WO2020204151A1

WO2020204151A1 - Aptamer to fgf9 and use thereof

Info

Publication number: WO2020204151A1
Application number: PCT/JP2020/015263
Authority: WO
Inventors: 健朗安達
Original assignee: 株式会社リボミック
Priority date: 2019-04-04
Filing date: 2020-04-03
Publication date: 2020-10-08

Abstract

The present invention provides an aptamer binding to FGF9, which contains a nucleotide sequence represented by formula (I): CAAGGHTGCCG (SEQ ID NO: 37) (I) (wherein H represents A, C or T), etc.

Description

Aptamers for FGF9 and their use

The present invention is an invention relating to an aptamer for FGF9.

Fibroblast Growth Factor 9 (FGF9) is one of the FGF family proteins and is a protein involved in various biological processes such as embryogenesis, development, angiogenesis, and tumorigenesis (Fibroblast Growth Factor 9; FGF9). Non-Patent Document 1). In particular, it has been reported that it is expressed in various cancers like other FGF family proteins, and it has also been reported that various organ-specific cancer models can be created by expressing FGF9 in a cell-specific manner.

Molecules that bind to FGF9 and inhibit its function have been reported so far. For example, Non-Patent Document 2 suggests that an anti-FGF9 antibody is effective for prostate cancer-induced osteoblastic bone metastasis.

Aptamers are nucleic acids that specifically bind to target molecules (proteins, sugar chains, hormones, etc.) and can bind to target molecules via the three-dimensional structure formed by single-stranded RNA (or DNA). it can. A screening method called the SELEX method (Systematic Evolution of Ligands by Exponential Enrichment) is used for the acquisition (Patent Documents 1 to 3). The chain length of the aptamer obtained by the SELEX method is about 80 nucleotides, and then the chain length is shortened using the physiological inhibitory activity of the target molecule as an index. Furthermore, chemical modification is added for the purpose of improving stability in the living body, and optimization as a pharmaceutical product is achieved. Aptamers are less susceptible to immune exclusion, and side effects such as antibody-specific antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cellular cytotoxicity (CDC) are less likely to occur. In addition, low-molecular-weight compounds, which are the same molecular-targeted drugs, also have poorly soluble molecules, and optimization may be required for their formulation, but aptamers are highly water-soluble, which is also advantageous. Furthermore, since it is produced by chemical synthesis, cost reduction can be achieved by mass production. In addition, long-term storage stability, heat, and solvent resistance are also predominant features of aptamers. On the other hand, aptamers generally have a shorter half-life in blood than antibodies. However, this point may also be advantageous from the viewpoint of toxicity. Various aptamer drugs have been developed, including Macugen (target disease: age-related macular degeneration), the first RNA aptamer drug approved in the United States in December 2004. In recent years, not only RNA aptamers but also DNA aptamers that can be stably and inexpensively produced in vivo have been developed.

In addition, many attempts have been made to use aptamers for purification and molecular targeting of target molecules by utilizing their high affinity for target molecules. Aptamers often have a higher affinity than antibodies with similar functions. From the viewpoint of delivery, since the aptamer has a molecular size of about 1/10 of that of the antibody, tissue migration is likely to occur, and it is easier to deliver the drug to the target site. Antibodies to FGF9 are already commercially available, but no aptamers to FGF9 have been reported so far.

International Publication No. 91/19813 International Publication No. 94/08050 International Publication No. 95/07364

An object of the present invention is to provide an aptamer for FGF9.

The present inventor has succeeded in producing an aptamer that binds to FGF9 as a result of diligent studies to solve the above problems. We also showed that this aptamer inhibits the activity of FGF9. In particular, this aptamer was a novel aptamer having a characteristic potential secondary structure and a motif sequence of a loop portion, which is a characteristic of the secondary structure.

