SK6042002A3 - High order nucleic acid based structures - Google Patents

Abstract

The present invention relates to nucleic acid based molecular structures that bind to other molecular entities, especially entities other than nucleic acids themselves. In particular, the invention relates to nucleic acid based molecular structures with pharmaceutical activity through binding to specific molecular targets and thereby influencing disease states. The invention also relates to nucleic acid based molecular structures with diagnostic utility.

Description

BACKGROUND OF THE INVENTION Field of the Invention Nucleic acid structures bind molecules other than nucleic acids

The invention relates to the high order of which acids themselves. In particular, nucleic acid based structures with pharmaceutical activity through binding to specific molecular targets and thus affecting disease states. The invention also relates to nucleic acid-based molecular structures with diagnostic utility.

BACKGROUND OF THE INVENTION

There is a great need for compositions capable of specifically altering the activity of certain proteins or altering the expression of certain gene products. In particular, the molecules of interest are capable of forming specific binding interactions with other molecules, and in particular molecules having specific binding in vivo.

create libraries of composition classes. An example is antibody molecule technology for development using biological systems, totally synthetic binding molecules, from different libraries of similar or certain chemical class and generally

In addition to these efforts, methodologies have been developed to enable molecules from which to select such a binding specificity selection found in and exists today. a number of important monoclonal antibodies and their recombinant derivatives. These technologies have provided a range of therapeutic drugs and many diagnostic and development tools. All such products are protein molecules and as such are only produced. Alternatively, they have been produced. These are molecules of a variant variant of that selected by a screening system providing a surrogate of the desired therapeutic target or aspect of its activity. Screening of large chemical libraries of small molecules is a classical way in the development of small molecule drugs, but libraries of synthetic peptides and synthetic nucleic acid molecules are now also screened for potentially useful drugs.

In nucleic acid libraries, the technical approach has generally involved the use of single-stranded RNA or DNA molecules of defined unit length. Binding of the base to the target molecule is not in advance. configured and may be dependent on the formation of secondary structures within the DNA molecule (or RNA) itself, which facilitates binding to another molecule (Bock LC et al., Nature 355: 564-566, 1992: Kubrik MF et al., Nucleic Acids Res., 22: 2619-2626 (1994). No one has previously attempted to generate nucleic acid molecules containing preconfigured secondary (or higher order) structural structures for therapeutic and diagnostic uses.

The invention relates to novel high order nucleic acid structures and to a new use of such structures.

High-order nucleic acid structures are known in the art. One type of such nucleic acids is called aptamers and differs from the molecules of the invention in size, manufacture and topological complexity. Methods, including their in vitro development or selection from large random library collections, have been applied to develop RNA and DNA aptamers. DNA molecules capable of facilitating the enzymatic process, such as polynucleotide kinase activity, were developed by selection of iterative cycles (Lorsch JR and Szostak JW, Nature 371, pp. 31-36, 1994) and short single stranded DNA molecules capable of highly specific inhibition of human were selected. phospholipase A ₌ (Bennett CF et al., Nucleic Acids Res.

22, p. 3202-3209 (1994). Other artisans have independently developed DNA or RNA-based aptamers capable of binding and inhibiting several functions of human thrombi (Bock L.C. et al.,

Nature 355, p. 564-566, 1992: Kubrik M.F. > et al., Nucleic

Acids Res. 22, p. 2619-2626 (1994).

I

Other types of high order nucleic acid structures include branched DNA (Horn T. and Urdea MS Nucleic Acids Res. 17: 6959-6967, 1989), with one or more regions of the DNA molecules (probe) that hybridize to a complementary molecule. The nucleic acid may itself be subject to hybridization to another DNA molecule to enhance the amount of DNA associated with the DNA probe. However, the complexes described by Horn and Urdea are linearly expanded, whereby the new hybridized nucleic acid molecules are not intended to hybridize to previously hybridized molecules but to other approaching new molecules to form branched DNA structures. Such complexes are in fact simply designed to form as many branches as possible to provide multiple sites for thermal hybridization of the nucleic acid signal probe.

