KR101678249B1 - Method for Inhibiting Senescence of Cells Using Inhibition of miRNA-141 - Google Patents

Abstract

The present invention relates to a method for inhibiting senescence of cells, and more particularly, to a method for inhibiting senescence of cells by increasing expression of ZMPSTE24 in a cell by inhibiting miRNA-141, and a method for proliferating cells. The method and the method for inhibiting senescence of cells according to the present invention can solve the problem that the aging of cell progresses at a rapid rate as the subculture is carried out during cell culture and the cell division rapidly decreases, Adult adult stem cells can be maintained for a long time, and cells can be used as therapeutic agents for research or for research. In addition, it is expected that the aging phenomenon can be identified more specifically by identifying the cause of the decrease in the number of stem cells in vivo in the aging process of human and animal.

Description

[0001] The present invention relates to a method for inhibiting senescence of cells using inhibition of miRNA-

The present invention relates to a method for inhibiting senescence of cells, and more particularly, to a method for inhibiting senescence of cells by increasing expression of ZMPSTE24 in a cell by inhibiting miRNA-141, and a method for proliferating cells.

MicroRNAs (microRNAs) are 20 to 25 nucleotide sequences of non-coding RNA that regulate gene expression by degrading target mRNA or by inhibiting translation of target mRNA. Its regulation of gene expression is associated with cell differentiation and cell proliferation. Especially during embryonic development, miRNAs are expressed at a time when they are difficult to capture, which plays an important role in each embryonic developmental stage. However, although the important function to regulate miRNA miRNA differentiation is still being discovered, the exact mechanism by which miRNA expression is regulated remains to be elucidated. Recently, the potential for vivisection of anticancer miRNAs in human cancer cells has been suggested, and various evidence for the regulation of vivisity in miRNA clusters has been reported. In detail, the anti-cancer miRNA encoding various DNA regions is not activated due to abnormal hypermethylation in a human breast cancer cell line. In the AGS gastric cancer cell line, DNA methyltransferase (DNMT), 5-Asa Studies have shown that when DNA is treated with -dC (5-Asa-deoxycytidine), the expression of certain miRNA clusters is restored by demethylation.

Mesenchymal stem cells are pluripotent stem cells derived from various adult cells such as bone marrow, umbilical cord blood, placenta (or placental tissue cells), and fat (or adipose tissue cells). For example, various studies have been conducted to develop mesenchymal stem cells derived from bone marrow as a cell therapy agent by the pluripotency that can be differentiated into fatty tissue, bone / cartilage tissue, and muscle tissue. On the other hand, it is known that mesenchymal stem cells are rapidly degraded by in vitro culturing similar to other human primary cultured cells by senescence mechanism independent of telomere shortening (Shibata, KR et al . Stem cells , 25; 2371-2382, 2007 ).

Although this mechanism of aging has not been clarified yet, the expression of p16 (INK4a), a Cdk inhibitory protein, has been accumulated and accumulated by accumulation of environmental stress due to prolonged in vitro culture, and the activity of Cdk protein Which is the main cause. When mesenchymal stem cells express the Bmi-1 oncogene to inhibit the expression of p16, it has been shown that cell senescence is inhibited (Zhang, X. et al.Biochemical and biophysical research communications 351; 853-859, 2006It has also been reported that when the mRNA expression of p21 (Cip1), p53, and p16 (INK4a) is inhibited by treating with FGF-2 during the culture, the growth arrest of the G1-terminated mesenchymal stem cells is inhibited (Ito, T.meat get ., Biochemical and biophysical research communications , 359; 108-114 2007). Korean Patent Laid-Open No. 10-2009-0108141 also proposes a method of inhibiting senescence of mesenchymal stem cells by transforming a gene encoding Wip1 protein into mesenchymal stem cells.

However, because Bmi-1 itself is an oncogene that can cause tumors (Haupt, Y. et al ., Oncogene , 8; 3161-3164, 1993; Bruggeman, SW et al . Cancer cell 12; 328-341 2007 ), the possibility of tumor formation can not be excluded when mesenchymal stem cells treated with Bmi-1 and hTERT (telemorase catalytic subunit) are used as cell therapy agents. In addition, the method of treating FGF-2 during the culture requires the continuous use of FGF-2, which is relatively expensive, so that not only the cost is increased but also the effect of transient increase of cell growth rather than suppression of FGF- There is a limitation in suppressing aging.

Under these circumstances, the present inventors have made intensive efforts to solve the above-mentioned problems, and as a result, they have confirmed that inhibition of cell senescence and cell proliferation are inhibited when miRNA-141 is inhibited during cell culture, thereby completing the present invention.

One object of the present invention is to provide a method of inhibiting cellular senescence through inhibition of miRNA-141 during cell culture.

Another object of the present invention is to provide a composition for inhibiting cell senescence comprising an miRNA-141 inhibitor as an active ingredient.

It is another object of the present invention to provide a method for providing information for cell aging diagnosis comprising measuring the level of miRNA-141 in cell culture.

It is another object of the present invention to provide a method for screening a cell senescence inhibitor from a cell senescence inhibiting candidate by measuring the level of miRNA-141 in cell culture.

It is another object of the present invention to provide a method for proliferating cells through inhibition of miRNA-141 in cell culture.

It is another object of the present invention to provide a composition for cell proliferation comprising an miRNA-141 inhibitor as an active ingredient.

It is still another object of the present invention to provide a method for inhibiting cell senescence comprising any one selected from the group consisting of miRNA-141, a gene encoding miRNA-141, and an inducer capable of inducing the expression of miRNA- Promoting or inhibiting cell proliferation.

Yet another object of the present invention is to provide a method for the proliferation of a cell, comprising: (a) a cell proliferated by the cell proliferation method; Or (b) a cell therapy agent containing an miRNA-141 inhibitor and a cell.

In one aspect of the present invention, there is provided a method for inhibiting cell senescence, which comprises inhibiting miRNA-141 during cell culture.

In the present invention, the term "microRNA (microRNA, miRNA)" refers to a small RNA that controls gene expression of an organism. Target mRNA by complementary base pair alignment with target mRNA 3'UTR (untranslated region) It is a small RNA containing 20 to 25 nucleotides that can play an important regulatory role in gene expression through inhibition of translation. The microRNA plays an important role in cell function including proliferation, differentiation, and cell death, and is an evolutionarily conserved regulatory substance present in all animals. Some microRNAs have a proliferative, Histone modification, DNA methylation, etc.).

Among the above microRNAs, the present invention can inhibit cell senescence when miRNA-141 (microRNA-141, miR-141) is inhibited. It is known that miR-141 is highly expressed in the blood or nasopharyngeal carcinoma cells of prostate cancer patients, and its function has been reported mainly in cancer cells. The miR-141 may preferably have the nucleotide sequence of SEQ ID NO: 1. It was first discovered by the present inventors that miR-141 induces cell senescence and inhibits it to inhibit cell senescence.

In one embodiment of the present invention, it was confirmed that cell senescence was induced when ZMPSTE24 was inhibited (FIGS. 3 to 5). It was confirmed that miR-141 specifically targeted ZMPSTE24 among miroRNAs. Thus, it was confirmed that the expression of ZMPSTE24 was down-regulated by miR-141, and the accumulation of prelamin A could induce cell senescence. The expression level of ZMPSTE24 was decreased by miR-141 and the expression level of ZMPSTE24 was decreased by inhibitor of miR-141 as a result of measurement of various protein expression levels which are evidence of cell senescence using miR-141 and its inhibitors in the embodiment of the present invention While the expression levels of prelamin A, p16 ^INK4A and gamma ^H2AX were increased by miR-141 and decreased by inhibitors of miR-141 (Fig. 8).

In another embodiment of the present invention, the expression level of miR-141 is increased in the early passage to the late passage, and thus the expression of miR-141 in the replication- , And that the increase in expression was regulated by the aerobic change of the miR-141 promoter region.