That is, the present invention is as follows.
[1] An aptamer that binds to FGF9.
[2] Equation (I):
CAAGGHTGCCG (SEQ ID NO: 37) (I)
(In the formula, H represents A, C or T)
The aptamer according to [1], which comprises a nucleotide sequence represented by.
[3] The aptamer according to [2], which is either (a) or (b) below:
(a) In the nucleotide sequence contained in the aptamer,
(i) Each pyrimidine nucleotide is deoxyribose,
(ii) Each purine nucleotide is ribose;
(b) In the nucleotide sequence contained in the aptamer
(i) Each pyrimidine nucleotide is deoxyribose, and the hydrogen atom at the 2'position of the deoxyribose is independently unsubstituted or substituted with a methoxy group.
(ii) Each purine nucleotide is ribose, and the hydroxy group at the 2'position of the ribose is independently unsubstituted or substituted with a methoxy group.
[4] The nucleotide sequence represented by the formula (I), the nucleotides X1, X2, X3 and the nucleotides X4, X5, X6 adjacent to the 5'end of the nucleotide sequence are represented by the formula (II):

(In the formula, H represents A, C or T;
X1 to X6 are nucleotides selected from the group consisting of A, G, C and T, which are the same or different, respectively;
X1 and X6, X2 and X5, X3 and X4, and the 5'end C and 3'end G of the nucleotide sequence represented by formula (I) form Watson-Crick base pairs, respectively)
The aptamer according to [3], which forms a potential secondary structure represented by.
[5] In formula (II), nucleotide number 4th G and nucleotide number 10th C, nucleotide number 5th G and nucleotide number 9th C in the nucleotide sequence represented by formula (I) are further added. The aptamer according to [4], each of which forms a Watson click base pair.
[6] The following (A), (B) or (C):
(A) Nucleotide sequences selected from the group consisting of SEQ ID NOs: 1-6, 10-15, 17, 18, 20, 21 and 23-35,
(B) In a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 6, 10 to 15, 17, 18, 20, 21 and 23 to 35, one to several nucleotides are substituted, deleted, inserted or added. (However, excluding the nucleotide sequence represented by the formula (I)), the nucleotide sequence,
(C) Has 95% or more identity with the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6, 10-15, 17, 18, 20, 21 and 23-35 (provided that it is in formula (I)). The aptamer according to [4], which comprises any of the nucleotide sequences of the nucleotide sequences (the nucleotide sequences represented are identical).
In the nucleotide sequence contained in the aptamer,
(i) Each pyrimidine nucleotide is deoxyribose,
(ii) An aptamer in which each purine nucleotide is ribose.
[7] The aptamer according to [4] or [5], wherein the inverted dT is bound to the 3'end of the aptamer.
[8] The aptamer according to any one of [1] to [7], which further inhibits the binding between FGF9 and its receptor.
[9] A complex containing the aptamer and the functional substance according to any one of [1] to [8].
[10] The complex according to [9], wherein the functional substance is an affinity substance, a labeling substance, an enzyme, a drug delivery medium or a drug.
[11] A medicament comprising the aptamer according to any one of [1] to [8] or the complex according to [9] or [10].
[12] A reagent for detecting FGF9, which comprises the aptamer according to any one of [1] to [8] or the complex according to [9] or [10].

The aptamer or complex of the present invention may be useful for purification and concentration of FGF9, labeling of FGF9, and detection and quantification of FGF9.

