KR20140018448A - Method for inhibiting senescence of cells using inhibition of mirna-141 - Google Patents

Abstract

The present invention relates to a method for inhibiting cell aging and more particularly, to a method for inhibiting cell aging by inhibiting miRNA-141 to increase ZMPSTE24 expression in cells, and a method for cell proliferation. The method for inhibiting cell aging and the method for cell proliferation according to the present invention can solve the problem in that, as subculture is performed, the cell aging proceeds at a high rate, thereby sharply reducing cell division. Therefore, adult stem cells retaining differentiation potency and cell regenerating capability can be maintained for a long time, so that more cells usable for cell therapy agents or studies can be secured. Further, the aging process can be established more specifically by establishing the cause of the decrease in the number of in vivo stem cells in the aging procedures of humans and animals.

Description

Method for Inhibiting Senescence of Cells by Inhibiting MiRNA-141 {Method for Inhibiting Senescence of Cells Using Inhibition of miRNA-141}

The present invention relates to a method for inhibiting aging of a cell, and more particularly, to a method for inhibiting aging of a cell by increasing the expression of ZMPSTE24 in a cell by inhibiting miRNA-141 and a method for proliferating a cell.

MicroRNAs (microRNAs, miRNAs) are nucleotide sequences of 20 to 25 non-coding RNAs that regulate gene expression by degrading target mRNAs or inhibiting translation of target mRNAs. Its regulation of gene expression is involved in cell differentiation and cell proliferation, especially when miRNAs are difficult to capture during embryonic development, which plays an important role at each stage of embryonic development. However, despite the continued discovery of important functions that regulate the differentiation of miRNAs, the exact mechanisms that regulate the expression of miRNAs are still unknown. Recently, the possibility of epigenetic expression of miRNA that functions as an anticancer in human cancer cells has been suggested, and various evidences for epigenetic regulation of miRNA cluster have been reported. In detail, the anti-cancer miRNAs encoding various DNA sites are abnormally hypermethylated in human breast cancer cell lines, resulting in no gene activation, and 5-Asa, a DNA methylatransferase (DNMT) in AGS gastric cancer cell lines. Treatment with -dC (5-Asa-deoxycytidine) suggests that the expression of specific miRNA clusters is restored by demethylation of DNA.

Mesenchymal stem cells are stem cells having a multipotent property derived from various adult cells such as bone marrow, umbilical cord blood, placenta (or placental tissue cells), adipose (or adipose tissue cells). For example, various studies have been conducted for the development of mesenchymal stem cells derived from bone marrow as cell therapeutics due to the differentiation that can be differentiated into adipose tissue, bone / cartilage tissue, and muscle tissue. On the other hand, mesenchymal stem cells, like other human supercultured cells, are known to rapidly decrease cell division due to senescence mechanism that is independent of telomere shortening during in vitro culture. (Shibata, KR et al . Stem cells , 25; 2371-2382, 2007 ).

Although the mechanism of this aging is not yet clearly understood, the activity of Cdk protein, which is responsible for cell growth by the expression and accumulation of p16 (INK4a), a Cdk inhibitory protein, accumulates due to the accumulation of environmental stress caused by long-term in vitro culture. This suppression phenomenon is pointed out as the main cause. In mesenchymal stem cells, the expression of the oncogene called Bmi-1 inhibited the expression of p16 and inhibited the aging of cells (Zhang, X. et al. Biochemical) . and biophysical research communications 351; 853-859, 2006 ), and also, growth-inhibited mesenchymal stem cells of G1 phase inhibited growth arrest when FGF-2 was inhibited in culture to inhibit mRNA expression of p21 (Cip1), p53, and p16 (INK4a). Have been reported (Ito, T. et. al ., Biochemical and biophysical research communications , 359; 108-114 2007 ). In addition, Korean Patent Publication No. 10-2009-0108141 proposed a method of inhibiting the senescence of mesenchymal stem cells by transforming the gene encoding Wip1 protein into mesenchymal stem cells.

However, because Bmi-1 itself is an oncogene that can cause tumors (Haupt, Y. et. al ., Oncogene , 8; 3161-3164, 1993; Bruggeman, SW et al . Cancer cell 12; 328-341 2007 ), the application of mesenchymal stem cells treated with Bmi-1 and the termorase catalytic subunit (hTERT) as a cell therapy cannot exclude the possibility of tumor formation. In addition, the method of treating FGF-2 during the cultivation should be used continuously during the cultivation of relatively expensive FGF-2, which not only increases the cost, but also increases the temporary cell growth effect rather than suppressing aging due to FGF-2. Since is expected, there is a limit in suppressing aging.

Under these circumstances, the present inventors have made diligent efforts to solve the above problems. As a result, when the miRNA-141 is inhibited in cell culture, the present inventors confirmed that cell senescence is inhibited and cells are proliferated, thereby completing the present invention.

One object of the present invention is to provide a method for inhibiting aging of cells through the inhibition of miRNA-141 in cell culture.

Another object of the present invention to provide a composition for inhibiting cell aging comprising a miRNA-141 inhibitor as an active ingredient.

Another object of the present invention to provide a method for providing information for diagnosing cell aging comprising measuring the level of miRNA-141 in cell culture.

Yet another object of the present invention is to provide a method for screening cell aging inhibitors from cell aging inhibitors by measuring the level of miRNA-141 in cell culture.

Yet another object of the present invention is to provide a method for proliferating cells through inhibition of miRNA-141 in cell culture.

Another object of the present invention to provide a composition for cell proliferation comprising a miRNA-141 inhibitor as an active ingredient.

Another object of the present invention is a cell aging comprising any one selected from the group consisting of miRNA-141, gene encoding miRNA-141, and an inducer capable of inducing expression of miRNA-141 It is to provide a composition for promoting or inhibiting cell proliferation.

Another object of the invention is (a) a cell proliferated by the cell proliferation method; Or (b) providing a cell therapy comprising a miRNA-141 inhibitor and a cell.

As one aspect for achieving the above object, the present invention provides a method for inhibiting cell aging, characterized in that by inhibiting miRNA-141 in cell culture.

As used herein, the term “microRNA” refers to a small RNA that plays a role in controlling gene expression in a living organism, and target mRNA by a base pair sequence complementary to the target mRNA 3′UTR (untranslated region). Through inhibition of translation, it is a small RNA containing 20-25 nucleotides that can play an important regulatory role in gene expression. The microRNA plays an important role in cell functions including proliferation, differentiation, apoptosis, etc., and is an evolutionarily conserved regulator present in all animals, and some microRNAs have epigenetic regulatory mechanisms associated with their promoter sites. Histone modification, DNA methylation, etc.) is known to cause gene expression regulation.

Among the microRNAs, the present invention found that when the miRNA-141 (microRNA-141, miR-141) is inhibited, aging of the cells can be suppressed. The miR-141 is known to be highly expressed in blood or nasopharyngeal cancer cells of prostate cancer patients, mainly its function has been reported in cancer cells, but it is not yet known what kind of function in the cells. The miR-141 may preferably have a nucleotide sequence of SEQ ID NO: 1. It was first identified by the inventors that miR-141 induces cellular senescence and can inhibit cellular senescence.

In one embodiment of the present invention, first, it was confirmed that cell senescence is induced when ZMPSTE24 is inhibited (FIGS. 3 to 5), and miR-141 specifically targets ZMPSTE24 among miroRNAs. Accordingly, it was confirmed that the expression of ZMPSTE24 is down-regulated by miR-141 and accumulation of prelamin A occurs to induce cell senescence. In an embodiment of the present invention, the expression level of ZMPSTE24 is reduced by miR-141, and by the inhibitor of miR-141 as a result of measuring various protein expression levels that are evidence of cellular senescence using miR-141 and its inhibitors. While increased, the expression levels of prelamin A, p16 ^INK4A and γH2AX were increased by miR-141 and decreased by inhibitors of miR-141 (FIG. 8).

