KR20110117491A - A pharmaceutical composition for prevention or treatment of diseases related to helicobacter infection comprising extracts of cinnamomum cassia blume as an effective component and a health food - Google Patents

Abstract

The present invention relates to a pharmaceutical composition and health food for the prevention or treatment of Helicobacter bacterial infection disease comprising cinnamon extract as an active ingredient. The pharmaceutical composition and the health food of the present invention are developed by selecting an antimicrobial activity against Helicobacter bacteria among natural plants that have been used as foods for a long time and have a safety guarantee. It is suitable for use in the prevention and treatment of bacterial infectious diseases.

Description

A pharmaceutical composition for prevention or treatment of diseases related to Helicobacter infection containing extracts of Cinnamomum cassia Blume as an effective component and a health food }

The present invention relates to a pharmaceutical composition and health food for the prevention or treatment of Helicobacter infection disease using cinnamon extract as an active ingredient.

Helicobacter pylori was first isolated and identified in the gastrointestinal biopsy of Australian gastritis patients in 1983 (Warren, JR and Marshall, BJ, Lancet, 1: 1273-1275 (1983)). Helicobacter pylori, a parasitic human, is an aerobic, gram-negative bacterium that has several flagellar helical bacteria, with an optimal oxygen partial pressure of 2 to 8% and CO ₂ It can be cultured under conditions, and it is characterized by slow growth rate and rapid movement.

One of the bacteria's most important microbiological properties is the ability to produce urease, a powerful urease, which is an essential component for bacteria to live in the gastrointestinal mucosa. Urease hydrolyzes one molecule of urea (H ₂ NCONH ₂ , urea) in gastric juice to form two molecules of ammonia (NH ₃ ). Close associations have been reported with urease infecting human gastrointestinal epidermal cells and aiding colonization. Specifically, Helicobacter pylori strains that inactivate urease do not colonize in gastric mucosal cells, and it has been reported that urease activity is essential for colonization of Helicobacter pylori (Eaton KA, et al., Infect Immun., 59, pp2470-). 2475, 1991), ammonia produced by Helicobacter pylori urease increases the pH in gastric juice, damages the gastric mucus layer (Sidebotham RL, et al., J. Clin. Pathol., 44, pp52-57, 1991), Ammonia itself inhibits oxygen consumption of gastric mucosa cells and ATP production in mitochondria (Tsujii M., et al., Gastroenterology, 102, pp1881-1888, 1992), and ultimately ammonia forms monochloroamine Because of the production of reactive oxygen species, it has been reported to induce cellular damage, resulting in chronic inflammation, and further DNA damage to accelerate the cancer development process. ahm KB, et al., Am. J. Gastroenterol., 92, pp 1853-1857, 1997).

Adhesin, also present in Helicobacter, is a bacterial component found in many types of bacteria that cause infections on mucosal surfaces. Adhesin components of Helicobacter pylori have been reported with sialic acid-specific hemagglutinin and lipid-binding adhesin. It is known that pylori plays an important role in inducing inflammation of gastric mucosa by colonizing gastric mucosal epithelial cells.

The transmission of Helicobacter occurs through animals or humans, or through various channels such as carelessness or food in medical practice (Dunn, BE, Cohen, H., and Blaser, MJ (1997).) Clinical Microbiology Reviews, 10 (4 ), 720-7; Kodaira, MS, Escobar, AMU, & Grisi, S. (2002) Revista de Sade Pade Pblica. 36: 356-369), once infected, are not easily eradicated.

Helicobacter pylori is specific to humans and is primarily found in certain places in the stomach, such as peptic ulcers (e.g. gastric or duodenal ulcers), inflammation (e.g. gastritis, etc.), diseases of the upper digestive tract such as gastric cancer, MALT (Mucosaassociated lymphoid tissue) Background of pathogenesis of lymphoma or chronic heart disease. At present, studies on the treatment of Helicobacter pylori infection have been actively conducted, and many of the treatments have been reported as follows for the purpose of elimination and prevention of recurrence.

Representative methods of treatment of Helicobacter pylori include tetracycline, amoxicillin, metronidazole, clarithromycin, and the like, and antibiotic therapy, hydrogen ion pump inhibitors, and three drug treatments ( Tritherapy). Tritherapy is the treatment of two antibiotics and bismuth or hydrogen ion pump inhibitors, and has been applied to gastroduodenal ulcer disease associated with Helicobacter due to its high eradication rate (Lind, T., et al., (1996). ) Helicobacter 1: 138-144). However, eradication of Helicobacter pylori by tritherapy is not always successful, and repeated use of these drugs has been reported to cause side effects (Borody, TJ, Shortis, NP, Chongnan, J., Reyes, E., and O). Shea, JE, (1996), Eradication failure (EF) after H. pylori treatment-further therapies.Gastroenterology 110: A67; Dunn et al., 1997). In other words, triple therapy causes mild side effects in about 50% of patients and vaginal infections in about 10% of women (Borody, TJ, Shortis, NP, Chongnan, J., Reyes, E., and O '). Shea, JE, 1996, Eradication failure (EF) after H. pylori treatment-further therapies.Gastroenterology 110: A67). In addition, the continued use of antibiotics leads to the emergence of resistant strains (DKarim, QN, & Maxwell, RH (1989). Journal of Clinical Pathology. 42 (7): 778) and other adverse events such as intestinal bacteria. (Ahn, YJ, et al., (2000) J. Agric. Food Chem. 48, 2744-2748; Zoppi, G., et al., (2001) Curr. Ther. Res. Clin. E. 62, 418-43).

