KR20110080184A - Pharmaceutical compositions and functional food comprising extract of melia azedarach - Google Patents

Abstract

PURPOSE: A pharmaceutical composition and health food containing Melia toosendan Sied. et Zucc extract is provided to ensure antibacterial effect and to prevent and treat helicobacter infection. CONSTITUTION: A pharmaceutical composition for preventing and treating helicobacter infection contains 0.1-50 weight% of Melia toosendan Sied. et Zucc extract as an active ingredient. The Melia toosendan Sied. et Zucc extract is isolated using water, low alcohol of C1-C4, and mixture solvent. A health food for preventing and treating helicobacter infection contains Melia toosendan Sied. et Zucc extract as an active ingredient. The health food is manufactured in the form of powder, granule, tablet, capsule, or beverage.

Description

Pharmaceutical compositions and functional food comprising Extract of Melia azedarach}

The present invention relates to pharmaceutical compositions and health functional foods containing the extracts of St. Panax terrifolia having antibacterial activity against Helicobacter bacteria.

The presence of microorganisms in the gastric mucosa has been reported by several researchers to detect similar bacteria in the gastric mucosa of humans and animals since Bizzozero's observation of the gastric mucosa in dogs in 1893. Thought not to have a pathological significance (Hahm et. al ., Korean J. Gastroenterol., 37 , pp. 399-405, 2001). However, Helicobacter pylori , H. pylori ) were first isolated by Marshall and Warren in 1984 in a gastric mucosal biopsy tissue of chronic gastritis patients with spiral curved gram-negative bacillus, and subsequently to gastritis, gastric ulcer, duodenal ulcer and gastric cancer. It is known to be a major causative agent of digestive diseases (Marshall et. al ., Lancet, 1 , pp. 131-1315, 1984; Ho et al ., J. Clin. Microbiol., 29 , pp. 2543-2549, 1991). The genus Helicobacter is currently reported in 24 species and is a major factor in gastritis and gastric ulcers in humans and animals (Kim et al. al ., Kor. J. Lab. Anim. Sci., 20 , pp. 316-320, 2004). In addition, new Helicobacter species are being reported. Animal species such as pigs and cattle, as well as animals such as dogs and cats, are distributed in various Helicobacter species, and these species are reported to cause gastrointestinal lesions similar to those in humans. Helicobacter species are also excreted in their excreta, and the possibility of contamination of food and water by them has been reported (Velazquez et. al ., Int. J. Microbiol., 53 , pp. 95-104, 1999). Helicobacter heilmann II is a species found in animals such as dogs and cats, but has been found in patients with gastritis and gastric ulcers in humans (Priestnall et. al ., J. Clin. Microbiol., 42 , pp.2144-2151, 2004), which is known to cause gastritis and gastric ulcer lesions, and the opinion that it should be regarded as a common infectious disease has been raised.

Helicobacter Helicobacter pylori , H. pylori ) were first isolated by Marshall and Warren in 1984 from spiral gastrointestinal biopsy tissue of chronic gastritis patients into spiral curved gram-negative bacillus, and subsequently to gastritis, gastric ulcer, duodenal ulcer and gastric cancer. It has been found to be a major causative agent of digestive diseases (Ho et. al ., J. Clin. Microbiol., 29 , pp. 2543-2549, 1991). The World Health Organization (WHO) recently classified Helicobacter pylori as a definite carcinogen (class I carcinogen). Helicobacter confirmed that adenocarcinoma was caused by gastric cancer as a result of long-term infection of Helicobacter pylori in sand rats (Mongolian gerbil). It has been proven that pylori causes gastric cancer (Watanabe et al ., Gastroenterology., 115 , pp. 642-648, 1998). The annual incidence of gastric cancer in Koreans is reported as 57.9 males and 25.1 females per 100,000, which is very high compared to gastric cancer incidence in other countries. Gastric cancer has been reported as one of the major causes of mortality in Korean adults due to its severe clinical outcome (Ahn et al. al ., J. Kor. Med. Sci., 6 , pp. 7-14, 1991).

The prevalence of Helicobacter pylori has been reported to be 80% at 8 years old and 90% at 20 years of age in Koreans (Jung et al. al ., J. Korean Soc. Microbiol. 35 , pp. 97-108, 2000). These data indicate that most Koreans are infected with Helicobacter pylori and have been infected with Helicobacter pylori for an average of over 40-45 years. The high incidence of gastric cancer in Korea is a consequence of the high prevalence of Helicobacter pylori.

 Although Helicobacter pylori causes serious consequences and enormous economic losses that cause gastric ulcers and gastric cancer, there are currently no methods for effectively preventing Helicobacter pylori at home and abroad. Currently, the developed measures for Helicobacter pylori are the forms of treatment after the diagnosis of Helicobacter pylori infection. The treatment used at this time mainly uses antibiotic metrodinazol, which causes resistance and antibiotic side effects. Development of therapeutic compositions is needed.