Other geometric structures provided by nucleic acid base pairing characteristics have been used in the field of material science and nanotechnology (Aliviatos AP et al. _, Nature 382, pp. 609-611, 1996: Mao C, et al., Nature 407, p. 493). to 496, 2000: Zurke B. et al., Nature 406, 605-608, 2000). Elegant technical methods for producing and analyzing high-order nucleic acid structures have been described, including quadrilateral, octahedral, and triangular motifs interconnected multiple times in a lattice (Chen J. et al., J. Am. Chem. Soc. 111, pp. 6402-6407) , 1989: Zhank et al., J. Am. Chem. Soc., 116, pp. 1661-1669, 1994: U.S. Pat. Nos. 5,278,805, 5,468,551, 5,38620 and 6,072,444). Geometric objects are closed structures produced by iterative methods involving the restriction enzyme binding and

DNA. The nodal points in the figures may be fixed by cross-linking between positions to form a solid form or a less flexible branch achieved by thermal hybridization of unpaired positions. The prior art does not include geometric structures that are not closed (i.e., end-bound). The prior art does not include geometric structures that include regions of modified nucleic acids and does not contain geometric nucleic acid structures linked to other molecular units. The prior art does not include the use of libraries of random or semi-random nucleic acid structures.

In connection with the re-use of high-order nucleic acid structures, it is believed that low-order nucleic acids as therapeutic and diagnostic molecules are known in the art as such. In particular, there are many examples of nucleic acid molecules with possible or actual therapeutic activity. Such nucleic acid molecules function either as antisense cells, triplex reagents or as RNA molecules with endoribonuclease activity (ribozymes). In all these cases, the therapeutic nucleic acid modality acts as a modulator of protein expression by a mechanism of action that reduces or blocks protein translation. The specificity of the targeted binding in all these cases is the binding of the nucleic acid to the nucleic acid. These features (translation modulation, nucleic acid binding) are in contrast to the modality of the invention. A distinct and inventive feature of the invention is the use of high order zero acid structures with binding activity to the target molecule.

Other low-order nucleic acid structures, especially aptamers, have been tested as therapeutic and diagnostic molecules. It has been found that some other nucleic acid molecules, particularly ribosomes, have enzymatic effects of possible pharmaceutical importance. The pharmaceutical use of closed geometric structures has not been considered, although U.S. Pat. No. 5,278,551 suggests a possible use as solvents or controlled release carriers for small molecule drugs.

SUMMARY OF THE INVENTION

SUMMARY OF THE INVENTION An acid consisting of a nucleic acid or a base interaction of a two-dimensional polynucleic structure of a plurality of linked strands of molecules of their segments by a specific pairing or several molecules, wherein the structures are not covalently closed.

A first aspect of the invention relates to novel base structures as well as high order nucleic acids, particularly open geometric structures. In addition, the invention relates to the utility of such structures as pharmaceutical and / or diagnostic agents. The invention also relates to high order nucleic acid structures including nucleotides with modifications. The invention also relates to high nucleic acid structures. order, including half-random nucleotides. The invention is based on high region nucleic acids of random regions or also relates to order structures linked to other molecular units when they are proteins.

The structures of the invention utilize Watson-Crick base pairing rules in the field of constructing double-stranded structures. Single-stranded nucleic acid molecules have the ability to hybridize to other single-stranded complementary actions between bases. While hybridization of the two single chain structures leads to molecules while usually a linear double chain molecule, other structures can be produced by capillarous loops, where one molecule has internal base pair complementarity and rings, where both ends of each single chain molecule have complementarity with each other.

In the constructive construction of single-stranded nucleic acid sequences, individual molecules can be constructed which can simultaneously hybridize to two or more other molecules, and vice versa, these other molecules can hybridize to other molecules, including those already incorporated into the hybridization, then nucleic acid complexes can be formed. .

The overall dimensions and topology of double-stranded DNA molecules are well known. The double-stranded DNA is quite flexible and the helix is able to adopt a number of conformations differing in the angle of rotation between adjacent base pairs along the helix. Naturally occurring single-stranded nucleic acid molecules, such as RNA, will adopt advantageous conformations in solution. The conformation is dictated by base-pairing interactions within the same molecule and results in the production of a stabilized structure consisting of double-stranded strains and single-stranded loops. The molecules assume the lowest energy conformation and their structure for the known RNA sequence can be predicted by computational processes (Jaeger J.A. et al., Proc. Nat. Acad. Sci USA 86: 7706-7710, 1989). Efforts have been made to create predictive DNA bending software with some success (Nielsen D.A. et al., Nucleic Acids res. 23: 2287-2291, 1995). By comparing the dimensions between the nucleic acid and the protein molecules, it shows very significant differences in the structural alignment of the two classes of molecules, but it also supports the understanding underlying the invention. A typical globular protein, such as myoglobin with a molecular weight of 17 kDa, has a size in its longest dimension of 3 nm. A large globular protein, such as bovine serum albumin with a molecular weight of 68 kDa, is 5 nm in its largest dimension (Cohen C. in Wolstenholm)

