA-7a1, miRNA-7d, miRNA-7f1). Real-time PCR was used as primers shown in Table 3 (SEQ ID NO: 13-24).

As a result, as shown in Figure 6a, when the addition of VPA and NaBu, it was confirmed that miRNA-7a1, miRNA-7d, miRNA-7f1 associated with aging is increased, miRNA-23a is added to VPA to age the cells In this case, it was confirmed that the expression did not increase, but increased only when the cells were aged with NaBu.

SEQ ID NOs: 16-27 Gene SEQ ID NO: Primer sequence pre-miR-23a-sense SEQ ID NO: 16 5'- TCCTGGGGATGGGATTTGCTTCCT -3 ' pre-miR-23a-antisense SEQ ID NO: 17 5'- GGTCGGTTGGAAATCCCTGGCA -3 ' pre-miR-26a-sense SEQ ID NO: 18 5'- TAATCCAGGATAGGCTGTGCAGGT -3 ' pre-miR-26a-antisense SEQ ID NO: 19 5'- GCGTCCCCGTGCAAGTAACCA -3 ' pre-miR-30a-sense SEQ ID NO: 20 5'- GCGACTGTAAACATCCTCGACTGG -3 ' pre-miR-30a-antisense SEQ ID NO: 21 5'- TGCAAACATCCGACTGAAAGCCCA -3 ' pre-let 7a-1 ⁴⁰ -sense SEQ ID NO: 22 5'- AGGTAGTAGGTTGTATAGTTTTAGG -3 ' pre-let 7a-1 ⁴⁰ -antisense SEQ ID NO: 23 5'- TAGGAAAGACAGTAGATTGTATAGT -3 ' pre-let 7d ⁴⁰ -sense SEQ ID NO: 24 5'- AGGTTGCATAGTTTTAGGGCA -3 ' pre-let 7d ⁴⁰ -antisense SEQ ID NO: 25 5'- AAGGCAGCAGGTCGTATAGT -3 ' pre-let 7f-1 ⁴⁰ -sense SEQ ID NO: 26 5'- GATTGTATAGTTGTGGGGTAGTG -3 ' pre-let 7f-1 ⁴⁰ -antisense SEQ ID NO: 27 5'- GGGAAGGCAATAGATTGTATAG -3 '

6-2: HDAC  Specific siRNA In aged cells due to miRNA -23a, miRNA -26a and miRNA -30a expression confirmed

In addition to inhibitors of HDAC, in order to determine whether miRNA-23a expression is increased even when aging cells using HDAC-specific siRNA, 50 nM of HDAC1-specific siRNA (Dharmacon, ON Target plus SMART) in cord blood-derived mesenchymal stem cells pool, USA) and HDAC2-specific siRNA (Dharmacon, ON Target plus SMART pool, USA) were added to transform the cells and aged, followed by miRNA-23a, miRNA-26a and the same method as in Example 6-1. Expression of miRNA-30a was confirmed.

As a result, as shown in Figure 6b, the expression of miRNA-23a, miRNA-26a and miRNA-30a did not increase when cells were aged by adding HDAC1-specific siRNA, but the cells were added by adding HDAC2-specific siRNA. When aging, it was confirmed that the expression of miRNA-23a, miRNA-26a and miRNA-30a is increased. These results support that expression of miRNA-23a, miRNA-26a and miRNA-30a is associated with cellular aging.