These results suggest that miR-141 increases expression in the replicative senescent cells and down-regulates ZMPSTE24 expression to induce cell senescence, thereby inhibiting cell senescence by inhibiting miR-141 Respectively.

Accordingly, the cell senescence inhibiting method of the present invention is characterized by inhibiting miRNA-141, thereby increasing the expression of ZMPSTE24.

In the present invention, the term "ZMPSTE24" refers to a gene encoding a metallopeptidase and plays an important role in the production of lamin A from prelamin A precursor. The ZMPSTE24 shows a decreasing tendency in aged cells or tissues, and the deficiency of ZMPSTE24 expression causes accumulation of prelamin A and may cause progeny.

In one embodiment of the present invention, when inhibiting ZMPSTE24 expression, it was confirmed that prelamin A accumulates and ultimately induces cell senescence (FIGS. 3 to 5), confirming miR-141 specifically targeting ZMPSTE24, -141, respectively, to regulate cell senescence.

In the present invention, the term "cell" means a structural or functional unit constituting an organism. For the purpose of the present invention, cells capable of progressing cell senescence may be included without limitation. The term "cell senescence " refers to a series of processes until the trait and functional degradation of the cell and subsequent cell death or proliferation arrest occurs. In the present invention, when the expression of ZMPSTE24 is inhibited, the cell may progress to senescence. Such cells may include, but are not limited to, stem cells which maintain the pluripotency and cell regeneration ability, It may be a stem cell. The term "adult stem cell" refers to a cell immediately before differentiation into a specific organs cell, which is extracted from a bone marrow or blood of an umbilical cord blood or an adult, and is undifferentiated cells that differentiate into cells of a specific tissue when necessary . The adult stem cells may be selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta, although the present invention is not limited thereto.

In the present invention, the cells may be cultured by a conventional method using a cell culture medium.

The culture medium may be a medium suitable for maintaining and maintaining the same cell type as the cells, and a medium obtained by adding serum to EMEM (Eagle's minimal essential medium). Fetal bovine serum (FBS) may be used as the serum, and the content thereof may be about 10% by weight based on the total weight of the serum medium. If necessary, antibiotics, antifungal agents and mycoplasma inhibitors that cause contamination can be included. As antibiotics, antibiotics used in conventional cell cultures such as penicillin-streptomycin can be used. As antifungal agents, amphotericin B and mycoplasma inhibitors include tyrosine, gentamicin, ciprofloxacin, azithromycin, etc. Can be used. If necessary, an oxidative nutrient such as glutamine and an energy metabolite such as sodium pyruvate may be further added. Preferably supplemented with 1 to 2 mM glutamine, 0.5 to 1 mM sodium pyruvate, 0.1 to 10% FBS, 1% antibiotic (100 IU / ml), and 1 - 4.5 g / L glucose EMEM < / RTI > The culture may be carried out in a CO ₂ incubator at a humidity of 90 to 95% and at a temperature of 35 to 39 ° C in a 5 to 10% CO ₂ incubator, and if necessary, a carbon such as sodium bicarbonate to a final concentration of 0.17 to 0.22% A regulator can be added, and growth can be promoted by treating trypsin-EDTA. The cumulative population doubling time may be maintained until the cells in culture in the flask are confluent at 75-85%, preferably at 80% confluence, and subculture may be performed.

In the present invention, miRNA-141 may be inhibited by using an inhibitor specific to miRNA-141, including, but not limited to siRNA, aptamer, antisense oligonucleotide , Ribozyme or a compound. Such compounds include, but are not limited to, antioxidants, substances that affect cell growth, and compounds that inhibit miRNA-141 among cell signaling substances.

In the present invention, the term "miRNA-141 inhibitor" means an agent that reduces the expression or activity of miRNA-141 in a cell. Specifically, the miRNA-141 inhibitor acts directly on miRNA- 141 by decreasing the expression level of miRNA-141 at the transcription level, or by increasing the degradation of the expressed miRNA-141, or by interfering with the activity thereof. it means.

miRNAs are mostly intercalated into introns on chromosomes. After transcription, they are processed by Drosha etc. and converted to a precursor form (pre-miRNA), then they are exported to the nucleus, ) To a mature form of about 22bp in internal and external length, which is combined with RNA interference silencing complex (RISC). The miRNA-141 inhibitor of the present invention can participate in the pathway in which this miRNA-141 is activated and function, thereby reducing the expression level of miRNA-141, or inhibiting its activity.

The miRNA-141 inhibitor that can be used in the present invention can be used without any particular limitation as long as it has a miRNA-141 inhibitory activity. The miRNA-141 inhibitor can be a biological molecule such as a nucleic acid or polypeptide that can be processed into cells through standard techniques known in the art, Compounds, extracts isolated from bacteria or plants or animals. Preferably, antisense oligonucleotides complementary to the miRNA-141 base sequence, siRNAs specific for miRNA-141, RNA aptamers, ribozymes, and compounds can be used.

The term "siRNA" in the present invention is a nucleic acid molecule capable of mediating RNA interference or gene silencing and can be used as an efficient gene knockdown method or gene therapy method because it can inhibit the expression of a target gene. do. The siRNA is a small RNA fragment of 21-25 nucleotides in size produced by cleavage of double-stranded RNA by dicer, and can specifically inhibit expression by binding specifically to mRNA having a complementary sequence. For the purpose of the present invention, miRNA-141 can be inhibited by specifically acting on miRNA-141 to induce RNA interference (RNAi, RNA interference) phenomenon by cleaving miRNA-141 molecule. siRNA can be chemically or enzymatically synthesized. The method for producing siRNA is not particularly limited, and methods known in the art can be used. For example, a method of directly synthesizing siRNA, a method of synthesizing siRNA using in vitro transcription, a method of cutting long double-stranded RNA synthesized by in vitro transcription using an enzyme expression through an intracellular delivery of an shRNA expression plasmid or a viral vector, and expression through an intracellular delivery of a polymerase chain reaction (siRNA) expression cassette (cassette).

As used herein, the term "aptamer" refers to a single-stranded oligonucleotide, which is about 20 to 60 nucleotides in size and refers to a nucleic acid molecule having binding activity for a given target molecule. Depending on the sequence, it has various three-dimensional structures and can have a high affinity with a specific substance such as an antigen-antibody reaction. The aptamer can inhibit the activity of a given target molecule by binding to a predetermined target molecule. The aptamers of the present invention may be RNA, DNA, modified nucleic acids, or mixtures thereof, and may also be in linear or cyclic form. Preferably, the aptamer is capable of binding miRNA-141 and inhibiting the activity of miRNA-141. Such an aptamer can be prepared from a sequence of miRNA-141 by a method known to a person skilled in the art.

In the present invention, the term "antisense oligonucleotide" means a nucleotide sequence complementarily binding to miRNA-141 to inhibit expression. The antisense oligonucleotides of the present invention complementarily bind to single-stranded fragments of miRNA-141 molecules in a cell to reduce the process efficiency of miRNA-141, thereby inhibiting their expression and inhibiting their function. Although mature miRNA molecules are predominantly single stranded, precursor miRNA molecules may have a partially self-complementary structure (e.g., a stem-loop structure) that can primarily form double stranded portions . The antisense oligonucleotides of the present invention may be complementary to a single strand fragment of the precursor miRNA-141 molecule, or complementary to a mature miRNA-141 molecule.

The antisense oligonucleotides of the present invention are non-enzymatic nucleic acid compounds that bind to miRNA-141 nucleic acid by mutual interaction of RNA-RNA, RNA-DNA and RNA-PNA (protein nucleic acid) The sequence may be complementary to the miRNA-141 base sequence and may also bind miRNA-141, which itself forms a loop to form a loop. In addition, the antisense oligonucleotides of the present invention can be used to amplify double stranded or single stranded DNA, double stranded or single stranded RNA, DNA / RNA hybrids, DNA and RNA analogs and bases, sugar or backbone modifications complementary to miRNA- 141 single stranded nucleotide sequences The oligonucleotides may be modified by methods known in the art to increase stability and increase resistance to nuclease degradation.

