KR20030096447A - Short forms of chemokine beta-8 - Google Patents

Abstract

The present invention relates to novel polypeptides of truncated human chemokine beta-8 (Ckβ-8) and methods of using the polypeptides.

Description

SHORT FORMS OF CHEMOKINE BETA-8}

The present invention relates to polypeptides and polynucleotide sequences encoding short form chemokine beta-8 (Ckβ-8). In particular, the present invention relates to the use of polynucleotide and polypeptide sequences, the generation of polynucleotide and polypeptide sequences, and the inhibition of the action of such polypeptides.

Chemokines, also called interclean cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are small, inducible proinflammatory proteins. Generally, chemokines exhibit 20 to 75% homology at the amino acid level and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines are classified into two subfamily, alpha and beta. In alpha agua, the first two cysteines are separated by one amino acid and are therefore named "C-X-C" subgua. In the beta subfamily, the two cysteines are located contiguously and are therefore designated as "C-C" subfamily. The first cysteine forms a disulfide bond with the third cysteine and the second cysteine forms a disulfide bond with the fourth cysteine, whereby many chemokines form a similar tertiary structure. Structurally, many chemokines undergo proteolysis to yield functional "mature" proteins. This usually involves cleavage of the short leader sequence on the N-terminal portion of the protein. At least 14 distinct α-chemokines and at least 12 β-chemokines have been described at the protein and / or cDNA levels.

Interclean cytokines exhibit a variety of functions. One important feature is their ability to stimulate chemotactic migration of different types of cells such as monocytes, neutrophils, T lymphocytes, basophils and fibroblasts. The alpha and beta subfamily differ somewhat in their cell target selectivity. Most alpha chemokines attract neutrophils, fibroblasts, T cells and NK cells. Beta-chemokines mainly attract monocytes and T lymphocytes. Many chemokines possess preinflammatory activity and are involved in various stages of the inflammatory response. These activities include histamine release stimulation, lysosomal enzyme and leukotriene release, increased adhesion of target immune cells to endothelial cells, increased binding of complement proteins, induction of expression of granulocyte adhesion molecules and complement receptors, and respiratory rupture. In addition to their association with inflammation, certain chemokines have been shown to exhibit different activities. For example, macrophage inflammatory protein (MIP-1) can inhibit hematopoietic stem cell proliferation, platelet factor-4 (PF-4) is an effective inhibitor of endothelial cell growth, and interleukin-8 (IL-8) Promotes the proliferation of keratinocytes, GRO is an autocrine growth factor of melanoma cells. Chemokines have been implicated in many physiological and disease states, particularly those that possess inflammatory components. Examples thereof include, but are not limited to, lymphocyte exchange, wound healing, hematopoietic control and immunological diseases such as allergies, asthma and arthritis. Many chemokines were initially isolated as products of inflammatory responses. For example, MIP-1 was first isolated as endotoxin-induced preinflammatory cytokines produced by macrophages. Other members of the subfamily have been similarly identified based on amino acid sequence homology as well as inducing inflammation. It includes full length forms as well as shortened Ckβ-8 polypeptides of the invention.

According to a first aspect of the invention, a mixture of fragments, analogs and derivatives thereof, as well as biologically active, diagnostically or therapeutically useful novel polypeptides in truncated form of human Ckβ-8 This is provided.

According to a second aspect of the invention, isolated nucleic acid molecules encoding such polypeptides, including mRNA, DNA, cDNA, genomic DNA, as well as fragments, analogs and derivatives thereof that are biologically active, diagnostically or therapeutically useful Is provided.

According to a third aspect of the present invention, there is provided a recombinant technique comprising culturing a recombinant prokaryotic and / or eukaryotic host cell containing a nucleic acid sequence under conditions that promote expression of the protein, and subsequently recovering the protein. Methods of producing such polypeptides are provided.