The Millennium is Melia azedarach L. var. japonica Mature fruit of Makino (Meliaceae) is a dry, large, full, golden bark and pulp yellowish white. Appearance is spherical ~ oval, 10 ~ 15mm in diameter, outer surface is yellowish brown, glossy and wrinkled. The cut side is pale yellow, divided into 4 ~ 5 threads and contains 1 seed. Major ingredients include limonoid toosendanin and alkaloid azaridine, and other ingredients include resin, tannin and benzoic acid. Main pharmacological action is used for the purpose of antiparasitic action and antimicrobial action. (Medicinal Herbal Medicine Reorganization Committee, Herbal Medicine, pp. 418-419, Dongmyeongsa, 2006).

In this regard, the present inventors have developed a natural product that exhibits an excellent antimicrobial effect against Helicobacter bacteria and in vitro ( in In vitro ) and in vivo ( in vIVo ) experiments to confirm the antimicrobial effect on Helicobacter bacteria to complete the present invention.

The presence of microorganisms in the gastric mucosa has been reported by several researchers to detect similar bacteria in the gastric mucosa of humans and animals since Bizzozero's observation of the gastric mucosa in dogs in 1893. Thought not to have a pathological significance (Hahm et. al ., Korean J. Gastroenterol., 37 , pp. 399-405, 2001). However, Helicobacter pylori , H. pylori ) were first isolated by Marshall and Warren in 1984 in a gastric mucosal biopsy tissue of chronic gastritis patients with spiral curved gram-negative bacillus, and subsequently to gastritis, gastric ulcer, duodenal ulcer and gastric cancer. It is known to be a major causative agent of digestive diseases (Marshall et. al ., Lancet, 1 , pp. 131-1315, 1984; Ho et al ., J. Clin. Microbiol., 29 , pp. 2543-2549, 1991). The genus Helicobacter is currently reported in 24 species and is a major factor in gastritis and gastric ulcers in humans and animals (Kim et al. al ., Kor. J. Lab. Anim. Sci., 20 , pp. 316-320, 2004). In addition, new Helicobacter species are being reported. Animal species such as pigs and cattle, as well as animals such as dogs and cats, are distributed in various Helicobacter species, and these species are reported to cause gastrointestinal lesions similar to those in humans. Helicobacter species are also excreted in their excreta, and the possibility of contamination of food and water by them has been reported (Velazquez et. al ., Int. J. Microbiol., 53 , pp. 95-104, 1999). Helicobacter heilmann II is a species found in animals such as dogs and cats, but has been found in patients with gastritis and gastric ulcers in humans (Priestnall et. al ., J. Clin. Microbiol., 42 , pp.2144-2151, 2004), which is known to cause gastritis and gastric ulcer lesions, and the opinion that it should be regarded as a common infectious disease has been raised.

Helicobacter Helicobacter pylori , H. pylori ) were first isolated by Marshall and Warren in 1984 from spiral gastrointestinal biopsy tissue of chronic gastritis patients into spiral curved gram-negative bacillus, and subsequently to gastritis, gastric ulcer, duodenal ulcer and gastric cancer. It has been found to be a major causative agent of digestive diseases (Ho et. al ., J. Clin. Microbiol., 29 , pp. 2543-2549, 1991). The World Health Organization (WHO) recently classified Helicobacter pylori as a definite carcinogen (class I carcinogen). Helicobacter confirmed that adenocarcinoma was caused by gastric cancer as a result of long-term infection of Helicobacter pylori in sand rats (Mongolian gerbil). It has been proven that pylori causes gastric cancer (Watanabe et al ., Gastroenterology., 115 , pp. 642-648, 1998). The annual incidence of gastric cancer in Koreans is reported as 57.9 males and 25.1 females per 100,000, which is very high compared to gastric cancer incidence in other countries. Gastric cancer has been reported as one of the major causes of mortality in Korean adults due to its severe clinical outcome (Ahn et al. al ., J. Kor. Med. Sci., 6 , pp. 7-14, 1991).

The prevalence of Helicobacter pylori has been reported to be 80% at 8 years old and 90% at 20 years of age in Koreans (Jung et al. al ., J. Korean Soc. Microbiol. 35 , pp. 97-108, 2000). These data indicate that most Koreans are infected with Helicobacter pylori and have been infected with Helicobacter pylori for an average of over 40-45 years. The high incidence of gastric cancer in Korea is a consequence of the high prevalence of Helicobacter pylori.

 Although Helicobacter pylori causes serious consequences and enormous economic losses that cause gastric ulcers and gastric cancer, there are currently no methods for effectively preventing Helicobacter pylori at home and abroad. Currently, the developed measures for Helicobacter pylori are the forms of treatment after the diagnosis of Helicobacter pylori infection. The treatment used at this time mainly uses antibiotic metrodinazol, which causes resistance and antibiotic side effects. Development of therapeutic compositions is needed.