Antisense oligonucleotides that bind complementarily to the miRNA-141 base sequence of the present invention can be isolated or prepared using standard molecular biology techniques, such as chemical synthesis methods or recombinant methods. The antisense oligonucleotide preferably has a length of 15 to 40 nucleotides.

The term "ribozyme " in the present invention means an RNA molecule having an enzyme activity, and means a nucleic acid molecule capable of catalyzing a chemical reaction intramolecularly or intermolecularly. The ribozymes that can be used in the present invention include all types of ribozymes capable of catalyzing nuclease and nucleic acid polymerase type reactions based on ribozymes found in natural systems and are engineered to catalyze specific reactions in vivo Lt; / RTI > are also available. A ribozyme can cleave an RNA or DNA substrate and can cleave the RNA substrate for the purposes of the present invention. Ribozymes typically cleave the nucleic acid substrate through recognition and binding and subsequent cleavage of the target substrate. This recognition is based on base pair interaction, and thus can have a characteristic that target specific cleavage is possible.

In the present invention, introduction of the miRNA-141 inhibitor into cells can be carried out by a conventional method known in the art, including, but not limited to, microinjection, calcium phosphate co-precipitation, electroporation, And the like.

In the present invention, the inhibition of miRNA-141 may be accomplished by inhibiting binding of RNA polymerase II to regulate miRNA-141. In vivo synthesis of miRNA is precisely controlled by RNA polymerase II (RNA polymerase II), and RNA polymerase II catalyzes the transcription of genomic DNA to produce a large number of miRNAs. In one embodiment of the present invention, when the binding of the RNA polymerase II to the miRNA-141 is inhibited by confirming the increase of the RNA polymerase II bound to the miRNA-141 coding region in the replicative senescent cells, Expression was inhibited, and it was confirmed that cell aging could be suppressed ultimately.

In another aspect, the present invention provides a composition for inhibiting cell senescence comprising an miRNA-141 inhibitor as an active ingredient.

The cells are as described above, but are not limited to, preferably, stem cells, more preferably adult stem cells. In addition, the miRNA-141 inhibitor may be a siRNA, an aptamer, an antisense oligonucleotide, a ribozyme, or a compound form as described above, but is not limited thereto.

The composition of the present invention may contain additional substances that inhibit cell aging, and may also include agents that promote intracellular entry of the composition. Agents that promote intracellular entry of miRNA-141 inhibitors may be formulated with liposomes or with lipophilic carriers of one of many sterols, including cholesterol, cholates, and deoxycholic acid. It is also possible to use poly-L-lysine, spermine, polysilazane, polyethylenimine (PEI), polydihydroimidazolenium, polyallylamine Cationic polymers such as chitosan, chitosan and the like may be used, and succinylated PLL, succinylated PEI, polyglutamic acid, polyaspartic acid, anionic polymers such as polyaspartic acid, polyacrylic acid, polymethacylic acid, dextran sulfate, heparin, hyaluronic acid, and the like, It can also be used. When the miRNA-141 inhibitor is administered in the form of a complex, the residence time and the duration of expression of the gene are significantly increased compared to the naked nucleic acid.

The composition of the present invention may be administered together with a pharmaceutically acceptable carrier. For oral administration, a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, In the case of injections, a buffer, a preservative, an anhydrous agent, a solubilizer, an isotonic agent, a stabilizer and the like may be mixed and used. For topical administration, a base, excipient, lubricant, preservative may be used. Formulations of the compositions of the present invention may be prepared in a variety of ways by mixing with pharmaceutically acceptable carriers as described above. For example, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers and the like in the case of oral administration, and in the case of injections, unit dosage ampoules or a plurality of dosage forms.

The compositions of the present invention may be administered in a therapeutically or prophylactically effective amount. The dose may vary depending on various factors such as the kind and severity of the patient, age, sex, weight, sensitivity to the drug, kind of current treatment, administration method, target cell, and the like, . In addition, the composition of the present invention can be administered in combination with conventional therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. It may also be single or multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

The term "administration" as used herein refers to the introduction of a predetermined substance into a patient by any appropriate method, and the administration route of the composition for inhibiting cell senescence may be administered through any conventional route so long as it can reach the target tissue have. But are not limited to, intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, intrathecal, rectal. In addition, the composition may be administered by any device capable of transferring the active agent to the target cell.

In addition, the present invention can provide a kit for inhibiting cell senescence comprising the composition for inhibiting aging. In addition to the composition described above, the kit for inhibiting cell senescence may further include a medium for cell culture, instructions for explaining the use method, and the like.

In yet another aspect, the present invention provides a method for identifying a cell, comprising: (a) measuring the level of miRNA-141 during cell culture; And (b) comparing the level of miRNA-141 with the level of miRNA-141 prior to cell culture.

In the step (a) of the present invention, miRNA-141 is as described above, and the level of miRNA-141 is a concept including both the expression level or activity level of miRNA. As the method for measuring the level of the miRNA-141, any of ordinary methods known in the art can be used. For example, real-time quantitative PCR, reverse transcriptase polymerase chain reaction and the like can be used have.

In the present invention, the step (b) is a step of comparing the level of miRNA-141 at the time of cell culture with the level of miRNA-141 before cell culture, wherein the level of miRNA-141 during the aging identified in the present invention, , It was confirmed that the cell senescence was more advanced when the level of miRNA-141 in the cell culture was significantly increased compared with the level of miRNA-141 before the cell culture.

In yet another aspect, the present invention provides a method for identifying a cell, comprising: (a) measuring the level of miRNA-141 during cell culture; (b) administering a candidate substance inhibiting cell senescence; And (c) confirming that the level of miRNA-141 in the cell culture is reduced compared to the step (a).

The miRNA-141 of the present invention and its level measurement are as described above, and the method for measuring the level of miRNA-141 may be any of the conventional methods known in the art.

The term "candidate for inhibiting cell senescence" in the present invention is a substance expected to inhibit cell senescence, and can be used without limitation as long as it is a substance expected to directly or indirectly inhibit cell senescence. Gene, protein, and the like.

In the screening method of the present invention, the level of miRNA-141 before and after administration of the candidate substance is confirmed, and when the level is lower than that before administration of the candidate substance, the candidate substance can be determined as a cell senescence inhibitor.

In another aspect, the present invention provides a method for proliferating a cell characterized by inhibiting miRNA-141 during cell culture.

The aging of the cells is a result of degeneration of the function and cell death or proliferation arrest over time, and as the number of cells increases, the cells die and the number of cells decreases. Therefore, by inhibiting miRNA-141, the method of the present invention can inhibit cell aging as well as stimulate cell proliferation. In one embodiment of the present invention, it was confirmed that when the miRNA-141 is inhibited, the cell proliferation rate and the cell growth rate are significantly increased through MTT assay and cell cycle analysis (FIG. 8) But also induce an increase in cell proliferation.

The inhibition of miRNA-141 may be accomplished using an miRNA-141 inhibitor selected from the group consisting of siRNA, aptamers, antisense oligonucleotides, ribozymes or compounds that are preferably, but not limited to, miRNA-141 , As described above.

In addition, the cells may be stem cells, more preferably adult stem cells, as described above, but not limited thereto, and the stem cells may be derived from cord blood, umbilical cord blood, bone marrow, Fat, muscle, nerve, skin, amnion, and placenta.

In yet another aspect, the present invention provides a composition for cell proliferation comprising an miRNA-141 inhibitor as an active ingredient.

The composition of the present invention may contain additional substances for cell proliferation and may include agents that promote intracellular entry of the composition. This is as described above.

In addition, the present invention can provide a kit for cell proliferation comprising the cell proliferation composition. In addition to the composition for cell proliferation, the kit may further include a medium for cell culture, instructions for use, and the like.

