KR20020059727A - High order nucleic acid based structures - Google Patents

Abstract

The present invention relates to nucleic acid based molecular structures which bind to other molecular entities, in particular to entities other than the nucleic acid itself. In particular, the present invention relates to nucleic acid based molecular structures with pharmaceutical activity that affect disease states through binding to specific molecular targets. The invention also relates to nucleic acid based molecular structures having diagnostic utility.

Description

Higher Order Nucleic Acid Based Structures {HIGH ORDER NUCLEIC ACID BASED STRUCTURES}

It is an object to provide subject compositions that can specifically alter the activity of certain proteins or modulate the expression of specific gene products. It is an object for molecules that can form specific binding interactions with other molecules, and in particular those molecules exhibiting specific binding in an in vivo environment.

Against this purpose, methodologies have been developed to enable the preparation of a class of libraries of molecules for selecting such subject compositions. Suitable examples are the sophisticated specificities of the binding found in antibody molecules, and several important techniques now exist for the development of monoclonal antibodies and recombinant derivatives thereof. This has provided many therapeutic drugs, and many diagnostic and research instruments. All such products are protein molecules and can be prepared using biological systems as they are. Alternative fully synthetic binding molecules have been prepared. These are molecules that are selected from a diverse library of similar or variant molecules of the same chemical class and are generally selected using a search system that provides a replacement for some aspect of the desired therapeutic target or activity thereof. Searching for an extensive chemical library of small molecules has been a traditional route to the development of conventional small molecules, but libraries of synthetic peptides and synthetic nucleic acid molecules are currently searched for potentially useful therapeutics.

For libraries of nucleic acids, the technical approach has generally been the use of single stranded RNA or DNA molecules of limited unit length. The basis for binding to a target molecule is not prearranged and may depend on the formation of secondary structures within the DNA (or RNA) molecule itself that facilitates binding to other molecular entities (Bock LC et al. 1992 Nature 355: 564-566; Kubrik, MF et al. 1994 Nucleic Acids Res. 22: 2619-2626). The preparation of nucleic acid molecules comprising pre-arranged tracks of secondary (or higher) structure for therapeutic and diagnostic utility has not been attempted in advance and is an object of the present invention.

The present invention relates to novel higher nucleic acid structures and novel uses of such structures.

Several types of higher nucleic acid structures are known in the art. One type of such nucleic acid is called an aptamer and differs from the molecules of the present invention in terms of their size, preparation and topological complexity. Methods involving in vitro evolution or selection from a vast random library pool have been applied to the development of both RNA and DNA aptamers. RNA molecules that can facilitate enzymatic processes, such as polynucleotide kinase activity, have evolved by repeating cycles of choice (Lorsch JR & Szostak JW 1994 Nature 371: 31-36), and short single-stranded DNA molecules are human phospholipases. It was selected to be able to inhibit A ₂ very specifically (Bennett C. F et al. 1994 Nucleic Acids Res. 22: 3202-3209). Others have developed aptamers based on RNA or DNA that can bind and inhibit some functions of human thrombin (Bock LC et al. 1992 Nature 355: 564-566; Kubrik, MF et al. 1994 Nucleic Acids Res. 22: 2619-2626 ).

Other types of high-dimensional nucleic acid structures include "side chain DNA" (Horn, T. & Urdea, MS 1989, Nucleic-Acids-Res. 17: 6959-6967), thereby DNA hybridizing to complementary nucleic acid molecules. One or more regions of the molecule (“probes”) may themselves hybridize to other DNA molecules, thereby amplifying the amount of DNA associated with the DNA probe. However, the complexes described by Horn and Urdea (ibid) expand linearly, whereby the newly hybridized nucleic acid molecules are designed to hybridize to other incoming new molecules rather than to pre-annealed molecules, resulting in side chain DNA structures. To form. In fact, the complex is allowed to form as many side chains as possible to provide more points for annealing the signaling nucleic acid probes.