The Millennium is Melia azedarach L. var. japonica Mature fruit of Makino (Meliaceae) is a dry, large, full, golden bark and pulp yellowish white. Appearance is spherical ~ oval, 10 ~ 15mm in diameter, outer surface is yellowish brown, glossy and wrinkled. The cut side is pale yellow, divided into 4 ~ 5 threads and contains 1 seed. Major ingredients include limonoid toosendanin and alkaloid azaridine, and other ingredients include resin, tannin and benzoic acid. Main pharmacological action is used for the purpose of antiparasitic action and antimicrobial action. (Medicinal Herbal Medicine Reorganization Committee, Herbal Medicine, pp. 418-419, Dongmyeongsa, 2006).

In this regard, the present inventors have developed a natural product that exhibits an excellent antimicrobial effect against Helicobacter bacteria and in vitro ( in In vitro ) and in vivo ( in vIVo ) experiments to confirm the antimicrobial effect on Helicobacter bacteria to complete the present invention.

The present invention for achieving the above object, provides a pharmaceutical composition for the prevention and treatment of Helicobacter bacterial infections containing as an active ingredient.

It is preferable to contain 0.1 to 50% by weight of the puncture extract.

In another aspect, the present invention provides a health functional food for the prevention and improvement of Helicobacter bacterial infections containing the extract as a active ingredient.

The health functional food may be selected from powder, granule, tablet, capsule or beverage form.

The puncture extract is preferably an extract available in water, lower alcohols of C1 to C4 and mixed solvents thereof.

In particular, it is preferable to use the prepared by extracting the pulverized cheonnyeon extracted from 20 to 150 ℃ with a dry weight of 1 to 20 times the water, C ₁ to C ₄ lower alcohol and a mixed solvent thereof. .

The Helicobacter bacteria is a bacterium selected from Helicobacter species, Helicobacter pylori ), Helicobacter heilmann II, Helicobacter Felis ( Helicobacter felis ), Helicobacter mustelae ), Helicobacter fenelliae ), Helicobacter rappini), H. pylori party Syracuse (Helicobacter hepaticus), H. Billy's (Helicobacter bilis ) and Helicobacter pullorum ) .

The Helicobacter bacterial infection is characterized in that occurs in mammals, such as pigs, cattle, goats, including humans.

Hereinafter, the pharmaceutical composition for the prevention and treatment of Helicobacter bacterial infection and health functional food for the prevention and improvement of Helicobacter bacterial infection will be described in detail as follows.

Chunjaja extract used in the pharmaceutical composition and health functional food of the present invention can be obtained as follows.

Firstly dry the millennium and then grind. The pulverized cheonnyeonja can be extracted with water, C1 ~ C3 lower alcohol or a mixed solvent thereof to obtain the cheonnyun extract.

1 to 20 times the dry weight of the milled pulverulent, preferably 2 to 6 times the water, C1 to C4 lower alcohol or a mixed solvent thereof at 20 to 150 ° C, preferably 70 to 120 ° C for 1 hour. It is good to extract for 10 to 10 days, preferably for 2 to 5 hours.

The extraction method may be any of extraction methods such as cold sediment extraction, hot water extraction, ultrasonic extraction, reflux cooling extraction, but is preferably concentrated under reduced pressure after extraction using a reflux cooling extraction method.

In the pharmaceutical composition of the present invention, the puncture extract may vary according to the condition of the patient, the type of disease, and the degree of progression, but it is preferable to include the puncture extract in an amount of 0.1 to 50% by weight based on the total weight of the composition. The cheonngija extract itself has little toxicity and side effects, so can be used with confidence even for prolonged administration for prophylactic purposes.

The pharmaceutical composition of the present invention may be provided in various forms. For example, they may be provided in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral formulations, external preparations, suppositories, and sterile injectable solutions.

In addition, the pharmaceutical composition of the present invention may further include appropriate carriers, excipients and diluents commonly used in the preparation of general compositions. The carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and the solid preparations may include at least one excipient such as starch, calcium carbonate, sucrose in the extract. ) Or lactose, gelatin and the like are mixed.

In addition to simple excipients, lubricants such as magnesium styrate talc are also used.

Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, simple diluents commonly used, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The preferred dosage of the pharmaceutical composition of the present invention depends on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, and may be appropriately selected by those skilled in the art. However, for the desired effect, the pharmaceutical composition of the present invention is preferably administered at a dry weight of 0.5 g / kg to 5 g / kg, preferably 1 g / kg to 3 g / kg per day. The administration may be carried out once a day or divided into several doses. Thus, the dosage amounts are not intended to limit the scope of the invention in any manner.