FIG. 1 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the nucleotide sequence circled corresponds to a common sequence. FIG. 2 shows a sensorgram in which an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 binds to FGF9. FIG. 3 shows a sensorgram showing that an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 inhibits the binding between FGF9 and FGFR3c. FIG. 4-1 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 2 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the nucleotide sequence circled corresponds to a common sequence. FIG. 4-2 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 3 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the nucleotide sequence circled corresponds to a common sequence. FIG. 4-3 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 4 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the nucleotide sequence circled corresponds to a common sequence. FIG. 4-4 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 5 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the nucleotide sequence circled corresponds to a common sequence. FIG. 4-5 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 6 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the nucleotide sequence circled corresponds to a common sequence. FIG. 4-6 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 7 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the nucleotide sequence circled corresponds to a partial sequence of the common sequence. FIG. 4-7 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 8 as expected by the MFOLD program. U or u represents deoxythymidine. Also, the circled nucleotide sequence corresponds to a sequence in which two adjacent A's are deleted in the common sequence. FIG. 4-8 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 9 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the nucleotide sequence circled corresponds to a partial sequence of the common sequence. FIG. 5-1 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 10 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-2 shows the secondary structure of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 11 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-3 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 12 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-4 shows the secondary structure of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 13 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-5 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 14 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-6 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 15 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-7 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 16 as expected by the MFOLD program. U or u represents deoxythymidine. FIG. 5-8 shows the secondary structure of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 17 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-9 shows the secondary structure of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 18 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-10 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 19 as expected by the MFOLD program. U or u represents deoxythymidine. FIG. 5-11 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 20 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-12 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 21 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-13 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 22 as expected by the MFOLD program. U or u represents deoxythymidine. FIG. 5-14 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 23, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-15 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 24, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-16 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 25, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-17 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 26, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 5-18 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 27, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 6-1 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 28, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 6-2 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 29, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 6-3 shows the secondary structure of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 30 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 6-4 shows the secondary structure of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 31 as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 6-5 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 32, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 6-6 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 33, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 6-7 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 34, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence. FIG. 6-8 shows the secondary structure of an aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 35, as expected by the MFOLD program. U or u represents deoxythymidine. In addition, the loop surrounded by a square corresponds to a loop formed by a common sequence.

The present invention provides an aptamer having a binding activity to FGF9.

An aptamer is a nucleic acid molecule having a binding activity to a predetermined target molecule. Aptamers can inhibit the activity of a given target molecule by binding to the given target molecule. The aptamers of the present invention can be RNA, DNA, modified nucleic acids or mixtures thereof, but preferably pyrimidines are DNA and purines are RNA. The aptamers of the present invention may also be in linear, cyclic or stem-loop form.

The aptamer of the present invention binds to FGF9 in a physiological buffer solution. The buffer solution is not particularly limited, but one having a pH of about 5.0 to 10.0 is preferably used, and examples of such a buffer solution include solution C (see Example 1) described later. The aptamer of the present invention binds to FGF9 with a strength that can be detected by any of the following tests.
Biacore T200 manufactured by GE Healthcare is used to measure the bond strength. One measurement method is to first immobilize the aptamer on the sensor chip. The amount of immobilization is about 370 RU. The FGF9 solution for analite is prepared to 0.1 μM and injected to detect the binding of FGF9 to the aptamer. When a DNA containing a random nucleotide sequence consisting of 35 nucleotides is used as a negative control and FGF9 binds to an aptamer significantly more strongly than the control DNA, it can be determined that the aptamer has a binding ability to FGF9. ..

In one embodiment, the aptamer of the present invention can bind to FGF9 and inhibit the activity of FGF9. That is, the aptamer of the present invention may also have an inhibitory activity on FGF9.

The inhibitory activity on FGF9 means an inhibitory ability against any activity possessed by FGF9. For example, FGF9 acts on FGF receptor-expressing cells to activate signal transduction and induce the production of various cell growth factors and their receptors. Therefore, the inhibitory activity on FGF9 may be an activity that inhibits intracellular signal transduction via the FGF receptor. In addition, the expression of these various cell growth factors and their receptors results in the enhancement of cell growth activity and migration activity, and thus the inhibitory activity of FGF9 means inhibition of those activities.
Therefore, when the aptamer of the present invention binds to FGF9 and inhibits the binding between FGF9 and the FGF receptor, the action associated with the activation of the intracellular signal transduction pathway mediated by the FGF receptor, for example, phosphorylation of ERK1 / 2 and The accompanying proliferation of fibroblasts and the like can be inhibited.

FGF9 is a protein that is strongly expressed during embryogenesis, development, angiogenesis, and tumorigenesis, and is, for example, a protein having the amino acid sequence represented by SEQ ID NO: 36. In addition to being produced in an animal body, FGF9 in the present invention can also be produced using mammalian cells such as mice, insect cells, and cultured cells such as Escherichia coli, and can also be produced by chemical synthesis. When prepared by cultured cells or chemical synthesis, a mutant can be easily prepared by a method known per se. Here, the "mutant" of FGF9 is one in which one to several amino acids are substituted, deleted, added, etc. from the known amino acid sequence of FGF9, or one consisting of a part of the amino acid sequence of the known amino acid sequence of FGF9. It means a protein or peptide having at least one activity of the activity originally possessed by FGF9. When an amino acid is substituted or added, the amino acid may be a natural amino acid or an unnatural amino acid. FGF9 in the present invention contains these variants.

