KR20060040848A - Pharmaceutical composition comprising the complex crude drug extract for preventing and treating hyperthyroidism - Google Patents

Abstract

The present invention relates to a composition for the prevention and treatment of hyperthyroidism containing herbal extracts, and more specifically, a compound consisting of root roots, gold, gypsum, as a by-product, Giltyeong, Gobon, horse riding, licorice and white paper extract. It relates to a pharmaceutical composition for the prevention and treatment of hyperthyroidism containing herbal extracts. The composition of the present invention lowers the level of thyroid hormone T4 (Thyroxine) and does not affect TSH (Thyroid stimulating hormone), which is a representative cause of hyperthyroidism and has an excellent effect against Graves disease having anti-thyroid resistance. It is safe for the human body and can be useful for medicines and dietary supplements for the prevention and treatment of hyperthyroidism.

Hyperthyroidism, Graves' disease, Root, Golden, Gypsum, Pharmaceutical composition

Description

Pharmaceutical composition comprising the complex crude drug extract for preventing and treating hyperthyroidism             

Figure 1 is a measure of cell activity when treated with FRTL-5 (Fisher rat thyroid cells) thyroid cells of the complex herbal extract of the present invention,

2 is a diagram showing whether or not cell proliferation when FRTL-5 cells are treated with the complex herbal extract of the present invention,

Figure 3 is a diagram measuring the degree of synthesis of DNA when treated with a compound herbal extract to FRTL-5 cells,

Figure 4a and 4b is a diagram showing the effect of the combined herbal extract on the concentration of T4 (Thyroxine, Figure 4a) and TSH (Thyroid stimulating hormone, Figure 4b) of FRTL-5 cells,

Figure 5 is a diagram showing the effect of the extract of the herbal medicine on the cAMP (cyclic AMP) level of FRTL-5 cells,

6, 7a and 7b is a diagram showing the effect of the composite herbal extracts on the expression of Tg (Thyroglobulin) and TPO (Thyroid peroxidase) genes of FRTL-5 cells, Figure 6 is a photograph of their expression level 7a is a diagram showing the expression of the Tg gene numerically, Figure 7b is a diagram showing the expression of the TPO gene numerically.

The present invention relates to a pharmaceutical composition for the prevention and treatment of hyperthyroidism, which contains a complex herbal extract consisting of root roots, gold, gypsum, and by-products of gilyeong, gobon, horse riding, licorice and white paper extract.

The thyroid gland is an endocrine gland below the anterior thyroid cartilage of the larynx. Its main function is the production of thyroxine, the thyroid hormone. Thyroxine is involved in the regulation of carbohydrates, proteins and fats, and also enhances the function of growth hormone.

Hyperthyroidism is a disease in which the function of the thyroid gland is increased due to a pathological increase in the function of the thyroid gland.The thyroid gland produces excessive amounts of thyroid hormone, which increases the concentration of thyroid hormone in the blood. It refers to a change in nature. Occurs in women in their 20s and 50s, with 5% of children being children. The cause is most often due to autoimmune disease, Bajes 'disease (or Graves' disease), but in addition to addictive nodular goiter (plumer's disease), thyroid-stimulating hormone gland of the pituitary gland, thyroid cancer, painless thyroiditis or subacute thyroiditis Also appears. The more thyroid hormones in the blood, the greater the metabolism, which makes the body warmer and more sensitive to external temperatures. Therefore, you can not stand the heat, sweat a lot, and the appetite increases, but the weight continues to decrease, usually between 1 to 2 months by 3 to 4kg. The pulse is faster, the chest is pounding, and an arrhythmia occurs, which causes irregular pulses. Your skin becomes warm and moist, and you may feel foreign body pain or pain in your neck. In addition, the nerves are nervous, nervous, and always feel tired. If you can't sleep well, your hands are trembling, your limbs are weak, and you are paralyzed. Menstrual cycles may become irregular, the amount may decrease, or even menstruation may stop. On the other hand, the front of the neck with the thyroid gland may protrude or, in severe cases, the eye may protrude.

For the treatment of hyperthyroidism, radioactive iodine is used to suppress thyroid function or, in severe cases, to remove the thyroid gland through surgical surgery.

Graves' disease is the most common cause of hyperthyroidism, which is caused by an increase in thyroid hormones such as T3 (Triiodothyronine) and T4 (Thyroxine) due to abnormal autoimmune responses to thyroid stimulating hormone (TSH) receptors. It is an organ-specific autoimmune disease that shows diffuse addictive goiter, invasive ocular disease, pretibial myxedema and the like. Graves' disease is one of the most common endocrine diseases in the world, with a high prevalence of 2 to 3%, mainly affecting young adults, and 4 to 10 times more common in women than men (Cho Bo-yeon, 1st edition of Clinical Thyroidology, Korea Medicine, pp. 149-150, 2001).

Cooper DS. Antithyroid durgs in the management of patients with Grave's disease: an evidence-based approach to therapeutic comtroversies. J. Clin. Endocrinol Metab . 88 (8) , pp3474-. 3481, 2003) and radioactive iodine therapy and thyroidectomy, but are frequently used (Hoermann R et al., Relapse of Grave's disease after successful outcome of antithyroid drug therapy: results of a prospective randomized study on the use) of levothyroxine.Thytoid. 12 (12) , pp1119-1128, 2002).