Example  7: HDAC After suppression of miRNA  Confirm increase of precursor

Regulation of expression of mRNA can be performed at the transcriptional or posttranscriptional level. Although it is well known that miRNA regulation occurs at post-transcriptional levels, little is known about the factors that influence miRNA transcriptional regulation. As HMGA2-targeting miRNA is shown in Figures 6a and 6b, based on the increased expression after HDAC inhibitor treatment, the present inventors, through RT-PCR analysis, let-7a1, let-7d, let-7f1, miR-23a Expression levels of miR-26a and miR-30a precursors were analyzed to investigate whether up-regulation of miRNA occurred at the transcription level. Precursors of miRNAs became significantly up-regulation 1 and / or 3 days after HDAC inhibitor treatment. Based on these results, we found that miRNA expression would be regulated at the transcription level after HDAC inhibitor treatment (FIGS. 6C and 6D). Synthesis of miRNA is transcribed by RNA polymerase II and processing occurs by RNase III, Drosha and Dicer. We examined the expression levels of these factors during aging of HDAC inhibitor-mediated mesenchymal stem cells, and the expression levels of Drosha and Dicer remained unchanged or slightly decreased. These results indicate that let-7a1, let-7d, let-7f1, miR-23a, miR-26a and miR-30a targeting HMGA2 are up-regulated transcriptionally rather than enhanced by the post-transcriptional process of miRNA. To support it.

Example  8: miRNA -23a Adult stem cell  Determination of anti-aging function

8 -1: In adult stem cells inhibited by miRNA- 23a Confirmation of HDAC Expression

In order to confirm the effects on the cell proliferation of the adult stem cells suppressed miRNA-23a, after treatment with the miRNA-23a inhibitor to adult stem cells, HMGA2 expression affecting the cell proliferation was confirmed.

The cord blood-derived mesenchymal stem cells of Example 1 were incubated for 48 to 96 hours in a culture medium containing 2 × 10 ⁴ / well of 50 nM hsa-miR-23a targeting inhibitor (Ambion, Anti-miR ^TM miRNA inhibitor). Transformed. MiRNA precusor negative control # 1 (Ambion) was used as a control. 48-72 hours after transformation, cells were passaged. Cells were stabilized for 24 hours at subculture and then cultured with 50 nM hsa-miR-23a targeting inhibitor for 48-72 hours. The cultured cells were observed under an optical microscope (Olympus, IX70).

As a result, as shown in FIG. 7D, it was confirmed that the adult stem cells in which the expression of miRNA-23a was suppressed were larger in the amount of cells than the cells not inhibited.

Thereafter, the expression of miRNA-23a and HMGA2 was confirmed in the same manner as in Example 2-3.

As a result, when treated with the hsa-miR-23a targeting inhibitor as shown in Figure 7a, it was confirmed that the expression of miRNA-23a is reduced, as shown in Figure 7b, it can be seen that the expression of HMGA2 is increased there was.

8-2: miRNA -23a suppressed In adult stem cells MTT assay Cell senescence suppression and proliferation through

In order to confirm cell proliferation in adult stem cells suppressed by miRNA-23a, adult stem cells were treated with miRNA-23a inhibitors and then subjected to MTT assay for confirming aging. MTT is reduced to inmazan crystals that are insoluble in water in living cells. Cell proliferation can be confirmed by checking the amount of formazan crystals.

Cord blood-derived mesenchymal stem cells were cultured in 24-well plates at 2 × 10 ⁴ / ml. 50 nM hsa-miR-23a targeting inhibitor (Ambion, Anti-miR ^TM miRNA inhibitor) and miRNA inhibitor control were incubated for 2 days. Thereafter, 50 μl of 5 mg / ml MTT (Sigma-Aldrich, St. Louis, MO, USA) was treated and incubated at 37 ° C. for 4 hours. After treatment with DMSO to dissolve the formazan crystals and absorbance was measured using an EL800 microplate reader (BIO-T instruments).

As a result, as shown in Figure 7c, it was confirmed that the amount of formazan crystals increased when the hsa-miR-23a targeting inhibitor was treated. As a result, it was confirmed that the proliferation of cells was increased in adult stem cells in which miRNA-23a was suppressed compared to adult stem cells in which miRNA-23a was not inhibited. This may be due to the inhibition of aging of adult stem cells suppressed miRNA-23a. These results also support that inhibition of miRNA-23a can propagate adult stem cells.

8-2: miRNA -23a suppressed In adult stem cells  In the cell p16 , p21  Confirmation of expression

In order to confirm that senescence is inhibited in the adult stem cells suppressed miRNA-23a, the expression of p16 and p21 was confirmed in the adult stem cells suppressed miRNA-23a in the same manner as in Example 8-1.