The FGF9 receptor means a cell surface protein to which FGF9 binds. FGFR3c is known as the FGF9 receptor. The FGF9 receptor in the present invention may be a protein containing a natural amino acid sequence or a mutant thereof. Here, the "mutant" of the FGF9 receptor is one in which one to several amino acids are substituted, deleted, added, etc., or one consisting of a part of the amino acid sequence of a known FGF9 receptor. , Means a protein or peptide having binding activity to FGF9. In one embodiment, the invention provides an aptamer that inhibits the binding of FGF9 to the FGF9 receptor.

The aptamer of the present invention is not particularly limited as long as it is an aptamer that binds to an arbitrary portion of FGF9. Further, the aptamer of the present invention is not particularly limited as long as it can bind to any portion of FGF9 and inhibit its activity.

The length of the aptamer of the present invention is not particularly limited and may be usually about 200 nucleotides or less, but for example, it is about 100 nucleotides or less, preferably about 50 nucleotides or less, and more preferably about 40 nucleotides or less. obtain. When the total number of nucleotides is small, chemical synthesis and mass production are easier, and there is a great cost advantage. In addition, it is considered that chemical modification is easy, stability in vivo is high, and toxicity is low. The lower limit of the aptamer length of the present invention is not particularly limited as long as it contains the common sequence represented by SEQ ID NO: 37 (CAAGGHTGCCG; H represents A, C or T), but the aptamer length is preferably 15 nucleotides or more, for example. Can be 20 nucleotides or more, more preferably 25 nucleotides or more. In a particularly preferred embodiment, the aptamer length of the present invention is 25-40 nucleotides.

In one preferred embodiment, the aptamer of the present invention is formulated (I):
CAAGGHTGCCG (SEQ ID NO: 37) (I)
(In the formula, H represents A, C or T)
It is an aptamer that binds to FGF9 (hereinafter, also referred to as the aptamer (I) of the present invention) containing the nucleotide sequence represented by. Each nucleotide constituting the aptamer (I) of the present invention may be ribose or deoxyribose independently. In the aptamer (I) of the present invention, when the nucleotide is ribose, thymine (T) shall be read as uracil (U).

In a more preferred embodiment, the aptamer of the present invention is formulated (I):
CAAGGHTGCCG (SEQ ID NO: 37) (I)
(In the formula, H represents A, C or T)
An aptamer that binds to FGF9 and contains the nucleotide sequence represented by (a) or (b):
(a) In the nucleotide sequence contained in the aptamer,
(i) Each pyrimidine nucleotide is deoxyribose,
(ii) Each purine nucleotide is ribose;
(b) In the nucleotide sequence contained in the aptamer
(i) Each pyrimidine nucleotide is deoxyribose, and the hydrogen atom at the 2'position of the deoxyribose is independently unsubstituted or substituted with a methoxy group.
(ii) Each purine nucleotide is ribose, and the hydroxy group at the 2'position of the ribose is independently unsubstituted or substituted with a methoxy group;
It is an aptamer (hereinafter, also referred to as an aptamer (II) of the present invention) which is one of the above.

In one preferred embodiment, the aptamer (II) of the present invention comprises the following (A) to (C):
(A) Aptamer containing a nucleotide sequence selected from the group consisting of SEQ ID NOs: 16, 19 and 22;
(B) In the nucleotide sequence selected from the group consisting of SEQ ID NOs: 16, 19 and 22, one to several nucleotides were substituted, deleted, inserted or added (however, CAAGGHTGCCG (SEQ ID NO: 37) (in the formula). , H represents A, C or T) Except for the nucleotide sequence represented by) An aptamer that binds to FGF9;
(C) Has 95% or more identity with the nucleotide sequence selected from the group consisting of SEQ ID NOs: 16, 19 and 22 (where CAAGGHTGCCG (SEQ ID NO: 37) (wherein H stands for A, C or T). The nucleotide sequence represented by) is the same.) An aptamer that binds to FGF9 and contains a nucleotide sequence;
In any of the aptamers, in the nucleotide sequence contained in the aptamer,
(i) Each pyrimidine nucleotide is deoxyribose,
(ii) Each purine nucleotide is an aptamer that is ribose (hereinafter, also referred to as an aptamer (III) of the present invention).