Graves' disease is most clinically non-specific, and most patients who visit oriental hospitals take anti-thyroid drugs to treat thyroid gland, ocular protrusion, heartworm, fatigue, anorexia, weight loss, and menstrual cramps. Has other atypical symptoms and is not readily accessible to oriental medicine.

To date, clinical reports on oriental medical treatment of Graves' disease have reported improvement of subjective symptoms through the combination of anti-thyroid drugs and herbal medicine (Park Jong-hyuk, Kim Sung-kyun, Han-bae Lee, Seung-hee, Jin Chang, Min-woo et al., Patients with hyperthyroidism) Case report on one case: Journal of Korean Oriental Internal Medicine 23 : pp238-243, 2002), but due to concomitant administration, there is a lack of verification of inherent efficacy of herbal medicine, and thyroid function test (Thyroid) No studies have reported improvements in the Function Test (TFT). Furthermore, no studies on the efficacy of herbal medicines have been reported in patients who do not respond to existing treatments.

Brown roots are the roots of Peuraria thunbergiana BENTH, which are composed of isoflavone-based furarin, furarin xyloside, daidzein and β-sitosterol. ), Arachnic acid or large amounts of starch. The isoflavone component of the reeds acts on the circulatory system and increases the blood flow of brain and enema, and the diyzein of the reeds has a hardening effect and the repulsion of the reeds is relatively strong. Has antipyretic effect (Jung Ji-sup and Shin Min-kyo's medicinal herbs), Yeonglimsa, pp704-705, 1998.

Gold ( Scutellaria baicalensis GEORGI) uses the root of gold as a medicinal herb, including baicalein, baicalin, wogonin, wogonin, wogonoside and neobaicalein. ). Gold has antipyretic, anti-inflammatory, anti-allergic effects, and dilates blood vessels and lowers blood pressure (Jim, Jung-seop and Shin-Kyomin medicinal herbs), Yeonglimsa, pp864-865, 1998.

Gypsum is a mineral belonging to the monoclinic system, which is colorless or white, grayish white, sometimes yellow, red, rarely dark gray. It is used as a mixture of cement, fertilizer, and white pigment, and it is used as baking and calcined gypsum. It is used for materials, modeling materials for castings, and medical casts. The colorless and transparent is called dialysis gypsum, and the good quality is used for optical materials.

Gil-Gi-Gi (P. Platycodon grandiflorum A. DC.) Contains saponins as the root of the bellflower, and its known constituents are polygalacic acid, platicodigenin and glucose. In addition, α-spinasterol (α-spinasterol), α-spinasteryl-β-d-glucoside (α-spinasteryl-β-d-glucoside), 5α-sigmastera-7-ene-3β-ol ( 5α-stigmasta-7-en-3β-ol), betulin, beulin, inulin, and platinumcodonin. Its pharmacological action has the efficacy of abolition, sputum, and drainage (Information and Sinmin-kyo Ilbo medicinal herb, Yeonglimsa, pp1089-1090, 1998) .

Ligusticum tenuissimum KITAG. Is the root and root of the root and the same root plant, which contains essential oils, and its main components are 3-butyl phthalide and cndilide. Its root contains 1.5% of essential oils, and its pharmacological effect is that it has the effect of releasing acid (發表 散寒), Geopungjitong (祛風 止痛) (Information and Shinmingyo medicinal herbs), Yeonglimsa, pp 428-429, 1998).

Horseback riding is the rooting of the Stork Horse Riding ( Cimicifuga foetida L.) and its cohort, which contains cicimicifugine, salicylic acid, caffeic acid and ferula. It is. Its pharmacological action has antimicrobial activity against Mycobacterium tuberculosis, it acts on the circulatory system, and other sedative effects (Information Interpretation and Sinmin-kyo Ilbo Herbal Medicine (Medicinal Medicine), Daelim, pp485-487, 1998).

Licorice ( Glycyrrhiza uralensis FISCH.) Is a perennial herb, which is a herbaceous perennial herb. It is used as a drug, and itself has a weakness such as neutralization of poison. For example, licorice has the effect of protecting the liver and facilitating liver function to regulate fatigue, and taking licorice reduces the burden on the liver by its detoxification. Triterpene-based saponins and glycyrrhizin are contained in the roots and roots of plants, so they have all detoxification effects on bacterial toxins as well as drug addiction, food poisoning, and metabolism in the body. There is a function and regulation of thyroid sebum hormone. Licorice has anti-inflammatory and anti-allergic reactions, antagonistic action against acetylcholine, and a potent effect of adrenaline stimulation. 1998).

White paper refers to the roots of Angelica dahurica BENTH. Et HOOK.f. and the same plant, which contains essential oils and the roots of by-angelicin and roots. Angelicol (byak-angelicol), oxypeucedanin, imperatonin, torin, isoimperatonin, pelopopterin, etc. It contains the toxin angelicatoxin. Its pharmacological action has antibacterial activity against Sonne, Typhos, and Cholera. A small amount of white poison is applied to the animal's training and blood vessels, respiratory center, vagus nerve and spinal cord. Excited to increase blood pressure, slow the pulse and take deep breaths, at the same time cause flexible, vomiting and when used in large quantities, causing spasticity of spasticity and even general paralysis. .

As mentioned above, much research has been conducted on the efficacy and toxicity of each of the roots, golden, gypsum, street lamp, hard bones, horse riding, licorice and white paper, which have been used for a long time in the oriental medicine and civilian without special toxicity or side effects Has been made. However, no research literature or other data has been disclosed or taught about the composition for the prevention and treatment of hyperthyroidism containing the herbal extract.