On the other hand, in another embodiment of the present invention by confirming that the expression level of miR-141 increases from the early passage (lately passage) to the late passage (late passage), the expression of miR-141 in replicative aging cells It was confirmed that the increase, the increase in expression was controlled by epigenetic changes of the miR-141 promoter region.

Taken together, it was confirmed that miR-141 increases expression in replicative senescent cells and induces cellular senescence by downregulating ZMPSTE24 expression. Therefore, miR-141 inhibits cellular senescence. Confirmed.

Therefore, the method for inhibiting cellular senescence of the present invention is characterized by increasing the expression of ZMPSTE24 by inhibiting the miRNA-141.

As used herein, the term "ZMPSTE24" refers to a gene encoding a metallopeptidase, and plays an important role in the production of lamin A from a prelamin A precursor. The ZMPSTE24 shows a tendency to decrease in aged cells or tissues, the lack of ZMPSTE24 expression leads to the accumulation of prelamin A, can lead to premature mania.

In one embodiment of the present invention, when inhibiting ZMPSTE24 expression, it was confirmed that prelamin A accumulates and ultimately induces cellular senescence (FIGS. 3 to 5), and confirms miR-141 specifically targeting ZMPSTE24, miR It was confirmed that cell senescence can be controlled by controlling -141.

As used herein, the term "cell" refers to a structural or functional unit constituting an organism, and may include, without limitation, cells in which cell aging proceeds for the purposes of the present invention. The term "cell aging" refers to a series of processes until the deterioration of the trait and function of the cell followed by cell death or proliferation arrest. In the present invention, when the expression of ZMPSTE24 is suppressed the aging may proceed, such cells include, without limitation, preferably may be stem cells that maintain differentiation and cell regeneration ability, more preferably adult Stem cells. The term "adult stem cell" refers to a cell immediately before differentiation into cells of specific organs extracted from umbilical cord blood or mature adult bone marrow, blood, etc., and is an undifferentiated cell that will differentiate into cells of a specific tissue when necessary. . The adult stem cells may be selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta, although the present invention is not limited thereto.

In the present invention, the cells can be cultured in a conventional manner using a cell culture medium.

The culture medium is a medium suitable for maintaining and storing the same cell type as the cell, and may be a medium obtained by containing serum in EMEM (Eagle's minimal essential medium). Fetal bovine serum (FBS) may be used as the serum, and the content thereof may be about 10% by weight based on the total weight of the serum medium. If necessary, antibiotics, antifungal agents and mycoplasma inhibitors that cause contamination can be included. As antibiotics, antibiotics used in normal cell culture, such as penicillin-streptomycin, may be used.Amphotericin B as an antifungal agent, tyrosine, gentamicin, ciprofloxacin, azithromycin, etc. may be used as a mycoplasma inhibitor. Can be used. If necessary, an oxidative nutrient such as glutamine and an energy metabolite such as sodium pyruvate may be further added. Preferably, supplemented with 1-2 mM glutamine, 0.5-1 mM sodium pyruvate, 0.1-10% FBS, 1% antibiotic (100 IU / ml), and 1-4.5 g / L glucose Can be EMEM. Cultivation can be carried out in a CO ₂ incubator of 5 to 10% at a humidity of 90 to 95% and 35 to 39 ℃, if necessary, carbon such as sodium bicarbonate such that the final concentration is 0.17 to 0.22% by weight Regulators can be added and growth can be promoted by treating trypsin-EDTA. The cumulative population doubling time can be maintained until 75-85% confluence of the cells in culture in the flask, and preferably subcultures can be performed by collecting the cells at 80% confluence.

In the present invention, the inhibition of the miRNA-141 may use an inhibitor specific to miRNA-141, but is not limited thereto. Preferably, the siRNA, aptamer, and antisense oligonucleotides specific to the miRNA-141 are used. , Ribozymes or compounds. The compound is not limited thereto, but any compound that inhibits miRNA-141 among antioxidants, substances affecting cell growth, and cell signaling may be used.

As used herein, the term “miRNA-141 inhibitor” refers to an agent that reduces the expression or activity of miRNA-141 in a cell, and specifically, directly acts on miRNA-141 or is a higher regulator of miRNA-141. Agents that act indirectly to reduce expression of miRNA-141 at the transcription level, increase degradation of expressed miRNA-141, or interfere with its activity, thereby reducing the expression level or activity of miRNA-141 it means.

Most miRNAs are trapped in introns on chromosomes, which are processed by Drosha, etc. after transcription, and converted to pre-miRNAs, which then exit the nucleus by exportin. ) Is transformed into a mature form of about 22bp in length and combines with the RNA interference silencing complex (RISC). The miRNA-141 inhibitor of the present invention may be involved in the pathway in which miRNA-141 is activated and function to reduce the expression level of miRNA-141, or inhibit the activity.

The miRNA-141 inhibitor that can be used in the present invention can be used without particular limitation as long as the substance has miRNA-141 inhibitory activity, and biological molecules such as nucleic acids or polypeptides that can be processed to cells through standard techniques known in the art, Compounds, bacteria or extracts isolated from plants or animals. Preferably, antisense oligonucleotides that complementarily bind to miRNA-141 sequences, siRNAs specific for miRNA-141, RNA aptamers, ribozymes, compounds, and the like can be used.

As used herein, the term "siRNA" is a nucleic acid molecule capable of mediating RNA interference or gene silencing, and thus, may be used as an efficient gene knockdown method or gene therapy method because it may inhibit expression of a target gene. do. The siRNA is a small RNA fragment having a size of 21-25 nucleotides generated by cleaving double-stranded RNA by Dicer, and can specifically bind to mRNA having a complementary sequence to suppress expression. By specifically acting on miRNA-141, the miRNA-141 may be cleaved to induce RNA interference (RNAi), thereby inhibiting the miRNA-141. siRNA can be synthesized chemically or enzymatically. The method for producing siRNA is not particularly limited, and methods known in the art can be used. For example, methods of chemically synthesizing siRNAs directly, methods of synthesizing siRNAs using in vitro transcription, and methods of cleaving long double-stranded RNAs synthesized by in vitro transcription using enzymes. , shRNA expression plasmid or viral vector expression through intracellular delivery and PCR (polymerase chain reaction) induced siRNA expression cassette (cassette) through the expression method through intracellular delivery, but is not limited thereto.

As used herein, the term "aptamer" refers to a single-stranded oligonucleotide, which is about 20 to 60 nucleotides in size and refers to a nucleic acid molecule having binding activity for a given target molecule. Depending on the sequence, it has various three-dimensional structures and can have a high affinity with a specific substance such as an antigen-antibody reaction. The aptamer can inhibit the activity of a given target molecule by binding to a predetermined target molecule. The aptamers of the present invention may be RNA, DNA, modified nucleic acids, or mixtures thereof, and may also be in linear or cyclic form. Preferably, the aptamer may bind to miRNA-141 and serve to inhibit the activity of miRNA-141. Such aptamers can be prepared by a person skilled in the art from a sequence of miRNA-141 by known methods.

As used herein, the term “antisense oligonucleotide” refers to a nucleotide sequence that binds to miRNA-141 complementarily to inhibit expression. Antisense oligonucleotides of the invention can bind complementarily to single-stranded fragments of miRNA-141 molecules in cells, thereby reducing the process efficiency of miRNA-141, thereby inhibiting their expression and inhibiting their function. While mature miRNA molecules exist predominantly single stranded, precursor miRNA molecules may have partially self-complementary structures (e.g. stem-loop structures) that can form predominantly double stranded portions. . Antisense oligonucleotides of the invention may be complementary to single-stranded fragments of precursor miRNA-141 molecules or complementary to mature miRNA-141 molecules.

Antisense oligonucleotides of the invention are non-enzymatic nucleic acid compounds that bind to and mitigate their activity by miRNA-141 nucleic acids by RNA-RNA, RNA-DNA, RNA-PNA (protein nucleic acid) interactions, which are one sequence The sequence may be complementary to the miRNA-141 sequence, and may bind to miRNA-141, which forms a loop by itself and forms a loop. In addition, the antisense oligonucleotides of the present invention incorporate double or single stranded DNA, double or single stranded RNA, DNA / RNA hybrids, DNA and RNA analogs and base, sugar or backbone modifications complementary to miRNA-141 single stranded sequence. The oligonucleotides may be modified by methods known in the art to increase stability and to increase resistance to nuclease degradation.