The composition of the present invention can be administered to mammals such as rats, mice, livestock, humans, etc. by various routes. All modes of administration can be expected, for example by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

In addition, the present invention provides a health functional food for the prevention and improvement of gastritis, gastric ulcers and gastric cancer caused by Helicobacter bacterial infections containing as an active ingredient the cheonnyeonja extract obtained by the above production method.

The health functional food of the present invention can be used in a variety of foods and beverages for the prevention and improvement of gastritis, gastric ulcer and gastric cancer caused by Helicobacter bacterial infection.

Specifically, there are various foods, beverages, gums, teas, vitamin complexes, health supplements, and the like, and may be used in the form of powders, granules, tablets, capsules, or beverages.

And cheonnyeonja extract contained in the health functional food of the present invention may be contained in 1 to 5% by weight of the total food weight.

When the health functional food of the present invention is provided as a beverage, it may be added at a ratio of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml. The beverage may contain various flavors, natural carbohydrates, etc. as additional ingredients, as in the conventional beverage. Examples of the natural carbohydrates include disaccharides such as monosaccharides, glucose and fructose, polysaccharides such as maltose and sucrose, conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. . As the flavoring agent, natural flavoring agents (tautin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The ratio of 1 to 20 g, preferably 5 to 12 g per 100 ml of the beverage of the health functional food of the present invention is preferably contained.

In addition, the beverage of the health functional food of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic and natural flavors, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, Alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. Others may contain pulp for the production of natural fruit juices and vegetable drinks. These components can be used independently or in combination.

The pharmaceutical composition containing the cheonnyeonja extract of the present invention has an excellent antimicrobial effect against Helicobacter bacteria has an effect that can be widely used for the prevention and treatment of Helicobacter bacterial infection.

In addition, the health functional food containing the cheonnyeonja extract of the present invention has a great effect in the prevention and improvement of gastritis, gastric ulcer and gastric cancer caused by Helicobacter bacterial infection.

1 is in vitro ( in In vitro ) antimicrobial efficacy test showing the antimicrobial activity against Helicobacter bacteria.
2 is a diagram showing the configuration and schedule of experimental treatment in vivo ( in vIVo ).
3 is a diagram showing the visual score of the gastric lesion,
Figure 4 is a diagram showing the pathological score of the gastric lesions.
5 is a diagram showing a Helicobacter infection confirmation PCR result,
6 is a diagram showing the results of Helicobacter infection confirmed rapid urease test.

Hereinafter, a pharmaceutical composition for preventing and treating a helicobacter bacterial infection of the present invention will be described in detail with reference to the following examples, and the scope of the present invention is not limited to the following examples.

[ Example  1] Preparation of Chunja Extract

The dried drill was purchased from the University of Iksan Pharmacy using a grinder (Daesung Artron, DA700) to grind the particle size to 30 mesh (mesh, pore size 00㎛) or less to obtain a powder. An aqueous 70% ethyl alcohol solution containing distilled water corresponding to three times (v / w) of the dry weight (1 kg) of the Stirrup powder was added and reflux-cooled at 100 ° C. for 3 hours. The extracted extract was filtered and concentrated under reduced pressure, and then lyophilized to obtain 600 g of a powder-like puncture extract. The obtained Stirrup extract was used as a sample of the following experiment, hereinafter referred to as "CC-1".

Antimicrobial effect against Helicobacter bacteria, body weight change, gastric lesion gross score, gastric lesion pathological score, Helicobacter pathogen test, and toxicity evaluation were performed on the obtained Stylus extract.

[Preparation of experimental animals and Helicobacter bacteria]

Experiments on the extract of the present invention according to the present invention (Ishizone et al. al ., Int J Med Sci. 4 , pp.203-208, 2007).

Since experiments gerbil (Mongolian gerbil) model used in the two Helicobacter bacteria Helicobacter pylori infection in men is caused because test system to reproduce most closely the pathology aspects of human living body to investigate the antibacterial effect of H. pylori bacteria (in vIVo ) is the best model for experiments.

Sand mouse (Mongolian gerbil, Meriones maintained in line at Animal Resource Development Research Center, Wonkwang University) unguiculatus ) was supplied at 6 weeks of age and used for experiments after acclimation in the experimental animal breeding room of the Wonkwang University Animal Resource Development Research Center for 1 week. During the breeding period, the temperature was 23 ± 1 ℃, humidity 50 ± 5%, noise less than 60 phone, lighting time 08: 00 ~ 20: 00 (12 hours a day), and 10 ~ 12 times per ventilation time. Animal feed (Sampaco) was freely fed, and the negative water was freely supplied with sterile water. All experimental procedures and procedures related to experimental animals used in this study were conducted in compliance with the regulations of the Institutional Animal Care & Use Committee (IACUC).