As a result, as shown in Figure 7e, it was confirmed that the expression of p16 and p21 expressed in the aged cells in the adult stem cells suppressed miRNA-23a.

The above results indicate that the culture method comprising the step of inhibiting the expression of miRNA-23a supports the suppression of senescence of adult stem cells.

Example  9: miRNA -23a, miRNA -26a and miRNA -30a HMGA2  Expression suppression confirmation

To confirm that miR-23a, miR-26a and miR-30a actually target HMGA2 mRNA associated with cellular aging, we used miR-23a, miR-26a and miR- using specific mRNA inhibitors and mature miRNAs. Experiments were conducted to see if 30a targets HMGA2.

After miRNA inhibitor-mediated inhibition of miR-23a, miR-26a and miR-30a expression, we performed real-time qPCR in a similar manner as in Example 2-3 to down-regulate miRNAs and reduce HMGA2 mRNA expression. It was confirmed that the up-regulation. In contrast, overexpression of miRNA down-regulated the expression of HMGA2 mRNA. This result suggests that the miRNA targets HMGA2 (FIGS. 8A and 8B).

In order to investigate the effects of age-related factor in miRNA expression level of the downstream such as p16 ^INK4A and p21 ^{CIP1 / WAF1,} how mature miRNA after oligonucleotide inhibition or over-expression of miRNA is temporarily using a similar nucleotide as in Example 2-3 Real-time qPCR was performed. As a result, miR-23a and miR-30a were correlated to p16 ^INK4A and p21 ^{CIP1 / WAF1} expression level and (Fig. 8c and 8d). wherein -miRNA mediated inhibition of miR-23a and miR-30a is ^INK4A p16 and p21 ^{CIP1 / WAF1} Expression was reduced. In contrast, mature -miR-23a and miR-30a is p16 ^INK4A and p21 ^{CIP1 / WAF1} Expression levels were increased (FIGS. 8C and 8D). Overexpression of miR-26a also increased p16 ^INK4A , but miR-26a inhibition did not decrease p16 ^INK4A . p21 ^{CIP1 / WAF1} by miR-26a Expression regulation was inconsistent with regulation by miR-23a and miR-30a (FIGS. 8C and 8D). Inhibition or overexpression of miR-23a and miR-30a affected cell aging, as shown in SA β-gal staining results (FIG. 8E).

Anti-miR-23a and anti-miR-30a inhibited β-galactosidase activity of cells. Maturation of the miRNA-miRNA increased the SA β-gal staining state. However, after the regulation of miR-26a, the SA β-gal staining state showed no significant change (FIG. 8E).

These results suggest that miR-23a, miR-26a and miR-30a regulate HMGA2 in cell aging.