In this regard, the present inventors have searched for herbal medicines to treat hyperthyroidism and improved the usability as medicines. It was confirmed that the herbal extract containing safe Baekho-tang extract as an excellent effect in the treatment of hyperthyroidism and completed the present invention.

An object of the present invention relates to a pharmaceutical composition for the prevention and treatment of hyperthyroidism, containing as an active ingredient a complex herbal extract consisting of brown root, golden, gypsum, by-product as a main medicine, Gilyeong, Gobon, horse riding, licorice and white paper as an active ingredient will be.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention and treatment of hyperthyroidism comprising the root, golden, gypsum as a main component and a pharmaceutically acceptable carrier, excipient or diluent.

In addition, the present invention provides a pharmaceutical composition for preventing and treating hyperthyroidism, which includes Gilyeong, Gobon, Horse Riding, Licorice, and white paper as an additional ingredient, and includes a pharmaceutically acceptable carrier, excipient, or diluent.

The extract includes a polar solvent selected from water, a lower alcohol having 1 to 4 carbon atoms or a mixed solvent thereof, preferably an extract available in water.

Hereinafter, the present invention will be described in more detail.

The extract is characterized in that it is included in the form of a pulverized product, extract or powder extract thereof. At this time, the composition according to the present invention includes a mixed extract comprising a single extract of each herbal medicine, or a complex extract prepared by extracting a plant containing two or more of each herbal medicine.

The extract according to the present invention may be a crude extract prepared by applying a solvent extraction method using a conventional water extract, alcohol, etc. as a solvent, and may also be a fraction extract purified using column chromatography. Extraction method according to the invention can be applied to all extraction methods known to those of ordinary skill in the art, for example, extraction with water, alcohol or mixed solvents, extraction method using a bath or room temperature, etc. Including but not limited to.

In a preferred embodiment of the present invention, dried herbal medicines may be washed to remove foreign substances, etc. present on the surface of the material, and then dried in a dryer, mixed in an appropriate blending ratio, and ground to obtain the herbal powders. In addition, 1 to 20 times volume / weight of distilled water, lower alcohol having 1 to 4 carbon atoms or a mixed solvent thereof, preferably about 1 to 20 times, and most preferably about 3 to 10 times of the powdered complex herbal medicines. With pear water, cold soaking, hot water extraction, ultrasonic extraction, reflux cooling extraction, preferably for about 1 hour to 10 days, preferably about 2 to 5 hours, at an extraction temperature of 20 to 100 ° C., preferably 50 to 70 ° C., preferably The extract obtained by using the hot water extraction method may be filtered and concentrated under reduced pressure to obtain a water extract.

The extract of the present invention is not limited to this composition ratio, but is based on the dry weight of each herbal medicine 4 ~ 5: 1.5 ~ 2: 0.5 ~ 1: brown root, golden, gypsum, Gilyeong, ancient bone, horse riding, licorice and white paper 0.5-1: 0.5-1: 0.5-1: 0.5-1: It is preferable to contain in the ratio of 0.5-1. The herbal extracts have been used as food for a long time as the extract of the present invention extracted therefrom also has no problems such as toxicity and side effects.

The complex herbal extract prepared by the above method is effective in preventing and treating hyperthyroidism by inhibiting proliferation of FRTL-5 (Fisher rat thyroid cells) thyroid cells and reducing the concentration of T4, a thyroid hormone.

The present invention is a thyroid function comprising a complex herbal extract consisting of brown root, golden, gypsum, streetscape, hardwood, horseback riding, licorice and white paper prepared by the method as an active ingredient and a pharmaceutically acceptable carrier, excipient or diluent It provides a pharmaceutical composition for the prevention or treatment of hyperalgesia.

The pharmaceutical composition for preventing or treating hyperthyroidism of the present invention comprises 0.01 to 50% by weight of the extract based on the total weight of the composition.

Pharmaceutical dosage forms of the extracts of the present invention may be used in the form of their pharmaceutically acceptable salts, and may be used alone or in combination with other pharmaceutically active compounds, as well as in a suitable collection.

Pharmaceutical compositions comprising extracts according to the invention, in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral preparations, suppositories and sterile injectable solutions, respectively, according to conventional methods. Can be formulated and used. Carriers, excipients and diluents that may be included in the composition comprising the extract include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate , Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like, and such solid preparations may include at least one excipient such as starch, calcium carbonate and sucrose in the extract. ) Or lactose, gelatin and the like are mixed. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. . Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

Preferred dosages of the extracts of the present invention vary depending on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, and may be appropriately selected by those skilled in the art. However, for the desired effect, the extract or compound of the present invention is preferably administered at 10 to 2000 mg / kg, preferably at 100 to 1000 mg / kg. Administration may be administered once a day or may be divided several times.

The pharmaceutical composition of the present invention can be administered to various mammals such as rats, mice, livestock, humans, and the like. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injections.

Complex herbal extract of the present invention is a drug that can be used with confidence even when taken for a long time for the purpose of prevention because there is little toxicity and side effects.

The present invention comprises a composite herbal extract consisting of brown root, golden, gypsum, gilyeong, hard bones, horse riding, licorice and white paper showing the preventive effect of hyperthyroidism as an active ingredient and a food supplement acceptable food supplement Provide food.