Helicobacter pylori, a bacterium similar to Helicobacter pylori, has been isolated from humans and animals to date. Helicobacter felis, Helicobacter mustelie, Helicobacter fenelliae, Helicobacter raffelli, Helicobacter hepaticus, Helicobacter bilis bacilli (Helicobacter bacilli) (Helicobacter pullorum) and the like are known.

As described above, although Helicobacter causes serious diseases and huge economic loss causing various diseases such as peptic ulcer and gastric cancer, the difficulties faced with treatment, that is, Helicobacter bacteria are present on the surface or gastric mucosa of the gastrointestinal mucosa. In many cases, the therapeutic drug does not reach the germs sufficiently, and the above-mentioned treatments have frequent frequency of administration, and may require a large amount of administration above the normal dose, and symptoms such as diarrhea and constipation due to drug administration In addition, there are a lot of resistant bacteria, and there is no method at home and abroad that can effectively prevent Helicobacter.

Therefore, there is a need for the development of a new mechanism of prevention and treatment of harmless, low toxicity to the human body and having antibacterial activity against Helicobacter and at the same time preventing resistance and side effects due to the use of antibiotics made of synthetic compounds.

Conventional Helicobacter therapies are antibiotics consisting mainly of synthetic compounds, causing long-term resistance and serious side effects. In the present invention, by selecting as having a long-term food safety and antibacterial activity against Helicobacter bacteria among natural plants, the risk of resistance and side effects and low toxicity to the human body safe and safe pharmaceutical composition for preventing or treating Helicobacter and health food We want to develop

In order to solve the problems of the present invention as described above, the present invention provides a pharmaceutical composition for the prevention or treatment of Helicobacter infection disease comprising cinnamon extract as an active ingredient.

The Helicobacter is Helicobacter pylori ( Helicobacter pylori ), Helicobacter canis , Helicobacter cinaedi), H. Hale Mani (Helicobacter heilmannii), H. Felice (Helicobacter felis), H. non-steel rail (Helicobacter mustelae), Helicobacter page Nelly (Helicobacter fenelliae), H. La Feeney (Helicobacter rappini), H. H. party Syracuse (Helicobacter hepaticus), H. Billy's (Helicobacter bilis) and pool room Helicobacter (Helicobacter pullorum ).

The disease is peptic ulcer, inflammation, lymphoma, malignant lymph or stomach cancer.

The extract is preferably extracted using water, lower alcohol or a mixed solvent thereof.

The extract is preferably extracted using a reflux cooling extraction method.

The content of the active ingredient is 0.1 to 50% by weight based on the total weight of the composition.

In another aspect, the present invention provides a health food for the prevention or reduction of Helicobacter bacterial infection disease comprising cinnamon extract as an active ingredient.

The health food is preferably in the form selected from the group consisting of powders, granules, tablets, capsules and beverages.

The pharmaceutical composition and health food comprising the extract of cinnamon of the present invention exhibits excellent antimicrobial effect against Helicobacter bacteria and has low risk of resistance and side effects and is safe to the human body because of low toxicity, and peptic ulcer caused by Helicobacter bacterial infection, inflammation, It can be used for the prevention and amelioration of diseases caused by various Helicobacter bacterial infections such as lymphoma, malignant lymph or stomach cancer.

1 is in vitro ( in In vitro ) antimicrobial efficacy test showed antimicrobial activity against Helicobacter bacteria.
2 is a living body ( in In vivo ) experimental treatment configuration and schedule are shown.
Figure 3 shows the gross score of the gastric lesions. I represents a Helicobacter + cinnamon treated group, II represents a Helicobacter treated group, III represents a cinnamon treated group, and IV represents an untreated group.
Figure 4 shows the pathological score of the gastric lesions. I represents a Helicobacter + cinnamon treated group, II represents a Helicobacter treated group, III represents a cinnamon treated group, and IV represents an untreated group.
Figure 5 shows the Helicobacter infection confirmation PCR results. M represents a 100bp marker, H represents DNA of H. pylori ATCC 43504, I represents DNA of a Helicobacter + cinnamon group, and II represents a DNA of a Helicobacter group.
Figure 6 shows the results of Helicobacter infection confirmed rapid urease test. The left side shows the Helicobacter + cinnamon treatment group, the right side shows the Helicobacter treatment group.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for the prevention or treatment of Helicobacter bacterial infection disease containing cinnamon extract as an active ingredient.