According to a fourth aspect of the present invention there is provided a method of using said polypeptide or polynucleotide encoding said polypeptide for therapeutic purposes, such as protecting bone marrow hepatocytes from a chemotherapeutic agent during a chemotherapy period and for stimulating wound healing. .

According to a fifth aspect of the invention, an antibody against said polypeptide is provided.

According to a sixth aspect of the present invention there is provided an antagonist to said polypeptide that can be used to inhibit the action of such polypeptides, such as for use in treating aplastic anemia, myelodysplastic syndrome, asthma and arthritis.

According to a seventh aspect of the invention, a nucleic acid probe is provided comprising a nucleic acid molecule of sufficient length to specifically hybridize to a Ckβ-8 nucleic acid sequence.

According to an eighth aspect of the present invention, there is provided a diagnostic assay for detecting a disease associated with underexpression and overexpression of said polypeptide and a diagnostic assay for detecting mutations in nucleic acid sequences encoding said polypeptide.

According to a ninth aspect of the present invention, there is provided a scientific study of such polypeptides or polynucleotides encoding the polypeptides, in vitro purposes associated with the synthesis of DNA and the preparation of DNA vectors, for the purpose of developing therapies and diagnostics for the treatment of human diseases. The use as an excessive research reagent is provided.

These and other aspects of the invention will be apparent to those skilled in the art from the teachings herein.

DNA sequences encoding polypeptides structurally associated with pre-inflammatory “interclean” chemokine superfamily have been described. Polynucleotide sequences encoding full length Ckβ-8 (120 amino acids) were derived from the aortic endothelial cDNA library. The present invention relates to a novel shortened Ckβ-8 containing only 82, 76, 75 or 74 C-terminal amino acids in long form. In addition to the N-terminal amino acid, 21 residues of the signal peptide sequence are cleaved. For enteric Ckβ-8, the first two cysteine residues in these clones are at adjacent positions that place them "C-C", or are beta subfamily of chemokines. The presence of these motifs distinguishes them from the subfamily of chemokines (“CXC”) in which the first two cysteine residues are separated by one amino acid.

Polynucleotide sequences encoding mature polypeptides (SEQ ID NOs: 1, 2, 3, and 4) can be represented in any nucleic acid form, such as RNA, ssDNA, genomic DNA, etc., including additional coding and noncoding sequences associated with the polypeptide. have. Also included within the scope of the present invention are any DNA coding sequences that encode the same mature polypeptide due to the degeneracy of the amino acid code. Variants, alleles or naturally occurring sequences of these sequences are also included within the scope of the present invention. In addition, the present invention relates to a reading frame in which the coding sequence is identical to another DNA sequence that serves as a marker (eg, an HA tag) to assist in the expression or secretion of a protein from a cell or to identify the protein in a cell. Fused polynucleotides.

The invention also relates to a polynucleotide sequence which hybridizes to at least 50%, preferably at least 70%, sequence identity with the sequences described. These polynucleotides preferably encode polypeptides that retain the same biological function or activity as the mature polypeptide. Alternatively, the sequence may be a polynucleotide that retains identity to the sequence of the invention and hybridizes to this sequence but does not retain activity, preferably having 50 bases. Such sequences can be used as probes or PCR primers.

Polypeptides of the invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides. Derivatives of these polypeptides may be substituted with one or more amino acids; One or more amino acids contain substituents; The mature protein is fused with another compound; Or additional amino acids may be fused to mature proteins.

The polypeptide of the invention is preferably provided in isolated form, preferably in homogeneously purified form.

The present invention also relates to the production of a polypeptide comprising the polynucleotide of the present invention, a host cell genetically engineered with the vector, and a polypeptide of the present invention by recombinant techniques. Host cells are genetically engineered with the vectors (cloning vectors or expression vectors) of the invention. Culture conditions for activating a promoter, selecting a transformant, or amplifying the truncated Ckβ-8 gene in these cells will be apparent to those skilled in the art.