Other geometries conferred by the base pair nature of nucleic acids have been used in the fields of material science and nanotechnology (Aliviatos, AP et al. 1996, Nature 382: 609-611; Mao C. et al. 2000, Nature 407: 493-496; Yurke, B. et al. 2000, Nature 406: 605-608). Sophisticated technical methods for the analysis and preparation of higher order nucleic acid based structures, including tetramorphic, octahedral and triangular motif folds connected into the lattice, are described in Chen J. et al. 1989, J. Am. Chem. Soc. 111: 6402-6407; Zhang et al. 1994, J. Am. Chem. Soc. 116: 1661-1669; US Patent No. 5,278,051; US Patent No. 5,468,851; US Patent No. 5,386,020 & US Patent No. 6,072,044. Geometric objects are closed structures made using an iterative process involving restriction enzymes and DNA ligation. The nodal points in the structure can be fixed by cross junctions between the strands to create a fixed form, or more flexible side chains can be achieved by cross anneal heterologous strands. The prior art does not include an unclosed (ie terminally ligated) geometry. The prior art does not include geometric structures comprising regions of modified nucleic acids and does not include geometric nucleic acid structures conjugated to other molecular entities. The prior art does not include the use of libraries of random or semirandom nucleic acid structures.

With regard to the novel use of higher nucleic acid structures, it is recognized that the use of "low order" nucleic acids as therapeutic and diagnostic molecules is known in the art. In particular, there are many examples of nucleic acid molecules with potential and / or actual therapeutic activity. It acts as an antisense molecule, triplex reagent or RNA molecule ("ribozyme") with endoribonuclease activity. In all of these aspects, aspects of therapeutic nucleic acids are modulators of protein expression by mechanisms of action that reduce or block protein translation. In all these cases the specificity of the target binding is nucleic acid to nucleic acid. This feature (translational control, nucleic acid to nucleic acid binding) is contrary to aspects of the present invention. A characteristic and progressive feature of the present invention is the use of higher order nucleic acid structures with binding activity to target molecules.

Other "lower" nucleic acid structures, particularly aptamers, have been tested as therapeutic and diagnostic molecules. Certain other nucleic acid molecules, particularly ribozymes, have been identified as having enzymatic activity of potential pharmaceutical importance. Although US Pat. No. 5,278,051 describes a possible utility as a solubilizer or sustained release vehicle for small molecular therapeutics, pharmaceutical usefulness for closed geometries is not considered.

The present invention relates to nucleic acid based molecular structures which bind to other molecular entities, in particular to entities other than the nucleic acid itself. In particular, the present invention relates to nucleic acid based molecular structures with pharmaceutical activity that affect disease states through binding to specific molecular targets. The invention also relates to nucleic acid based molecular structures having diagnostic utility.

1

Depiction of stepwise assembly of open cube nucleic acid structures from six individual single stranded molecules given by A ₁ , A ₂ , B ₁ , B ₂ , C ₁ and C ₂ .

It proceeds through antiparallel base pairs that are common among nucleic acid molecules. Dimer intermediates formed between B ₁ and C ₁ molecules, as well as B ₂ and C ₂ . A trimer structure formed between A ₁ , B ₁ , and C ₁ molecules, and A ₂ , B _2, and C ₂ molecules. Assembly of the cubic structure is achieved by the association of two trimer moieties and is depicted as the molecule (A ₁ + B ₁ + C ₁ ) + (A ₂ + B ₂ + C ₂ ).

2

The sequence of the oligonucleotide subunits IL2R-1 and IL2R-2 containing a DNA structure having binding activity to the IL-2 receptor.

3

The sequences of oligonucleotide subunits TB-R1 and TB-R2 containing DNA structures having binding activity to human thrombin.

A first aspect of the invention relates to novel higher nucleic acid based structures, in particular open geometry. Moreover, it relates to the utility of such structures as medicaments and / or diagnostics. The present invention also relates to higher nucleic acid based structures comprising nucleotides with modifications. The invention also relates to higher nucleic acid based structures comprising regions of random or semirandom nucleotides. The invention also relates to higher nucleic acid based structures conjugated to other molecular entities such as proteins.

The structure of the present invention utilizes the Watson-Crick base pair rule in the processing region of the double stranded structure. Single stranded nucleic acid molecules have the ability to anneal (hybridize) to other single stranded molecules by complementarity between bases. The base annealing of two single-stranded molecules results in a linear double-stranded molecule, but the other structure is, for example, a hairpin loop in which one molecule has internal base pair complementarity, and a circle having mutual complementarity at both ends of each single-stranded molecule. Can be formed. With the strategic design of single stranded nucleic acid sequences, individual molecules can be designed that can anneal simultaneously to two or more different molecules, which in turn can anneal to additional molecules, including molecules already included in the annealing. In that case, complexes of nucleic acids may be formed.