Antisense oligonucleotides complementary to the miRNA-141 sequences of the present invention can be isolated or prepared using standard molecular biology techniques such as chemical synthesis or recombinant methods. Preferably, the antisense oligonucleotide has a length of 15 to 40 nucleotides.

As used herein, the term “ribozyme” refers to an RNA molecule having enzymatic activity, and refers to a nucleic acid molecule capable of catalyzing a chemical reaction within or between molecules. The ribozymes that can be used in the present invention include all types of ribozymes capable of catalyzing nuclease and nucleic acid polymerase type reactions based on ribozymes found in natural systems and are engineered to catalyze specific reactions in vivo Lt; / RTI > are also available. A ribozyme can cleave an RNA or DNA substrate and can cleave the RNA substrate for the purposes of the present invention. Ribozymes typically cleave the nucleic acid substrate through recognition and binding and subsequent cleavage of the target substrate. This recognition is based on base pair interaction, and thus can have a characteristic that target specific cleavage is possible.

In the present invention, the introduction of the miRNA-141 inhibitor into the cells may use a general method known in the art, but is not limited thereto, such as micro-injection, calcium phosphate co-precipitation, electroporation and liposomes. It can be used.

In addition, the inhibition of the miRNA-141 in the present invention may be made by inhibiting the binding of RNA polymerase II that regulates miRNA-141. In vivo synthesis of miRNA is precisely regulated by RNA polymerase II, which catalyzes transcription of genomic DNA to produce a number of miRNAs. In one embodiment of the present invention by confirming the increase of RNA polymerase II bound to the miRNA-141 coding region in replicative senescent cells, in the case of inhibiting the binding of the RNA polymerase II to miRNA-141, It was confirmed that the expression can be suppressed, and ultimately, it was confirmed that the cell senescence can be suppressed.

As another aspect, the present invention provides a composition for inhibiting cell aging comprising a miRNA-141 inhibitor as an active ingredient.

The cells are as described above, but are not limited thereto. Preferably, the cells may be stem cells, more preferably adult stem cells. In addition, the miRNA-141 inhibitor is as described above, but is not limited thereto, and may preferably be in the form of siRNA, aptamer, antisense oligonucleotide, ribozyme or compound specific to miRNA-141.

The compositions of the present invention may include additional substances that inhibit aging of cells and may also include agents that promote intracellular influx of the composition. Formulations that promote intracellular influx of miRNA-141 inhibitors may be used with liposomes or combined with one of the lipophilic carriers of many sterols, including cholesterol, cholate and deoxycholic acid. Poly-L-lysine, spermine, polysilazane, polyethylenimine, polydihydroimidazolenium, polyallylamine Cationic polymers such as chitosan), succinylated PLL, succinylated PEI, polyglutamic acid, and polyaspartic acid. anionic polymers such as polyaspartic acid, polyacrylic acid, polymethacylic acid, dextran sulfate, heparin, hyaluronic acid, etc. It can also be used. Administration of the miRNA-141 inhibitor in complex form significantly increases the retention and expression duration of genes in comparison to naked nucleic acids.

The composition of the present invention may be administered with a pharmaceutically acceptable carrier, and when used orally, a binder, a suspending agent, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a perfume, and the like may be used. In the case of injections, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers and the like can be used in combination, and for topical administration, bases, excipients, lubricants, preservatives and the like can be used. Formulations of the compositions of the present invention may be prepared in a variety of ways by mixing with pharmaceutically acceptable carriers as described above. For example, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers and the like in the case of oral administration. In the case of injections, it can be prepared in unit dosage ampoules or in multiple dosage forms.

The compositions of the present invention may be administered in a therapeutically or prophylactically effective amount. Dosage may vary depending on a variety of factors, including the type and severity of the patient, age, sex, weight, drug sensitivity, type of current treatment, method of administration, target cells, and can be readily determined by those skilled in the art. Can be. In addition, the composition of the present invention may be administered in combination with a conventional therapeutic agent and may be administered sequentially or simultaneously with the conventional therapeutic agent. It may also be single or multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

As used herein, the term "administration" means introducing a predetermined substance into a patient by any suitable method, and the route of administration of the composition for inhibiting cell aging may be administered through any general route as long as it can reach the target tissue. have. Intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, nasal administration, pulmonary administration, rectal administration, but is not limited thereto. In addition, the composition may be administered by any device that allows the active material to migrate to the target cell.

Additionally, the present invention may provide a kit for inhibiting cell aging comprising the composition for inhibiting aging. In addition to the composition, the kit for inhibiting cell aging may further include a medium for cell culture, instructions for explaining a method of use, and the like.

In yet another aspect, the present invention provides a method for producing a cell, comprising (a) measuring the level of miRNA-141 in cell culture; And (b) provides a method of providing information for diagnosing cell aging, comprising the step of comparing with the level of miRNA-141 before cell culture.

In the step (a) of the present invention, miRNA-141 is as described above, and the level of miRNA-141 is a concept that includes both the expression level or activity level of miRNA. The method for measuring the level of miRNA-141 may use all the conventional measuring methods known in the art, but is not limited thereto. For example, real-time quantitative polymerase chain reaction and reverse transcriptase polymerase chain reaction may be used. have.

In the present invention, the step (b) compares the level of miRNA-141 in cell culture with the level of miRNA-141 before cell culture, wherein the level of miRNA-141 during the aging identified in the present invention is passaged at an early passage in the late passage. Through the fact that as the progress is significantly increased, it can be seen that if the level of miRNA-141 in the cell culture is significantly increased than the level of miRNA-141 before the cell culture, the cell aging progressed more.

In yet another aspect, the present invention provides a method for producing a cell, comprising (a) measuring the level of miRNA-141 in cell culture; (b) administering a cell aging inhibitor candidate; And (c) confirming that the level of miRNA-141 in the cell culture is reduced compared to the step (a).

The miRNA-141 of the present invention and its level measurement as described above, and the method for measuring the level of miRNA-141 can be used for all conventional measurement methods known in the art.

In the present invention, the term "cell aging inhibitor candidate" is a material that is expected to inhibit cell aging, as long as it is a material that is expected to inhibit cell aging directly or indirectly, can be used without limitation, compounds, It can include all possible predictors such as genes or proteins.

The screening method of the present invention confirms the level of miRNA-141 before and after administration of the candidate, and if the level is reduced compared to before administration of the candidate, the candidate may be determined as a cell aging inhibitor.

As another aspect, the present invention provides a method for proliferating cells, characterized in that by inhibiting miRNA-141 in cell culture.

The aging of the cell is a function of dividing, cell death or proliferation stop occurs, and as the number of passages increases, the cell number dies as the cell dies. Thus, the method of the present invention can inhibit cell aging by inhibiting miRNA-141, as well as activate cell proliferation. In one embodiment of the present invention, the cell proliferation rate and cell growth rate were significantly increased through MTT assay and cell cycle analysis when miRNA-141 was inhibited (FIG. 8). It was confirmed that an increase in cell proliferation could also be induced.

Inhibition of the miRNA-141 is not limited thereto, but preferably may be made using a miRNA-141 inhibitor selected from the group consisting of siRNA, aptamers, antisense oligonucleotides, ribozymes or compounds specific to miRNA-141. This is as described above.

In addition, the cells are as described above, but are not limited thereto, and preferably, may be stem cells, more preferably adult stem cells, the origin of the adult stem cells are umbilical cord, cord blood, bone marrow, It may be selected from the group consisting of fat, muscle, nerves, skin, amnion and placenta.

As another aspect, the present invention provides a composition for cell proliferation comprising a miRNA-141 inhibitor as an active ingredient.

The compositions of the present invention may include additional materials for the proliferation of cells and may include agents that promote intracellular influx of the composition. This is as described above.