G.E.W and O'Connor M. (editors) Ciba Foundation Symposium, London, J and A. Churchill, 1966). As such, the double stranded helix diameter is 2 nm and the DNA strand with a small number of base pairs, about 100, would have a perimeter length of approximately 30 nm. For that

Ί although the density of the DNA or any other nucleic acid molecule is sufficiently lower than that of a typical protein, the topology of the DNA molecule, even in the most structured native form, such as a double helix, could easily nurse large portions of the exposed surface of nearly each protein molecule. In particular, if the topology of usually single-stranded DNA has not been so altered, the DNA could occupy a large part of the space in a way closer to protein molecules with a fairly higher density. It can be concluded that a set of nucleic acid structures consisting of a series of linked strands, each of which is only short (50), of the nucleotide tracts can easily lead to structures with overall dimensions in the order of 10 to 500 nm. It is a particular object of the invention to provide such a nucleic acid molecule formulation.

acid, or alternatively defined segments within the acid. In utilizing a protein, nucleic to direct strange based on the generation of molecules by structures formed as several nucleic acid molecules, the result of the interaction of the various invention is both a coding unit or as a blocking acid and a gene three-dimensional assembly

The acid structures are

DNA or RNA with the secondary result of the interaction of two or as single nucleotide molecules the information content of DNA or RNA for expression of a therapeutic unit for the metabolism of expression (positive), αA molecular structure of shape.

The invention of a synthetic (non-planar) interior designed to contain domains includes molecules of molecular molecules in nucleic acid molecules, especially DNA, that create three-dimensional structures by pairing specific bases of a set. Specifically, the DNA molecules have one or more sequence sequences that can hybridize to other molecules in the array to create a composite three-dimensional nucleic acid structure. By such a scheme, an approximate cubic structure can be formed by hybridizing six synthetic DNA molecules, each of which contains four complementarity domains, each molecule interacting with four other molecules and each molecule acting effectively as a single edge of a hexagonal cube. The structure is open (not covalently closed), flexible especially for other formations that are modifiable to be modified by the addition of additional functional or structural groups.

In one high order nucleic acid structure of the invention, nucleic acid molecules, each of which occupies two or more domains of a self-complementary sequence, allow the nucleic acid molecule to fold around itself and to interact with each other to form a particular three-dimensional molecular structure through specific base pairing. In some applications, it has been found that the chemical instability of unmodified DNA molecules has been a specific problem for the use of such structures as a drug. Today, there are several ways to protect DNA molecules from degradation by enzymatic attack. These include the use of modified phosphodiester skeletons (methylphosphonate, phosphorothioate, peptide nucleic acids) ', or capping at the 5' and 3 'ends using the phosphoramidite, phosphorothioate or phosphorodithioate linkages. According to the invention, it is particularly preferred to use modified or unnatural nucleic acids in high order nucleic acid based structures. Therefore, a particularly desirable feature is the increased flexibility of the binding specificity achieved by using a combination of chemistry and alternative skeletons of unnatural nucleic acids.

The structure of the high-order nucleic acid subunits of the invention may be homotypic or heterologous in nature, for example DNA containing RNA tracts. RNA tracts within a DNA helix are known to alter the pooling in solution (Wang A. et al., Nature 299, pp. 601-604, 1982). The ability to provide conformational diversity within a localized nucleic acid tract can be significant by altering the specificity of the target protein, and this phenomenon is known in the art, with the binding specificity of the thrombin aptamer being dependent on the short tract of the higher order tertiary structure (Griffin).

L. et al., Gene 137, p. 25-31, 1993). In addition, non-natural phosphate backbone analogs can be used to improve stability as well as alter the binding specificity of a desired target protein. Latham et al. (Lathan J.A. et al., Nucleic Acids Res. 22, 2817-2822, 1994) gives an example in which a modified 5- (1-pentynyl) -2'-deoxyuridine nucleotide was used instead of a thiamidine in a random oligonucleotide group. The invention encompasses molecules consisting of tracts of a single-stranded nucleic acid structure translated by tracts of a double-stranded structure and other synthesized chimeric molecules to contain various chemical substructures but associated with the use of conventional base pairing rules. Such structures may also combine DNA and RNA molecules.