The overall dimension and phase of the double stranded DNA molecule is well understood. Double-stranded DNA is very fluid, and helices can adopt many configurations with different rotation angles between adjacent base pairs along the helix. Naturally occurring single-stranded nucleic acid molecules such as RNA adopt the desired arrangement in solution. Placement is dictated by base pair interactions within the same molecule resulting in the creation of a stable structure consisting of a double stranded stem and a single stranded loop. The molecules will adopt the lowest energy configuration and this structure for the known sequence of RNA can be predicted by a computational approach (Jaeger J. A. et al. 1989 Proc. Natl. Acad. Sci USA 86: 7706-7710). Attempts were made to make prediction software for DNA folding and with some success (Nielsen D. A. et al. 1995 Nucleic Acids Res. 23: 2287-2291). Dimensional comparisons between nucleic acid and protein molecules account for significant differences in the structural arrangement between the two classes of molecules and also support the concepts upon which the present invention is based. Typical spherical proteins such as myoglobin with a molecular weight of 17 kDa have the longest dimension of 3 nm. Larger globular proteins such as bovine serum albumin with a molecular weight of 68 kDa have a longest dimension of 5 nm (Cohen C., Wolstenholme GEW & O'Connor M. (eds), Ciba Foundation Symposium, London, J & A Churchill, 1966). The double strand helix has a diameter of 2 nm, and a small number of base pairs of DNA strands, such as 100, have a contour length close to 30 nm. Therefore, although the density of DNA or other nucleic acid molecules is much smaller than typical proteins, even in most structured and native forms, such as double helices, the phase of a DNA molecule can easily cover a large portion of the exposed surface of almost all protein molecules. . In particular, where the phase of conventional monofilament DNA is altered as described above, the DNA can occupy a large area of space in a manner more similar to higher density protein molecules. It can be appreciated that an assembly of nucleic acid structures consisting of multiple interconnected strands of each only short (<50) nucleotide track can easily result in a structure having an overall dimension of 10 to 500 nm. It is a particular object of the present invention to provide formulations of such nucleic acid molecules.

The structure of the present invention provides for the preparation of DNA or RNA molecules having secondary structures formed as a result of the interaction of two or more nucleic acid molecules, or alternatively as a result of the interaction of differently defined fragments within individual molecules of the nucleic acid. Based. In the present invention, the informational content of DNA or RNA is not used as an encoding entity for the expression of therapeutic proteins, nor as a blocking entity for nucleic acid metabolism and gene expression (anti-sense), but in a three-dimensional specific form. Direct assembly of the molecular structure.

The present invention includes nucleic acid molecules, especially synthetic DNA molecules, which form a three-dimensional (non-planar) molecular structure by specific base pairs in the molecule within the set. Specifically, DNA molecules are designed to have one or more regions (“domains”) that can anneal to other molecules in the set that ultimately form complex three-dimensional nucleic acid structures. Under this scheme, the approximate cube is an autologous of six synthetic DNA molecules containing four domains of complementarity, in which each molecule interacts with four other molecules, and each molecule acts effectively similar to each side of the cube. -Can be formed by annealing. The structure is open (not covalently closed), flexible, and is an additional embodiment that can be modified, in particular by the addition of other functions or structure groups.

In one structure of the higher order nucleic acid basis of the present invention, two or more domains of self-complementary sequences can be made that allow nucleic acid molecules to fold themselves and react with each other to form specific tertiary molecular structures through specific base pairs. Nucleic acid molecules are provided. For certain applications, it is recognized that chemical instability of unmodified DNA molecules has become a significant problem for use in therapeutics and the like. Several approaches are currently available to protect DNA molecules from degradation by enzymatic attack. Phosphodiesters backbones (methylphosphonates, phosphorothioates, peptide nucleic acids) or cappings 5 'and or 3' modified using phosphoramidite, phosphorothioate or phosphorodithioate linkages generally Terminal use. It is a particular object of the present invention to use modified or non-natural nucleic acids in higher nucleic acid base structures. Moreover, a particular desired feature is the increased flexibility in binding specificities achieved by the use of mixed chemistry and alternative non-natural nucleic acid backbones.