In addition, a compound herbal extract consisting of root, golden, gypsum, gilyeong, hard bones, horse riding, licorice and white paper may be added to food or drink for the purpose of preventing hyperthyroidism, but the food type is not particularly limited. For example, various foods such as sweets, breads, noodles, and the like, drinks such as water, soft drinks, fruit drinks, gums, teas, vitamin complexes, seasonings, and health functional foods. At this time, the amount of the extract or compound in the food or beverage, in general, in the case of the health functional food composition of the present invention can be added to 0.01 to 15% by weight, preferably 0.1 to 5% by weight of the total food weight, health drink The composition may be added at a ratio of 0.01 to 30 g, preferably 0.1 to 1 g based on 100 ml. Since the health functional food of this invention obtained in this way contains the composition of this invention, it is a food which can fully utilize the health prevention effect and health treatment effect which the compound of this invention has.

Food supplement additives as defined herein include food additives customary in the art, such as flavorings, flavoring agents, colorants, fillers, stabilizers, and the like, and are exemplified below.

The dietary supplement of the present invention includes the form of tablets, capsules, pills or liquids.

The health beverage composition of the present invention has no particular limitation on the liquid component except for containing the extract or compound as essential ingredients in the indicated proportions, and may contain various flavors or natural carbohydrates, etc. as additional ingredients, like ordinary beverages. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those mentioned above, natural flavoring agents (tauumatin, stevia extract (for example rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The proportion of natural carbohydrates is generally about 1-20g, preferably about 5-12g per 100ml of the composition of the present invention.

The food of this invention is easily obtained by adding the process of adding the composition of this invention mentioned above to the manufacturing process of the base food, or by adding the process of adding the composition of this invention mentioned above after manufacture of the foodstuff which is a base material. Can be. At this time, a taste and odor correction agent may be added as needed.

In addition to the above, the composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavoring agents, colorants and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. The compositions of the present invention may also contain pulp for the production of natural fruit juices and fruit juice beverages and vegetable beverages. These components can be used independently or in combination. The proportion of such additives is not so critical but is generally selected from the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

Hereinafter, the present invention will be described in detail by Examples and Experimental Examples.

However, the following Examples and Experimental Examples are only illustrative of the present invention, and the content of the present invention is not limited to the following Examples and Experimental Examples.

Example 1. Preparation of Complex Herbal Extract

Brown root, golden, gypsum, gilkyung, hard bone, horse riding, licorice and white paper purchased from Kyunghee Medical Center A total of 192g of 80g, 32g of gold , 16g each of gypsum, Giltyeong, Gobon, horseback riding, licorice and white paper were put together in 1.5ℓ of distilled water and heated and extracted at 10 ℃ for 4 hours. The filtrate was filtered through a rotary evaporator (model NE- (1, Tokyo Chemical Co., Ltd.), concentrated under reduced pressure and dried with a freeze dryer (model FD-1, Tokyo Chemical Co., Japan). This lyophilized After dissolving 1 g of the first extract of the drug in 10 ml of distilled water and heating and extracting again in a 90 ° C. water bath for 2 hours, the supernatant was collected by centrifugation at 14000 rpm for 20 minutes (yield 11.8%). The supernatant was filtered through a 0.2 mm diameter filter paper and sterilized and stored at -70 ° C until used as a sample for the experiment.

Reference Example 1. Cell Culture

FRTL-5 (Fisher rat thyroid cells) thyroid cells used in this experiment were distributed by Professor Song Min-ho (Department of Internal Medicine, Chungnam National University). Culture of FRTL-5 cells was performed in Coon's modified Ham's F-12 medium, KC Biological, Louis, MO, USA, 5% fetal bovine serum for 6H medium. (calf fetus serum, Gibco; Invitrogen Corp., CA, USA), 10 μg / ml insulin (insulin, Sigma Chemical Co., St. Louis, MO, USA), 5 μg / ml transferrin (Sigma), 10 ng / ml lycyl-L-histidyl-L-lysine acetate (Sigma), 10 ng / ml somatosatin (Sigma), 10 uM cortisol (cortisol, Sigma), 1 mU / Ml TSH (Sigma), 100 U / ㎖ penicilin (Sigma), 100 ㎍ / ㎖ Streptomycin (Sigma) was added to the culture medium, 1MU / ㎖ TSH for 5H medium (medium) Except the remaining culture was added to the culture medium was cultured in a 37% 5% CO ₂ cell culture. Medium was changed every 2-3 days, the passage interval of the cells was 7-10 days, FRTL-5 cells used in this experiment was used cells in passage 5-15 generation.

Reference Example 2. Statistical Analysis

Statistical comparisons were performed using the TurkeyPad PRISM statistical package (ver 2.00, Graphpad software inc., San Diego, USA) with Turkish one-way analysis of variance (Tuckey's) post-hoc test). Each value was expressed as mean ± S.D., and the two-tailed p value was based on when the p value was <0.05.

Experimental Example 1. Measurement of Cell Activity

Cell activity was measured by dye reduction assay using MTT (3- (4,5-dimethylthiazol) -2,5-diphenyltetrazolium bromide, Sigma Chemical Co., St. Louis, MO, USA). The FRTL-5 cells cultured in Reference Example 1 were dispensed into 1 × 10 ⁴ cells / well in a 96 well cell culture vessel, followed by incubation for at least 12 hours, followed by 24 hours in free serum media (serum-free media). It was. After that, the cell culture solution was removed, and the complex herbal extract obtained in Example 1 was incubated for 2 days after administration at various concentrations under free TSH (TSH-free) or TSH-containing media (TSH-containing media). After incubation for about 2-3 hours with MTT, the culture was removed. Cells were digested by addition of 100 μl of DMSO (dimethylsulfoxide), and then absorbance was measured at 570 nm with a photometer (spectrophotometer, Dynatech, Inc., Alexandria, VA, USA).