In another embodiment, the present invention provides a composition for promoting cell senescence or inhibiting cell proliferation, comprising an miRNA-141, a gene encoding miRNA-141, or an inducer capable of inducing the expression of miRNA-141 .

In the present invention, miRNA-141 targets ZMPSTE24 and inhibits the expression of ZMPSTE24, thereby inducing cell senescence and inhibiting cell proliferation. In one embodiment of the present invention, when the miRNA-141 was transfected into cells, it was confirmed that the expression level of ZMPSTE24 was decreased, leading to cell senescence, and the cell growth rate was remarkably decreased, and anti-miRNA-141 In the case of infection, the expression level of ZMPSTE24 was increased, thereby inhibiting cell senescence and increasing cell growth rate (FIG. 8). Therefore, the composition comprising miRNA-141 of the present invention can promote cell senescence, decrease cell growth rate, and inhibit cell proliferation.

Accordingly, it is possible to provide a composition for increasing the level of miRNA-141 to promote cell senescence or inhibit cell proliferation. In addition, by introducing an expression vector containing miRNA-141 or a gene encoding the miRNA-141 into the cell, or introducing an inducer capable of inducing the expression of miRNA-141 into the cell, the cell aging is promoted, And can be used in a variety of cell therapy fields by using it to inhibit the proliferation of cancer cells.

In yet another aspect, the present invention provides a method of producing a cell, comprising: (a) a cell proliferated by the cell proliferation method; Or (b) a cell therapy agent containing an miRNA-141 inhibitor and a cell.

In the present invention, the term "cell therapeutic agent" means a series of actions such as alive, homologous or xenogeneic cell propagation, screening, or other means of changing the biological characteristics of a cell in order to restore the functions of cells and tissues The term " cell therapy agent " refers to a therapeutic agent for stem cells, which can be classified into a somatic cell therapy agent and a stem cell treatment agent depending on the type and degree of differentiation of cells used. And adult stem cell therapy.

In the present invention, a cell therapy agent containing miRNA-141 inhibitor and cells containing proliferated cells or inhibiting miRNA-141, respectively, inhibits miRNA-141, thereby inhibiting cell senescence and proliferating And maintains the ability to differentiate and regenerate cells, making it possible to use it as an effective cell therapy agent.

The method and the method for inhibiting senescence of cells according to the present invention can solve the problem that the aging of cell progresses at a rapid rate as the subculture is carried out during cell culture and the cell division rapidly decreases, Adult adult stem cells can be maintained for a long time, and cells can be used as therapeutic agents for research or for research. In addition, it is expected that the aging phenomenon can be identified more specifically by identifying the cause of the decrease in the number of stem cells in vivo in the aging process of human and animal.

Figure 1 shows the characteristics of replicative aging hMSCs and progerin-expressing hMSCs. FIG results confirm the A is the aging state through the SA-β-gal staining of the 1, B is a result showing cell jeungsikyul by MTT assay, C, after transfection of progerin-GFP prelamin A, lamin A and p16 ^INK4A Was confirmed by Western blotting.
Figure 2 shows the characteristics of replicative aging hMSCs and progerin-expressing hMSCs. FIG. 2A shows the result of observing the expression of GFP after lamin A-GFP and progerin-GFP vectors by confocal microscopy. The accumulation of prelamin A and the morphology of the nucleus were confirmed by immunocytochemistry, and the graph shows the ratio of abnormal nuclei among GFP-expressing cells or whole nucleated cells. FIG. 2B shows the results of the expression of γH2AX by immunocytochemistry and the ratio of cells having three or more γH2AX centers in the whole nucleated cells.
Figures 3 A and B show the results of Western blotting (A) and real-time qPCR analysis (B) of LMNA protein and mRNA expression by passages (5, 10, 15 passages) and expression of p16 ^INK4A mRNA as an aging indicator The result is confirmed. C and D of Figure 3 are the results confirmed by ZMPSTE24 and p16 ^INK4A expressing western blotting (C) and immunocytochemistry (D) for each passage.
FIG. 4 shows the results of treatment of ZMPSTE24-specific siRNA with the group treated with control siRNA. A of Figure 4 Western block by ratting lamin A, prelamin A, ZMPSTE24, p16 ^INK4A and γH2AX protein, B indicates SA-β-gal staining, C indicates cell proliferation rate by MTT assay, and D indicates the level of individual replication.
FIG. 5 is a graph showing the ratios of cells having three or more γH2AX centers among all the nuclear staining cells by confirming the expression of γH2AX by immunocytochemistry.
FIG. 6 shows the results of confirming the expression of ZMPSTE24 in miR-141. FIG. 6A is a schematic diagram showing the search of miRNA targeting ZMPSTE24 through the miRNA database, and B is a schematic diagram of the miR-141 target site in ZMPSTE24 3'UTR. FIG. 6C shows the result of transfection of a reporter vector having ZMPSTE24 3'UTR into 293FT cells together with miR-CTL, miR-141 or miR-106b and measuring the activity of luciferase, and D shows prelamin A and ZMPSTE24 The level of protein expression was confirmed by Western blotting, and E was the result of immunostaining the nucleus with DAPI.
Figure 7A shows that a reporter vector with ZMPSTE24 3'UTR is transfected into 293FT cells with miR-CTL, miR-141, miR-124, miR-182, miR-200a or miR-106b and luciferase activity B is the result of confirming ZMPSTE24 protein expression level by Western blotting in two different hMSCs cell lines and C is the result of transfection of control miRNA, miR-141 mimic and anti-miR-141 in human and mouse The levels of lamin A and ZMPSTE24 protein expression in skin fibroblasts were determined by Western blotting.
FIG. 8A shows the results of immunostaining of hMSCs transfected with miR-CTL, miR-141 or miR-106b using a γH2AX antibody and the ratio of cells having three or more γH2AX centers in all nuclear staining cells . B of Figure 8 confirm the level of expression of 72 hours after each transfection Western block in LMNA, prelamin A, ZMPSTE24, p16 INK4A and γH2AX ratting results, C is the result confirming cell jeungsikyul through the MTT assay, D is G0 / G1, S, and G2 / M groups.
Fig. 9 shows the results of abnormal nucleus morphology and ratio when miR-141 was treated in umbilical cord blood-derived, bone marrow-derived, and adipose-derived mesenchymal stem cells.
Figure 10 shows the results of confirming ZMPSTE24 modulation of miR-141 in vivo. Fig. 10A shows the results of infection with the miR virus fused with the GFP virus and GFP tag, Fig. B shows the cell proliferation rate of the miR-141 expression level by real-time qPCR, As a result of the cell cycle analysis showing the percentage of cells in G0 / G1, S, G2 / M group, E was determined by immunohistochemistry after 7 days and miR-141 was measured in mouse liver tissue. F was obtained by Western blotting Lt; RTI ID = 0.0 > ZMPSTE24 < / RTI > protein expression levels.
Fig. 11 shows the results of measurement of the level of ZMPSTE24 protein expression in each tissue using Western blotting after 7 days of intraperitoneal injection of GFP virus and miR-141 virus into mice.
FIG. 12 shows the results of confirming the level of expression of ZMPSTE24 and prelamin A (A) and the level of miR-141 expression (B) in 6-week old mouse (Y) and 72 week old mouse (O) in heart and liver tissues.
Figure 13 shows the increase in miR-141 expression in replicative senescent cells and the histone mark activated in the miR-141 promoter. FIG. 13A shows the result of measuring the expression level of miR-141 according to the passage in hMSCs, B is a figure showing the primer position near the miR-141 genomic region, and C and D indicate the vicinity of the miR-141 genomic region The expression of AcetylH3, AcetylH4, H3K4Me3, H3K9Me3, H3K27Me3 (C) and RNA polymerase II (D) was expressed as the relative expression rate of the replicative senescent cells compared to the control cells.
Fig. 14 shows the result of confirming the expression level of miR-106b expressed in the replication-defective senescent cells. The expression level of miR-106b in the case of (A), (A), (B) and (C) FIG. 14D shows the result of confirming the position of the primer and the histone mark near the miR-106b genomic region.
Fig. 15 shows the results of confirming induction of cell aging of the HDAC inhibitor. FIG. 15A shows the results of Western blotting of the expression levels of HDAC1 and HDAC2, and FIG. 15B shows results of performing SA-β-gal staining after treatment with HDAC inhibitors VPA and NB for 6 days. D is the result confirmed by the LMNA, prelamin a, ZMPSTE24 and p16 ^INK4A expression levels in Western blotting (C) and immunocytochemistry (D), E is the result showing the percentage of abnormal nuclei.
Fig. 16 shows the results of measuring changes in ZMPSTE24 expression level of DMNT inhibition. FIG. 16A shows the results of Western blotting of the expression levels of DMNT. B and C were obtained by performing SA-β-gal staining (B) and Western blotting (C) after DMNT inhibition by 5-Azacytidine And D is the result of miR-141 measurement.
Fig. 17 shows the results of confirming cell aging induction of specific inhibition of HDAC1 and HDAC2 using siRNA. FIG. 17A shows the result of measurement of the expression level of each protein by Western blotting. As a result, B shows SA-β-gal staining result, C shows MTT assay result, D indicates an individual cloning level measurement result, Measurement results are shown.
Figure 18 shows the result of confirming miR-141 regulation of HDAC. 18A to 18C show the results of measurement of miR-141 expression levels at the time of VPA treatment (A), NB treatment (B) and siRNA (C), and D and E are the results of AcetylH3 near the miR- 141 genomic region, Expression of AcetylH4, H3K4Me3, H3K9Me3, H3K27Me3 (D) and RNA polymerase II (E) was expressed as the relative expression rate of replicative senescent cells compared with control cells.