Nucleic acid subunits of the higher nucleic acid structure of the invention may be homologous or heterologous in nature, such as, for example, DNA comprising an RNA track. RNA tracks in DNA helices are known to alter coiling in solution (Wang, A. et al., 1982 Nature, 299: 601-04). The ability to provide placement diversity within the local tracks of nucleic acids can be important in altering binding specificity for a target protein, which is known in the art, where binding specific thrombin aptamers have a higher order tertiary structure. Depends on the short track of (Griffin, L. et al. 1993 Gene 137: 25-31). In addition, non-natural phosphate backbone analogs can be used to enhance stability and alter the binding specificity for the target protein of interest. Latham et al. (1994 Nucleic-Acids-Res. 22: 2817-22) show that the modified nucleotide 5- (1-pentynyl) -2′-deoxyuridine is a thymidine in the pool of random oligonucleotides. Provide an example used for the location of. The present invention includes molecules composed of tracks of single-stranded nucleic acids, interspersed with tracks of double-stranded structures, and other chemical molecules synthesized to include different chemical substructures, but linked using conventional base pair rules. The structure may also combine molecules of DNA and RNA.

The higher molecular structures of the present invention may be assembled from individual or multiple nucleic acid molecules according to any scheme present in the art and may include fragments from even larger molecules such as synthetic nucleic acid species or recombinant plasmids. The structure can be established after easy folding or self-folding (auto-assembly) of a single linear molecule of DNA. Easy folding is mediated by protein individuals (enzymes such as ligase, topoisomerase, endonucleases, polymerases, etc.) or through interactions with nonprotein physiochemical conditions (pH, temperature, ionic conditions). Can be. Alternatively and or in combination with the above, the molecules may be assembled by interaction with molecules bound to a solid matrix, or DNA that has undergone folding into higher order structures is bound or fixed in space during all or part of the assembly process .

A second aspect of the present invention is the provision of a library of nucleic acid molecules formed to include a wide range of semi-random molecules, some of which may have a desired phase in which they can interact in a specific manner with the target molecule. This aspect of the invention includes a library of nucleic acid molecules featuring a guide framework that facilitates assembly of conventional subunits. Within each subunit, a randomized track of sequences is included that maximizes the potential functional utility for activity in library diversity and selective binding assays. In a second aspect of the invention, embodiments are used in which the library is formed from a mixture of n discrete populations (sets) of synthetic DNA molecules (subunits). In this aspect, the population size of the synthetic nucleic acid subunit is large and is dictated by the degree of randomization present in the various segments of the subunit. Subunit diversity is also established in other embodiments by diversity of the location of the variable domains, diversity of the number of variable domains (spread into the track of a fixed sequence) and diversity in the length of any given various domains. The n discrete populations of subunits are preferably mixed in a library of multiple nucleic acid structures and in a single cycle of annealing for the production of individual sequence diversity. Other implementations may include multiple periods of annealing and multiples of the whole integer n. A particular feature of the library under the scheme is the ability to control the degree of complexity of interaction between subunits by the determined design and the position of the complementary or guide sequence track.

A third aspect of the invention is the novel utility of higher nucleic acid based structures, particularly for pharmaceutical and diagnostic uses. In this aspect, such structures can bind to specific target molecules, typically proteins or protein based target molecules. Preferred embodiments include a single protein target, and additional embodiments where the target is a protein complex consisting of multiple protein subunits, such as cell surface receptors, collectively bound by a molecule of the first aspect of the invention. Another embodiment of the third aspect comprises binding to a cell species or cell target identified by the ability to bind a molecule of the first aspect. Further embodiments include binding to a target or target complex comprising a cell, in particular a non-protein component such as a carbohydrate or lipid component on the cell surface. Proteins, carbohydrates, lipid individuals, and / or complexes thereof may be disease specific individuals or exist as normal components of tissues or cells. Targets or target complexes include viral particles or virus-inducing components such as capsid proteins or host-inducing components of the viral coating. The target or target complex may comprise metal ions or other inorganic chemicals or chemical groups in its composition and may be naturally occurring or introduced by treatment with an exogenous agent. Target receptors may include IL-2 receptors or other cytokine receptors, such as receptors for IL-3, M-CSF, GM-CSF and many others. Likewise, surface molecules such as IgE receptors, in which blocking of IgE binding occurs with blocking of crosslinking activation events at the receptor, would be a very desired result. Clustered phase difference (CD antigen) Another surface molecule comprising a series of members is a target of interest for disease control, in particular diseases of autoimmune components.