As long as the vector can replicate and survive in the host, the polynucleotide sequence can be included in the expression vector of any one of various expression vectors. The polynucleotide sequence inserted into the expression vector is under the control of a suitable promoter (LTR promoter) that induces mRNA synthesis. In addition, the expression vector may contain a ribosome binding site for translational initiation, a transcription terminator, an enhancer component that increases transcription (eg, SV40 late enhancer), and a suitable selection marker to ensure maintenance of the vector in the host (eg, ampi). Silin resistance genes). The host cell may be higher eukaryotic cells such as mammalian cells or insect cells, lower eukaryotic cells such as yeast, or prokaryotic cells such as bacteria. Constructs can be introduced into host cells in a variety of protocols. All of the above steps will be apparent to those skilled in the art. Host and vector selection steps as well as cloning steps are known in the art (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, New York (1989)).

Proteins can be synthesized in host cells under the control of suitable promoters. In addition, cell-free translation systems can be used to generate such proteins using RNA derived from the DNA constructs of the invention. Alternatively, polypeptides of the invention can be produced by synthesis with conventional peptide synthesizers.

After transformation or transfection of the appropriate host strain and growth to a suitable cell density of the host strain, the selected promoter is induced by suitable means (eg, temperature shift or chemical induction) and the cells are further cultured. Cells are typically harvested by centrifugation, triturated by physical or chemical means, and purified homogeneously by various methods (eg, chromatography, HPLC). Depending on the host cell used, the polypeptide can be modified in several ways (eg, glycosylation). In addition, the polypeptides of the present invention may comprise an original methionine residue.

Ckβ-8 intestinal is a chemotactic factor that attracts leukocytes and can therefore be used for a number of disease states as well as for various immunoregulatory and inflammatory functions. This protein is mainly expressed in tissues of hematopoietic origin. One of the important biological effects of Ckβ-8 polypeptides on leukocytes is that the migration of Ca ⁺⁺ reserves is stimulated. This migration is involved in the functional activation of the cell. Stimulation of differentiated EOL-3 cells with a mixture containing four shortened forms of Ckβ-8 (SEQ ID NOs: 1-4) resulted in an immediate increase in dose-dependent intracellular Ca ⁺⁺ . When tested individually, the short forms with SEQ ID NO: 4 were most active. In contrast, the long form of Ckβ-8 is about 1000 times less potent than the short form in Ca ⁺⁺ migration. The short-acting effects of the present invention include, but are not limited to, protection of bone marrow hepatocytes from chemotherapeutic agents during chemotherapy, removal of leukemia cells, stimulation of immune responses, control of hematopoietic and lymphocyte exchange, treatment of psoriasis, solid tumors, chronic or acute resistance It relates to the effectiveness of therapeutic uses, including improving host protection against infections and stimulating wound healing.

The polynucleotides and polypeptides of the present invention can be used as research reagents in the synthesis of DNA and in the preparation of DNA vectors and for the development of therapies and diagnostics for the treatment of human diseases (eg, expansion of immature hematopoietic progenitor cells). Can be. The fragment of the truncated Ckβ-8 polynucleotide sequence can also be used as a hybridization probe for separating other genes having high sequence similarity. Experimental techniques of this kind are known to those skilled in the art.

The present invention also relates to the use of these sequences as part of a diagnostic assay for detecting a disease or disease susceptibility associated with the presence of mutations in nucleic acid sequences. This disease is associated with underexpression of chemokine polypeptides. For example, individuals carrying mutations in the Ckβ-8 gene can be detected at the DNA level by various techniques such as PCR. Genetic testing based on DNA sequence differences can be performed by detecting changes in the electrophoretic mobility of the DNA fragments in the gel, with or without denaturing agents. Detection of specific DNA sequences can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing, RFLP analysis, and Southern blotting of genomic DNA. Mutations can also be analyzed by in situ analysis.