Cinnamon is the plant name Cassia, the herbal name is cinnamon (cassiae cortkex), broiler (cinnamomi cortex), cauliflower, branch, the scientific name is Cinnamomum cassia (Cinnamomum loureitii). In Chinese medicine, cinnamon and cinnamon are used as medicines. Cinnamon is the bark of cassia, and broilers used to refer to the bark of cinnamon, but cinnamon (stalk bark), cinnamon (bark) and bracts Somewhat removed, commonly used as cinnamon. Presence takes only the central part by removing the outer surface of the broiler and removing the inner skin. Gage is the thinnest, thinnest and softest of the branches of cassia. Cinnamon is a warm, nontoxic drug. The main ingredients of cinnamon are essential oils called cinnamon oils, cinnamic aldehyde, camphene cineol, linalool, eugenol, sugar, fat, phosphorus, iron, and vitamins. It contains components, such as A, B1, and B2. Cinnamon has been used in various ways, including antiperspirants, antipyretics, and analgesics, as well as fragrances in foodstuffs.

The helicobacter bacterium of the present invention is not particularly limited and may include all bacteria included in Helicobacter spp., But preferably Helicobacter pylori , Helicobacter canis , Helicobacter canis , Helicobacter cinaedi , Helicobacter heilmannii , Helicobacter felis , Helicobacter mustelae , Helicobacter fenelliae , Helicobacter helicobacini Helicobacter hepaticus , Helicobacter bilis and Helicobacter pullorum may be selected from bacteria.

In addition, the Helicobacter bacterial infection disease in the present invention means all diseases caused by the Helicobacter bacteria, preferably peptic ulcer (for example, gastric ulcer or duodenal ulcer, etc.), inflammation (for example, gastritis, etc.) ), Diseases of the upper digestive tract such as gastric cancer, mucosa-associated lymphoid tissue (MALT) lymphoma, pathogenesis of lymphoma, malignant lymph, gastric adenocarcinoma or chronic heart disease. In addition, idiopathic thrombocytopenic keyboard disease, iron deficiency anemia in children, chronic urticaria, and other diseases may be.

Cinnamon extract of the present invention can be used a variety of extraction solvents are not particularly limited in its kind, water, lower alcohol, acetone, ethyl acetate, chloroform, ethylene glycol, butylene glycol, propylene glycol, dichloromethane, butyl acetate Or a mixed solvent thereof may be used, and preferably, purified water, C ₁ to C ₄ lower alcohols, or a mixed solvent thereof may be used, and more preferably, a mixed solvent of water and ethyl alcohol is used.

As the extraction method of the present invention, all extraction methods commonly used by those skilled in the art such as cold sediment extraction, heat extraction, ultrasonic extraction, reflux cooling extraction, etc. may be used, but it is preferable to use reflux cooling extraction method.

In a preferred embodiment of the present invention, the dried cinnamon is chopped to 60 to 80% by weight aqueous solution of ethyl alcohol at 1 to 20 times, preferably 2 to 6 times the dry weight, 20 to 150 ℃, preferably 70 to Extraction by reflux cooling extraction for about 1 hour to 10 days, preferably about 2 hours to 5 hours at an extraction temperature of 120 ℃ can be concentrated under reduced pressure.

In addition, the extract of the present invention may include not only the extract by the above-described extraction solvent, but also the extract that has undergone a conventional purification process. Obtained by various additional purification methods, such as, for example, separation using ultrafiltration membranes having a constant molecular weight cut-off value, separation by various chromatography (manufactured for separation according to size, charge, hydrophobicity or affinity). Active fractions may also be included in the extracts of the present invention.

For the prevention and treatment of Helicobacter bacterial infection disease of the present invention The pharmaceutical composition comprises 0.1 to 50% by weight relative to the total weight of the composition.

For the prevention and treatment of Helicobacter bacterial infection disease containing cinnamon extract of the present invention as an active ingredient The pharmaceutical composition may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions. The pharmaceutical compositions of the present invention may be prepared in any formulation conventionally prepared in the art (e.g., Remington's Pharmaceutical Science, latest edition; Mack Publishing Company, Easton PA), for example granules, fines, powders, It may be administered as a pharmaceutical composition for oral administration such as hard capsules, soft capsules, syrups, emulsions, suspensions or solutions, and may be intravenous, intramuscular or subcutaneous injections, mucus, suppositories, transdermal absorbents, It is also possible to administer as a pharmaceutical composition for parenteral administration such as a transmucosal absorbent, a nasal drop, an ear drop, an eye drop, an inhalant, a cream, an ointment, a pape. The formulation prepared as a pharmaceutical composition in powder form may be dissolved in use and used as an injection or mucus. In particular, the pharmaceutical composition of the present invention may be preferably in the form of a paste ointment, cream, milk, powder, powder, penetrating pad, solution, gel, spray, lotion or suspension.

For the preparation of pharmaceutical compositions, additives for the preparation of solids or liquids may be used. The additive for preparation may be either organic or inorganic. In other words, when preparing oral solid preparations, excipients, binders, disintegrating agents, lubricants, coloring agents and the like are added to the main medicine, and then tablets, coating tablets, granules, powders, Preparations in the form of capsules and the like can be prepared. Examples of excipients to be used include lactose, sucrose, white sugar, glucose, corn starch, starch, talc, sorbet, crystalline cellulose, dextrin, kaolin, calcium carbonate, silicon dioxide and the like. Examples of the binder include polyvinyl alcohol, polyvinyl ether, ethyl cellulose, methyl cellulose, gum arabic, tragacanth, gelatin, shellac, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, calcium citrate, Dextrin, pectin and the like. Examples of the lubricant include magnesium stearate, talc, polyethylene glycol, silica, hardened vegetable oil, and the like. As a coloring agent, if it is normally permitted to add to a pharmaceutical, all can be used. These tablets and granules can be appropriately coated according to sugar, gelatin coating, and other needs. Moreover, preservatives, antioxidants, etc. can be added as needed.