The present invention is designed to be particularly widely applied in the field of therapeutic molecules. The molecular structure of the present invention is aimed at promoting or antagonizing certain receptors or enzymatic processes for the therapeutic benefit contributing to the lack of defects of conventional protein therapeutics such as immunity. The present invention therefore extends to methods of treating or preventing diseases or conditions, which are methods comprising administering to a subject an effective amount of a molecular structure. The invention also extends to the use of such structures in in vivo and in vitro diagnostics.

A fourth aspect of the invention encompasses higher order nucleic acid based structures having modified nucleotides included within the structure. In addition to, or separated from, the diversity imparted by the second aspect, modified bases (thiolated bases, biotinylated bases, epsilon-amino derivatized bases, etc.) by the diversity of subunits of the library and / or during their synthesis It is particularly intended to be given by the inclusion of). Therefore, a wide variety of libraries are obtained that vary in both the sequence composition and the level of sequence length. Such parameters may be fixed within defined limits for different libraries and different target applications. Higher nucleic acid structures will also include modified nucleotides that can impart desired specific properties to the structure in addition to such features that provide binding control or stability. Such additional desired modifications can be implemented under the first or second aspect of the invention and include the use of hydrophobic tracks, the inclusion of psoralene or acridine groups, easy binding to linked heptene groups such as biotin or to specific target molecules. Connection to different charged side chains, such as amino or carboxyl groups that provide In further preferred embodiments, such groups can serve as points for attachment of nucleic acid molecules such as antibodies or enzymes or other molecules such as proteins.

The desired feature of the present invention will have high stability in vitro and in vivo. Chemical compositions of nucleic acid structures are very influential, and the physical size of the molecules requires control to minimize shear damage in solution and maximize functional utility in vivo. For this reason, multi-chain nucleic acid structures generally constructed of small (<80 dimer) subunits are preferred in the present invention. Alternatively, the use of a structure consisting of larger subunits (> 80 dimers) can be aimed at, and likewise falls within the scope of the present invention.

A fifth aspect of the invention includes higher order nucleic acid based structures attached to other molecular entities. In particular, this aspect relates to nucleic acids that are attached at one or more specific sites to one or more specific sites on other molecular entities, such that the specific attachment of nucleic acids is facilitated by modified nucleotides as in the fourth aspect of the invention. Include. In particular, this aspect encompasses higher order nucleic acid based structures to which a nucleic acid is attached to a pharmaceutically or diagnostically associated molecular entity that binds to a specific molecular target associated with the disease, wherein the attached molecular entity is then used to counter or detect the disease. Used for.

Pharmaceutically related entities include cytokines, Fc portions of antibodies, other antibody related entities, toxins, enzymes, drugs and prodrugs, receptor promoters or antagonists, receptor molecules themselves (especially ligand binding domains), radioisotopes, pharmaceuticals Active nucleic acid, drug delivery vesicles such as liposomes, live or attenuated microorganisms, photoactive parts, and other individuals that induce vaccination effects. Diagnostically related entities will in particular include those which produce signal transduction vesicles such as radioisotopes, photoactive moieties such as chemiluminescent signals, fluorescent pigments, enzymes and beads.

In summary, the present invention includes the following objects:

A tertiary polynucleic acid structure consisting of multiple interconnected strands of nucleic acid molecules or fragments thereof by specific base pair interactions of two or more molecules, characterized in that they are not covalently closed.

A corresponding polynucleic acid structure characterized by being formed by two or more strands of nucleic acid molecules.

A corresponding polynucleic acid structure characterized by being formed by three or more strands of nucleic acid molecules.

Corresponding polynucleic acid structure, characterized in that the structure is in the form of a cube or essentially in the form of a cube.

Corresponding polynucleic acid structure formed by six nucleic acid molecular strands in which the cube structure is such that each molecular strand acts like each side of a six-sided cube.

Corresponding polynucleic acid structures in which each nucleic acid sequence comprises two or more domains capable of annealing to other molecules in the set.

The corresponding polynucleic acid structure in which each nucleic acid sequence comprises four domains.