As a result of performing the experiment, as shown in FIG. 1, the cell survival rate decreases depending on the concentration of the complex herbal extract (AJBHT of FIG. 1) of the present invention. As judged, the following experiments were conducted at 15 and 30 µg / ml.

Experimental Example 2 Inhibition of Proliferation of FRTL-5 Thyroid Cells

FRTL-5 thyroid cells of Reference Example 1 were cultured for 1-2 days under F-12 modified 6's medium of ham containing 1 mU / ml TSH. After the incubation, the cells were treated with 0.05% Trypsin-0.53 mM EDTA solution, harvested into individual cells, and washed twice with PBS (phosphate buffered saline) solution containing 5% fetal calf serum. These cells were adjusted to a concentration of 1 × 10 ⁵ cells / well and incubated for 72 hours in FUS modified 5-12 medium of ham without 1 mU / ml TSH. After incubation, the cells were washed twice with PBS solution, and these cells were converted into 6H media containing the compound herbal extract of the concentration determined in the cell activity experiment of Experimental Example 1 and the control drug MMI (methimazole) for 48 hours. After inducing the proliferation reaction, the cells were harvested as individual cells by treatment with 0.05% trypsin-0.53 mM EDTA solution, and each cell number was calculated by direct cell counting under a microscope. In the experiment, the experiment was divided into a control group without addition of the compound herbal extract and MMI, an experimental group with the addition of the compound herbal extract, and a positive control with the addition of MMI.

As a result of performing the experiment, in the control group, the MMI-administered group and the 15 µg / ml complex herbal extract-administered group (AJBHT in FIG. 2), inhibition of the proliferation of FRTL-5 thyroid cells was not significantly observed. In the group administered with the ㎍ / ㎖ extract, it was confirmed that the proliferation of FRTL-5 thyroid cells decreased by approximately 0.4-fold compared to the control group, significantly inhibited.

Experimental Example 3 Measurement of DNA Synthesis of FRTL-5 Thyroid Cells

The degree of DNA synthesis of FRTL-5 thyroid cells was determined using the ability of ³ H-thymidine to bind to trichloroacetic acid-insoluble material. FRTL-5 thyroid cells cultured for 1-2 days under 6H media were attached to a 96 well cell culture vessel at 1 × 10 ⁵ cells / well, and then cultured for 72 hours under 5H media. Thereafter, the mixture was converted to 6H media including the compound herbal extract obtained in Example 1 and MMI, and cultured for 48 hours, and the final 4 hours were administered with ³ H-thymidine (1 uCi / ml, Amersham, Uppsala, Sweden). It was. Thereafter, the culture medium was removed to decompose cells with 0.1 M KOH, and DNA synthesis by cell proliferation was measured using a scintillation counter.

As a result of the experiment, as shown in Figure 3, the control group and the group administered with 1 mM MMI high binding of ³ H-thymidine, which means that the synthesis of DNA of FRTL-5 thyroid cells occurred actively, On the contrary, in the group administered with the herbal extract 15, 30 ㎍ / ml of the present invention (AJBHT of FIG. 3), the binding to ³ H-thymidine was inhibited significantly, which significantly inhibited DNA synthesis of FRTL-5 thyroid cells. It could be confirmed.

Experimental Example 4 Synthesis of T4 and TSH in FRTL-5 Thyroid Cells

Synthesis measurement of T4 (Thyroxine) of FRTL-5 thyroid cells was carried out using the Rodent T4 ELISA test kit (Endocrine technologies Inc., USA), and measurement of synthesis of thyroid stimulating hormone (TSH) was performed by Rodent TSH. Measurement was performed using an Elisa test kit (Rodent TSH ELISA test kit, Endocrine technologies Inc.). FRTL-5 thyroid cells cultured for 1-2 days under 6H media were attached to a 24 well cell culture vessel at 1 × 10 ⁵ cells / well, and then cultured for 72 hours under 5H medium. Then, the mixed herbal extract obtained in Example 1 and 6H media containing MMI were incubated for 48 hours, and the supernatants were collected. 50 μl of each supernatant and standard T4 solution collected for measurement of T4 concentration were placed in antibody-coated microtiter wells, followed by 100 μl of T4-HRP mixed solution, 100 μl of TBM color solution, After 50 μl of 2N HCl stop solution was added and reacted, T4 concentration was quantified using an ELISA reader at 450 nm. To determine the concentration of TSH, 100 μl of each collected supernatant and standard T4 solution were placed in antibody coated microtiter wells, followed by 100 μl of TSH enzyme mixed solution, 100 μl of TBM color solution, After the reaction by adding 50 μl of 2N HCl stop solution, the TSH concentration was quantified using an ELISA reader at 450 nm.

As a result of performing the experiment, as shown in FIGS. 4A and 4B, in the case of T4 concentration, the control group was about It showed a T4 concentration of 8.85 ng / ml, but about 4.9 ng / ml when the MMI was administered, about 15 ng / ml of the combined herbal extract, and about 4.1 ng for the 30 µg / ml group (AJBHT in FIG. 4A). By showing the T4 concentration of / ㎖, 3.1ng / ㎖ it was confirmed that the concentration of T4 was reduced depending on the concentration of the complex herbal extract of the present invention (Fig. 4a).