Helicobacter pylori (ATCC 43504, American Tissue Culture Collection, Rockville, MD) strains were inoculated in Brussela agar medium containing 10% calf serum, and then incubated in a 37 ° C thermostat for 10% CO ₂ and 100% humidity. . The cultured Helicobacter pylori was collected in a tube containing sterile PBS (pH 7.2), and then prepared to include 2.0 × 10 ⁹ colony-forming unit (CFU) bacteria per ml and used in the experiment.

Forty weeks of healthy 7 week old male sand rats were used for the experiment. Using 10 animals in each group, as shown in Table 1 below, the group applied with the extract of Helicobacter pylori after group infection (Group I), the group without the treatment of Helicobacter pylori after group infection with Helicobacter pylori (Group II) and Helicobacter pylori infection The experiment was performed by dividing into four groups without the 1000 extract group (Group III), without the Helicobacter pylori infection group (IV group). After 12-hour fasting of the 7-week-old sand rats used in the experiments, animals of group I and group II were helicobacter pylori of 2.0 × 10 ⁹ colony-forming unit (CFU) per ml. Helicobacter pylori was administered by orally (po) the culture solution prepared to contain the bacterial counts using a mouse horn for 0.5 ml per head. It caused an infection. Animals of group III and IV were orally administered 0.5 ml of sterile PBS pH 7.2 after 12 hours of fasting. After dosing, animals in each group received feed after 12 hours of fasting. During fasting negative numbers were allowed to feed freely. Helicobacter pylori Alternatively, animals in group I and group III administered with PBS were orally administered with oral administration at 500 mg / kg based on body weight for 4 weeks, that is, 13 weeks of age, from 9 weeks of age, which was 2 weeks later, from 9 weeks of age. . During this period, animals in groups II and IV were freely fed feed and negative water without any treatment (see FIG. 2). Animals of each test group from 9 to 13 weeks of age weighed once a week, fasted each subject for 12 hours at 13 weeks of age, and euthanized them under ether anesthesia. Infection was confirmed by PCR, rapid urease analysis, and histopathologic examination to evaluate the effect of puncture extract on H. pylori infection.

Group composition of sand rats Group Treatment n Helicobacter pylori Puncture extract term I Test   (○) (○) 6 weeks 10 Ⅱ Posit IVe control   (○) (×) 6 weeks 10 Ⅲ Vehicle control   (×) (○) 6 weeks 10 Ⅳ NegatⅣe control   (×) (×) 6 weeks 10

Statistical significance of each test group was obtained using 95% confidence interval (CI) using MINITAB software (Minitab Inc, USA). The confidence intervals of each group were statistically significant if they differed from group II of the positive control group of Helicobacter infection (p <0.05).

[ Experimental Example  1] antibacterial effect

Observation of the formation of peripheral clear zones of each of the disks applied to the Helicobacter bacterial culture plate by the puncture extract obtained from Example 1 was carried out, and the diameters of the formed clear zones were measured in the existing literature (Narayan et. al ., Phytother Res. 21 , pp. 190-193, 2007) was performed as follows.

Helicobacter pylori (ATCC 43504, American Tissue Culture Collection, Rockville, MD) strains were stained on Brussela agar medium plates with 10% calf serum and antibiotic disc gentamicin (Bay Veterinary Medicine, Korea), Ghana Mycin (Bay Veterinary Medicine, Korea) and Enrofloxacin (Bay Veterinary Medicine, Korea) were applied as 0.5 mg, 0.25 mg, and 0.25 mg, respectively. In addition, 30 mg of the puncture extract obtained in Example 1 was dissolved in 100 ul of DMSO, and 10 ⁰ (stock solution) (applied capacity 1.5 mg), 10 ^-1 (0.15 mg), and a solvent control were mixed in 5 μl of disk filter paper at a concentration of 300 mg / ml. Dimethyl sulfoxide (DMSO) for each was applied. In this experiment, sterilized discs (0.7 mm in diameter) were placed in a medium inoculated with bacteria, and then incubated in a thermostat maintained at 10% CO ₂ and 100% humidity and evaluated 4 days later. After 6, 12, 24, 48 and 60 hours after inoculation, the zone of inhibition, expressed as the diameter of the clear zone, was measured using standard standards. The clear zone was observed. Five disks were examined for each strain to analyze the mean value of the inhibition range. Evaluation of the results was observed for the formation of peripheral clear zones of each of the antibiotic disks and the diameters of the formed clear zones were measured to determine that the larger the diameter, the higher the antimicrobial effect.

Experimental results, as shown in Table 2 and Figure 1, with the Helicobacter strain, as a result of observation of the antimicrobial susceptibility of the puncture, the puncture extract is a higher level of inhibition than gentamicin, kanamycin and enrofloxacin well known as representative antibiotics Showed range.