The aptamers of (B) and (C) above include the sequence represented by the formula (I): CAAGGHTGCCG (SEQ ID NO: 37) (where H represents A, C or T) as a common sequence.

In the above (B), the number of nucleotides to be substituted, deleted, inserted or added is not particularly limited as long as the aptamer can bind to FGF9 and inhibit the activity of FGF9, but is, for example, 10 or less, preferably 5 or less. , More preferably 4, 3, 2, or 1.

In (C) above, "identity" means the optimum alignment (preferably, the algorithm is the optimum alignment) when two nucleotide sequences are aligned using a mathematical algorithm known in the art. Therefore, the introduction of a gap in one or both of the sequences can be considered), which means the ratio (%) of the same nucleotide residue to the total number of overlapping nucleotide residues.

In the present specification, for the identity in the nucleotide sequence, for example, the homology calculation algorithm NCBI BLAST-2 (National Center for Biotechnology Information Basic Local Alignment Search Tool) is used, and the following conditions (gap open = 5 penalty; gap extension = 2) are used. It can be calculated by aligning the two nucleotide sequences with a penalty; x_dropoff = 50; expected value = 10; filtering = ON).

The aptamer (III) of the present invention also
(D) can be one or more of the above (A) and / or one or more of the above (B) and / or one or more of the above (C). In (D) above, the connection can be performed by a tandem bond. In addition, a linker may be used for the connection. Linkers include nucleotide chains (eg, 1 to about 20 nucleotides), non-nucleotide chains (eg,-(CH ₂ ) n-linker,-(CH ₂ CH ₂ O) n-linker, hexaethylene glycol linker, TEG linker. , Peptide-containing linkers, -SS-binding-containing linkers, -CONH-binding-containing linkers, -OPO ₃ -binding-containing linkers). The plurality of the above-mentioned plurality of connected products is not particularly limited as long as it is two or more, but may be, for example, two, three, or four.

In another preferred embodiment, the aptamer (II) of the present invention comprises a nucleotide sequence represented by formula (I), adjacent to nucleotides X1, X2, X3 and 3'ends adjacent to the 5'end of the nucleotide sequence. Nucleotides X4, X5, X6 are expressed in formula (II):

(In the formula, H represents A, C or T;
X1 to X6 are nucleotides selected from the group consisting of A, G, C and T, which are the same or different, respectively;
X1 and X6, X2 and X5, X3 and X4, and the 5'end C and 3'end G of the nucleotide sequence represented by formula (I) form Watson-Crick base pairs, respectively)
It is an aptamer capable of forming a latent secondary structure represented by (hereinafter, also referred to as an aptamer (IV) of the present invention).

The aptamer (IV) of the present invention is a nucleotide sequence represented by the formula (I), nucleotides X1, X2, X3 and nucleotides X4, X5, X6 adjacent to the 5'end of the nucleotide sequence. The above structure can be taken in the represented sequence portion. By adopting this structure, it is considered that it has various activities against FGF9 (binding activity to FGF9, inhibitory activity of FGF9, etc.).

In the above structure, the stem structure is formed by Watson-Crick base pairing of C at the 5'end and G at the 3'end of the nucleotide sequence represented by X1 and X6, X2 and X5, X3 and X4, and the formula (I). Is formed. Having a stem structure stabilizes the aptamer and gives it a strong activity. The number of base pairs forming the stem structure (stem length) is not particularly limited. Preferably, the stem length is 4 base pairs or more. The upper limit is not particularly limited, but is, for example, 10 base pairs or less, preferably 7 base pairs or less. Further, in the stem structure, as long as the stem structure is formed as a whole, the aptamer activity is maintained even if a part of the stem structure does not form a base pair.