Inert diluents commonly used in the preparation of liquid preparations for oral administration, for example emulsions, syrups, suspensions, solutions, may be used, for example water or vegetable oils. In addition to the inert diluent, this preparation may be formulated with an adjuvant such as a wetting agent, suspending aid, sweetener, fragrance, colorant or preservative. After the liquid formulation is prepared, it may be filled into a capsule of absorbable material such as gelatin. As a solvent or suspending agent used for preparation of a parenteral administration agent, for example, an injection or a suppository, water, propylene glycol, polyethylene glycol, benzyl alcohol, ethyl oleate, lecithin are mentioned, for example. As a base used for manufacture of a suppository, a cacao butter, an emulsified cacao butter, a laurin butter, and a witezol are mentioned, for example. The preparation method of the formulation is not particularly limited, and any method commonly used in the art can be used.

In the case of injectable preparations, for example, diluents such as water, ethyl alcohol, macrogol, propylene glycol, citric acid, acetic acid, phosphoric acid, lactic acid, sodium lactate, sulfuric acid and sodium hydroxide; PH adjusters and buffers such as sodium citrate, sodium acetate and sodium phosphate; Stabilizers, such as sodium pyrosulfite, ethylenediamine tetraacetic acid, thioglycolic acid, and thio lactic acid, etc. can be used. In this case, in order to prepare an isotonic solution, a sufficient amount of salt, glucose, mannitol, or glycerin may be blended in the formulation, or a conventional dissolution aid, analgesic agent, or local anesthetic may be used.

In the case of ointments such as pastes, creams, and gels, bases, stabilizers, wetting agents, preservatives, and the like, which are commonly used, may be blended as necessary, and the components may be mixed and formulated by conventional methods. . As the base, for example, white petrolatum, polyethylene, paraffin, glycerin, cellulose derivatives, polyethylene glycol, silicone, bentonite and the like can be used. Methyl paraoxybenzoate, ethyl paraoxybenzoate, propyl paraoxybenzoic acid, etc. can be used as a preservative. When it is set as the form of a patch, the said ointment, cream, gel, paste, etc. can be apply | coated to a normal support body by a conventional method. As a support body, woven or nonwoven fabric which consists of cotton, staple fiber, and chemical fiber; Films or foam sheets such as soft vinyl chloride, polyethylene, and polyurethane can be suitably used.

The dosage of the pharmaceutical composition of the present invention is not particularly limited, but in the case of oral administration, it is usually 0.1 to 500 mg / kg per kg, preferably 1 to 100 mg / kg, as the weight of the substance as an active ingredient per adult Can be. It is preferable to appropriately increase or decrease this dosage depending on the age, condition and symptoms of the patient. The daily dose may be administered once a day or divided into two to three times a day at appropriate intervals, or may be administered intermittently at intervals of several days. When used as an injection, the weight of the substance as an active ingredient per adult may be usually 0.01 to 10 mg / kg, preferably 0.1 to 1 mg / kg per kg. However, since the dosage of the pharmaceutical composition of the present invention is determined in view of various related factors such as the route of administration, the age, sex, weight of the patient, the severity of the patient, the dosage limits the scope of the present invention in any aspect. It should not be understood to be.

In addition, the present invention provides a health food that is effective in the prevention or reduction of Helicobacter bacterial infection disease comprising cinnamon extract as an active ingredient.

The health food may be in the form of powder, granules, capsules or beverages, and more specifically, for example, beverages, gums, teas, vitamin complexes, fermented milk, and the like. The amount of cinnamon extract in the health food may be added as 0.1 to 90% by weight of the total health food.

The health food of the present invention may contain other ingredients, such as various flavors or natural carbohydrates, as additional ingredients in addition to the cinnamon extract in the indicated ratio. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents (tauumatin, stevia extract (for example rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. The ratio of the natural carbohydrate may be generally about 1 to 20 parts by weight, preferably about 5 to 12 parts by weight, per 100 parts by weight of the health food of the present invention.

In addition to the above, the health food of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof, alginic acid and Salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. In addition, the health food of the present invention may contain fruit flesh for the production of natural fruit juice and fruit juice beverage and vegetable beverage. These ingredients may be used independently or in combination, and the proportion of such additives is not so critical but may generally be selected from the range of 0.01 to about 20 parts by weight per 100 parts by weight of the health food of the present invention.

The invention is illustrated in detail by the following examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited by the following examples.

Example  1. Preparation of Cinnamon Extract

The dried cinnamon purchased from the University of Iksan was pulverized using a grinder (Daesung Artron, DA700) so that the particle size was 30 mesh (mesh, pore size 00 μm) or less to obtain cinnamon powder. 70% ethyl alcohol solution containing distilled water corresponding to three times the mass of dried cinnamon powder (1 kg) (v / w) was added thereto, followed by reflux extraction at 100 ° C. for 3 hours, filtration and concentration under reduced pressure, and lyophilization. 600 g of powdered cinnamon extract was obtained and used as a sample of the following example (hereinafter, referred to as "CC-1").