In addition, the present invention can provide a kit for cell proliferation comprising the composition for cell proliferation. In addition to the composition for cell proliferation, the kit may further include a medium necessary for culturing cells, instructions for describing the method of use, and the like.

As another aspect, the present invention provides a composition for promoting cell aging or inhibiting cell proliferation, including miRNA-141, a gene encoding miRNA-141, or an inducer capable of inducing expression of miRNA-141. To provide.

In the present invention, the miRNA-141 targets ZMPSTE24, and by inhibiting the expression of ZMPSTE24, induces cellular senescence and inhibits cell proliferation. In one embodiment of the present invention, when the transfection of miRNA-141 into cells, the expression level of ZMPSTE24 was reduced, thereby inducing cell senescence and remarkably decreasing the cell growth rate. When infected, it was confirmed that the expression level of ZMPSTE24 was increased, thereby inhibiting cell aging and increasing cell growth rate (FIG. 8). Therefore, the composition comprising miRNA-141 of the present invention can promote cell aging and reduce cell growth rate to inhibit cell proliferation.

Thus, it is possible to provide a composition for promoting cell senescence or inhibiting cell proliferation by increasing the level of miRNA-141. In addition, by introducing an expression vector containing miRNA-141 or a gene encoding the same into the cell, or by introducing an inducer capable of inducing the expression of miRNA-141 into the cell, it promotes cell aging, It is possible to provide a method of inhibiting proliferation, and by using the same to inhibit cancer cell proliferation, it may be applied to various cell therapeutic fields.

As another aspect, the present invention provides a cell comprising: (a) a cell proliferated by the method for propagating the cell; Or (b) a cell therapy comprising a miRNA-141 inhibitor and a cell.

As used herein, the term "cell therapeutic agent" refers to a series of acts such as proliferating, selecting, or otherwise altering biological characteristics of a cell in vitro in order to restore the function of cells and tissues in vitro. Means the medicine used for the purpose of treatment, diagnosis, prevention, the cell therapy can be classified into somatic cell therapy and stem cell therapy according to the type and differentiation of cells used, the stem cell therapy is embryonic stem cell therapy And adult stem cell therapy.

In the present invention, a cell therapeutic agent containing proliferated cells by inhibiting miRNA-141 at the time of cell culture, or separately containing miRNA-141 inhibitor and each cell, inhibits miRNA-141, thereby inhibiting aging of the cells and promoting proliferation. In addition, it is possible to use as an efficient cell therapy by maintaining differentiation capacity and cell regeneration ability.

The method for inhibiting aging and proliferation of cells according to the present invention can solve the problem of rapidly dividing cells due to the rapid aging of cells as subcultures are carried out in the cell culture, thereby improving the differentiation and cell regeneration ability. The adult stem cells can be retained for a long time, and more cells can be used for cell therapy or research. In addition, by discovering the cause of stem cell number decrease in vivo in the aging process of humans and animals, it is expected that the aging phenomenon can be more specifically identified.

1 shows the characteristics of replicative aging hMSCs and progerin-expressing hMSCs. FIG results confirm the A is the aging state through the SA-β-gal staining of the 1, B is a result showing cell jeungsikyul by MTT assay, C, after transfection of progerin-GFP prelamin A, lamin A and p16 ^INK4A The expression of the protein was confirmed by Western blotting.
2 shows the characteristics of replicative aging hMSCs and progerin-expressing hMSCs. 2A shows the results of observing the expression of GFP after transfection of lamin A-GFP and progerin-GFP vectors by confocal microscopy. The accumulation of prelamin A and the shape of the nucleus were confirmed by immunocytochemistry, and the graph shows the proportion of abnormal nuclei among GFP expressing cells or whole nuclear stained cells. 2B shows the expression of γH2AX by immunocytochemistry and shows the ratio of cells having three or more γH2AX centers among all nuclear stained cells.
A and B of FIG. 3 show p16 ^INK4A mRNA expression as an aging marker as confirmed by Western blotting (A) and real-time qPCR analysis (B) for LMNA protein and mRNA expression by passage (5, 10, 15 passages). This is the confirmed result. C and D of Figure 3 are the results confirmed by ZMPSTE24 and p16 ^INK4A expressing western blotting (C) and immunocytochemistry (D) for each passage.
4 shows the results of treatment with ZMPSTE24 specific siRNA compared with the group treated with control siRNA. A of Figure 4 Western block by ratting lamin A, prelamin A, ZMPSTE24, p16 ^INK4A and γH2AX protein expression level is confirmed, B is SA-β-gal staining result, C is the cell proliferation rate confirmed by MTT assay, D is the result of confirming the level of individual replication.
5 is a result of confirming the expression of γH2AX by immunocytochemistry, and graphically showing the ratio of cells having three or more γH2AX centers among all nuclear stained cells.
6 shows the results of confirming ZMPSTE24 expression regulation of miR-141. Figure 6 A is a schematic diagram showing the search of miRNA targeting ZMPSTE24 through the miRNA database, B is a schematic diagram of miR-141 target site in ZMPSTE24 3'UTR. 6C is the result of transfecting a reporter vector with ZMPSTE24 3'UTR into 293FT cells with miR-CTL, miR-141 or miR-106b and measuring the activity of luciferase, D being prelamin A and ZMPSTE24 Protein expression level was confirmed by Western blotting, E is the result of immunostaining the nucleus by DAPI.
FIG. 7A transfects reporter vectors with ZMPSTE24 3′UTR into 293FT cells with miR-CTL, miR-141, miR-124, miR-182, miR-200a or miR-106b and luciferase activity B is the result of Western blotting in two different hMSCs cell lines, C is human and mouse after transfection of control miRNA, miR-141 mimetic and anti-miR-141 Lamin A and ZMPSTE24 protein expression levels in skin fibroblasts were measured by Western blotting.
FIG. 8A shows the results of immunostaining of hMSCs transfected with miR-CTL, miR-141 or miR-106b using γH2AX antibody and the ratio of cells having three or more γH2AX centers in total nuclear stained cells. Indicates. B of Figure 8 confirm the level of expression of 72 hours after each transfection Western block in LMNA, prelamin A, ZMPSTE24, p16 INK4A and γH2AX ratting results, C is the result confirming cell jeungsikyul through the MTT assay, D is G0 / Cell cycle analysis results showing the percentage of cells in the G1, S, G2 / M phases are shown.
Figure 9 is a result showing the shape and ratio of the abnormal nucleus when treated with miR-141 in cord blood-derived, bone marrow-derived, adipose-derived mesenchymal stem cells.
10 shows the results of confirming ZMPSTE24 regulation of miR-141 in vivo. 10A shows the infection of GFP virus and GFP tag fused miR virus, B shows the miR-141 expression level by real-time qPCR, C shows the cell proliferation rate test by MTT assay after 5 days, and D shows Cell cycle analysis showing the percentage of cells in G0 / G1, S and G2 / M phases, E was measured miR-141 in mouse liver tissues by immunohistochemistry 7 days later, F was Western blotting ZMPSTE24 protein expression level measurement results are shown.
FIG. 11 shows the results of measuring ZMPSTE24 protein expression levels in each tissue using Western blotting 7 days after intraperitoneal injection of GFP virus and miR-141 virus into mice.
12 shows the results of confirming ZMPSTE24 and prelamin A expression levels (A) and miR-141 expression levels (B) in 6-week-old mice (Y) and 72-week-old mice (O) in heart and liver tissues.
FIG. 13 shows the results of confirming the increased miR-141 expression and the activated histone marks in the miR-141 promoter. 13A is a result of measuring the expression level of miR-141 according to passage in hMSCs, B is a diagram showing the position of the primer near the miR-141 genomic region, C and D is near the miR-141 genomic region AcetylH3, AcetylH4, H3K4Me3, H3K9Me3, H3K27Me3 (C) and RNA polymerase II (D) expressions of cloned senescent cells compared with control cells.
14 shows the results of confirming the expression level of miR-106b in replicative senescent cells. By passage (A), when treated with VPA (B), when treated with NB (C) miR-106b expression levels are shown. 14D shows the result of confirming the primer positions and histone marks near the miR-106b genomic region.
Figure 15 shows the results confirming the induction of cellular senescence of HDAC inhibitors. 15A is the result of confirming the expression levels of HDAC1 and HDAC2 by passage by Western blotting, B is the result of performing SA-β-gal staining after treatment with VPA and NB which are HDAC inhibitors for 6 days, C and D is the result confirmed by the LMNA, prelamin a, ZMPSTE24 and p16 ^INK4A expression levels in Western blotting (C) and immunocytochemistry (D), E is the result showing the percentage of abnormal nuclei.
16 shows the results of measuring the change in ZMPSTE24 expression level of DMNT inhibition. 16A shows the results of confirming the expression level of DMNT by Western blotting, and B and C performed SA-β-gal staining (B) and Western blotting (C) after DMNT inhibition by 5-Azacytidine. D is the result of measuring miR-141.
17 shows the results confirming the induction of cellular senescence of specific inhibition of HDAC1 and HDAC2 using siRNA. Fig. 17A shows the expression level of each protein by Western blotting, B shows SA-β-gal staining, C shows MTT assay, D shows individual replication level, and E shows abnormal nucleus ratio. The measurement result is shown.
18 shows the results of confirming miR-141 regulation of HDAC. 18A to 18C are results of measuring miR-141 expression levels during VPA treatment (A), NB treatment (B), and siRNA (C), and D and E are AcetylH3 near the miR-141 genomic region. The expression of AcetylH4, H3K4Me3, H3K9Me3, H3K27Me3 (D) and RNA polymerase II (E) is expressed by the relative expression rate of replicative senescent cells compared with control cells.