On the other hand, the TSH concentration showed a slight decrease only in the MMI-administered group, and the control group and the group administered the compound herbal extract of the present invention (AJBHT in FIG. 4B) showed that the TSH concentration was not reduced. 4b)

Experimental Example 5 cAMP level measurement of FRTL-5 thyroid cells

The measurement of cAMP levels in FRTL-5 thyroid cells was measured using the cAMP RIA kit (New England Nuclear). FRTL-5 thyroid cells cultured for 1-2 days under 6H media were attached at 1 × 10 ⁵ cells / well and attached, followed by incubation for 72 hours under 5H media. Thereafter, the mixture was converted to 6H media containing the compound herbal extract and MMI obtained in Example 1 and incubated for 4 hours. The culture was replaced with 250 μl Hank's Balanced Salt Solution (HBSS) containing 100 μl / ml TSH, 0.4% BSA, 10 mM HEPES (pH 7.4) and 0.5 mM IMX (3-isobutyl-L-methylxanthine) for 2 hours. After incubation, the culture solution was removed. Here, 300 μl ethanol was added to separate cAMP from the cells and incubated at −20 ° C. for about 12 hours. After incubation, ethanol was collected, dried, and the assay buffer of cAMP lea kit was added. Then, diphenylamine solution was added to each well to measure DNA, and each value was expressed as pmol / well.

As a result of the experiment, as shown in FIG. 5, the cAMP level was slightly decreased in the MMI-administered group as compared to the control group, and the compound herbal extract of the present invention was treated with 15 µg / ml (AJBHT in FIG. 5) similar to the control group. Although the cAMP level was shown, the composite herbal extract showed a markedly decreased cAMP level of 1.5 mmol / ml in the 30 µg / ml administration group, which was significantly reduced compared to the control group.

Experimental Example 6 Measurement of Tg and TPO Gene Expression in FRTL-5 Thyroid Cells

6-1. RNA Isolation of FRTL-5 Thyroid Cells

FRTL-5 thyroid cells cultured for 1-2 days under 6H media were suspended in 10 cm ² dishes at a concentration of 1 × 10 ⁶ cells / dish, and then cultured for 72 hours under 5H media. Thereafter, the mixture was converted to 6H medium including the compound herbal extract obtained in Example 1 and MMI, incubated for 48 hours, the supernatant was removed, and RNA sol B (RNA Zol B, TELTEST; Friendswood, TX, USA) was collected from the collected cells. RNA was isolated.

6-2. Measure expression of Tg and TPO genes

The expression of Tg (Thyroglobulin) and TPO (Thyroid peroxidase) genes in FRTL-5 thyroid cells was measured using a semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR). PCR buffer and 5 mM MgCl ₂ , 1 mM dNTP, 20 U RNasin, 2.5 μM oligo (dT), 100 U mole in 1 μg RNA of FRTL-5 thyroid cells isolated in Experimental Example 6-1 Ronnie rat leukemia virus transcriptase (Moloney murine leukemia virus reverse transcriptase) was mixed and reacted for 50 minutes at 42 ℃, 15 minutes at 70 ℃. PCR (Eppendorfs Mastercycler Gradient PCR device, Eppendorf, Hamburg, Germany) by mixing primers of PCR buffer, 2.5 mM dNTP, 2 U Taq polymerase and 5 pM to each cDNA (complementary DNA) obtained through reverse transcription ) Was used for chain polymerization. A - 'and 5'- GTAGCCTGCCAGAATCTATG 3', respectively, of the nucleotide sequence of the primers in the case of Tg 5'- ACTCCACAGATGACTATGCC used in the 3 'and 5'- GCATGACTTTCAGAGAGAGG - - 3' In the case of a, TPO 5'- GCCTCCTGTCTGTAAAGATG 3 In the case of β-actin used as a control group, 5'-CCTCTATGCCAACACAGT-3 'and 5'-AGCCACCAATCCACACAG - 3' were used, respectively. The cycle and annealing temperature of each chain polymerization reaction is 30 cycles at 60 ℃ for Tg, 30 cycles at 60 ℃ for TG, and 30 cycles at 55 ℃ for β-actin. The base size of the expected chain polymerization reaction was 267 bp for Tg, 164 bp for TPO, and 155 bp for β-actin as a control. Each result of the chain polymerization reaction obtained through the above process was stained with ethidium bromide (ethidium bromide) and confirmed on a 2% agarose gel (agarose gel) and then each expression was measured using a densitometry (densitometry). Measured expression was expressed by converting the value of β-actin as a control to 1 value.

As a result of performing the experiment, as shown in FIGS. 6, 7A and 7B, the Tg gene was significantly reduced in the 30 ㎍ / ml administration group of the complex herbal extract of the present invention (AJBHT of FIGS. 6, 7A and 7B), and TPO. In the case of the composite herbal extract administration group of the present invention did not show a significant reduction compared to the control group.

Experimental Example 7. Clinical Trial

7-1. Target and Statistics Processing

This study conducted a thyroid function test and clinical symptom analysis of 48 patients with Graves disease who visited the Department of Internal Medicine, Kyunghee Medical Center from February 2002 to August 2002. Eleven patients with abnormal findings and hyperthyroidism were selected. Of these, prospective studies were conducted on five subjects who agreed to this study (see Table 1). All subjects had no disease other than Graves' disease and all patients during the treatment period did not take any other drugs except the combination herbal extract of the present invention.