Example  2. Preparing for Experiment

The present invention relates to the experimental method described in the existing literature (Ishizone et. al ., Int J Med Sci. 4, pp.203-208, 2007) was carried out by the following method.

Since experiments gerbil (Mongolian gerbil) model used in the two Helicobacter bacteria Helicobacter pylori infection in men is caused because test system to reproduce most closely the pathology aspects of human living body to investigate the antibacterial effect of H. pylori bacteria (in It is the best model for in vivo experiments.

Example  2-1. Laboratory animals Helicobacter bacteria  Ready

The rats (Mongolian gerbil, Meriones unguiculatus) were kept at the Wonkwang University Animal Resource Development Research Center at 6 weeks of age, and were used for experiments after acclimation in the experimental animal breeding room at Wonkwang University Animal Resource Development Research Center for 1 week. . During the breeding period, the temperature was raised at 23 ± 1 ℃, humidity 50 ± 5%, noise below 60 phone, lighting time 08: 00-20: 00 (12 hours per day), 10-12 times per ventilation hour. Animal feed (Sampaco) was freely fed, and negative water was freely supplied with sterile water. All experimental procedures and procedures related to experimental animals used in this study were performed in compliance with the regulations of the Institutional Animal Care & Use Committee (IACUC).

Helicobacter pylori (ATCC 43504, American Tissue Culture Collection, Rockville, MD) strains were inoculated in Brussela agar medium with 10% calf serum, and then incubated for 3 days at 37 ° C in a 10% CO2, 100% humidity. The cultured Helicobacter pylori was collected in a tube containing sterile PBS (pH 7.2), and then prepared to include 2.0 × 109 colony-forming unit (CFU) bacteria per ml and used in the experiment.

Example  2-2. Military composition

In Example 2-1, 40 heads of 7-week-old healthy male sand rats that had been reared for one week were used for the experiment. Using 10 animals per group, cinnamon extract application group after Helicobacter pylori infection (Group I), cinnamon extract untreated application group (Group II) and Helicobacter pylori infection after Helicobacter pylori infection as shown in Table 1 Experiments were performed by dividing into four groups of extract application group (Group III), cinnamon extract untreated application group (Group IV) without Helicobacter pylori infection. After 12-hour fasting of the 7-week-old sand rats used in the experiment, the animals of group I and group II were helicobacter pylori of 2.0 × 10 ⁹ colony-forming unit (CFU) per ml. Helicobacter pylori was administered by oral (po) administration of the culture medium prepared to contain the bacterial counts with 0.5 ml per head. It caused an infection. Animals of group III and IV were orally administered 0.5 ml of sterile PBS (pH 7.2) after 12 hours of fasting. After dosing, animals in each group received feed after 12 hours of fasting. During fasting negative numbers were allowed to feed freely. Helicobacter pylori Alternatively, animals in groups I and III administered with PBS received oral administration of cinnamon extract obtained in the above example at 400 mg / kg based on body weight for 4 weeks, that is, 13 weeks of age, from 9 weeks of age, 2 weeks later. During this period, animals in groups II and IV were freely fed feed and negative water without any treatment (FIG. 2). Animals of each test group from 9 to 13 weeks of age weighed once a week, fasted each individual for 12 hours at the end of the experiment at 13 weeks of age, euthanized under ether anesthesia, and extracted the stomach to obtain a gross lesion score. Infections were confirmed by PCR, rapid urease analysis, and histopathologic examination to evaluate the effect of cinnamon extract on Helicobacter bacterial infection.

Group Treatment n Helicobacter pylori Cinnamon Extract term I Test   (o) (o) 6 weeks 10 Ⅱ Positive control   (o) (X) 6 weeks 10 Ⅲ Vehicle control   (X) (o) 6 weeks 10 Ⅳ Negative control   (X) (X) 6 weeks 10

Example  2-3. Statistical analysis

Statistical significance of each test group was obtained using 95% confidence interval (CI) using MINITAB software (Minitab Inc, USA). The confidence intervals of each group were statistically significant if they were different from the Helicobacter infection positive control group II (p <0.05).

Example  3. antibacterial effect

The formation of peripheral clear zones of each of the disks applied to the Helicobacter bacterial culture plate by the cinnamon extract obtained in Example 1 was observed, and the diameters of the formed clear zones were described in the literature (Narayan et. al ., Phytother Res. 21, pp. 190-193, 2007).