Hereinafter, the present invention will be described in more detail with reference to the following examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Experimental Example  1: human Intermediate lobe  Stem Cells( hMSCs Isolation and Cultivation

Umbilical cord blood samples obtained from umbilical vein were mixed with Hetasep solution (StemCell Technologies, Vancouver, Canada) at a ratio of 5: 1 to remove red blood cells, and then cultured at room temperature. The supernatant was harvested and centrifuged for 20 minutes at 2500 rpm with picol solution added to collect monocyte cells. Cells were washed twice in PBS and seeded at a density of 2 × 10 ⁵ to 2 × 10 ⁶ cells / cm ² in a plate of growth medium consisting of D-media (Formula No. 78-5470EF, Gibco BRL). It was. After 3 days of incubation, unattached cells were removed and seeded at a density of 4 × 10 ⁵ cells / 10 cm-plate when cells were 80-90% confluent.

Experimental Example  2: SA -β- gal ( senescence associated -β- galactosidase ) dyeing

Seeds in 6-well plates at a density of 1 × 10 ⁵ / well to obtain late passage cells for hMSCs, seeded at a density of 5 × 10 ⁴ / well to obtain early passage cells, until the appropriate confluence Incubated for 3 days. The cells were washed twice with PBS and fixed by treating 0.5% glutaraldehyde at room temperature for 5 minutes. Then, washed with PBS containing 1 mM MgCl ₂ and X-gal solution (1mg / ml X-gal, 0.12mM K ₃ Fe [CN] ₆ (Potassium Ferricyanide), 1mM MgCl2 in PBS, pH6.0) 37 Staining was performed overnight at < RTI ID = 0.0 > The cells were washed twice with PBS and images were observed under a microscope (IX70, Olympus, Japan).

Experimental Example  3: MTT assay

20000 hMSCs per well were seeded in 24-well plates. After 48 hours of incubation, 50 ml of MTT stock solution (5 mg / ml, Sigma) was added to each well and the plate was further incubated at 37 ° C. for 4 hours. The supernatant was then removed and 200 ml of DMSO added to each well and transferred to a 96-well microplate. Absorbance at 540 nm was measured with an EL800 microplate reader (BIO-TEK Instruments, Winooski, VT, USA).

Experimental Example  4: Western Blasting  analysis

Western blotting of LMNA, prelamin A, ZMPSTE24, HDAC1, HDAC2, DNMT1, DNMT3B, p16 ^Ink4A , γH2AX and β-actin was performed. hMSCs were lysed with 50 mM Tris-HCl buffer containing 0.1% Triton X-100 with protease / phosphatase inhibitor cocktail. Proteins were separated on 7.5-15% SDS-PAGE and transferred to nitrocellulose membranes for 5 hours at 350 mA. Primary antibodies used to detect each protein were LMNA [133A2] (polyclonal, Abcam, 1: 2500), prelamin A (polyclonal, Santacruz, 1: 500), ZMPSTE24 (polyclonal, Abcam, 1: 500). ), HDAC1 [2E10] (monoclonal, Upstate, 1: 2000), HDAC2 [3F3] (monoclonal, Upstate, 1: 2000), DNMT1 (polyclonal, BD, 1: 1000), DNMT3A (polyclonal, Millipore , 1: 1000), DNMT3B (polyclonal, Abcam, 1: 1000), p16 ^Ink4A (Polyclonal, Abcam, 1: 1000), γH2AX (polyclonal, Abcam, 1: 1000) and β-actin [8H10D10] (monoclonal , Cell-signaling, 1: 5000). All antibodies were used according to manufacturer's instructions and protein bands were measured using an enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech, UK).

Experimental Example  5: Virus package ( Viral package ) And cell infection

Cells expressing GFP-wt-lamin A and GFP-progerin were purchased from Addgene (Plasmid 17662, 17663) (Cambridge, Massachusetts) and miR-141 lentiviral vectors were purchased from Genecopoeia (HmiR0181) (Rockville, Maryland). . 6 μg of vector with VSVG-based package system or Mission lentiviral packaging mix (Sigma, Ronkonkoma, New York, USA) was added to a tube containing Fugene 6 transfection reagent (Roche, Basel, Switzerland).

Plasmids were transfected into 293FT cells, and after 48 and 72 hours the virus supernatant was filtered through a 0.45 μm cellulose acetate filter and concentrated by centrifugation at 20,000 rpm for 90 minutes. Viral supernatants were used to infect hMSCs in the presence of 5 μg / ml polybrene (Sigma).

Experimental Example  6: RT - PCR

Whole cell RNA was extracted using TRIzol reagent ^™ (Invitrogen, USA) according to the manufacturer's instructions. Purified RNA and oligo-dT primers were added to Accupower RT premix (Bioneer, Korea) to synthesize cDNA. For miRNA cDNA synthesis, the NCode VILO miRNA cDNA Synthesis Kit (invitrogen, USA) was used.

Experimental Example  7: Real-time quantitative PCR ( Real - time quantitative PCR )

Real-time qPCR analysis was performed using SYBR® Green (Applied Biosystems, USA) according to the manufacturer's instructions. For miRNA real-time qPCR, universal primers and miRNA specific primers provided by the NCode VILO miRNA cDNA Synthesis Kit were used. RPL13A was used as an internal control. All amplicons were analyzed using Prism 7000 sequence detection system 2.1 software (Applied Biosystems, USA). Primer set sequences used for the present invention are as given in the table below.