In addition, since the present invention can detect the presence of a disease or susceptibility to these diseases, such as the presence of a tumor, by overexpression of the protein as compared to a normal control tissue sample, altered Ckβ-8 protein in various tissues A diagnostic assay for detecting levels. Assays used to detect Ckβ-8 protein levels in samples derived from a host are known in the art and include, for example, radioimmunoassays, competitive binding assays, western blot assays, ELISA assays, and "sandwich" assays. have.

The present invention provides a method for identifying a receptor for a chemokine polypeptide. Genes encoding receptors can be identified by a number of methods known in the art, including ligand panning and FACS sorting.

Alternatives to receptor identification include photoaffinity binding of the labeled polypeptide to an extract that expresses a cell membrane or receptor molecule. Labeled complexes can be separated to perform microsequencing of proteins. The resulting amino acid sequences can be used to design a set of degenerate oligonucleotide probes to screen cDNA libraries to identify genes encoding putative receptors.

The present invention provides methods for screening compounds for identifying agonists and antagonists for chemokine polypeptides of the invention. Chemotaxis can be analyzed by placing cells chemically attracted by these polypeptides on top of a filter with pores (5 mm) large enough for the cells to pass through. A solution of the effective antagonist or agonist is placed in the lower chamber to prevent cells from moving or moving through the membrane for a period of time. As an alternative, the receptor of Ckβ-8 is incubated with the labeled polypeptide in the presence of the compound. The ability of a compound to block interaction or to interact with a receptor in the absence of a polypeptide can be measured.

Examples of effective truncated Ckβ-8 antagonists include polypeptides that bind to an antibody, an oligonucleotide that binds a polypeptide, or a receptor of a wild type polypeptide, but which do not retain biological activity. In addition, antisense techniques used to control gene expression may also be effective antagonists. The availability of the foregoing techniques will be apparent to those skilled in the art.

Antagonists can be used for the treatment of infectious diseases such as silicosis, sarcoidosis, idiopathic pulmonary fibrosis, idiopathic hypereosinophilic syndrome and endotoxin shock, all of which are made by preventing the production of polypeptides of the invention. Antagonists can also be used to treat atherosclerosis by preventing monocyte infiltration of arterial walls. Antagonists can be used to treat histamine-mediated allergic reactions and various immunological disorders associated with the dermis.

In addition, antagonists can be used to treat chronic and acute inflammation by preventing the induction of monocytes to the wound site. These antagonists can be used to treat inflammatory lung disease, general inflammation and rheumatoid arthritis by preventing the influx of monocytes into the affected area.

Antagonists may also be used to treat bone marrow failure in aplastic anemia or myelodysplastic syndromes. They can also be used to treat asthma and allergies as well as subepithelial basement membrane fibrosis that is characteristic of asthmatic lungs.

Chemokine polypeptides and agonists and antagonists can be used with suitable pharmaceutical carriers such as saline, buffered saline, dextrose, water, glycerol, ethanol and mixtures thereof. The formulation should be suitable for the mode of administration. The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical compositions of the present invention. Polypeptides, agonists and antagonists can be used in combination with other therapeutic compounds.

The pharmaceutical compositions can be administered by conventional methods such as topical, intravenous, intraperitoneal, intramuscular, intratumoral, subcutaneous, intranasal or intradermal routes in amounts effective to treat certain conditions. Its administration method should be obvious to those skilled in the art.

Chemokine polypeptides, agonists, or antagonists that are polypeptides can be used for expression of polypeptides in vivo in accordance with the present invention. This type of therapy is known in the art. For example, patient cells are engineered in vitro with DNA or RNA encoding shortened Ckβ-8 polypeptides, and the patient is provided with engineered cells expressing these polypeptides. Similarly, cells may be engineered in vivo for expression of polypeptides in vivo.