The above-mentioned latent secondary structure means a secondary structure that exists stably under physiological conditions. For example, whether or not it has a latent secondary structure can be determined by the structure prediction program described in the examples.

In the formula (II), the aptamer (IV) of the present invention further has a nucleotide number 4th G and a nucleotide number 10th C, a nucleotide number 5th G and a nucleotide number in the nucleotide sequence represented by the formula (I). The ninth C may each potentially form a Watson click base pair. Therefore, the aptamer (IV) of the present invention has the following formula (II').

(Hereinafter, also referred to as the aptamer (V) of the present invention).
According to the secondary structure prediction by Mfold, when there are multiple energetically stable candidates, multiple candidates may be presented. When the nucleotide sequence of the aptamer of the present invention is applied to Mfold and the secondary structure is predicted, both the structure of the formula (II) and the structure of the formula (II') may be obtained. Therefore, the aptamer (IV) of the present invention may adopt the structure of the formula (II) or the structure of the formula (II').

In one preferred embodiment, the aptamer (IV) of the present invention comprises the following (A') to (C'):
(A') Aptamer containing nucleotide sequences selected from the group consisting of SEQ ID NOs: 1-6, 10-15, 17, 18, 20, 21 and 23-35;
(B') In a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6, 10-15, 17, 18, 20, 21 and 23-35, one to several nucleotides are substituted, deleted, inserted or inserted. An aptamer that binds to FGF9, including an added (excluding the nucleotide sequence represented by CAAGGHTGCCG (SEQ ID NO: 37) (where H stands for A, C or T)).
(C') Has 95% or more identity with the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-6, 10-15, 17, 18, 20, 21 and 23-35 (provided that CAAGGHTGCCG (SEQ ID NO:) 37) An aptamer that binds to FGF9, which comprises a nucleotide sequence (in the formula, H represents A, C or T) has the same nucleotide sequence;
In any of the aptamers, in the nucleotide sequence contained in the aptamer,
(i) Each pyrimidine nucleotide is deoxyribose,
(ii) Each purine nucleotide is an aptamer that is ribose (hereinafter, also referred to as an aptamer (VI) of the present invention).

The aptamers of (B') and (C') above include the sequence represented by the formula (I): CAAGGHTGCCG (SEQ ID NO: 37) (where H represents A, C or T) as a common sequence.

In (B') above, the number of nucleotides substituted, deleted, inserted or added may be preferably 5 or less, more preferably 4 and even more preferably 3 and particularly preferably 2 or 1. ..

In the above (C'), "identity" is synonymous with the above (C).

The aptamer (V) of the present invention is also
(D') Can be one or more of the above (A') and / or one or more of the above (B') and / or one or more of the above (C'). In the above (D'), the connection can be performed by a tandem bond. In addition, a linker may be used for the connection. Linkers include nucleotide chains (eg, 1 to about 20 nucleotides), non-nucleotide chains (eg,-(CH ₂ ) n-linker,-(CH ₂ CH ₂ O) n-linker, hexaethylene glycol linker, TEG linker. , Peptide-containing linkers, -SS-binding-containing linkers, -CONH-binding-containing linkers, -OPO ₃ -binding-containing linkers). The plurality of the above-mentioned plurality of connected products is not particularly limited as long as it is two or more, but may be, for example, two, three, or four.

The aptamers (IV) or (V) of the present invention, in another preferred embodiment, are polyethylene glycol, amino acids, peptides, inverted dT, nucleic acids, nucleosides, Myristoyl, Lithocolic-oleyl, Docosanyl, Lauroyl, Stearoyl, Palmitoyl, Oleoyl. , Linoleoyl, other lipids, steroids, cholesterol, caffeine, vitamins, pigments, fluorescent substances, anticancer agents, toxins, enzymes, radioactive substances, biotin, etc. by adding to the 5'end and / or 3'end of the aptamer. Modifications can be made. In one more preferred embodiment, the aptamer (IV) or (V) of the present invention is an aptamer in which an inverted dT is bound to the 3'end of the aptamer (hereinafter, also referred to as the aptamer (VII) of the present invention). ). Such end modifications can be made, for example, with reference to US Pat. Nos. 5,660,985 and 5,756,703.