Primers used for RT-PCT and qRT-PCR gene direction Primer sequence SEQ ID NO: β-ACTIN Forward AGAGCTACGAGCTGCCTGAC 2 Reverse AGCACTGTGTTGGCGTACAG 3 RPL13A Forward CATCGTGGCTAAACAGGTACTG 4 Reverse GCACGACCTTGAGGGCAGCC 5 LMNA-1 Forward CAGAACACCTGGGGCTGCGG 6 Reverse CTGCAGTGGGAGCCGTGGTG 7 LMNA-2 Forward ACCACGTGAGTGGTAGCCGC 8 Reverse AGATTTTTGGCACGGGGAGGCTG 9 LMNA-3 Forward CCACTGGGGAAGGCTCCCACT 10 Reverse GTTCGGGGGCTGGAGTTGCC 11 p16Ink4A Forward GAAGGTCCCTCAGACATCCC 12 Reverse CCCTGTAGGACCTTCGGTGA 13 hsa-miR-141 TAACACTGTCTGGTAAAGATGG 14 hsa-miR-106b TAAAGTGCTGACAGTGCAGAT 15

Experimental Example  8: siRNA , Maturity miRNA  And anti - miRNA Transfection of

Transient transfection tests were performed using commercially available siRNA (L-006104-00-0005) and non-targeting siRNA (D-001810-10) specific to ZMPSTE24 inhibition (ON Target plus SMART pool, Dharmacon, USA). Was carried out. Inhibition or overexpression of miRNAs was carried out by commercial antisense miRNAs or mature miRNAs of hsa-miR-141 with a suitable miRNA precursor-negative control (mature miRNA, anti-miRNA inhibitors: #AM 10860, Ambion, USA, miRNA precursor- Negative control # 1: Ambion, USA). siRNA, mature miRNA and anti-miRNA transfections were performed with Dharmafect transfection reagent (Dharmacon) according to the manufacturer's instructions.

Cells were seeded at a concentration of 2 × 10 ⁴ / well and siRNA, miRNA and anti-miRNA-containing media were added at 50-60% confluence of cells. Cells were incubated with 50 nM anti-miRNA or 50 nM mature miRNA for 48 hours. To confirm the long-term effects of inhibition, the cells were passaged for 48-72 hours after siRNA, anti-miRNA or mature miRNA transfection. The passaged cells were stable for 24 hours and incubated with siRNA, anti-miRNA or mature miRNA at the same concentration for 48 to 72 hours. After inhibition RNA extraction and real-time qPCR or SA-β-gal staining were performed for genetic or characteristic analysis.

Experimental Example  9: immunocytochemistry Immunocytochemistry )

Cultured cells were fixed in 4% paraformaldehyde and permeated into 0.2% Triton X-100 (Sigma Aldrich, USA). Thereafter, they were cultured in 10% normal goat serum (Zymed Laboratories Inc., USA), LMNA [133A2] (monoclonal, Abcam, 1: 300), prelamin A (polyclonal, Santacruz, 1: 200), ZMPSTE 24 ( ^Dalton , ^Abcam , 1: 200), p16 ^Ink4A (Polyclonal, Abcam, 1: 200), stained with antibody to γH2AX (polyclonal, Abcam, 1: 200). Next, the cells were incubated with Alexa 488 or Alexa 594-labeled secondary antibody (1: 1000; Molecular Probes, USA) for 1 hour. Nuclei were stained with Hoechst 33258 (1 μg / ml; 10 min) and images were observed by confocal microscopy (Eclipse TE200, Nikon, Japan).

Experimental Example  10: chromatin immunoprecipitation ( ChIP ) analysis

hMSCs have a density of 1 × 10 ⁵ per plate Seeding on 10-cm plate was incubated for 3 days in the presence or absence of valproic acid. ChIP assay was performed according to the manufacturer's instructions (ChIP assay kit, Upstate Biotechnology, USA). Chromatin was immunoprecipitated using antibodies according to the manufacturer's instructions. Real time qPCR was performed at a final template dilution of 1:50. The sequence of the primers used in the ChIP test of the present invention is as follows.

Primers used in ChIP test gene direction Primer sequence SEQ ID NO: miR-141 primer-1 Forward CCTGGGTCCATCTTCCAGTA 16 Reverse AGGGGTGAAGGTCAGAGGTT 17 miR-141 primer-2 Forward ACAAGGGGTGGTTCTTGTTG 18 Reverse GTCGACTGTGGGTTCTGGAT 19

Experimental Example  11: Proliferative ability  And cell cycle distribution measurements

3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, USA) assay for the effects of replicative aging, progerin, ZMPSTE24 inhibition and miR-141 inhibition in proliferation of hMSCs It measured using.

Cells were plated in 24-well plates at a density of 2 × 10 ⁴ / ml and after 24 hours cells were infected with virus or transfected with siRNA or miRNA. At the end of the incubation, 50 μl of MTT stock solution (5 mg / ml) was added to further incubate the plate at 37 ° C. for 4 hours. Formazan crystal was dissolved in DMSO and absorbance was measured with an EL800 microplate reader (BIO-TEK Instruments, USA).

Flow cytometry cell cycle analysis was performed using propidium iodide staining. Briefly, hMSCs in exponential growth phase were transfected with siRNA or miRNA and harvested by trypsinization. The cells were washed with ice-cooled PBS, fixed with 70% ethanol at −20 ° C., and stained with 50 μg / ml of propidium iodide in the presence of 100 μg / ml RNase A for 30 minutes. Cell cycle distribution was analyzed using the FACS Calibur system (Becton Dickinson, Franklin Lakes, NJ, USA).

Experimental Example  12: Luciferase  analysis( Luciferase assay )

To demonstrate miRNA targets, the entire 3'UTR sequence of human ZMPSTE24 was PCR amplified and cloned into a T-vector (Promega, Madison, WI, USA, # A1360). 3'UTR was subcloned into pmirGLO Dual-Luciferase vector (Promega, # E1330) using restriction enzymes XhoI and SalI . 293FT cells were seeded 24 h prior to transfection in 24-well at 50% confluency. Control constructs and ZMPSTE24 3'UTR reporter constructs were co-transfected with miRNAs (Ambion) 50nM using Dharmafect according to the manufacturer's instructions. 24 hours after transfection, firefly and renilla luciferase activity was measured by a luminometer using the Dual-Glo Luciferase Assay System (Promega, E2920). Firefly chemiluminescence was normalized by Renilla chemiluminescence.

Example  1: aging humans Intermediate lobe  Stem Cells( hMSCs Check the features of

Disruption of lamin A maturation leads to the accumulation of prelamin A and leads to premature aging of organisms such as in congenital etiosis (HGPS, Hutchinson-Gilford progeria syndrome). To determine whether prelamin A accumulation correlates with normal aging of hMSCs as well as HGPS, traits were compared between replicative senescence and progerin-induced senescence in hMSCs.

After inducing replicative aging by repeated passage and aging by overexpression of progerin, SA-β-gal (senescence associated-β-galactosidase) staining and MTT assay were performed to confirm the aging status of hMSCs.

As a result, 20 passages of replicative senescent cells and progerin-expressing hMSCs were confirmed to be strongly stained by SA-β-gal staining, and cell proliferation was also reduced by MTT assay (FIG. 1A). And B).

On the other hand, as a further experiment to determine whether prelamin A accumulation is involved in normal aging of hMSCs, the expression level of prelamin A in replicative senescent cells was significantly increased. It confirmed (C of FIG. 1)

In addition, expression of p16 ^INK4A and γH2AX were further confirmed as aging markers, and the shape of the nucleus was confirmed. As a result, replication St. aging cells and common p16 ^INK4A progerin- derived from senescent cells An increase in expression (C in FIG. 1) and an increase in γH2AX expression (B in FIG. 2) were observed, and an abnormal nucleus in the corrugated form was observed (A in FIG. 2).

These results suggest that late passage of replicative senescent cells, ie aged human mesenchymal stem cells, induces accumulation of prelamin A similarly to progerin-induced senescent cells and has an abnormal nucleus shape.

Example  2: ZMPSTE24  Confirmation of Induction of Cellular Aging

In Example 1, as a result of confirming that prelamin A accumulated during aging of the cells, the possible mechanism of the accumulation of prelamin A was screened.

First, as a result of confirming the expression level of lamin A itself during aging of the cells, it was confirmed that there is no change in lamin A expression level of 5 passages, 10 passages, and 15 passages in mRNA and protein levels (FIGS. 3A and 3B). . In addition, it was confirmed by Western blot and immunocytochemistry how the expression level of ZMPSTE24, which converts prelamin A to mature lamin A, changes during cell aging. As a result, it was confirmed that the expression level of ZMPSTE24 tends to decrease as the passage is increased (C and D of FIG. 3).