The higher order molecular structures of the invention consist of single or multiple nucleic acid molecules according to any scheme in the art, and the types of synthetic larger molecules may be, be or nucleic acids, or as built by the facilitated

Facilitated by units of plasmid fragments. The individual windings may be recombinant by self-winding winding (enzymes such as ligase, or by way of interaction involving from far away the structure (by self-assembly) of linear DNA molecules mediated by protein topoisomerase, endonuclease, polymerase) with non-protein physiochemical conditions (pH, temperature, ionic conditions). Alternatively, or in combination with the above, the molecules may be coupled by interacting with molecules bound to a solid matrix, or when the DNA is wound into a higher order structure entangled or anchored in space, during all or part of the pooling processes.

A second aspect of the invention is to provide libraries of nucleic acid molecules designed to contain semi-random molecules, some of which may have the desired topology capable of interacting in a specific manner with the target molecule. According to the invention, these are libraries of nucleic acid molecules having a framework leader to facilitate assembly of the known structural subunit. Maximizing library diversity and potential functional utility with respect to activity in a selective binding assay are incorporated within each subunit within the random tract sequence. In a second aspect of the invention, an embodiment is included in which the library is made up of mixtures of n-individual populations (sets) of synthetic DNA molecules (subunits). In this regard, the dimension of the population of synthetic nucleic acid subunits is large and is dictated by the degree of randomness within the variable segment of the subunit. Further, the diversity of subunits is incorporated into other embodiments of variations in the location of the variable domain of variations in the number of variable domains (intersperse with the sequences of the fixed sequence) and variations in length of each given variable domain. It is preferred that the n-single subunit population is mixed into one cycle by temperature hybridization to form a library of a variety of nucleic acid structures and individual sequence diversity. It is understood that other embodiments may include multiple thermal hybridization cycles and multiple integer values of n. A particular feature of the library of this scheme is the ability to modulate the degree of complex inter-subunit interaction by rational construction and placement of a complementary or leader sequence tract.

A third aspect of the invention is the novel utility of high order nucleic acid structures, particularly for pharmaceutical and diagnostic uses. In this regard, these structures are capable of binding to a specific target molecule of both a protein and a protein target molecule. If the preferred embodiment includes a single protein target, further embodiments are contemplated, wherein the target is a protein complex consisting of a number of protein subunits, such as a cell surface receptor, collectively bound by a molecule of the first aspect of the invention. Another embodiment of the third feature comprises binding to a cellular target or cell species identified by the ability to bind the molecule of the first feature. Other embodiments include binding to a target or target complex comprising non-proteinaceous components, for example, carbohydrates or lipid compounds of the cell, and in particular the cell surface. The protein, carbohydrate and lipid units or complexes thereof may be disease-specific units or may be present as normal tissue or cell components. The target or target complex would comprise viral particles or components derived from the virus, such as capsid proteins or host-derived components of the viral coat. The target or target complexes may comprise metal ions or other organic chemicals or chemical groups in their composition and may be natural or may be introduced by treatment with exogenous agents. Target receptors may include, for example, the IL-2 receptor or other cytokine receptors, such as receptors for, e.g., IL-3, M-CSF, GM-CSF. Also surface molecules such as the IgE receptor, where blockade of IgE coupled with blockade of cross-linking activation at receptors would be a highly desirable outcome. Other surface molecules, including a series of cluster differentiation members (CD antigens), are desirable targets for disease modulation, and in particular for diseases of the autoimmune component.

The invention is directed to a particularly widespread utility in the field of therapeutic molecules. The molecular structures of the invention are intended to agonize or antagonize particular receptors or enzymatic processes for therapeutic benefits without contributing to any of the disadvantages of conventional protein therapy such as immunogenicity. The invention therefore extends to methods of treating diseases or conditions and preventing them and comprises administering to an individual an effective amount of a molecular structure. The invention also interferes with the use of such diagnosis structures in vivo and in vitro.