The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> KANG STEM HOLDINGS CO., LTD <120> Method for Inhibiting Senescence of Adult Stem Cells Using          Inhibition of miRNA Expression <130> PA110148 / KR <150> KR10-2010-0029545 <151> 2010-03-31 <160> 27 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> RNA <213> Homo sapiens <400> 1 aucacauugc cagggauuuc c 21 <210> 2 <211> 22 <212> RNA <213> Homo sapiens <400> 2 uucaaguaau ccaggauagg cu 22 <210> 3 <211> 22 <212> RNA <213> Homo sapiens <400> 3 uguaaacauc cucgacugga ag 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HDAC 1 sense primer <400> 4 gaagagttct ccgattctga 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HDAC1 antisense primer <400> 5 ctcttcggtg acttctttct 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HDAC2 sense primer <400> 6 gacagtggag atgaagatgg a 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HDAC2 antisense primer <400> 7 ttctgatttg gtgcctttgg 20 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HMGA2 sense primer <400> 8 agtccctcta aagcagctca aaag 24 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HMGA2 antisense primer <400> 9 gccatttcct aggtctgcct c 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> p16INK4A sense primer <400> 10 gaaggtccct cagacatccc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> p16INK4A antisense primer <400> 11 ccctgtagga ccttcggtga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> P223 Cip1 / Waf1 sense primer <400> 12 attagcagcg gaacaaggag 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> P223 Cip1 / Waf1 antisense primer <400> 13 ctgtgaaaga cacagaacag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> P223 Kip1 sense primer <400> 14 agatgtcaaa cgtgcgagtg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> P223 Kip1 antisense primer <400> 15 gcgtgtcctc agagttagcc 20 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> pre-miR-23a sense primer <400> 16 tcctggggat gggatttgct tcct 24 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> pre-miR-23a antisense primer <400> 17 ggtcggttgg aaatccctgg ca 22 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> pre-miR-26a sense primer <400> 18 taatccagga taggctgtgc aggt 24 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pre-miR-26a antisense primer <400> 19 gcgtccccgt gcaagtaacc a 21 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> pre-miR-30a sense primer <400> 20 gcgactgtaa acatcctcga ctgg 24 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> pre-miR-30a antisense primer <400> 21 tgcaaacatc cgactgaaag ccca 24 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> pre-let 7a-140 sense primer <400> 22 aggtagtagg ttgtatagtt ttagg 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> pre-let 7a-140 antisense primer <400> 23 taggaaagac agtagattgt atagt 25 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pre-let 7d-40 sense primer <400> 24 aggttgcata gttttagggc a 21 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pre-let 7d-40 antisense primer <400> 25 aaggcagcag gtcgtatagt 20 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pre-let 7f-140 sense primer <400> 26 gattgtatag ttgtggggta gtg 23 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> pre-let 7f-140 antisense primer <400> 27 gggaaggcaa tagattgtat ag 22

Claims (17)

A method of inhibiting senescence of adult stem cells, characterized in that the expression of any one or more miRNA selected from the group consisting of miRNA-23a, miRNA-26a and miRNA-30a during adult stem cell culture.
The method of claim 1, wherein the miRNA expression is suppressed by using a miRNA expression inhibitor selected from the group consisting of siRNA, aptamer, antisense oligonucleotide and compound.
The method of claim 1, wherein the expression of HMGA2 is increased by inhibiting the expression of the miRNA.
The method of claim 1, wherein the expression of the miRNA is inhibited, thereby reducing the expression of p16 or p21.
The method of claim 1, wherein the adult stem cells are derived from adult stem cells selected from the group consisting of umbilical cord, cord blood, bone marrow, fat, muscle, nerves, skin, amniotic membrane and placenta.
MiRNA-23a, miRNA-26a and miRNA-30a comprising an expression inhibitor of any one or more miRNA selected from the group consisting of, as an active ingredient, the composition for inhibiting aging of adult stem cells.
The composition of claim 6, wherein the expression inhibitor of miRNA is selected from the group consisting of siRNA, aptamer, antisense oligonucleotide and compound.
A method for regulating senescence of adult stem cells, characterized by regulating the expression of HMGA2 (high mobility group A2).
The method of claim 8, wherein the regulation of HMGA2 expression is characterized in that using the expression regulator of HMGA2.
The method of claim 9, wherein the expression regulator of HMGA2 is selected from the group consisting of siRNA, aptamer, antisense oligonucleotide and compound.
A method for proliferating adult stem cells, characterized in that when the adult stem cell culture, the expression of any one or more miRNA selected from the group consisting of miRNA-23a, miRNA-26a and miRNA-30a.
12. The method of claim 11, wherein the inhibition of expression of the miRNA uses a miRNA expression inhibitor selected from the group consisting of siRNA, aptamer, antisense oligonucleotide, and compound.
The method of claim 12, wherein the adult stem cells are derived from adult stem cells selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerves, skin, amniotic membrane and placenta.
miRNA-23a, miRNA-26a and miRNA-30a comprising an expression inhibitor of any one or more miRNA selected from the group consisting of, as an active ingredient, a composition for adult stem cell proliferation.
The composition of claim 14, wherein the expression inhibitor of miRNA is selected from the group consisting of siRNA, aptamer, antisense oligonucleotide and compound.
The adult stem cell aging inhibitor kit comprising the composition of claim 6 or 7.
Kit for propagating adult stem cells comprising the composition of claim 14 or 15.

Images