Hereinafter, the present invention will be described in more detail with reference to the following examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Experimental Example  1: human Intermediate lobe  Stem Cells( hMSCs ) And culture

Umbilical cord blood samples from umbilical vein were mixed with Hetasep solution (StemCell Technologies, Vancouver, Canada) at a ratio of 5: 1 to remove red blood cells and then cultured at room temperature. The supernatant was collected and the Ficoll solution was added to collect the mononuclear cells and centrifuged at 2500 rpm for 20 minutes. Cells were washed twice in PBS and seeded at a density of 2 x 10 ⁵ to 2 x 10 ⁶ cells / cm ² on a plate of growth medium consisting of D-media (Formula No. 78-5470EF, Gibco BRL) Respectively. After 3 days of incubation, unattached cells were removed and seeded at a density of 4x10 ⁵ cells / 10 cm-plate when cells were 80-90% confluent.

Experimental Example  2: SA -β- gal ( senescence associated -β- 가alat 시드세제 ) dyeing

In order to obtain a late passage cells for the hMSCs were seeded in 6-well plates at a density of 1 × 10 ⁵ / well, were seeded to a density of 5 × 10 ⁴ / well in order to obtain an early passage cells, by suitable joining point And cultured for 3 days. The cells were washed twice with PBS and fixed with 0.5% glutaraldehyde at room temperature for 5 minutes. Then, the cells were washed with PBS containing 1 mM MgCl ₂ , and X-gal solution (1 mg / ml X-gal, 0.12 mM K ₃ Fe [CN] ₆ (Potassium Ferricyanide), 1 mM MgCl 2 in PBS, ≪ / RTI > overnight. The cells were washed twice with PBS and images were observed with a microscope (IX70, Olympus, Japan).

Experimental Example  3: MTT assay

20000 hMSCs per well were seeded in 24-well plates. After 48 hours of incubation, 50 ml of MTT stock solution (5 mg / ml, Sigma) was added to each well and the plate was further incubated at 37 占 폚 for 4 hours. The supernatant was then removed and 200 ml of DMSO was added to each well and transferred to a 96-well microplate. Absorbance at 540 nm wavelength was measured with an EL800 microplate reader (BIO-TEK Instruments, Winooski, VT, USA).

Experimental Example  4: Western Blasting  analysis

Western blotting of LMNA, prelamin A, ZMPSTE24, HDAC1, HDAC2, DNMT1, DNMT3B, p16 ^Ink4A , ^{gamma H2AX} and beta ^-actin was performed. hMSCs were lysed with 50 mM Tris-HCl buffer containing 0.1% Triton X-100, supplemented with a protease / phosphatase inhibitor cocktail. Proteins were separated on 7.5 to 15% SDS-PAGE and transferred to a nitrocellulose membrane for 5 hours at 350 mA. Primary antibodies used to detect each protein were LMNA [133A2] (polyclon, Abcam, 1: 2500), prelamin A (polyclon, Santacruz, 1: 500), ZMPSTE24 ), HDAC1 [2E10] (monoclonal, Upstate, 1: 2000), HDAC2 [3F3] (monoclonal, Upstate, 1: 2000), DNMT1 (polyclon, BD, 1: 1000), DNMT3A , 1: 1000), DNMT3B (polyclone, Abcam, 1: 1000), p16 ^Ink4A (Polyclonal, Abcam, 1: 1000), γH2AX (polyclonal, Abcam, 1: 1000) and β-actin [8H10D10] (single clone , Cell-signaling, 1: 5000). All antibodies were used according to the manufacturer's instructions and protein bands were measured using an enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech, UK).

Experimental Example  5: Virus package ( Viral package ) And cell infection

Cells expressing GFP-wt-lamin A and GFP-progerin were purchased from Addgene (Plasmid 17662, 17663) (Cambridge, Mass.) And miR-141 lentivirus vector was purchased from Genecopoeia (HmiR0181) (Rockville, Md. . 6 ug (Sigma, Ronkonkoma, New York, USA) with a VSVG-based package system or a Mission lentivirus packaging mix was added to a tube containing Fugene 6 transfection reagent (Roche, Basel, Switzerland).

The plasmid was transfected into 293FT cells and after 48 and 72 hours the virus supernatant was filtered through a 0.45 mu m cellulose acetate filter and centrifuged at 20,000 rpm for 90 minutes and concentrated. Virus supernatants were used to infect hMSCs in the presence of 5 ug / ml polybrene (Sigma).

Experimental Example  6: RT - PCR

Total cellular RNA was extracted using TRIzol reagent ^™ (Invitrogen, USA) according to the manufacturer's instructions. Purified RNA and oligo-dT primers were added to Accupower RT premix (Bioneer, Korea) to synthesize cDNA. For miRNA cDNA synthesis, the NCode VILO miRNA cDNA synthesis kit (Invitrogen, USA) was used.

Experimental Example  7: Real-time quantitative PCR ( Real - time quantitative PCR )

Real-time qPCR analysis was performed using SYBR® Green (Applied Biosystems, USA) according to the manufacturer's instructions. For miRNA real-time qPCR, the universal primers and miRNA specific primers provided by the NCode VILO miRNA cDNA synthesis kit were used. RPL13A was used as an internal control. All amplicons were analyzed using the Prism 7000 Sequence Detection System 2.1 software (Applied Biosystems, USA). The primer set sequences used for the present invention are as given in the table below.