A fourth aspect of the invention relates to high order nucleic acid structures with modified nucleotides incorporated into these structures. Apart from the difference given by the aforementioned second feature or additionally, it is particularly desirable to apply a differentiation to the derivatization of the library subunits or the incorporation of modified bases during their synthesis (thiolated bases, biotinylated bases and epsilon-amino derivatized bases). Thus, a highly different library is obtained with differences in both levels of sequence composition and length. Such parameters can be fixed within defined limits for different libraries and different target applications. High-order nucleic acid structures will also contain modified nucleotides capable of conferring particularly desirable properties to the structures, together with features providing stability or binding modulation as described above. Such additional desirable modifications may be included in the first or second aspect of the invention and include the use of hydrophobic tracts, introduction of psoralene or acridine groups, binding haptenic groups such as biotin or binding to various added side chains such as amino or carboxyl groups to provide easier binding to a particular target molecule. In another preferred embodiment, such groups may act as sites for attachment of other molecules, such as other nucleic acid or protein molecules, such as an antibody or an enzyme.

The desired characteristics of the molecules of the invention are high stability in vitro and in vivo. The chemical composition of the nucleic acid structures is highly influenced, and also the physical size of the molecule requires control to minimize the risk of slippage in solution and to maximize functional utility in vivo. Therefore, multi-stranded nucleic acid structures constructed from generally small (<80mer) subunits are preferred according to the invention. Alternatively, it may be desirable to utilize a structure composed of large subunits (> 80 mer), which is also within the scope of the invention.

A fifth aspect of the invention relates to high order nucleic acid structures associated with other molecular units. In particular, this feature includes nucleic acids linked to one or more specific sites to one or more specific sites of another molecular unit, wherein specific attachment to the nucleic acid is facilitated by modified nucleotides as in the fourth aspect of the invention. In particular, this feature means high-order nucleic acid based structures attached to pharmaceutical or diagnostically significant molecular units, wherein the nucleic acid binds to specific molecular targets associated with the disease and the attached molecular unit is then used to treat or detect the disease.

Pharmaceutically significant units include cytokines, Fc portion of antibodies, other antibody-derived units, toxins, enzymes, drugs and prodrugs, receptor agonists and antagonists, receptor molecules alone (especially ligand binding domains), radioisotopes, pharmaceutical active nucleic acids, delivery vehicles drugs such as liposomes, live or enhanced microorganisms, light activated moieties, and other molecular units that produce a vaccine effect. Diagnostically significant units include radioisotopes, light-activated moieties, for example, producing a chemiluminescent signal, fluorochromes, enzymes, and signal delivery carriers such as pearls.

In summary, the invention provides:

A three-dimensional polynucleic acid structure consisting of a plurality of linked strands of nucleic acid molecules or segments thereof by specific base pairing of two or more molecules, wherein the structure is not covalently closed.

A corresponding polynucleic acid structure formed by two or more strands of a nucleic acid molecule.

A corresponding polynucleic acid structure formed of three or more strands of a nucleic acid molecule.

- The corresponding polynucleic acid structure of the cubic or substantially cubic form.

A corresponding polynucleic acid structure, wherein the cubic structure consists of six nucleic acid strand chains, each molecule chain acting as a separate edge of a six-cubed cube.

A corresponding polynucleic acid structure, wherein each nucleic sequence comprises two or more domains that can hybridize to other set molecules.

A corresponding polynucleic acid structure, wherein each nucleic sequence comprises four domains.

A corresponding polynucleic acid structure comprising nucleic acid molecules consisting of tracts. single-stranded nucleic acid, translated by tracts of double-stranded structure.

A corresponding polynucleic acid structure according to claims 1 to 8, wherein each nucleic acid strand has less than 80, preferably less than 50 nucleotides.

A corresponding polynucleic acid structure, wherein the structure has an assembly (A1 + B1 + Cl) + (A2 + B2 + C2) as shown in FIG. First

A polynucleic acid structure as defined above, wherein the structure comprises subunits consisting of multiple random sequence tracts to form their semi-random molecules or segments capable of interacting with the target molecule.

- A three-dimensional polynucleic acid structure comprising subunits consisting of a series of interconnected strands of nucleic acid molecules or segments thereof by a specific base pairing interaction of two or more molecules, each structure covalently sealed and comprising subunits composed of a diverse random sequence of their tract semi-random molecules or segments thereof in interaction with the target molecule.

A polynucleic acid structure as defined above, wherein the composition and length of the sequence are variable.