In order to determine whether the disruption of ZMPSTE24 induces cellular senescence of hMSCs, the expression of ZMPSTE24 was inhibited by siRNA. Control siRNA and siZMPSTE24 were treated with hMSCs to confirm the evidence of various cell aging. As a result, the accumulation of prelamin A occurred remarkably in the group which suppressed the expression of ZMPSTE24 using siZMPSTE24 compared to the control group, and it was confirmed that an increase in p16 ^INK4A and γH2AX, which are aging markers, occurred (FIG. 4A). In addition, the ZMPSTE24-inhibited group showed activity in SA-β-gal staining (FIG. 4B), and the cell proliferation rate and individual replication level through MTT assay decreased (C and D in FIG. 4), An increase in γH2AX and abnormal wrinkled nuclei could be observed (FIG. 5). All these results indicate that when inhibiting the expression of ZMPSTE24, prelamin A accumulates and ultimately induces cellular aging.

Example  3: ZMPSTE24  Regulate expression miRNA -141 OK

3-1. ZMPSTE24 To Target miR -141 OK

To determine if miRNA was involved in the regulatory mechanism of ZMPSTE24 induced by HDAC (Hystone deacetylase), a miRNA targeting ZMPSTE24 was investigated using a combination of prediction algorithms. miRNA database was used miRanda, TargetScan, PicTar (Fig. 6A). As miRNAs targeting ZMPSTE24 mRNA predicted by two or more database programs, miR-124, miR-141, miR-182 and miR-200a were selected for further luciferase assay.

To quantitatively assess miRNA activity, a 3'UTR (untranslated region) of ZMPSTE24 mRNA was inserted into the double-luciferase miRNA target expression vector. Dual-luciferase reporter vectors were transfected with control miRNAs or hMSCs containing the miRNAs predicted above. Luciferase activity was measured 48 hours after transfection.

As a result, it was confirmed that the luciferase activity of the reporter including ZMPSTE24-3'UTR significantly decreased in the case of miRNA-141 compared to the control miRNA and other miRNAs (FIG. 7A), and miR-141 showed ZMPSTE24. It was confirmed that the 3'UTR of the mRNA can be directly bound (Fig. 6B). The association between the expression of miR-141 and ZMPSTE24 was also confirmed in two other hMSCs cell lines (FIG. 7B).

Additionally, further experiments with control miRNAs and miR-106b predicted not to target ZMPSTE24 with miR-141 resulted in downregulation of ZMPSTE24 expression in miR-141-transfected hMSCs compared to the rest of the group. As a result, accumulation of prelamin A was confirmed to increase expression (C and D of FIG. 6). In addition, treatment with miR-141 showed a significant increase in aging marker γH2AX (FIG. 8A).

In addition, miR-141 was treated in cord blood-derived mesenchymal stem cells (UCB-MSCs), bone marrow-derived mesenchymal stem cells (BM-MSCs) and adipose-derived mesenchymal stem cells (AD-MSCs). By confirming that many abnormal nuclei were observed, evidence of aging was confirmed (FIG. 9).

These results indicate that miR-141 acts as a miRNA targeting ZMPSTE24 mRNA, and accordingly, increased expression of miR-141 means that the expression of ZMPSTE24 may induce cell senescence.

3-2. miR With inhibitor of -141 ZMPSTE24  Increased expression

In the case of inhibiting miR-141 targeting ZMPSTE24 identified in Example 3-1, ZMPSTE24, by using miR-141 and its inhibitor anti-miR-141, in order to confirm whether cell aging can be inhibited Expression levels of prelamin A, p16 ^INK4A and γH2AX were confirmed by western blotting.

As a result, it was confirmed that the expression level of ZMPSTE24 is reduced by transfection of miR-141 and increased by transfection of anti-miR-141. On the other hand, in the case of prelamin A, p16 ^INK4A and γH2AX, the expression level is increased by the transfection of miR-141, it was confirmed that reduced by the transfection of anti-miR-141 (Fig. 8B). In addition, transfection of anti-miR-141 was increased in human and mouse skin fibroblasts as well as hMSCs (FIG. 7C).

In order to determine whether anti-miR-141 also affects cell proliferation, MTT assay and cell cycle analysis showed that the cell growth rate was significantly decreased when transfected with miR-141 and siZMPSTE24. When treated with miR-141, the cell growth rate was also increased compared to the control (C and D in Figure 8).

All these results indicate that miR-141 targeting ZMPSTE24 induces cellular senescence, and inhibiting miR-141 can inhibit cellular senescence.

3 -3. Confirmation of long-term overexpression of miR -141

To confirm the effect of long-term overexpression of miR-141, hMSCs were infected with miR-141 virus generated from precursor miR-141 expressing clones. The expression vector was designed to express GFP with miR-141, and the presence of miR-141 was measured by GFP fluorescence using the expression vector.

Virus-infected hMSCs showed potent expression of GFP with significantly increased miR-141 expression identified by real time qPCR (A and B in FIG. 10). In addition, MTT assay and cell cycle analysis confirmed that cell proliferation was inhibited after 5 days of overexpression of miR-141 (C and D of FIG. 10).

Next, to confirm the role of miR-141 in vivo, miR-141 virus was delivered into mice via intraperitoneal (i.p.) injections. Seven days after intraperitoneal injection, the tissues were removed and subjected to immunohistochemistry and western blotting. Among the extracted tissues, ZMPSTE24 expression was reduced in liver tissues and GFP positive cells were observed (E, F and FIG. 10 in FIG. 10).

In addition, it was confirmed whether the level of ZMPSTE24 expression can be changed during normal mouse aging by miR-141. As a result, no significant difference in ZMPSTE24 expression was observed between 6-week-old and 72-week-old C57BL / 6 mice in cardiac tissues, but ZMPSTE24 expression was down-regulated in hepatic tissues compared to 6-week-old mice, and miR- 141 was confirmed to be upregulated (FIG. 12).

Taken together, it can be seen that miR-141 is a direct target of ZMPSTE24 in vitro and in vivo, and thus involved in cellular aging. Thus, inhibition of miR-141 can inhibit cell senescence by increasing expression of ZMPSTE24.

Example  4: Replication  Aging cells miR -141 Expression Confirmation

In order to confirm miR-141 expression during replication aging, miR-141 expression level was confirmed by real-time qPCR for each passage. As a result, miR-141 expression level was significantly increased from the early passage to late passage (Fig. 13A). On the other hand, as a result of measuring the expression level of miR-106b through the same experiment, it was not possible to observe a consistent change according to the passage (Fig. 14A).

Accordingly, chromatin immunoprecipitation (ChIP) tests were used to confirm histone acetylation and methylation changes in the miR-141 promoter region to reveal epigenetic changes responsible for increasing miR-141 expression levels in replicative aging. . As a result, in late passage cells, acetylation of histone H4 and trimethylation of histone H3 lysine 4 residue (H3K4), which promote transcription factor binding to nucleosome DNA and participate in activated gene transcription, are encoded by miR-141. Up-regulation in the region. However, the trimethylation of histone H3 lysine 9 (H3K9) and lysine 27 (H3K27), which is characterized by the formation of inactivated regions of nucleosome DNA and gene silencing, has been markedly reduced (FIG. 13C). ).

In vivo synthesis of miRNA is precisely regulated by RNA polymerase II, which catalyzes transcription of genomic DNA to produce a number of miRNAs. Therefore, immunoprecipitation test was performed to confirm the amount of RNA polymerase II in the miRNA coding region. Real-time qPCR after immunoprecipitation test showed an increase in RNA polymerase II bound to miR-141 coding region in replicative senescent cells (18 passages) (FIG. 13D).

On the other hand, the same experiment for histone acetylation and methylation and RNA polymerase II measurement was also performed for miR-106b, but no significant experimental data were obtained (FIG. 14D).

These results indicate that by identifying histone modifications associated with transcription activated in the miR-141 coding region, expression of miR-141 is upregulated during replicative aging, and accordingly, replication of miR-141 is regulated. Imply that aging can be controlled.