The primers used for RT-PCT and qRT-PCR gene direction Primer sequence SEQ ID NO: β-ACTIN Forward AGAGCTACGAGCTGCCTGAC 2 Reverse AGCACTGTGTTGGCGTACAG 3 RPL13A Forward CATCGTGGCTAAACAGGTACTG 4 Reverse GCACGACCTTGAGGGCAGCC 5 LMNA-1 Forward CAGAACACCTGGGGCTGCGG 6 Reverse CTGCAGTGGGAGCCGTGGTG 7 LMNA-2 Forward ACCACGTGAGTGGTAGCCGC 8 Reverse AGATTTTTGGCACGGGGAGGCTG 9 LMNA-3 Forward CCACTGGGGAAGGCTCCCACT 10 Reverse GTTCGGGGGCTGGAGTTGCC 11 p16Ink4A Forward GAAGGTCCCTCAGACATCCC 12 Reverse CCCTGTAGGACCTTCGGTGA 13 hsa-miR-141 TAACACTGTCTGGTAAAGATGG 14 hsa-miR-106b TAAAGTGCTGACAGTGCAGAT 15

Experimental Example  8: siRNA , Maturity miRNA  And anti - miRNA Transfection of

Transient transfection assays were performed using commercially available siRNA specific for ZMPSTE24 inhibition (L-006104-00-0005) and non-targeting siRNA (D-001810-10) (ON Target plus SMART pool, Dharmacon, USA) Respectively. Inhibition or over-expression of miRNAs was performed by commercial antisense miRNAs or mature miRNAs of hsa-miR-141 with a suitable miRNA precursor-negative control (mature miRNA, anti-miRNA inhibitor: #AM 10860, Ambion, USA, miRNA precursor- Negative control # 1: Ambion, USA). siRNA, mature miRNA and anti-miRNA transfection were performed by Dharmafect transfection reagent (Dharmacon) according to the manufacturer's instructions.

Cells were seeded at a concentration of 2 x 10 ⁴ / well and siRNA, miRNA and anti-miRNA-containing media were added at the time of 50-60% confluence of the cells. Cells were incubated with 50 nM anti-miRNA or 50 nM mature miRNA for 48 h. To confirm the long term effect of inhibition, the cells were subcultured for 48-72 hours after siRNA, anti-miRNA or mature miRNA transfection. Subcultured cells were stable for 24 hours and incubated with siRNA, anti-miRNA or mature miRNA for 48-72 hours at the same concentration. Inhibition RNA extraction and real-time qPCR or SA-β-gal staining were performed for genetic or characteristic analysis.

Experimental Example  9: Immunocytochemistry ( Immunocytochemistry )

The cultured cells were fixed in 4% paraformaldehyde and permeabilized with 0.2% Triton X-100 (Sigma Aldrich, USA). LMNA [133A2] (monoclonal, Abcam, 1: 300), prelamin A (polyclon, Santacruz, 1: 200), ZMPSTE 24 (Zymed Laboratories Inc., USA) ^Daclon , ^Abcam , 1: 200), p16 ^Ink4A (Polyclonal, Abcam, 1: 200), gamma H2AX (polyclonal, Abcam, 1: 200). And then incubated with Alexa 488 or Alexa 594-labeled secondary antibody (1: 1000; Molecular Probes, USA) for 1 hour. Nuclei were stained with Hoechst 33258 (1 μg / ml; 10 min) and images were observed with a confocal microscope (Eclipse TE200, Nikon, Japan).

Experimental Example  10: Chromatin Immunoprecipitation ( ChIP ) analysis

hMSCs were grown at a density of 1x10 < ⁵ > per plate 10-cm plates and cultured for 3 days in the presence or absence of valproic acid. ChIP assays were performed according to manufacturer's instructions (ChIP assay kit, Upstate Biotechnology, USA). Chromatin was immunoprecipitated using antibodies according to the manufacturer's instructions. Real-time qPCR was performed at a final template dilution of 1:50. The sequences of the primers used in the ChIP test of the present invention are as follows.

Primers used in ChIP screening gene direction Primer sequence SEQ ID NO: miR-141 primer-1 Forward CCTGGGTCCATCTTCCAGTA 16 Reverse AGGGGTGAAGGTCAGAGGTT 17 miR-141 primer-2 Forward ACAAGGGGTGGTTCTTGTTG 18 Reverse GTCGACTGTGGGTTCTGGAT 19

Experimental Example  11: Proliferative ability  And cell cycle distribution measurement

(4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, USA) assay for the effects of replication aging, progerin, ZMPSTE24 inhibition and miR-141 inhibition in hMSCs proliferation .

Cells were plated in 24-well plates at a density of 2 x ¹⁰ < ⁴ > / ml and after 24 hours the cells were infected with virus or siRNA or miRNA. At the end of the incubation, 50 ㎕ of MTT stock solution (5 mg / ml) was added and the plate was further incubated at 37 캜 for 4 hours. Formazan crystal was dissolved in DMSO and the absorbance was measured with an EL800 microplate reader (BIO-TEK Instruments, USA).

Cell cycle analysis of flow cytometry using propidium iodide staining was performed. Briefly, hMSCs in exponential growth phase were transfected with siRNA or miRNA and harvested by trypinization. Cells were washed with ice-cold PBS, fixed with 70% ethanol at -20 ° C, and stained with propidium iodide (50 μg / ml) in the presence of 100 μg / ml RNase A for 30 min. Cell cycle distribution was analyzed using a FACS Calibur system (Becton Dickinson, Franklin Lakes, NJ, USA).

Experimental Example  12: Luciferase  analysis( Luciferase assay )

For miRNA target validation, the entire 3'UTR sequence of human ZMPSTE24 was PCR amplified and cloned into T-vector (Promega, Madison, WI, USA, # A1360). The 3'UTR was subcloned into the pmirGLO Dual-luciferase vector (Promega, # E1330) using the restriction enzymes XhoI and SalI . 293 FT cells were seeded 24 h before transfection in 50% confluence. The control construct and the ZMPSTE24 3'UTR reporter construct were co-transfected with Dharmafect as miRNAs (Ambion) at 50 nM according to the manufacturer's instructions. Twenty-four hours after transfection, firefly and renilla luciferase activities were measured by a luminescence meter using the Dual-Glo Luciferase Assay System (Promega, E2920). Firefly chemiluminescence was standardized by Renilla chemiluminescence.

Example  1: aged human Intermediate lobe  Stem Cells( hMSCs ) Identification of features

Discontinuation of laminar maturation leads to accumulation of prelamin A and induces premature aging of organisms such as in Hutchinson-Gilford progeria syndrome (HGPS). We compared the traits between replicative senescence and progerin-induced senescence in hMSCs to ascertain whether accumulation of prelamin A is associated with normal aging of hMSCs as well as with HGPS.

Β-gal (senescence associated-β-galactosidase) staining and MTT assay were performed to determine the aging status of hMSCs after induction of reproductive aging and progerin overexpression by repeated subculture.

As a result, it was confirmed that replication-aging cells and progerin-expressing hMSCs of 20 passages were strongly stained by SA-β-gal staining, and cell proliferation was also decreased by MTT assay And B).

On the other hand, as an additional experiment to confirm whether prelamin A accumulation is involved in normal aging of hMSCs, prelamin A expression level in replicative senescent cells was significantly increased in 20 passages of replicative aging cells (C in Fig. 1)

In addition, the expression of p16 ^INK4A and? H2AX as aging markers was confirmed and the shape of the nucleus was confirmed. As a result, in both replicative senescent cells and progerin-induced senescent cells, p16 ^INK4A The increase in expression (C in FIG. 1) and the increase in expression of γH2AX (FIG. 2B) were observed, and abnormal nuclei in corrugated form could be observed (FIG.

These results indicate that the replicative senescent cells of late passage, ie, senescent human mesenchymal stem cells, induce accumulation of prelamin A similar to progerin-induced senescent cells and have an abnormal nucleus shape.

Example  2: ZMPSTE24  Confirming cell aging induction

The prelamin A accumulation was confirmed during cell aging in Example 1, and the possible mechanism of prelamin A accumulation was screened.

First, the expression level of lamin A itself was checked during aging of the cells. As a result, it was confirmed that there was no change in the level of lamin A expression in 5 passages, 10 passages and 15 passages at the mRNA and protein levels (A and B in FIG. 3) . In addition, how expression levels of ZMPSTE24, which converts prelamin A to mature lamin A, changes during cell senescence was confirmed by Western blotting and immunocytochemistry. As a result, it was confirmed that the expression level of ZMPSTE24 decreased with increasing passage (C and D in Fig. 3).