As is known in the art, retrovirus particles containing RNA encoding the polypeptides of the invention can also be used. Retroviral plasmid vectors can be used to transduce packaging cell lines (eg, PE501) in various ways (eg, electroporation) to form producer cell lines. In a preferred embodiment, the retrovirus expression vector containing the polynucleotide sequence is under the control of a promoter such as LTR and contains a selectable drug resistance marker (eg neo). The cell lines for the preparation and production of these vectors are familiar to those skilled in the art, and the techniques are described herein. Producer cell lines produce infectious retroviral vector particles comprising nucleic acid sequence (s) encoding said polypeptide. Such retroviral vector particles can be used to transduce eukaryotic cells such as fibroblasts or endothelial cells in vitro or in vivo. The transduced eukaryotic cells will then express the nucleic acid sequence (s) encoding the protein.

In addition, the sequences of the invention are useful for chromosome identification. Such sequences can be hybridized by specifically targeting specific locations on individual chromosomes. DNA mapping of chromosomes is an important step in correlating genes associated with disease. One of the techniques known to those skilled in the art involves the preparation of primers used for PCR screening of somatic hybrids containing individual human chromosomes. Only hybrids containing human genes corresponding to the primers will yield amplified fragments. Examples of other mapping methods known in the art include in situ hybridization, preliminary screening using labeled flow sorting chromosomes, detailing fragments of specific chromosomes using the same PCR primers and hybrids to construct chromosome specific cDNA libraries. Preliminary screening by fire, but is not limited thereto. Fluorescent in situ hybridization (FISH) of cDNA clones to cleavage mid-term chromosomes can be used to provide accurate chromosomal location in a single step.

Once the sequence is mapped to the correct chromosomal location, the physical location of the sequence can be related to genetic map data. The relationship between gene and disease can be confirmed by binding analysis. Any difference in cDNA or genomic sequence between a diseased individual and a non- diseased individual may be an indicator of disease. For example, mutations in DNA found only in affected individuals may be the causative agent of the disease.

Polypeptides, fragments or other derivatives thereof, or analogs thereof or cells expressing them can be used as immunogens to generate antibodies against them. For example, these antibodies can be polyclonal or monoclonal antibodies. The present invention also encompasses chimeric antibodies, single chain antibodies and humanized antibodies as well as products of Fab fragments or Fab expression libraries. Various procedures known in the art can be used to prepare such antibodies and fragments. Polyclonal antibodies prepared by standard procedures can be used to isolate polypeptides from tissues expressing such polypeptides. To provide monoclonal antibodies, any technique that provides antibodies produced in continuous cell line culture can be used. The methods described for single chain antibody preparation can be applied to prepare single chain antibodies against the immunogenic polypeptides of the invention. Mutant mice can also be used to express humanized antibodies against immunogenic polypeptides of the invention.

The invention will be further described by the following examples: however, it will be appreciated that the invention is not limited to these examples. In order to facilitate understanding of the following examples, some frequently used methods and / or terms are briefly described.

Starting plasmids herein can be constructed from commercially available, unlimited publicly available, or plasmids available in published procedures. Equivalent plasmids, such as those disclosed, are known in the art and will be apparent to those skilled in the art. Various restriction enzymes used herein to “degrade” DNA were commercially available and used reaction conditions, cofactors and other conditions as known to those skilled in the art. Size separation of the cleaved fragments was performed using an 8% polyacrylamide gel.

Oligonucleotides refer to single-stranded polydeoxynucleotides or two complementary polydeoxynucleotide strands that can be chemically synthesized. Such synthetic oligonucleotides do not possess 5 'phosphate and therefore cannot be ligated to other oligonucleotides without the addition of phosphate using ATP in the presence of kinases. Synthetic oligonucleotides will be ligated to fragments that are not dephosphorylated. Unless otherwise noted, transformation was performed as described in the methods of Graham, F. and Van der Eb, A., Virology, 52, 456-457 (1973).

The following examples are for illustrative purposes only and are not intended to limit the invention.