The corresponding polynucleic acid structure, wherein the composition of the variable sequence is achieved by one or more modifications of the nucleotides within the sequence.

A polynucleic acid structure as defined above, wherein the structure comprises nucleic acid sites or groups that can bind or attach to another molecule or solid matrix.

A corresponding polynucleic acid structure, wherein said second molecule is a protein, an enzyme, a lipoprotein, a glycosylic protein, an immunoglobulin or a fragment thereof.

A corresponding polynucleic acid structure, wherein said second molecule is a nucleic acid.

A corresponding polynucleic acid structure, wherein the second molecule is pharmaceutically active.

A pharmaceutical composition comprising the aforementioned polynucleic acid structure, optionally with suitable carriers, excipients or diluents, and / or other pharmaceutically active compounds.

Use of the corresponding polynucleic acid structure as a diagnostic reagent.

Use of a polynucleic acid structure as defined above to obtain a library for influencing a variety of specifically random topologies to obtain various functions and / or activities.

Description of the drawings

Fig. 1

Description of sequential assembly of cubic nucleic acid structure from six individual single-stranded molecules designated Α _χ , A ₂ , B ', B ₌ , C and C ₂ . The assembly proceeds by routine pairing of antiparallel bases between nucleic acid molecules. The dimeric intermediates formed between the molecules a _{χ a} and also B _{and a} are shown. The trimeric structures formed between the molecules Α _χ , Β _χ and C as well as A 1, B ₂ and C _{= are shown} . The assembly of the cubic structure is achieved by combining two trimeric moieties designated as (Al + B1 + Cl) + (A2 + B2 + C2).

Fig. 2

IL2R-1 and IL2R-2 oligonucleotide subunit sequence comprising a DNA structure having IL-2 receptor binding activity. Fig. 3

Sequence of TBR-1 and TBR-2 oligonucleotide subunits containing DNA structure with human thrombin binding activity.

The invention is illustrated, but not limited, by the following examples.

DETAILED DESCRIPTION OF THE INVENTION

Example 1

A method of inhibiting an IL-2 dependent cell line using a DNA structure selected from a DNA library.

Libraries of synthetic DNA molecules are prepared, each containing a random sequence region. >.

Library A consists of molecules with the structure:

5'AGTCCCAAGCTGGCT (N) CTCCATCGTGAAGTCAGCCAGCTTTGGACT

Library B consists of molecules with the structure:

5'GACTTCACGATGGAGGTCAGAATGTGAATA (N) _χq TATTCACATTCTGAC

These sequences have been designed to facilitate crosshybridization and represent subunits of the library of structures formed by mixing and crosshybridizing the various subunits according to the scheme of the invention.

Oligonucleotide (subunit) libraries are synthesized for maximum stability with phosphorothioate linkages to maximize stability in the presence of serum factors and purified by HPLC chromatography. Purified oligonucleotides are obtained from Genosys Biotechnologies (Camridge, UK). The DNA library is assembled using single cycle crosshybridization. The subunit libraries A and B are denatured, mixed and hybridized at 37 ° C in 50 mM Tris, pH 7.4, 100 mM NaCl, 5 mM EDTA. Subunit libraries A and B are mixed at equimolar concentration (10M). In other experiments, they are mixed using different molar ratios. The assembly of the subunits is verified by gel electrophoresis.

The DNA structure library is screened for structures capable of binding a particular cell domain of the IL-2 receptor (IL2R). This is accomplished using a soluble IL2R recombinant prepared according to the above methods (Meidel M.C. et al., Biochem. Biophys. Res. Commun. 154: 372-379, 1988: Meidel M.C. et al.

J. Biol. Chem. 264, p. 21097-21105 (1989). Recombinant IL2R covalently binds to surface activated magnetic beads according to protocols recommended by the manufacturer (Bangs Labs. Fishers, IN, USA). The IL2R beads are used as the affinity surface to select binding structures from the DNA structure library. IL2R beads are reacted with the library under a variety of experimental conditions, including the presence of chaotropic salts in controlled reactions. The library (DNA) concentration is approximately 100 nmol in the hybridization solution as above. Binding molecules were obtained by polymerase chain reaction (PCR) directly from the beads after an extensive wash cycle with 75 mM Tris HCl, 200 mM NaCl, 0.5 N-octylglucoside, pH 8.0. PCR is carried out using primer PRA1 (5'-AGTCCCAAGCTGGCT) to obtain a library A component using standard reaction systems and conditions. In special reactions, primers PRB1 (5'GACTTCACGATGGAG) and PRB2 (5'GTCAGAATGTGAATA) were used to obtain components of library B. PCR products were cloned and sequenced using standard reaction systems and procedures.