Corresponding polynucleic acid structure wherein the structure consists of a track of single stranded nucleic acid and comprises a nucleic acid molecule interspersed with a track of double stranded structure.

The corresponding polynucleic acid structure according to any one of claims 1 to 8, wherein each nucleic acid strand has less than 80 nucleotides, preferably less than 50 nucleotides.

The corresponding polynucleic acid structure in which the structure has the assembly (A1 + B1 + C1) + (A2 + B2 + C2) shown in FIG. 1.

Corresponding polynucleic acid structure as defined above comprising subunits consisting of various random sequence tracks, in order to obtain semi-random molecules or fragments thereof in which the structure can interact with the target molecule.

A three-dimensional polynucleic acid structure comprising subunits consisting of multiple interconnected strands of nucleic acid molecules or fragments thereof by specific base pair interactions of two or more molecules, wherein the structure is covalently closed and interacts with the target molecule A structure comprising subunits composed of various random sequence tracks to obtain semi-random molecules or fragments thereof that can act.

The polynucleic acid structures defined above which vary in sequence composition and sequence length.

Corresponding polynucleic acid structures in which various sequence compositions are achieved by one or more modifications of nucleotides in the sequence.

The polynucleic acid structure as defined above, wherein said structure comprises a site or group of nucleic acids capable of binding or attaching to another molecule or solid matrix.

The corresponding polynucleic acid structure wherein said other molecule is a protein, enzyme, lipoprotein, glycosylated protein, immunoglobulin or fragment thereof.

The corresponding polynucleic acid structure wherein said other molecule is a nucleic acid.

The corresponding polynucleic acid structure in which the molecule is pharmaceutically effective.

A pharmaceutical composition containing a polynucleic acid structure as defined above, optionally together with a suitable carrier, excipient and diluent and / or other pharmaceutically effective compound.

Use as a diagnostic agent of the corresponding polynucleic acid structure.

Use of a polynucleic acid structure as defined above to provide a library that affects various phases that are specifically randomized to obtain different functions and / or activities.

The invention is illustrated by the following examples, which should not be construed as limiting the scope thereof.

Example 1

Inhibition method of IL-2 dependent cell line using DNA structure selected from DNA structure library.

Two libraries of synthetic DNA molecules, each containing regions of randomized sequences, were synthesized.

Library A containing the following structure:

5'AGTCCCAAGCTGGCT (N) ₁₃ CTCCATCGTGAAGTCAGCCAGCTTTGGACT

Library B containing the following structure:

5'GACTTCACGATGGAGGTCAGAATGTGAATA (N) ₁₀ TATTCACATTCTGAC

The sequences are designed to facilitate cross annealing and represent subunits of the structural library formed by cross annealing and mixing of different subunits according to the scheme of the present invention.

Oligonucleotide (subunit) libraries were synthesized in the presence of serum factors to have phosphorothioate linkages to maximize stability and purify by HPLC. Purified oligonucleotides were obtained from GenoSys Biotechnologies (Cambridge, UK). DNA structure libraries were assembled using a single cycle of cross annealing. Subunit libraries A and B were denatured, mixed and annealed in a solution of 50 mM Tris pH 7.4, 100 mM NaCl, 5 mM EDTA at a temperature of 37 ° C. Mixing of subunit libraries A and B was performed at equimolar concentrations (1 □ M). In other experiments mixing was performed using different molar ratios. Assembly of the subunits was confirmed by gel electrophoresis.

DNA structure libraries were selected for structures capable of binding to the outer cellular domain of the IL-2 receptor (IL2R). This was performed using soluble recombinant IL2R prepared according to published methods (Meidel, MC et al. 1988 Biochem. Biophys. Res. Commun. 154: 372-379; Meidel, MC et al. 1989, J. Biol. Chem. 264: 21097-21105). Recombinant IL2R is covalently bound to surface activated magnetic beads using a protocol recommended by the supplier (Bangs Labs, Fishers, IN, USA). IL2R-beads were used as affinity surfaces for selecting binding structures from DNA structure libraries. IL2R-beads were reacted with the library under many experimental conditions, including the presence of chaotrope salts in a control reaction. The library (DNA) concentration was about 100 nmol in the annealing solution as above. Binding molecules were recovered by polymerase chain reaction (PCR) directly from the beads after extensive washing cycles with a solution of 75 mM TrisHCl, 200 mM NaCl, 0.5% N-octylglucoside pH 8.0. PCR was performed using primers PRA1 (5′-AGTCCCAAGCTGGCT) to recover the Library A component using standard reagent systems and conditions. In a separate reaction, the library B component was recovered using primers PRB1 (5'GACTTCACGATGGAG) and PRB2 (5'GTCAGAATGTGAATA). PCR products were cloned and sequenced using standard reagent systems and procedures.