Example 1 Bacterial Expression and Purification of Ckβ-8

DNA sequence ATCC # 75676 encoding Ckβ-8, corresponding to the 5 'and 3' terminal sequences of the processed Ckβ-8 protein (excluding the signal peptide sequence) and the vector sequence 3 'for the Ckβ-8 gene Initially amplified using primers. The 5 'oligonucleotide primer had the sequence 5' TCAGGATCCGTCACAAAAGATGCAGA 3 '(SEQ ID NO: 5) and the 3' primer had the sequence 5 'CGCTCTAGAGTAAAACGA CGGCCAGT 3' (SEQ ID NO: 6). These primers each contain BamHI and XbaI restriction sites used for cloning into the polylinker region of ampicillin resistant bacterial expression vector PQE-9 (available from Qiagen Inc., Catsworth, CA). . The amplified sequence was ligated into PQE-9 in frame with the sequence encoding the histidine tag and the ribosomal binding site (RBS). Using this ligation, E. coli containing multiple copies of plasmid pREP4. Coli strain M15 / rep 4 (Qiagen) was transformed. pREP4 expresses lacI repressor and also confers kanamycin resistance. Transformants were selected for their ability to proliferate on LB plates supplemented with ampicillin / kanamycin. Clones containing the desired construct (isolated and identified by restriction analysis) were grown overnight in liquid culture in LB medium supplemented with ampicillin (100 μg / ml) and kanamycin (25 μg / ml). This culture was used to inoculate large cultures at a ratio of 1: 100 to 1: 250. Cells were grown to an optical density of 0.4 to 0.6 at 600 nm. IPTG (isopropyl-B-D-thiogalacto-pyranoside) was then added at a final concentration of 1 mM. Cells were further propagated for 3-4 hours and harvested by centrifugation. Cell pellets were dissolved in 6M guanidine HCl, a chaotropic agent, chromatographed and chromatographed on a nickel-chelate column under conditions allowing strong binding by proteins containing 6-His tags. Hochuli , E. et al., J. Chromatography, 411, 177-184 (1984)]. The truncated Ckβ-8 (purity 95%) elutes from the column in 6 M guanidine HCl, pH 5, and for regeneration 3 M guanidine HCl, 100 mM sodium phosphate, 10 mM glutathione (reduced) and 2 mM glutathione Adjusted to (oxidized). After incubation for 12 hours in this solution, the protein was dialyzed with 10 mM sodium phosphate.

Example 2: Expression of Recombinant Ckβ-8 in COS Cells

Expression of the plasmid CMV-Ckβ-8 HA is derived from the vector pcDNAI / Amp (Invitrogen) containing the ampicillin resistance gene and the CMV promoter, followed by the polylinker region, the SV40 intron and the polyadenylation site. DNA fragments encoding the truncated Ckβ-8 sequence and HA tag fused in frame with the 3 'end were cloned into the polylinker region of the vector; Thus, recombinant protein expression is induced under the CMV promoter. HA tags correspond to epitopes derived from influenza hemagglutinin protein, as already described in I. Wilson et al., Cell 37: 767 (1984). The introduction of an HA tag to a target protein facilitates the detection of recombinant proteins using antibodies that recognize HA epitopes.

For expression of recombinant shortened Ckβ-8, COS cells are transfected with an expression vector by DEAE-dextran method. J. Sambrook, E. Fritsch, T. Manatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratiry Press (1989). Two days after transfection, cells are labeled for 8 hours with 35S-cysteine. The culture medium is then harvested and the cells lysed with a washing agent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5). Wilson, I. et al., ID. 1984, 37: 767. Both cell lysates and culture media are precipitated with HA specific monoclonal antibodies The precipitated proteins are analyzed on 15% SDS-PAGE gels.