A number of sequences are obtained and identified as originating from subunit library A and subunit library B. A pair is synthesized using phosphorothioate chemistry as described above. The IL2-R1 and IL2-R2 oligonucleotides (sequences in FIG. 2) are purified and pooled as above and used as cellular assays for IL-2 antagonism.

TALL-104 (ATCC CRL-11386) is a human, T-cell leukemia cell line. The cells grow in suspension culture and need IL-2 for optimal growth. Cells can be grown for a short time without IL-2, but their growth is significantly reduced. Cells are grown in Iscoves modified Dulbeccosa medium (Life technologies, Paisley, UK) with 50-100 µl / ml recombinant human IL-2 (Life Technologies, Paisley, UK) and supplemented with 10% (v / v) heat activated calf germ serum. . The cells are grown in an environment with 8-10% carbon dioxide. Dilution of the hybridized IL2-R1 / IL2-R2 DNA preparation and control of a DNA sample containing a random sequence of identical contour length are prepared in a culture medium containing IL-2. Parallel series, dilutions using IL-2-free medium are prepared. Solutions are from 500 M DNA to 390 nM DNA. The assay is performed with sub-pooled TALL-104 cells plated the previous day in 96-well microtiter plates. Cells are collected by centrifugation, washed with pre-warmed (37 ° C) phosphate buffered saline and DNA containing medium added after 48 hours. The experiments were performed four times. Proliferation is assessed at the end of a 48-hour pause by a colorimetric assay using a commercially available tetrazolium compound and following the supplier's instructions (Promega, Southampton, UK). Microtiter plates are read at 540 nm.

The results show that the hybridized DNA compositions inhibit the growth of the TALL-104 cell line under conditions where the synthetic oligonucleotides IL2-R1 and IL2-R2 were inactive.

Example 2

A method for selecting a DNA structure binding to human thrombin

The library described in Example 1 was used to select a DNA structure capable of binding to human thrombin. The library is screened using human thrombin composition (Sigma, Poole, UK) bound to activated magnetic beads as in Example 1. Thrombin beads are reacted with a DNA structure library as in Example 1, except that binding washes are performed with a solution. mM Tris acetate, pH 7.4, 140 mM NaCl, 5 mM KCl, 1 mM MgCl 2. Bound molecules are obtained directly from beads using PCR using the reactions and primer sets as in Example 1. PCR products are cloned and sequenced using standard reaction systems and procedures.

A number of sequences are obtained and identified as originating from subunit library A and subunit library B. From these, a pair is synthesized using phosphorothioate chemistry as described above. The oligonucleotides TB-R1 and TB-R2 (sequences in Figure 3) were purified and pooled. The TB-R1 / TB-R2 complex is used in the thrombin inhibition assay. Clotting is measured with a fibrometer at 37 ° C in freshly prepared plasma from a healthy donor. The extent of thrombin inhibition is determined using a standard curve of clotting plotted against thrombin concentration. The shrinkage is measured through three logs of the DAY structure in the assay.

The result shows inhibition of clotting in the presence

TB-R1 / TB-R2 DNA complex.

Example 3

A method of selecting DNA structures binding to recombinant soluble CD4

The libraries described in Example 1 are used to select the DNA structure of the CD4 compositions of a CD4 composition capable of binding to recombinant soluble (rsCD4). The DNA structure is screened with the aid of (BioDesign, Saco, ME, USA) immobilized on activated magnetic beads as described above.

Library screening, washing and selection by PCR were performed according to Example 2. Individual ologinucleotide pairs derived from subunit libraries A and B were synthesized and assembled. The structure was used to inhibit the binding of anti CD4 monclonal RPAT4 (Serotech., Abinston, UK) in the enzyme. bound by immunoabsorbant assay (ELISA).