The aptamer (VII) of the present invention is, in a preferred embodiment, an aptamer that binds to FGF9, which comprises the nucleotide sequence represented by SEQ ID NO: 30, in the nucleotide sequence contained in the aptamer.
(i) The hydrogen atom at the 2'position of deoxyribose of each pyrimidine nucleotide is independently unsubstituted or substituted with a methoxy group.
(ii) The hydroxy group at the 2'position of ribose of each purine nucleotide is an aptamer that is independently unsubstituted or substituted with a methoxy group (hereinafter, also referred to as the aptamer (VIII) of the present invention). ).

The aptamer of the present invention may be one in which the sugar residues (ribose, deoxyribose) of each nucleotide are further modified in order to enhance the binding property, stability, drug delivery property and the like to FGF9. Examples of the site modified in the sugar residue include those in which the hydroxy group or hydrogen atom at the 2'-position, 3'-position and / or 4'-position of the sugar residue is replaced with another atom. Types of modification include, for example, fluorolysis, alkoxylation (eg, methoxylation, ethoxylation), O-allylation, S-alkylation (eg, S-methylation, S-ethylation), S-allylation. , Amination (eg, -NH ₂ ). Such modification of sugar residues can be carried out by a method known per se (eg, Sproat et al., (1991) Nucle. Acid. Res. 19, 733-738; Cotton et al., (1991)). Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).
The sugar residue can also be BNA: Bridged nucleic acid (LNA: Linked nucleic acid) having a crosslinked structure formed at the 2'and 4'positions. Such modification of sugar residues can also be performed by a method known per se (eg, Tetrahedron Lett., 38, 8735-8738 (1997); Tetrahedron, 59, 5123-5128 (2003), Rahman SMA, Seki. See S., Obika S., Yoshikawa H., Miyashita K., Imanishi T., J. Am. Chem. Soc., 130, 4886-4896 (2008)).

The aptamer of the present invention may also have a nucleobase (eg, purine, pyrimidine) modified (eg, chemically substituted) in order to enhance the binding activity to FGF9 and the like. Such modifications include, for example, 5-position pyrimidine modification, 6- and / or 8-position purine modification, modification with extracyclic amine, substitution with 4-thiouridine, substitution with 5-bromo or 5-iodo-uracil. Can be mentioned.
Further, the phosphate group contained in the aptamer of the present invention may be modified so as to be resistant to nucleases and hydrolysis, or for the purpose of enhancing the binding activity to FGF9. For example, the P (O) O group, which is a phosphate group, is P (O) S (thioate), P (S) S (dithioate), P (O) NR ₂ (amidate), P (O) R, R ( O) oR ', CO or CH ₂ (formacetal) or 3'-amine _{_{(-NH-CH 2 -CH 2 -}} ) each of R or R may be substituted [wherein in' is independently Alkyl (eg, methyl, ethyl) that is H, substituted, or unsubstituted].
Linking groups include -O-, -N- or -S-, which can bind to adjacent nucleotides through these linking groups.
Modifications may also include 3'and 5'modifications such as capping.