Example  5: HDAC ( Histone deacetylase )of ZMPSTE24  Regulation of expression

During aging of cells of hMSCs, the activity of HDAC and DNA methyltransferase (DNMT) decreases (A in FIG. 15 and A in FIG. 16). These factors regulate epigenetic status of genomic DNA and regulate transcriptional activity.

In order to confirm whether these factors are related to the expression regulation of ZMPSTE24, valproic acid (VPA) and sodium butyrate (SB, NB) were treated as HDAC inhibitors and 5-azacytidine as DNMT inhibitors. HDAC and DNMT inhibition induced cellular senescence of hMSCs, showing an increase in p16 ^INK4A , a marker of SA-β-gal activity and cellular senescence (B, C in Figure 15 and B in Figure 16). However, unlike the inhibition of DNMT, only HDAC inhibition induced a decrease in ZMPSTE24 expression, indicating an increase in prelamin A (FIG. 15C, FIG. 16C). In addition, abnormal nuclei, characteristic of senescent cells in which prelamin A was accumulated, were also increased by HDAC inhibition (D and E in FIG. 15).

The main targets of HDAC inhibitors, such as VPA and SB, are HDAC1 and HDAC2, but since HDAC inhibitors can be broad and nonspecific, their siRNA is important to determine whether HDAC1 and HDAC2 are key factors regulating the expression of ZMPSTE24. Specifically inhibited HDAC1 and HDAC2. Since HDAC1 and HDAC2 have activity with each other and decrease simultaneously in aged hMSCs, experiments were performed by simultaneously inhibiting HDAC1 and HDAC2.

As a result, specific inhibition of HDAC1 and HDAC2 reduced the expression level of ZMPSTE24, accumulated prelamin A, increased p16 ^INK4A expression, and induced SA-β-gal activity (A and B in FIG. 17). In addition, the cell proliferation rate and individual replication level were decreased by MTT assay, and the number of abnormal nuclei showing specific characteristics of progerin-induced senescent cells was increased (FIGS. 17C to E).

These results indicate that HDAC regulates the expression level of ZMPSTE24, and in particular, inhibition of HDAC decreases the expression level of ZMPSTE24 and accumulates prelamin A to induce cell aging of hMSCs.

Example  6: HDAC of miR -141 adjustable

As confirmed in Example 5, inhibition of HDAC significantly downregulated the expression of ZMPSTE24. Accordingly, expression of miR-141 was measured during HDAC suppression-mediated aging to determine whether HDAC activity regulates transcription of miRNAs targeting ZMPSTE24.

Expression levels of miR-141 in cells treated with VPA and NB, inhibitors of HDAC, were about 25- or 5-fold compared to the untreated cell population after 6 days of treatment (FIGS. 18A and 18B). In addition, up-regulation of miR-141 was induced even when inhibited by siRNA specific to HDAC1 and HDAC2 (FIG. 18C).

Next, histone modification of the miR-141 coding region was confirmed using chromatin immunoprecipitation (ChIP) test. As a result, histone modifications in the group treated with HDAC inhibitors showed a pattern almost similar to histone modifications in replicative senescent cells. In the coding region of miR-141 in the group treated with VPA and NB, acetylation of histone H3 and histone H4 and trimethylation of histone H3 lysine 4 residue (H3K4) were upregulated, whereas histone H3 lysine 9 (H3K9) and Trimethylation of lysine 27 (H3K27) remained down regulated or unchanged (D in FIG. 18).

In addition, the miRNA gene is transcribed by RNA polymerase II, and the amount of RNA polymerase II was measured in the miR-141 coding region. As a result, it was confirmed that RNA polymerase II was increased in the vicinity of the miR-141 coding region in the group induced by aging by the HDAC inhibitor, and thus miR-141 was actively transcribed (E of FIG. 18).

These results indicate that miR-141 transcription is regulated during HDAC inhibition-mediated aging by histone modification and RNA polymerase II activity at the miR-141 promoter site. As a result, miR-141 induces cellular senescence. It can be seen that.

<110> SNU R & DB FOUNDATION <120> Method for Inhibiting Senescence of Cells Using Inhibition of          miRNA-141 <130> PA110737 / KR <160> 19 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> microRNA-141 <400> 1 gguagaaaug gucugucaca au 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forward primer <400> 2 agagctacga gctgcctgac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 3 agcactgtgt tggcgtacag 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> RPL13A forward primer <400> 4 catcgtggct aaacaggtac tg 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RPL13A reverse primer <400> 5 gcacgacctt gagggcagcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LMNA-1 forward primer <400> 6 cagaacacct ggggctgcgg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> 223 LMNA-1 reverse primer <400> 7 ctgcagtggg agccgtggtg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LMNA-2 forward primer <400> 8 accacgtgag tggtagccgc 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> 223 LMNA-2 reverse primer <400> 9 agatttttgg cacggggagg ctg 23 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LMNA-3 forward primer <400> 10 ccactgggga aggctcccac t 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LMNA-3 reverse primer <400> 11 gttcgggggc tggagttgcc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> p16Ink4A forward primer <400> 12 gaaggtccct cagacatccc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> P223Ink4A reverse primer <400> 13 ccctgtagga ccttcggtga 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> hsa-miR-141 primer <400> 14 taacactgtc tggtaaagat gg 22 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> hsa-miR-106b primer <400> 15 taaagtgctg acagtgcaga t 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-141 primer-1 forward primer <400> 16 cctgggtcca tcttccagta 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-141 primer-1 reverse primer <400> 17 aggggtgaag gtcagaggtt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-141 primer-2 forward primer <400> 18 acaaggggtg gttcttgttg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-141 primer-2 reverse primer <400> 19 gtcgactgtg ggttctggat 20

Claims (20)

Inhibiting the aging of cells, characterized in that to inhibit miRNA-141 in cell culture.
The method of claim 1, wherein the cell is an adult stem cell.
The method of claim 1, wherein the inhibition of miRNA-141 is characterized by using a miRNA-141 inhibitor selected from the group consisting of siRNA, aptamer, antisense oligonucleotide and ribozyme specific for miRNA-141. .
The method of claim 1, wherein the inhibition of miRNA-141 is achieved by inhibiting the binding of RNA polymerase II to the miRNA-141 coding region.
The method of claim 1, wherein the expression of ZMPSTE24 is increased by inhibiting the miRNA-141.
The method of claim 2, wherein the adult stem cells are selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta.
Cellular anti-aging composition comprising a miRNA-141 inhibitor as an active ingredient.
8. The composition of claim 7, wherein said cells are adult stem cells.
8. The composition of claim 7, wherein the miRNA-141 inhibitor is in siRNA, aptamer, antisense oligonucleotide or ribozyme form.
(a) measuring the level of miRNA-141 in cell culture; And
(b) providing information for diagnosing cell aging, comprising comparing the level of miRNA-141 before cell culture.
(a) measuring the level of miRNA-141 in cell culture;
(b) administering a cell aging inhibitor candidate; And
(c) confirming that the level of miRNA-141 in the cell culture is reduced compared to the step (a).
A method of proliferating cells, characterized in that by inhibiting miRNA-141 in cell culture.
13. The method of claim 12, wherein said cell is an adult stem cell.
The method of claim 12, wherein the inhibition of miRNA-141 uses a miRNA-141 inhibitor selected from the group consisting of siRNA, aptamers, antisense oligonucleotides and ribozymes specific for miRNA-141.
The method of claim 13, wherein the adult stem cells are selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerves, skin, amniotic membrane, and placenta.
Comprising a miRNA-141 inhibitor as an active ingredient, a composition for cell proliferation.
The composition of claim 16, wherein the cells are adult stem cells.
The composition of claim 16, wherein the miRNA-141 inhibitor is in siRNA, aptamer, antisense oligonucleotide or ribozyme form.
A composition for promoting cell aging or inhibiting cell proliferation comprising any one selected from the group consisting of miRNA-141, a gene encoding miRNA-141, and an inducer capable of inducing expression of miRNA-141.
(a) cells proliferated by the method of any one of claims 12-15; or
(b) miRNA-141 inhibitors and cells
Cell therapy containing a.

Images