96-well ELISA plates were coated overnight with a 0.2 mg / ml solution of rsCD4 in coating buffer (0.05 M carbonate-bicarbonate buffer, pH 9.0) at 4 ° C. The plates were washed extensively with TBS- T (tris-buffered saline pH 8.0, 0.05% Tween 20 by volume) and DNA test and control structures are diluted (1: 2) and DNA test and control structures are diluted (1: 2). on plate in TBS východ starting concentration 100 £> M. Plates are incubated for 40 minutes at 37 ° C and washed with TBS. Add to the plate 100 ng / ml RPAT4 v. PBS and incubated at 37 ° C for 40 minutes. Plates were washed and bound RPAT4 was gated with alkaline phosphatase labeled sheep anti-mouse (Sigma, Poole, UK) and Sigma Fast OPD (Sigma, Poole, UK) as a color substrate. . . In some assays, DNA is co-incubated with monoclonal

RPAT4. Color intensity is read by a plate reader and the signal is compared between test and control wells. The results show significant inhibition of RPAT4 binding to reCDE4 in the presence of DNA structure.

Industrial usability

High-order nucleic acid structures for the manufacture of pharmaceutical compositions for the treatment and diagnosis of diseases.

Claims (22)

PATENT CLAIMS A three-dimensional structure of a polynucleic acid consisting of a plurality of linked strands of nucleic acid molecules or segments thereof by specific base pairing of two or more molecules, wherein the structures are not covalently closed. The three-dimensional structure of claim 1 consisting of two or nucleic acids. polynucleic acid according to several strands of the molecule The three-dimensional structure of claim 2 consisting of three or nucleic acids. polynucleic acid according to several strands of the molecule The three-dimensional structure of a polynucleic acid according to claims 1 to 3 in the form of a cube or substantially cube-shaped. The three-dimensional structure of the polynucleic acid of claim 3 consisting of six molecular chains, wherein each molecular chain acts as a separate edge of a six-cube cube. The three-dimensional structure of the polynucleic acid according to claims 1 to 5, wherein each nucleic sequence consists of two or more domains that can hybridize to other collection molecules. The three-dimensional structure of the polynucleic acid of claim 6, wherein each nucleic sequence consists of four domains. A three-dimensional polynucleic acid structure according to claims 1 to 7, comprising nucleic acid molecules consisting of single-stranded nucleic acid tracts translated by tracts of a double-stranded structure. The three-dimensional structure of the polynucleic acid of claim 1 to 8, wherein each nucleic acid strand has less than 80 nucleotides. The three-dimensional structure of the polynucleic acid of claim 9, wherein each nucleic acid strand has less than 50 nucleotides. A three-dimensional polynucleic acid structure according to claims 1 to 10 having an assembly (A1 + B1 + Cl) + (A2 + B2 + C2) as shown in FIG. First A three-dimensional polynucleic acid structure according to claims 1 to 11 comprising subunits consisting of a variety of random sequence tracts to form their semishogenic molecules or segments capable of interacting with a target molecule. A three-dimensional polynucleic acid structure comprising subunits consisting of a series of interconnected strands of nucleic acid molecules or segments thereof by a specific base pairing interaction of two or more molecules, each structure covalently enclosed and comprising subunits that are composed of a variety of random sequential tracts to obtain seminar segments in interaction with the target molecule. The three-dimensional structure of a polynucleic acid according to claims 1 to 13 of variable length composition. The three-dimensional structure of a polynucleic acid according to claim 14, wherein the composition of the variable sequence is achieved by one or more modifications of the nucleotides within the sequence. A three-dimensional polynucleic acid structure according to claims 1 to 15 comprising sites or groups of nucleic acids that can bind or attach to another molecule or solid matrix. The three-dimensional structure of the polynucleic acid of claim 16, wherein said second molecule is a protein, an enzyme, a lipoprotein, a glycosylated protein, an immunoglobulin, or a fragment thereof. The three-dimensional structure of the polynucleic acid of claim 16, wherein the second molecule is a nucleic acid. The three-dimensional structure of a polynucleic acid according to claims 16 to 18, which is pharmaceutically active. 20. A pharmaceutical composition comprising a three-dimensional polynucleic acid structure according to claims 1 to 19 optionally with suitable carriers, excipients or diluents and / or other pharmaceutically active compounds. Use of a three-dimensional polynucleic acid structure according to claims 1 to 18 as a diagnostic agent. Use of a three-dimensional polynucleic acid structure according to claim 12 or 13 for obtaining a library for influencing a variety of specifically random topologies to obtain various functions and / or activities.