Helicobacter pylori (ATCC 43504, American Tissue Culture Collection, Rockville, MD) strains were stained on Brucella agar medium plates with 10% calf serum and antibiotic disc gentamycin (Bay Veterinary Medicine, Korea), Ghana Mycin (Bay Animal Drugs, Korea) and Enrofloxacin (Bay Animal Drugs, Korea) were applied as 0.25 mg, 0.5 mg, and 0.25 mg, respectively. In addition, 30 mg of the cinnamon extract obtained in Example 1 was dissolved in 100ul of DMSO and dissolved in 100mg (300mg / ml) of disc filter paper at a concentration of 300mg / ml for 10 ⁰ (stock solution) (applied capacity 1.5mg), 10 ^-1 (0.15mg) and solvent control. Dimethyl sulfoxide (DMSO) was applied respectively. In this experiment, sterilized discs (0.7 mm in diameter) were placed in the inoculated medium, and then cultured in an incubator maintained at 10% CO ₂ , 100% humidity and evaluated 4 days later. After 6, 12, 24, 48 and 60 hours after inoculation, the zone of inhibition, expressed as the diameter of the clear zone, was measured using a standard, respectively. The clear zone was observed. Five disks were examined for each strain to analyze the mean value of the inhibition range. Evaluation of the results was observed for the formation of peripheral clear zones of each of the antibiotic disks and the diameters of the formed clear zones were measured to determine that the larger the diameter, the higher the antimicrobial effect.

Diameter of clear zone Applicable Material Clearzone
Diameter (mm) 6 h 12 h 24 h 48 h 60 h DMSO 0 0 0 0 0 Gentamicin 5 10 8 8 7 Kanamycin 5 9 8 7 7 Enrofloxacin 10 15 13 12 9 (Cinnamon) Extract 10 ⁰
(Stock) 10 14 12 12 10 10 ^-1
(10-fold dilution) 5 7 6 6 5

As shown in Table 2 and FIG. 1, the results of observing the antimicrobial susceptibility of cinnamon with the Helicobacter strain, cinnamon extract showed a superior level of inhibition than gentamicin and kanamycin, which are widely known as representative antibiotics, The extent of inhibition was similar to that of rofloxacin.

Example  4. Weight Change of Helicobacter Bacterial Infected Animals by Cinnamon Extract

After administering the cinnamon extract obtained in Example 1 to the Helicobacter bacterial infection and non-infected animals, the weight change was confirmed and the results are shown in Table 3 below.

Group Treatment Weight (gram) Helicobacter pylori cinnamon
extract 9 weeks 10 weeks 11 weeks 12 weeks 13 weeks I   (o) (o) 135.5
± 2.05 137.0
± 2.55 141.0 *
± 2.00 144.5 *
± 3.55 146.0 *
± 1.55 Ⅱ   (o) (x) 135.5 ±
4.00 135.0
± 3.00 136.0
± 2.55 136.5
± 2.55 137.0
± 1.55 Ⅲ   (x)  (o) 135.0
± 5.10 141.0
± 4.25 145.0 *
± 4.00 149.5 *
± 2.55 153.0 *
± 2.40 Ⅳ   (x) (x) 135.5
± 4.15 139.0
± 3.55 144.0 *
± 3.15 148.0 *
± 2.30 152.0 *
± 2.00  * p <0.05 (compare with group II)

Example  5. Changes in Gross Score of Stomach Lesions by Cinnamon Extracts

After administering the cinnamon extract obtained in Example 1 to the Helicobacter bacterial infection and non-infected animals, to confirm the gastric gross lesion score, the experimental animals of Example 2-2 were extracted for each test group at the end of the experiment Then, after dissection and spread along the Taiwan part, the lesion was observed using a stereomicroscope (× 10), and the score of the visual lesion was calculated. The score of the gross lesion was calculated as the sum of the width x length (mm ² ) of the gastric ulcer lesion. After the score of each individual, the average score was calculated for each group.

As shown in Figure 3, Helicobacter pylori Cinnamon extract application group (Group III), Helicobacter pylori without infection Gastric ulcer lesions were not observed in cinnamon extract-free group (Group IV) without infection, resulting in a gross score of zero. On the other hand, Helicobacter pylori Cinnamon extract-free treatment group (Group II) showed a visual score of 85 ± 15.5 after infection with Helicobacter pylori After infection, the cinnamon extract application group (group I) showed more significant changes than 12 ± 2.0 (p <0.05).

Example  6. Caused by Cinnamon Extract Gastric lesions  Histopathological Score Changes

The cinnamon extract obtained in Example 1 was administered to Helicobacter bacterial infection and non-infected animals and tested as follows to determine the gastric pathological lesion score.

After gross lesion observation and lesion scores were obtained from the animals of each group in Example 5, the stomach tissue was fixed in 10% neutral formalin. For gastric histology, the glandular stomach was cut at intervals of 5 mm in the transverse direction, and the three sites were examined and the lesions were graded. The above selected sites were carefully selected to be the same site among different individuals. Tissues of the selected sites were embedded in paraffin using a conventional method for histopathological examination, and then sliced into 4 μm thickness and subjected to pathological examination after H & E staining. Evaluation of the lesions of each tissue finding was performed and their degree was recorded by dividing the scores into four stages {0 (no lesion), 1 (mild), 2 (moderate), 3 (severe)}, and After the sum of the scores, the mean scores of each group for the pathological findings above were obtained.

As shown in Figure 4, Helicobacter pylori Cinnamon extract application group (Group III), Helicobacter pylori without infection Histopathological lesions were not observed in the cinnamon extract-treated group (Group IV) without infection, resulting in a gross score of zero. On the other hand, Helicobacter pylori Cinnamon extract-free treatment group (Group II) showed a visual score of 7.5 ± 0.55 after infection with Helicobacter pylori After infection Cinnamon extract application group (group I) showed a significant change than 1.5 ± 0.25 (p <0.05).