Example 3: Expression and Purification of Shortened Chemokine Ckβ-8 Using Baculovirus Expression System

SF9 cells were infected with recombinant baculoviruses designed to express Ckβ-8 cDNA. Infected with MOI 2 in 10 L cultures, cells were incubated for 72-96 hours under low serum conditions at 28 ° C. Cell debris taken from the infected culture was removed by low speed centrifugation. Protease inhibitor cocktails were added to the supernatants at a final concentration of 20 μg / ml (1 μg / ml lupeptin, 1 μg / ml E-64 and 1 mM EDTA). These specific culture conditions (eg, low serum) produced several NH ₂ -terminal truncations of the Ckβ-8 polypeptide. The level of Ckβ-8 in the supernatant was monitored by loading 20-30 μl of the supernatant on a 15% SDS-PAGE gel. Shortened Ckβ-8 was detected as an identifiable band corresponding to an expression level of several mgs per liter. The truncated Ckβ-8 was further purified through a three step purification procedure: 1) Heparin binding affinity chromatography. The supernatant of Baculovirus culture was mixed with 1/3 volume of buffer (pH 6) containing 100 mM HEPES / MEM / NaOAc and filtered through a 0.22 μm membrane. The sample was then applied to a heparin binding column (HE1 Poros 20, Bio-Perceptive System Incorporated). Uniaxial Ckβ-8 eluted at about 300 mM NaCl in a linear gradient of 50-500 mM NaCl in 50 mM HEPES / MES / NaOac at pH 6; 2) Cation Exchange Chromatography. Proteins concentrated by heparin chromatography were diluted 5-fold using a buffer containing 50 mM HEPES / MES / NaOAc at pH 6. The resulting mixture was then added to a cation exchange column (S / M Poros 20, Bio-Perceptive System Incorporated). The truncated Ckβ-8 was eluted at 250 mM NaCl in a 25 to 300 mM NaCl linear gradient in 50 mM HEPES / MES / NaOAc at pH 6; 3) size exclusion chromatography. After performing cation exchange chromatography, truncated Ckβ-8 was further purified by application to a size exclusion column (HW50, TOSO HAAS, 1.4 × 45 cm). Amino acid sequencing of the purified samples confirmed that it was a mixture of four or more major sequences corresponding to four truncated forms of the protein (SEQ ID NOs: 1, 2, 3 and 4).

Example 4 Stimulation of EOL-3 Cells and PBL with a Mixture Containing Shortened Ckβ-8

EOL-3 cells were grown under standard growth conditions and differentiated for 2 weeks with 1 μM sodium butyrate. PBL (peripheral blood leukocytes) were obtained from human donors by venipuncture. PBL was purified by standard techniques. The sheep cell preparation was separately loaded with FURA-2 (1 μM) for 45 minutes. 1 × 10 6 / mL of cells (2 mL total) were transferred to plastic cuvettes. Baseline recordings were obtained by adjusting the fluorescence spectrophotometer before adding short Ckβ-8 (871a, 871b, 871c, 871RP) or long Ckβ-8 (889) at a concentration of 0.33 to 33 nM. The increase in fluorescence was monitored by spectrophotometer. Changes in free Ca ⁺⁺ inside the cells were first lysed (trimmed Fmax) with Triton x100 in the presence of excess Ca ⁺⁺ , followed by the addition of 5 mM EGTA to obtain Fmin. The ratio of free Ca ⁺⁺ can be calculated from the minimum and maximum values. MCP-1 (monocyte chemotactic protein-1) is a known chemokine and used as a positive control.

According to the present invention a novel polypeptide of truncated human chemokine beta-8 (Ckβ-8) can be obtained and used to treat patients in need of or need to inhibit this polypeptide.

Claims (3)

A method of treating a patient in need of Ckβ-8, comprising administering to the patient an effective amount of a polypeptide comprising any of SEQ ID NOs: 1-4. A method of treating a patient in need of Ckβ-8, comprising administering to the patient an effective amount of a composition comprising a mixture of polypeptides comprising any one of SEQ ID NOs: 1-4. A method of treating a patient in need of inhibition of Ckβ-8, comprising administering to the patient an effective amount of an antagonist to the polypeptide comprising any of SEQ ID NOs: 1-4.