Diameter of clear zone Applicable Material Clear zone diameter (mm) 6 h 12 h 24 h 48 h 60 h DMSO 0.7 0.7 0.7 0.7 0.7 Gentamicin 1.95 19.5 2.0 2.0 2.1 Kanamycin 2.35 22.5 1.7 2.2 2.6 Enrofloxacin 2.0 2.0 1.2 2.2 2.0 Puncture extract 100 (stock) 0.7 0.7 1.2 1.2 0.7 10-1 (10 times) 0.7 0.7 0.8 1.0 0.7

[ Experimental Example  2] Weight Change in Helicobacter Bacterial Infection Animals

After administering the cheonnyeonja extract obtained in Example 1 to the Helicobacter bacterial infection and non-infected animals, the weight change was confirmed to obtain the results shown in Table 3.

Weight change measurement result Group
Treatment Weight (g) Helicobacter pylori (1000)
extract) 9 weeks 10 weeks 11 weeks 12 weeks 13 weeks I   (○) (○) 130.6
± 3.15 135.2
± 2.23 140.6 *
± 2.45 143.4 *
± 3.25 145.4 *
± 2.95 Ⅱ   (○) (×) 132.2
± 4.4 133.8
± 3.1 134.0
± 2.55 136.8
± 2.79 137.9
± 1.55 Ⅲ   (×)  (○) 133.0
± 4.16 136.0
± 4.47 140.4 *
± 3.45 145.4 *
± 2.78 148.4 *
± 2.79 Ⅳ   (×) (×) 134.4
± 3.28 136.4
± 3.28 141.0 *
± 3.24 147.4 *
± 2.30 149.6 *
± 2.07 * p <0.05 (compare with group II)

[ Experimental Example  3] Changes in the Gross Score of Gastric Lesions by Extracts

After administering the cheonnyeonja extract obtained in Example 1 to the Helicobacter bacterial infection and non-infected animals, the experiment was carried out as follows to determine the gastroscopic lesion score.

The test animals were extracted from the stomach at the end of the experiment for each test group, and then dissected and unfolded along the Taiwan section, the lesions were observed using a stereomicroscope (× 10), and the scores of the visual lesions were calculated. The score of the gross lesion was calculated as the sum of the width x length (mm ² ) of the gastric ulcer lesion. After the score of each individual, the average score was calculated for each group.

Experimental results, as shown in Figure 3, Helicobacter pylori Helicobacter pylori, Group III application without group infection Gastric ulcer lesions were not observed in the group treated with Tianja extract without treatment (Group IV), resulting in a gross score of zero. On the other hand, Helicobacter pylori Helicobacter pylori showed a visual score of 74 ± 26.7 in the untreated application group (Group II) after infection. After infection, the change was more significant than that of 14 ± 4.1 in the group applied with the extract of group A (P <0.05).

[ Experimental Example  4] by the extract Gastric lesions  Histopathological Score Changes

The medicinal herb extract obtained in Example 1 was administered to Helicobacter bacterial infection and non-infected animals, and the following experiments were performed to check the gastric pathological lesion score.

In Experimental Example 3, gross lesion observation and lesion scores were obtained from animals of each group, and the tissue was fixed to 10% neutral formalin. For gastric histology, the glandular stomach was cut at intervals of 5 mm in the transverse direction, and the three sites were examined and the lesions were graded. The above selected sites were carefully selected to be the same site among different individuals. Tissues of the selected sites were embedded in paraffin using a conventional method for histopathological examination, and then sliced into 4 μm thickness and subjected to pathological examination after H & E staining. The evaluation of the lesions of each tissue was performed, and their degree was recorded by dividing the score into four stages {0 (no lesion), 1 (mild), 2 (moderate), and 3 (severe)}. After the sum of the scores, the mean scores of each group for the pathological findings above were obtained.

Experimental results, as shown in Figure 4, Helicobacter pylori Helicobacter pylori, Group III application without group infection Histopathologic lesions were not observed in the group without IV infection (Group IV), resulting in a gross score of zero. On the other hand, Helicobacter pylori Helicobacter pylori showed a macroscopic score of 6.2 ± 0.84 after the infection After infection, there was a significant change of 1.2 ± 0.84 in the group applied with St. Panax extract (Group I) (p <0.05).

[ Experimental Example  5] PCR Helicobacter pathogen screening by

After administering to the Helicobacter bacterial infection and non-infected animals, the 1000 barn extract obtained in Example 1 was tested as follows to confirm the elimination effect by the treatment of Helicobacter bacteria.