Example  7. PCR Helicobacter pathogen screening by

After administering the cinnamon extract obtained in Example 1 to the Helicobacter bacterial infection and non-infected animals, in order to confirm the elimination effect by Helicobacter bacterial treatment, aseptically extract a portion of the gastric pyloric mucosa of the subjects and extract DNA at the end of the experiment. PCR was performed to confirm maintenance of Helicobacter pylori infection. DNA extraction was performed using a bead beater-phenol extraction method. Samples were aseptically collected in a 2 ml tube dedicated to Mini-Bead Beater (Biospec product) containing 1 ml sterile distilled water, chopped, and then suspended in sterile tertiary distilled water (200 mm) of glass bead (0.1 mm size, Biospec product) and phenol-chlorform 200 μl of -isoamyl alcohol solution (50: 49: 1 (v / v / v)) was added thereto and shaken with a Mini-Bead Beater (Biospec product) at 5,000 rpm for 30 seconds. After shaking, the mixture was centrifuged at 12,000 rpm for 15 minutes at 4 ° C, and the supernatant was transferred to a sterile 2 ml tube. 10 μl of 3 M sodium acetate and 250 μl of ice-cold ethanol were added to the mixture, and the mixture was suspended at −20 ° C. for 10 minutes, and then centrifuged at 15,000 rpm for 15 minutes. The precipitate was washed with 70% alcohol, dried at room temperature and dissolved in 60 μl of Tris EDTA (pH 8.0) and used for the experiment. Genus Helicobacter (Genus PCR was performed using primer pairs capable of amplifying rpoB DNA segments of Helicobacter . PCR using Taq DNA polymerase 1U, each dNTP 250μM, 50mM Tris-HCl (pH 8.3), 40mM KCl, 1.5 using Forward primer (HF; 5 'ACTTTAACGCATGAAGATAT 3') and Reverse primer (HR; 5 'ATATTTTGACCTTCTGGGGT 3') AccuPower PCR Premix (Bioneer) containing mM MgCl ₂ was used. 50ng of extracted DNA as a template and 20 pmol of each primer were put in AccuPower PCR Premix tube, and the final volume was adjusted to 20μl with sterile distilled water, followed by 30 cycle PCR of 94 ° C 30 seconds, 52 ° C 30 seconds, 72 ° C 45 seconds. Then, the presence or absence of a specific band of 458 bp in 1.2% agarose gel.

Group Treatment n Positive No. Positive% Helicobacter pylori cinnamon
extract I   (o) (o) 10 0 0 Ⅱ   (o) (x) 10 10 100 Ⅲ   (x) (o) 10 0 0 Ⅳ   (x) (x) 10 0 0

As shown in Table 4 and FIG. 5, Helicobacter pylori Without infection Cinnamon extract application group (Group III) and Helicobacter pylori Helicobacter bacterial DNA was not detected by PCR in the case of cinnamon extract-treated group (Group IV) without infection. On the other hand, Helicobacter pylori Helicobacter bacterial DNA was detected in all 10 subjects in the cinnamon extract-free treatment group (Group II) after infection. Cinnamon extract application group (Group I) after infection showed negative results in all 10 subjects, which was significantly different from group II of Helicobacter infection positive control group (p <0.05).

Example  8. Helicobacter bacterial pathogen test by rapid urease test

The cinnamon extract obtained in Example 1 was administered to Helicobacter bacterial infection and non-infected animals, and experimented as follows to confirm the elimination effect by the treatment of Helicobacter bacteria.

At the end of the experiment, a portion of the gastric pyloric mucosa of the subjects was aseptically collected and subjected to a rapid urease test. Rapid urease test was determined to be positive when the yellow medium turned red by culturing at room temperature according to the manufacturer's instructions using the CLO test kit (Asan Pharmaceutical Co., Korea). The result of the CLO test, a rapid urease digestion test, is an easy way to determine whether an infection is caused by color change induced by urease digestion and reaction of urea in a given medium.

Group Treatment n Positive No. Positive% Helicobacter pylori cinnamon
extract I   (o) (o) 10 0 0 Ⅱ   (o) (x) 10 10 100 Ⅲ   (x) (o) 10 0 0 Ⅳ   (x) (x) 10 0 0

Experimental results, as shown in Table 5 and Figure 6, Helicobacter pylori Without infection Cinnamon extract application group (Group III), Helicobacter pylori In the case of Cinnamon Extract-treated group (Group IV) without infection, negative results were obtained in Helicobacter bacteria by rapid urease test. On the other hand, Helicobacter pylori After infection, the cinnamon extract-free treatment group (group II) detected positive H. pylori bacteria in all 10 subjects. Helicobacter pylori The cinnamon extract application group (Group I) after infection showed negative results in all 10 cases, showing a significant change from Group II of the Helicobacter infection positive control group (p <0.05).

Example  9. By test substance Toxicity  evaluation

In order to determine whether there is a cell damage suspected of toxic expression due to ingestion of cinnamon extract of Example 1 for a long time, the following experiment was performed.