In order to confirm whether the interference of ZMPSTE24 induces cell senescence of hMSCs, expression of ZMPSTE24 was inhibited by siRNA. Control siRNA and siZMPSTE24 were treated with hMSCs and tested for evidence of various cellular senescence. As a result, accumulation of prelamin A was remarkably observed in the group in which expression of ZMPSTE24 was suppressed using siZMPSTE24, compared with the control group, and it was confirmed that the increase of p16 ^INK4A and gammaH2AX as aging markers (FIG. In addition, the group inhibiting the expression of ZMPSTE24 showed activity in SA-β-gal staining (FIG. 4B), and the cell proliferation rate and the individual replication level through MTT assay decreased (FIGS. 4C and 4D) an increase in < RTI ID = 0.0 > yH2AX < / RTI > and corrugated abnormal nuclei could be observed (Figure 5). All these results indicate that, when inhibiting the expression of ZMPSTE24, prelamin A accumulates and ultimately induces cell senescence.

Example  3: ZMPSTE24  Regulate expression miRNA -141 Confirmation

3-1. ZMPSTE24 To Target miR -141 Confirmation

To determine whether miRNAs are involved in the regulatory mechanism of ZMPSTE24 induced by HDAC (histone deacetylase, histone deacetylase), miRNA targeting ZMPSTE24 was investigated using a combination of predictive algorithms. The miRNA databases miRanda, TargetScan, and PicTar were used (Fig. 6A). MiR-124, miR-141, miR-182 and miR-200a were selected for additional luciferase assays as miRNAs targeting ZMPSTE24 mRNA predicted by two or more database programs.

To quantitatively assess miRNA activity, a 3'UTR (untranslated region) of ZMPSTE24 mRNA was inserted into the bi-luciferase miRNA target expression vector. The double-luciferase reporter vector was transfected into control miRNAs or hMSCs containing the miRNAs predicted above. Luciferase activity was measured 48 hours after transfection.

As a result, it was confirmed that miR-141 significantly reduced the reporter luciferase activity including ZMPSTE24-3'UTR in comparison with the control miRNA and other miRNAs (Fig. 7A) it was confirmed that it could bind directly to the 3'UTR of mRNA (Fig. 6B). The relationship between the expression of miR-141 and ZMPSTE24 was confirmed in two other hMSCs cell lines (Fig. 7B).

Additionally, additional experiments were performed on the control miRNA and miR-106b, which were predicted not to target ZMPSTE24 with miR-141, and the expression of ZMPSTE24 was down-regulated in miR-141-transfected hMSCs And accumulation of prelamin A was found to increase expression (C and D in Fig. 6). In addition, the treatment of miR-141 showed a significant increase in the aging marker gamma H2AX (Fig. 8A).

On the other hand, when miR-141 was treated with umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs), bone marrow-derived mesenchymal stem cells (BM-MSCs) and adipose derived mesenchymal stem cells (AD-MSCs) By confirming that many abnormal nuclei were observed, evidence of aging was confirmed (Fig. 9).

These results indicate that miR-141 acts as a miRNA targeting ZMPSTE24 mRNA, indicating that increased expression of miR-141 can decrease expression of ZMPSTE24 and induce cell senescence.

3-2. miR -141 inhibitor ZMPSTE24  Increased expression

In order to confirm whether or not miR-141 targeted to ZMPSTE24 identified in Example 3-1 could be inhibited, anti-miR-141 and its inhibitor, ZMPSTE24, Prelamin A, p16 ^INK4A and < RTI ID = 0.0 > ^yH2AX < / RTI > expression levels were confirmed by Western blotting.

As a result, the expression level of ZMPSTE24 was decreased by transfection of miR-141 and increased by transfection of anti-miR-141. On the other hand, in the case of prelamin A, p16 ^INK4A and γH2AX, expression level was increased by transfection of miR-141 and it was confirmed that it was reduced by transfection of anti-miR-141 (FIG. 8B). In addition, transfection of anti-miR-141 was increased not only in hMSCs, but also in human and mouse dermal fibroblasts (Fig. 7C).

As a result of MTT assay and cell cycle analysis, when the miR-141 and siZMPSTE24 were transfected, the cell growth rate was remarkably decreased, but anti-miR-141 and anti- When miR-141 was treated, the cell growth rate was increased as compared with the control (C and D in Fig. 8).

All these results indicate that miR-141 targeting ZMPSTE24 induces cell senescence and inhibits cell senescence when inhibiting miR-141.

3 -3. Identification of long-term overexpression of miR- 141

In order to confirm the effect of prolonged overexpression of miR-141, hMSCs were infected with the miR-141 virus generated from the precursor miR-141 expression clone. The expression vector was designed to express GFP with miR-141, and the presence of miR-141 was measured using GFP fluorescence.

Virus-infected hMSCs showed a strong expression of GFP with markedly increased miR-141 expression as confirmed by real-time qPCR (FIGS. 10A and B). Furthermore, it was confirmed that cell proliferation was suppressed after 5 days of miR-141 overexpression through MTT assay and cell cycle analysis (FIGS. 10C and 10D).

Next, in order to confirm the role of miR-141 in vivo, miR-141 virus was delivered into mice via intraperitoneal (i.p.) injection. Seven days after intraperitoneal injection, tissues were extracted and immunohistochemistry and Western blotting were performed. Of the extracted tissues, expression of ZMPSTE24 was decreased in liver tissues and GFP-positive cells were observed (FIG. 10, E, F and FIG. 11).

Additionally, it was determined whether ZMPSTE24 expression levels could be altered by miR-141 during normal mouse aging. As a result, no significant difference in expression of ZMPSTE24 between 6-week-old and 72-week-old C57BL / 6 mice in heart tissue was observed, but in 72-week old mice, expression of ZMPSTE24 was down- 141 was up-regulated (Fig. 12).

Taken together, these results indicate that miR-141 is a direct target of ZMPSTE24 in vitro and in vivo, and thus is involved in cell senescence. Therefore, when miR-141 is inhibited, expression of ZMPSTE24 can be increased to inhibit cell senescence.

Example  4: Replicability  Of aging cells miR -141 expression confirmation

In order to confirm miR-141 expression during replication aging, miR-141 expression levels by passage were confirmed by performing real-time qPCR. As a result, miR-141 expression level was markedly increased as it proceeded from early passage to late passage (Fig. 13A). On the other hand, as a result of measuring the expression level of miR-106b through the same experiment, it was not possible to observe a consistent change according to the passage (Fig. 14A).

Accordingly, histone acetylation and methylation changes in the miR-141 promoter region were confirmed using chromatin immunoprecipitation (ChIP) assays to reveal eugenic changes responsible for increased miR-141 expression levels in replicative aging . As a result, in late passage cells, acetylation of histone H4 involved in activated gene transcription by promoting transcription factor binding to nucleosomal DNA and trimerization of histone H3 lysine 4 residue (H3K4) Region. However, the formation of the inactivated region of the nucleosomal DNA and the trimerization of histone H3 lysine 9 (H3K9) and lysine 27 (H3K27), which characterize gene silencing, were markedly reduced (Fig. 13C ).

The in vivo synthesis of miRNA is precisely controlled by RNA polymerase II, and RNA polymerase II catalyzes the transcription of genomic DNA to produce a large number of miRNAs. Thus, immunoprecipitation tests were performed to determine the amount of RNA polymerase II in the miRNA coding region. Real-time qPCR after immunoprecipitation showed an increase in RNA polymerase II bound to the miR-141 coding region in replicative senescent cells (18 passages) (Fig. 13D).

On the other hand, the same experiment for histone acetylation and methylation and RNA polymerase II measurement was also performed for miR-106b, but no significant experimental data could be obtained (FIG. 14D).

These results demonstrate that miR-141 expression is up-regulated during replication aging by confirming the histone modification associated with activated transcription in the miR-141 coding region, thereby regulating replication Suggesting that aging can be controlled.