At the end of the experiment, a portion of the gastric mucosa of the stomach was aseptically extracted, DNA was extracted, and PCR was performed to confirm maintenance of Helicobacter pylori infection. DNA extraction was performed using a bead beater-phenol extraction method. Samples were sterilely collected and crushed in a 2 ml tube dedicated to Mini-Bead Beater (Biospec product) containing 1 ml sterile distilled water, and then 200 µl of glass bead (0.1 mm size, Biospec product) suspended in sterile tertiary distilled water and phenol- 200 μl of chlorform-isoamyl alcohol solution (50: 49: 1 (v / v / v)) was added and shaken with Mini-Bead Beater (Biospec product) at 5,000 rpm for 30 seconds. After shaking, the mixture was centrifuged at 12,000 rpm for 15 minutes at 4 ° C, and then the supernatant was transferred to a sterile 2 ml tube. 10 μl of 3 M sodium acetate and 250 μl of ice-cold ethanol were added to the mixture, and the mixture was suspended for 10 minutes at −20 ° C., followed by centrifugation at 15,000 rpm for 15 minutes. The precipitate was washed with 70% alcohol, dried at room temperature and dissolved in 60 μl of Tris EDTA (pH 8.0) and used for the experiment. Genus Helicobacter PCR was performed using primer pairs capable of amplifying rpoB DNA segments of Helicobacter . PCR using Taq DNA polymerase 1U, each dNTP 250 μM, 50 mM Tris-HCl (pH 8.3), 40 mM KCl, 1.5 using forward primer (HF; 5 'ACTTTAACGCATGAAGATAT 3') and reverse primer (HR; 5 'ATATTTTGACCTTCTGGGGT 3') AccuPower PCR Premix (Bioneer) containing mM MgCl ₂ was used. 50ng of the extracted DNA as a template, 20 pmol of each primer were put in AccuPower PCR Premix tube, and the final volume was adjusted to 20µl with sterile distilled water, followed by 30 cycle PCR of 94 ° C 30 seconds, 52 ° C 30 seconds, 72 ° C 45 seconds. Thereafter, the presence or absence of a specific band of 458 bp in the 1.2% agarose gel was confirmed.

Experimental results, Table 4 and FIG. 5 [M = 100 bp marker; P = DNA from H. pylori ATCC 43504; N = negatIVe control (Group IV); 1 ~ 2 = gerbil treated with Obaeja with H. pylori (Group I); 3 ~ 6 = gerbil infected with H. pylori without Obaeja (Group II)], Helicobacter pylori Helicobacter Pylori and Group III extracts without infection Helicobacter bacterial DNA was not detected by PCR in the case of the treatment group without the infection (Group IV). On the other hand, Helicobacter pylori Helicobacter bacterial DNA was detected in all ten subjects in the treatment group (Group II). Helicobacter bacterial DNA was detected in one individual after infection, but the negative results were detected in all 9 cases, showing a significant change from the Helicobacter infection positive control group II (p <0.05). .

Helicobacter pathogen test result by PCR
Group Treatment
n
Posit IVe No.
Posit IVe% Helicobacter
Pylori (Tianlian Extract) I   (○) (○) 10 One 10 Ⅱ   (○) (×) 10 10 100 Ⅲ   (×)  (○) 10 0 0 Ⅳ   (×) (×) 10 0 0

[ Experimental Example  6] Helicobacter bacterial pathogen test by rapid urease test

The medicinal herb extract obtained in Example 1 was administered to Helicobacter bacterial infection and non-infected animals and tested as follows to confirm the elimination effect by the treatment of Helicobacter bacteria.

At the end of the experiment, a portion of the gastric pyloric mucosa of the subjects was aseptically collected and a rapid urease test was performed. Rapid urease test was determined to be positive when the yellow medium turns red by culturing at room temperature according to the manufacturer's instructions using the CLO test kit (Asan Pharmaceutical Co., Korea). The result of the CLO test, a rapid urease digestion test, is a method of easily identifying whether the infection is caused by the color change induced by urease digestion and the reaction of the urea in the provided medium.

Experimental results, as shown in Table 5 and Figure 6 (A: Group I, B: Group II), Helicobacter pylori Helicobacter pylori, Group III application without group infection In the case of treatment group without IV infection (Group IV), hepatobacter bacteria showed negative results by rapid urease test. On the other hand, Helicobacter pylori Infection-free treatment group (Group II) of Helicobacter bacteria was detected in all 10 subjects after infection. Helicobacter pylori After infection, the group applied with 1000 extracts (group I) showed negative results in all 10 groups, which was significantly different from group II of the positive control group of Helicobacter infection (p <0.05).

Helicobacter bacterial pathogen test result by rapid urease test
Group Treatment
n
Posit IVe No.
Posit IVe% Helicobacter pylori (1000)
extract) I (○) (○) 10 0 0 Ⅱ (○) (×) 10 10 100 Ⅲ (×) (○) 10 0 0 Ⅳ (×) (×) 10 0 0

[ Experimental Example  7] by test substance Toxicity  evaluation

In order to determine whether there is a cell damage suspected of toxic expression due to ingestion of the puncture extract of Example 1 for a long time, the following experiment was performed.