Case gender age Antithyroid Therapy Clinical signs drugs Duration (m) Fatigue Accounting goitre Eye disease One F 34 PTU 2T / day 13 + + + - 2 M 14 PTU 2T / day 7 + - - + 3 F 35 PTU 1T / day 15 + + - - 4 F 36 PTU 6T / day 72 + + + + 5 F 33 PTU 6T / day 60 + + + +

In Table 1, PTU is 6-propyl-2-thiouracil, and MMI is 1-methyl-2mercaptoimidazole.

The ratio of males and females was 1: 4, and there were many women. The mean age at the time of Graves' disease was 26 years old (13 ~ 30 years old) and the study period was 5 months (3 ~ 10 months). The five patients who participated in this study were taking PTU before their visit. The most common symptom was severe fatigue (five), followed by heartworm (four), cervical Swelling, dysmenorrhea, insomnia, exophthalmos (3 cases each), heat intolerance (2 cases), hydration (1 case).

The statistical analysis of this study was conducted to evaluate the significance of changes in thyroid function test and subjective symptoms (VAS) after the initiation and termination of treatment.The graph pad PRISM statistical package, ver 2.00, Graphpad software inc., San Diego, USA) was used to verify the Paired sample T-test method. Each thyroid function test and VAS score were expressed as mean ± standard deviation (mean ± S.D.), and the two-tailed p value was based on the p-value <0.05.

7-2. Clinical trial

The effects of the combined herbal extract of the present invention on thyroid hormone regulation and clinical symptoms of Graves' disease patients were examined. With the consent of the patients, the anti-thyroid drug was continuously administered three times a day with the complex herbal extract of the present invention. The most common complaints of thyroid function test and patient's address were measured by visual analogue scale (VAS), and repeated one-month follow-up tests were performed.

In addition, in order to observe the effects of the composite herbal extracts of the present invention on fatigue and heartworm, which are the main subjective symptoms of Graves' disease patients, the results of pre- and post-administration of the composite herbal extracts of the present invention were analyzed. The measurement of VAS was carried out using a 10cm standard, which allows the patient to indicate the degree of subjective symptoms between the point of no subjective symptoms (0) and the point of severe symptoms (10). The measurement was carried out by recognizing the previous measurement point before each measurement and re-measurement.

The thyroid function test was performed by the Department of Clinical Pathology, Kyung Hee Medical Center, based on TSH (Thyroid stimulating hormone), T ₃ (Tuiiodothyronine), T ₄ (Thyroxine) and free T ₄ (free T4). At least three trials were performed.

As a result of conducting the clinical trial, as shown in Table 2 and FIG. 8, the T ₃ at the start of the clinical trial was significantly reduced from 246.60 ± 65.08 ng / dL to 167.80 ± 50.72 ng / dL after administration of the complex herbal extract of the present invention. The results were normal (78.80 ± 26.37 ng / dL, p <0.05), and all cases were normal after the end of the trial, except in Case 5, where T ₃ levels were significantly higher at the start of the study. T ₄ also significantly reduced from 12.54 ± 4.66 μg / dL to 6.98 ± 2.06 μg / dL after administration of the herbal extract of the present invention (5.56 ± 1.99 μg / dL, p <0.05). After T ₄ values showed a normal range. TSH showed an effect of increasing from 0.14 ± 0.13 mU / L before the start of the test to 1.97 ± 2.61 mU / L after the end of the test, but no statistical significance was observed. Free T ₄ also decreased from 2.69 ± 1.85 ng / dL to 1.73 ± 1.42 ng / dL by administration of the herbal extract of the present invention, but there was no statistical significance. Therefore, the herbal extract of the present invention was confirmed to have a significant effect on T3, T4 thyroid hormone.

Case TSH (mU / L) T ₃ (ng / dL) T ₄ (μg / dL) Free T4 (ng / dL) I'm after I'm after I'm after I'm after One 0.11 6.44 252 106 17.0 4.8 4.12 0.67 2 0.37 1.23 229 170 9.5 6.6 1.05 1.33 3 0.12 0.08 275 158 17.9 10.4 3.54 1.84 4 0.10 1.94 150 158 10.9 6.5 0.37 0.69 5 0.02 0.15 327 247 7.4 6.6 4.36 4.12

In addition, as shown in Table 3 and FIG. 9, in the case of fatigue, the change in VAS was significantly decreased from the mean score of 8.20 ± 0.84 at the start of the test to 4.60 ± 1.52 at the end of the test (p <0.05). Heartworm symptom also showed an effect of significantly reducing from 7.50 ± 1.00 to 2.75 ± 1.50 by administration of the herbal extract of the present invention (p <0.05).

Case Fatigue Accounting I'm after I'm after One 9 5 6 2 2 8 5 - - 3 8 6 8 5 4 9 2 8 2 5 7 5 8 2

Experimental Example 8. Toxicity Test

In order to investigate the presence or absence of toxicity by the oral administration of the extract of Example 1 to the rat male and female rats of the 1 g / kg, 2 g / kg and 5 g / kg three doses of 5 The animals were orally administered once and observed for 14 days of death, general symptoms, weight change and autopsy findings. The result of this test is as follows.

(1) There were no deaths observed during the entire test period in all administration groups of the composition of the present invention during the test period, and there was no change in general symptoms specifically observed compared to the control group.

(2) Body weight change showed significant weight loss on day 3 after administration in 5 g / kg dose group, but was not different from control group in all other administration groups.