Example  5: HDAC ( Histone deacetylase )of ZMPSTE24  Regulation of expression

During the aging of hMSCs cells, the activity of HDAC and DNMT (DNA methyltransferase) decreases (Fig. 15A and Fig. 16A). These factors regulate the epigenetic state of the genomic DNA and regulate transcriptional activity.

Valproic acid (VPA) and sodium butyrate (SB, NB) as HDAC inhibitors were treated with 5-azacytidine as a DNMT inhibitor to confirm whether these factors are involved in the modulation of ZMPSTE24 expression. HDAC and DNMT inhibition induced cell senescence of hMSCs with an increase in SA-beta-gal activity and p16 ^INK4A , a cell senescence marker (Fig. 15 B, C and Fig. 16B). However, unlike the inhibition of DNMT, only the inhibition of HDAC induced a decrease in ZMPSTE24 expression and an increase in prelamin A (FIG. 15C, FIG. 16C). In addition, abnormal nuclei, which are characteristic of aging cells accumulating prelamin A, also increased by HDAC inhibition (D and E in FIG. 15).

To determine whether HDAC1 and HDAC2 are key regulators of ZMPSTE24 expression, HDAC1 and HDAC2 are the major targets of HDAC inhibitors such as VPA and SB, but HDAC inhibitors may be broad and non-specific in their target range, Were used to specifically inhibit HDAC1 and HDAC2. Since HDAC1 and HDAC2 are mutually active and simultaneously decrease in senescent hMSCs, experiments were performed by inhibiting HDAC1 and HDAC2 simultaneously.

As a result, specific inhibition of HDAC1 and HDAC2 decreased expression level of ZMPSTE24, accumulated prelamin A, increased p16 ^INK4A expression, and induced SA-beta-gal activity (FIGS. 17A and B). In addition, the cell proliferation rate and individual replication level through MTT assay decreased, and the number of abnormal nuclei showing specific characteristics of progerin-induced senescent cells was increased (C to E of FIG. 17).

These results indicate that HDAC regulates the expression level of ZMPSTE24. In particular, inhibition of HDAC reduces the expression level of ZMPSTE24 and accumulates prelamin A, leading to cell senescence of hMSCs.

Example  6: HDAC of miR -141 regulation

As shown in Example 5 above, inhibition of HDAC significantly down-regulated the expression of ZMPSTE24. Accordingly, the expression of miR-141 during HDAC inhibition-mediated senescence was measured to determine whether HDAC activity regulates the transcription of miRNAs targeting ZMPSTE24.

Expression levels of miR-141 in cells treated with HDAC inhibitors VPA and NB were about 25-fold or 5-fold higher than the untreated cell group after 6 days of treatment (FIGS. 18A and B). In addition, when siRNAs specific for HDAC1 and HDAC2 were inhibited, upregulation of miR-141 was induced (Fig. 18C).

Next, histone deformation of the miR-141 coding region was confirmed using a chromatin immunoprecipitation (ChIP) test. As a result, the histone deformation in the group treated with the HDAC inhibitor showed a pattern almost similar to the histone deformation in the reproductive aging cells. In the coding region of miR-141 of the group treated with VPA and NB, the acetylation of histone H3 and histone H4 and the trimerization of histone H3 lysine 4 residue (H3K4) were upregulated whereas histone H3 lysine 9 (H3K9) and The trimethylation of lysine 27 (H3K27) remained down-regulated or unchanged (Fig. 18D).

In addition, the miRNA gene was transcribed by RNA polymerase II, and the amount of RNA polymerase II was measured in the miR-141 coding region. As a result, it was confirmed that RNA polymerase II increased in the vicinity of the miR-141 coding region in the group inducing the aging by the HDAC inhibitor, whereby miR-141 was actively transcribed (FIG. 18E).

These results indicate that miR-141 transcription is regulated during HDAC inhibition-mediated senescence by histone modification and RNA polymerase II activity at the miR-141 promoter region, resulting in miR-141 inducing cell senescence .

<110> SNU R & DB FOUNDATION <120> Method for Inhibiting Senescence of Cells Using Inhibition          miRNA-141 <130> PA110737 / KR <160> 19 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> microRNA-141 <400> 1 gguagaaaug gucugucaca au 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forward primer <400> 2 agagctacga gctgcctgac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 3 agcactgtgt tggcgtacag 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RPL13A forward primer <400> 4 catcgtggct aaacaggtac tg 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RPL13A reverse primer <400> 5 gcacgacctt gagggcagcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LMNA-1 forward primer <400> 6 cagaacacct ggggctgcgg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LMNA-1 reverse primer <400> 7 ctgcagtggg agccgtggtg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LMNA-2 forward primer <400> 8 accacgtgag tggtagccgc 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> LMNA-2 reverse primer <400> 9 agatttttgg cacggggagg ctg 23 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LMNA-3 forward primer <400> 10 ccactgggga aggctcccac t 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LMNA-3 reverse primer <400> 11 gttcgggggc tggagttgcc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> p16Ink4A forward primer <400> 12 gaaggtccct cagacatccc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> p16Ink4A reverse primer <400> 13 ccctgtagga ccttcggtga 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> hsa-miR-141 primer <400> 14 taacactgtc tggtaaagat gg 22 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> hsa-miR-106b primer <400> 15 taaagtgctg acagtgcaga t 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-141 primer-1 forward primer <400> 16 cctgggtcca tcttccagta 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-141 primer-1 reverse primer <400> 17 aggggtgaag gtcagaggtt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-141 primer-2 forward primer <400> 18 acaaggggtg gttcttgttg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-141 primer-2 reverse primer <400> 19 gtcgactgtg ggttctggat 20

Claims (20)

A method for inhibiting the senescence of adult stem cells in vitro, characterized by inhibiting miRNA-141 and increasing the expression of ZMPSTE24 in adult stem cell culture,
Wherein the senescence decreases the proliferation, differentiation, or regenerative capacity of adult stem cells as the number of adult stem cells increases.
delete The method according to claim 1, wherein the inhibition of miRNA-141 comprises using an miRNA-141 inhibitor selected from the group consisting of miRNA-141 specific siRNA, aptamer, antisense oligonucleotide, and ribozyme .
The method according to claim 1, wherein the inhibition of miRNA-141 is accomplished by inhibiting binding of RNA polymerase II to the miRNA-141 coding region.
delete The method according to claim 1, wherein the stem cells are selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta.
delete delete delete (a) measuring levels of miRNA-141 and ZMPSTE24 in adult stem cell culture; And
(b) comparing the level of miRNA-141 and the level of ZMPSTE24 before adult stem cell culture, the method comprising the steps of:
wherein the level of miRNA-141 and ZMPSTE24 in step (a) is higher than the level before adult stem cell culture, and when ZMPSTE24 is decreased, it is determined that adult stem cells are senescent.
Wherein said aging reduces the proliferation, differentiation, or regenerative capacity of adult stem cells as the number of adult stem cells increases.
(a) measuring the level of miRNA-141 and ZMPSTE24 in adult stem cell culture;
(b) administering a candidate substance for inhibiting adult stem cell senescence; And
(c) confirming that the level of miRNA-141 in adult stem cell culture is reduced compared to step (a) above and that the level of ZMPSTE24 is increased,
Wherein said aging decreases the proliferation, differentiation, or regenerative capacity of adult stem cells as the number of adult stem cells increases.
A method for proliferating adult stem cells in vitro, characterized by inhibiting miRNA-141 and increasing the expression of ZMPSTE24 in adult stem cell culture.
delete 13. The method of claim 12, wherein the inhibition of miRNA-141 utilizes an miRNA-141 inhibitor selected from the group consisting of miRNA-141 specific siRNA, aptamer, antisense oligonucleotide, and ribozyme.
13. The method according to claim 12, wherein the source of adult stem cells is selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta.
delete delete delete delete delete

Images