The experiment was performed using 9 week old male sand rats, and the test substance was orally administered at 500 mg / kg daily for 28 days. After the end of the experiment, an autopsy was performed under ether anesthesia, and gross lesions of each organ were observed, followed by cerebrum, cerebellum, cerebrum, pons, testis, heart, and liver. ), Lung, Kidney, Muscle, Muscle, Spleen, Prostate, Pancreas, Thymus, Adrenal gland, Small Intestine, Large Intestine, Bone marrow, Thyroid gland and seminal vesicle were extracted and fixed in 10% neutral buffered formalin. After paraffin embedding using a conventional method for the preparation, the cells were sectioned to a thickness of 4 μm and subjected to histopathological examination after H & E staining.

As a result, as shown in Table 6, it was confirmed that no cell damage was observed in the parenchyma.

Test result of toxicity by test substance Group Experimental group n Gross lesion Pathological lesion I Puncture extract
Administration group 10 0 0 Ⅱ Control group 10 0 0

Hereinafter, an example of the preparation of the composition including the puncture extract of the present invention will be described, but the present invention is not intended to limit the present invention but is only intended to be described in detail.

[ Formulation example  One] Powder  Produce

Angelica Extract (CC-1) 20 mg

Lactose 100 mg

Talc 10 mg

The above ingredients are mixed and filled in an airtight cloth to prepare a powder.

[ Formulation example  2] Preparation of Tablet

Millennium Extract (CC-1) 10 mg

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

After mixing the above components, tablets are prepared by tableting according to a conventional method for preparing tablets.

[ Formulation example  3] Production of capsule

Millennium Extract (CC-1) 10 mg

3 mg of crystalline cellulose

Lactose 14.8 mg

Magnesium Stearate 0.2 mg

The above components are mixed according to a conventional capsule preparation method and filled in gelatin capsules to prepare capsules.

[ Formulation example  4] Preparation of Injection

Millennium Extract (CC-1) 10 mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Na2HPO4,12H2O 26 mg

(2 ml) per 1 ampoule according to the usual injection preparation method.

[ Formulation example  5] Liquid  Produce

Angelica Extract (CC-1) 20 mg

10 g of isomerized sugar

5 g of mannitol

Purified water

Each component was added to purified water in accordance with the usual liquid preparation method and dissolved, and the lemon flavor was added in an appropriate amount. Then, the above components were mixed, and purified water was added thereto. The whole was adjusted to 100 ml with purified water, And sterilized to prepare a liquid preparation.

[ Formulation example  6] Manufacture of healthy food

Millennium Extract (CC-1) 1000 mg

Vitamin mixture proper amount

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

Vitamin B6 0.5 mg

0.2 μg of vitamin B12

Vitamin C 10 mg

10 μg biotin

Nicotinic Acid 1.7 mg

50 μg folic acid

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium Citrate 90 mg

Calcium Carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixtures is mixed with a component suitable for a health food in a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method. The granules may be prepared and used for preparing a health food composition according to a conventional method.

[ Formulation example  7] Manufacture of health drinks

Millennium Extract (GM-1) 1000 mg

Citric acid 1000 mg

100 g oligosaccharides

Plum concentrate 2 g

1 g of taurine

Add 900 ml of purified water

The above components were mixed according to a conventional health drink manufacturing method, and the mixture was heated at 85 DEG C for about 1 hour with stirring, and the solution thus prepared was filtered to obtain a sterilized 2-liter container, which was sealed and sterilized, &Lt; / RTI &gt;

Claims (6)

A pharmaceutical composition for the prevention and treatment of Helicobacter bacterial infection, which contains the extract of Asparagus.
The method of claim 1,
The cheonnyeonja extract is a pharmaceutical composition for the prevention and treatment of Helicobacter bacterial infection, characterized in that the extract available in water, lower alcohols of C ₁ to C ₄ and a mixed solvent thereof.
The method according to claim 2, wherein the cheonnyeonja extract is prepared by extracting the pulverized yeonjang 1 ~ 20 times the dry weight of water, C ₁ ~ C ₄ lower alcohol and a mixed solvent thereof at 20 ~ 150 ℃ A pharmaceutical composition for the prevention and treatment of Helicobacter bacterial infection.
4. The pharmaceutical composition for preventing and treating Helicobacter bacterial infection according to claim 3, wherein the extract contains 0.1 to 50% by weight.
Health functional food for the prevention and improvement of Helicobacter bacterial infection, which contains the extract of Asparagus.
The method of claim 5,
Health functional food for the prevention and improvement of Helicobacter bacterial infection, characterized in that it is selected from the form of powder, granules, tablets, capsules or beverages.

Images