As a result, no clinical symptoms were observed in all the test substance-treated groups compared to the death and control groups, and there were almost no specific symptoms in the anatomical changes at the time of body weight and autopsy. In addition, since the composition did not show a clear toxicity at the dose of 5 g / kg or less, LD ₅₀ (lethal dose) in rats by oral administration is determined to be more than 5 g / kg.

Hereinafter, the formulation examples of the pharmaceutical preparations will be described, which are intended to explain in detail only, not to limit the present invention.

Formulation Example 1 Preparation of Injection

Extract of Example 1 ............................ 1.0 mg

Sodium metabisulfite ........ 3.0mg

Methylparaben ............... 0.8 mg

Propylparaben ...................... 0.1 mg

Sterile distilled water for injection ..............

The above ingredients are mixed and made into 2 ml by a conventional method, and then filled into 2 ml ampoules and sterilized to prepare an injection.

Formulation Example 2 Preparation of Tablet

Extract of Example 1 ...................................... 20 mg

Lactose 100 mg

Starch .............................. 100 mg

Magnesium Stearate ...............

The above components are mixed and tableted according to a conventional method for producing tablets to produce tablets.

Formulation Example 3 Preparation of Capsule

Extract of Example 1 ............................ 10 mg

Lactose 50 mg

Starch ........................................ 50 mg

Talc ........................................ 2mg

Magnesium Stearate ...............

Capsules are prepared by mixing the above ingredients and filling into gelatin capsules according to a conventional method for preparing capsules.

Formulation Example 4 Preparation of Liquid

Extract of Example 1 .................. 100 mg

Sugar .................................. 20g

Isomerized sugar ......................................... 20 g

Lemon Flavor ......................

Purified water is added to the whole ........... 100ml

The above components are mixed according to a conventional method for preparing a liquid, filled into a 100 ml brown bottle, and sterilized to prepare a liquid.

Formulation Example 5 Preparation of Healthy Food

Extract of Example 1 ...................................... 1000 mg

Vitamin Mixture ......................

Vitamin A Acetate ......... 70 μg

Vitamin E ................................... 1.0 mg

Vitamin B ₁ ................................. 0.13 mg

Vitamin B ₂ ................................. 0.15 mg

Vitamin B ₆ ....................... 0.5 mg

Vitamin B ₁₂ ................................. 0.2 μg

Vitamin C ......................................... 10 mg

Biotin ......................................... 10 μg

Nicotinamide ........................................ 1.7 mg

Folic acid ......................................... 50 ㎍

Calcium Pantothenate ......................................... 0.5 mg

Inorganic mixtures ...............

Ferrous Sulfate ......... 1.75 mg

Zinc Oxide ..... 0.82 mg

Magnesium Carbonate ............... 25.3 mg

Potassium monophosphate ......................................... 15 mg

Dibasic calcium phosphate ............ 55 mg

Potassium Citrate ..... 90 mg

Calcium Carbonate ... 100 mg

Magnesium Chloride ............... 24.8 mg

Although the composition ratio of the vitamin and mineral mixture is a composition suitable for a relatively healthy food in a preferred embodiment, the composition ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method. The granules may be prepared and used for preparing a health food composition according to a conventional method.

Formulation Example 6 Preparation of Healthy Drink

Extract of Example 1 ..................... 1000 mg

Citric Acid .................................... 1000 mg

Oligosaccharide ........................... 100 g

Plum concentrate ........................... 2 g

Taurine ......................................... 1 g

Purified water is added .............. 900 ml total

After mixing the above components in accordance with a conventional healthy beverage production method, and stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed sterilization and then refrigerated and stored in the present invention For the preparation of healthy beverage compositions.

Although the composition ratio is a composition suitable for a preferred beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, use purpose.

Compound herbal extract of the present invention consisting of the root, golden, gypsum, hardwood, hard bones, horse riding, licorice and white paper extract is a representative cause of hyperthyroidism because it does not affect TSH while lowering the level of thyroid hormone (T4), Since it has an excellent effect on Graves' disease having anti-thyroid resistance and is safe for the human body, it can be useful for medicines and dietary supplements for the prevention and treatment of hyperthyroidism.

Claims (6)

A pharmaceutical composition for the prevention and treatment of hyperthyroidism, which includes brown root, gold, and gypsum as a main ingredient, and includes a pharmaceutically acceptable carrier, excipient, or diluent. The pharmaceutical composition for preventing and treating hyperthyroidism according to claim 1, further comprising gilyeong, honbon, horse riding, licorice and white paper as an additional ingredient, and a pharmaceutically acceptable carrier, excipient or diluent. According to claim 2, wherein the herbal extracts are 4 ~ 5: 1.5 ~ 2: 0.5 ~ 1: 0.5 ~ 1 based on the dry weight of each herbal medicine, brown, golden, gypsum, hardened, hard bones, horse riding, licorice and white paper : 0.5 to 1: 0.5 to 1: 0.5 to 1: The pharmaceutical composition characterized by containing in the ratio of 0.5 to 1. The pharmaceutical composition according to any one of claims 1 to 3, wherein the extract is soluble in a polar solvent selected from water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. A dietary supplement comprising a complex herbal extract consisting of brown root, golden, gypsum, hardwood, hardwood, horseback riding, licorice and white paper showing the prevention of hyperthyroidism as an active ingredient and a food acceptable additive. The health functional food according to claim 5, wherein the health functional food is a tablet, a capsule, a pill or a liquid.

Images