Many sequences were recovered and identified as originating from subunit library A and subunit library B. Among them, a pair was synthesized using phosphorothioate chemistry as described above. Oligonucleotides IL2-R1 and IL2R2 (sequences provided in FIG. 2) were purified as above, assembled and used for cell analysis for IL-2 antagonism.

TALL-104 (ATCC # CRL-11386) is a human T-cell leukemia cell line. Cells grow in suspension culture and require IL-2 for optimal growth. Cells can grow for a short time without IL-2, but their growth is significantly reduced. Cells were grown in Iscoves modified Dulbeccos medium, Life Technologies, Paisley, UK with 50-100 μ / ml recombinant human IL-2 (Life Technologies, Paisley, UK), 10% ( v / v) supplemented with heat inactivated fetal calf serum. Cells were incubated in an atmosphere of 8-10% CO ₂ . A control DNA sample containing a dilution of annealed IL2-R1 / IL2-R2 DNA preparation and random sequences of the same contour length was prepared in culture medium comprising IL-2. Parallel diluted serials were prepared using IL-2 deficient media. Dilution series ranged from 50 □ M DNA to 390 nM DNA. Assays were performed using sub-confluent TALL-104 cells crushed the day before in a 96 well microtiter dish. Cells were harvested by centrifugation, washed with pre-warmed (37 ° C.) phosphate buffered saline, and DNA containing medium was added for 48 hours. The treatment was performed four times. Proliferation was assessed at the end of the 48 hour period in a colorimetric assay, according to the instructions provided by the supplier (Promega, Southampton, UK) using commonly acceptable tetrazolium compounds. Microtiter plates were read at 540 nm.

The results indicate that annealed DNA preparations inhibited the growth of TALL-104 cell lines under conditions in which individual synthetic oligonucleotides IL2-R1 and IL2-R2 were inactive.

Example 2

Method of selecting a DNA structure that binds to human thrombin.

The library described in Example 1 is used to select for DNA structures capable of binding to human thrombin. Libraries are selected using human thrombin preparations linked to surface activated magnetic beads (Sigma, Poole, UK) according to Example 1. Thrombin beads were reacted with the DNA structure according to Example 1, except that post-binding washing was performed in a solution of 20 mM Tris Acetate, pH 7.4, 140 mM NaCl, 5 mM KCl, 1 mM MgCl ₂ . Binding molecules were recovered directly from the beads by PCR using the reaction and primer sets as in Example 1. PCR products were cloned and sequenced using standard reagent systems and procedures.

Many sequences were recovered and identified as originating from subunit library A and subunit library B. Among them, a pair was synthesized using phosphorothioate chemistry as above. Oligonucleotides TB-R1 and TB-R2 (sequences provided in FIG. 3) were purified and assembled. TB-R1 / TB-R2 complex was used for thrombin inhibition assay. The clotting time was measured at 37 ° C. using a fibrometer and adult plasma was freshly reconstructed from healthy donors. The extent of thrombin inhibition was measured using thrombin standard curve floating clotting time versus thrombin concentration. Clotting time was determined for 3 logs of DNA structure in the assay.

The results show inhibition of the clotting activity in the presence of TB-R1 / TB-R2 DNA complexes.

Example 3

Methods of selecting DNA structures that bind to recombinant soluble CD4

The library described in Example 1 is used to select for DNA structures capable of binding to recombinant soluble CD4 (rsCD4) preparations. DNA structure libraries were selected using CD4 preparations (BioDesign, Saco, ME, USA) immobilized on activating magnetic beads as above. Library selection, washing and selection by PCR are as described in Example 2. Single oligonucleotide pairs originating from the A and B subunit libraries were synthesized and assembled. The structure was used to inhibit the binding of CD4 monoclonal RPAT4 (Serotech, Abingdon, UK) in an enzyme linked immuno absorbant assay (ELISA).