The experiment was performed using 9 week old male sand rats, and orally administered test substance at 400 mg / kg dose daily for 28 days. On the day of the experiment, the patient was euthanized under ether anesthesia, and gross lesions of each organ were observed, followed by cerebrum, cerebellum, cerebellum, pons, testis, heart, and liver. ), Lung, Kidney, Muscle, Muscle, Spleen, Prostate, Pancreas, Thymus, Adrenal gland, Small Intestine, Small Intestine Large Intestine, Bone marrow, Thyroid gland and Seminal vesicle were extracted and fixed in 10% neutral buffered formalin. After fixing, the tissues were paraffinized using a conventional method for histologic examination, and then sliced into 4 μm thicknesses for H & E staining for pathological examination.

Group Experimental group n Gross lesion Pathological lesion I Cinnamon extract administration group 10 0 0 Ⅱ Control group 10 0 0

As shown in Table 6, it was confirmed that no cell damage was observed in the parenchyma.

The formulation example of the composition comprising the cinnamon extract of the present invention will be described, but the present invention is not intended to be limited thereto but merely to be described in detail.

Formulation example  One. Powder  Produce

Cinnamon Extract (CC-1) 20 mg

Lactose 100 mg

Talc 10 mg

The above ingredients are mixed and filled in an airtight cloth to prepare a powder.

Formulation Example 2 Preparation of Tablet

Cinnamon Extract (CC-1) 10 mg

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

After mixing the above components, tablets are prepared by tableting according to a conventional method for preparing tablets.

Formulation Example 3 Preparation of Capsule

cinnamon Extract (CC-1) 10 mg

3 mg of crystalline cellulose

Lactose 14.8 mg

Magnesium Stearate 0.2 mg

The above components are mixed according to a conventional capsule preparation method and filled in gelatin capsules to prepare capsules.

Formulation example  4. Preparation of injections

Cinnamon Extract (CC-1) 10 mg

180 mg mannitol

Sterile sterilized water for injection 2974 mg

Na ₂ HPO ₄ , 12H ₂ O 26 mg

(2 ml) per 1 ampoule according to the usual injection preparation method.

Formulation example  5. Liquid  Produce

Cinnamon Extract (CC-1) 20 mg

10 g of isomerized sugar

5 g of mannitol

Purified water

After preparing according to the conventional method for preparing a liquid, it is filled into a brown bottle and sterilized to prepare a liquid.

Formulation example  6. Manufacture of health food

Cinnamon Extract (CC-1) 1000 mg

Vitamin mixture quantity

70 [mu] g of vitamin A acetate

Vitamin E 1.0 mg

0.13 mg vitamin B1

0.15 mg of vitamin B2

0.5 mg vitamin B6

0.2 [mu] g vitamin B12

10 mg vitamin C

Biotin 10 μg

Nicotinic acid amide 1.7 mg

50 ㎍ of folic acid

Calcium pantothenate 0.5 mg

Mineral mixture quantity

1.75 mg of ferrous sulfate

0.82 mg of zinc oxide

Magnesium carbonate 25.3 mg

15 mg of potassium phosphate monobasic

Secondary calcium phosphate 55 mg

Potassium citrate 90 mg

100 mg of calcium carbonate

Magnesium chloride 24.8 mg

The composition ratio of the above-mentioned vitamin and mineral mixture is mixed with a composition suitable for a health food in a preferred embodiment, but the compounding ratio may be arbitrarily modified. The granules may be prepared and used for preparing a health food composition according to a conventional method.

Formulation example  7. Manufacture of health drinks

Cinnamon Extract (GM-1) 1000 mg

Citric acid 1000 mg

100 g of high sugar

2 g Ollie plum concentrate

1 g of taurine

900 ml of purified water

The above ingredients are mixed, sealed and sterilized and stored in a refrigerator according to a conventional healthy beverage manufacturing method.

Claims (8)

Pharmaceutical composition for the prevention or treatment of Helicobacter infection disease comprising cinnamon extract as an active ingredient.
The method of claim 1,
The Helicobacter is Helicobacter pylori (Helicobacter pylori), H. car in Nice (Helicobacter canis), Helicobacter downtown di (Helicobacter cinaedi), H. Hale Mani (Helicobacter heilmannii), H. Felice (Helicobacter felis), H. non-steel rail (Helicobacter mustelae), Helicobacter fenelliae, Helicobacter rappini, Helicobacter hepaticus, Helicobacter bilis and A pharmaceutical composition, characterized in that selected from the group consisting of Helicobacter pullorum .
The method of claim 1,
The disease is a peptic ulcer, inflammation, lymphoma, malignant lymph or stomach cancer.
The method of claim 1,
The extract is a pharmaceutical composition, characterized in that the extraction using water, lower alcohol or a mixed solvent thereof.
The method of claim 1,
The extract is a pharmaceutical composition, characterized in that extracted using a reflux cooling extraction method.
The method of claim 1,
The amount of the active ingredient is a pharmaceutical composition, characterized in that 0.1 to 50% by weight relative to the total weight of the composition.
Health food for the prevention or alleviation of Helicobacter bacterial infection disease comprising cinnamon extract as an active ingredient.
The method of claim 7, wherein
The health food is a health food, characterized in that the form selected from the group consisting of powders, granules, tablets, capsules and beverages.

Images