96 well ELISA plates were coated overnight at 0.2 ° C. with a 0.2 mg / ml solution of rsCD4 in coating buffer (0.05 M carbonate-bicarbonate buffer pH 9.0). Plates were TBS-T (Tris buffered saline pH 8.0, 0.05% (v / v) Tween 20) was used to wash on a large scale and test and control DNA structures were diluted (1: 2) across plates in TBS from a starting concentration of 100 □ M. Plates were incubated for 40 minutes at 37 ° C. and washed with TBS. 100 ng / ml preparation of antibody RPAT4 in PBS was added to the plate and incubated at 37 ° C. for 40 minutes. Plates were washed and bound RPAT4 was detected using alkaline phosphatase labeled both anti-mouse formulations (Sigma, Poole, UK) and Sigma Fast OPD (Sigma, Poole, UK) as color substrates. In some assays, DNA was incubated with RPAT4 monoclones. Color intensity was read using a plate reader, and the signal was compared between test and control wells. The results showed significant inhibition of RPAT4 binding to rsCD4 in the presence of DNA structure.

Claims (22)

A tertiary polynucleic acid structure consisting of multiple interconnected strands of nucleic acid molecules or fragments thereof by specific base pair interactions of two or more molecules, characterized in that they are not covalently closed. The polynucleic acid structure of claim 1, wherein the polynucleic acid structure is formed by two or more strands of nucleic acid molecules. The polynucleic acid structure of claim 2, wherein the polynucleic acid structure is formed by three or more strands of nucleic acid molecules. The polynucleic acid structure according to any one of claims 1 to 3, wherein the structure is in the form of a cube or is essentially in the form of a cube. 4. The polynucleic acid structure of claim 3, wherein the cube structure is formed by six nucleic acid molecule strands in which each molecular strand acts like each side of a six-sided cube. 6. The polynucleic acid structure of claim 1, wherein each nucleic acid sequence comprises two or more domains capable of annealing to other molecules in the set. 7. 7. The polynucleic acid structure of claim 6, wherein each nucleic acid sequence comprises four domains. 8. The polynucleic acid structure of claim 1, wherein the structure comprises nucleic acid molecules consisting of tracks of single stranded nucleic acid and interspersed with tracks of double stranded structure. 9. The polynucleic acid structure of claim 1, wherein each nucleic acid strand has less than 80 nucleotides. 10. The polynucleic acid structure of claim 9, wherein each nucleic acid strand has less than 50 nucleotides. The polynucleic acid structure according to claim 1, wherein the structure has the assembly (A1 + B1 + C1) + (A2 + B2 + C2) shown in FIG. 1. 12. The polynucleic acid according to any one of the preceding claims, wherein the structure comprises subunits composed of various random sequence tracks to obtain semi-random molecules or fragments thereof that can interact with the target molecule. rescue. A three-dimensional polynucleic acid structure comprising subunits consisting of multiple interconnected strands of nucleic acid molecules or fragments thereof by specific base pair interactions of two or more molecules, the structure being covalently closed and able to interact with the target molecule. A structure comprising subunits consisting of various random sequence tracks to obtain a semirandom molecule or fragment thereof. The polynucleic acid structure according to any of claims 1 to 13, wherein the sequence composition and sequence length vary. 15. The polynucleic acid structure of claim 14, wherein the various sequence compositions are achieved by one or more modifications of nucleotides in the sequence. The polynucleic acid structure of claim 1, wherein the structure comprises a site or group of nucleic acids capable of binding or attaching to another molecule or solid matrix. 17. The corresponding polynucleic acid structure of claim 16, wherein said other molecule is a protein, enzyme, lipoprotein, glycosylated protein, immunoglobulin or fragment thereof. 17. The polynucleic acid structure of claim 16, wherein said other molecule is a nucleic acid. The polynucleic acid structure of claim 16, wherein the molecule is pharmaceutically effective. A pharmaceutical composition containing the polynucleic acid structure of claim 19, optionally in combination with a suitable carrier, excipient and diluent and / or other pharmaceutically effective compound. Use as a diagnostic agent of the polynucleic acid structure of any one of Claims 1-18. Use of the polynucleic acid structure of claim 12 or 13 for providing a library that affects various phases that are specifically randomized to obtain different functions and / or activities.