The aptamer of the present invention can be synthesized by the methods disclosed in the present specification and known in the art. One of the synthetic methods is a method using RNA polymerase. The target RNA can be obtained by chemically synthesizing the DNA having the target sequence and the promoter sequence of RNA polymerase and transcribing this as a template by a method already known. It can also be synthesized by using DNA polymerase. DNA having the desired sequence is chemically synthesized, and this is used as a template for amplification by a known method, the polymerase chain reaction (PCR). This is made into a single strand by a already known method such as polyacrylamide gel electrophoresis or an enzyme treatment method. When synthesizing a modified aptamer, the efficiency of the extension reaction can be increased by using a polymerase in which a mutation is introduced at a specific position. The aptamer thus obtained can be easily purified by a known method.
Aptamers can be mass-synthesized by chemical synthesis methods such as the amidite method or the phosphoramidite method. The synthesis method is a well-known method, and is as described in Nucleic Acid (Vol.2) [1] Synthesis and Analysis of Nucleic Acid (Editor: Yukio Sugiura, Hirokawa Publishing Company). Actually, a synthesizer such as Oligo Pilot 100 or Oligo Process manufactured by GE Healthcare Bioscience is used. Purification is carried out by a method known per se, such as chromatography.
Aptamers can add functional substances after synthesis by introducing an active group such as an amino group during chemical synthesis such as the phosphoramidite method. For example, by introducing an amino group at the end of an aptamer, a polyethylene glycol chain having a carboxyl group introduced can be condensed.
Aptamar binds to a target substance by various bonding modes such as ionic bond using negative charge of phosphate group, hydrophobic bond and hydrogen bond using ribose, hydrogen bond and stacking bond using nucleobase. In particular, the ionic bond utilizing the negative charge of the phosphate group existing as many as the number of constituent nucleotides is strong and binds to the positive charge of lysine and arginine existing on the surface of the protein. Therefore, nucleobases that are not directly involved in binding to the target substance can be replaced. In particular, since the stem structure part has already been base paired and faces the inside of the double helix structure, it is difficult for the nucleobase to directly bind to the target substance. Therefore, replacing a base pair with another base pair often does not reduce the activity of the aptamer. Even in structures such as loop structures that do not form base pairs, base substitution is possible when the nucleobase is not involved in direct binding to the target molecule. Regarding the modification of the 2'position of ribose, in rare cases, the functional group at the 2'position of ribose may interact directly with the target molecule, but in many cases it is irrelevant and replaced with another modified molecule. It is possible. Thus, aptamers often retain their activity unless the functional groups involved in direct binding to the target molecule are substituted or deleted. It is also important that the overall three-dimensional structure does not change significantly.

Aptamers are prepared by using the SELEX method and its improved methods (for example, Ellington et al., (1990) Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510). can do. In the SELEX method, aptamers with stronger binding force to the target substance are concentrated and sorted by increasing the number of rounds or using competing substances to tighten the sorting conditions. Therefore, by adjusting the number of rounds of SELEX and / or changing the race condition, aptamers with different binding forces, aptamers with different binding forms, and aptamers with the same binding force and binding form but different base sequences. You may be able to get an aptamer. In addition, the SELEX method includes an amplification process by PCR, and by inserting mutations such as using manganese ions in the process, it is possible to perform SELEX with a greater variety.

The aptamer obtained by SELEX is a nucleic acid having a high affinity for the target substance, but that does not mean that it inhibits the physiological activity of the target substance. FGF9 is a basic protein, and it is considered that nucleic acids are likely to bind non-specifically, but it does not affect the activity of its target substance except for aptamers that strongly bind to specific sites. In fact, RNA containing a random sequence used as a negative control did not bind to or inhibit FGF9.

Based on the active aptamer selected in this way, SELEX can be performed by further changing the primer in order to obtain an aptamer having higher activity. The specific method is to prepare a template in which a part of the aptamer having a certain sequence is made into a random sequence or a template in which a random sequence of about 10 to 30% is doped, and perform SELEX again.

The aptamer obtained by SELEX has a length of about 80 nucleotides, and it is difficult to use this as it is as a medicine. Therefore, it is necessary to repeat trial and error to shorten the length to about 50 nucleotides or less, which can be easily chemically synthesized. The aptamer obtained by SELEX depends on its primer design, and the ease of subsequent minimization work changes. If the primers are not designed properly, even if SELEX can select active aptamers, further development will be impossible. In the present invention, it was possible to obtain an aptamer that retains inhibitory activity even at 29 nucleotides.

Since aptamers can be chemically synthesized, they are easy to modify. Aptamers can substitute or delete which nucleotides by predicting secondary structure using the MFOLD program, or predicting the three-dimensional structure by X-ray analysis or NMR analysis, and new nucleotides. It is possible to predict to some extent where it can be inserted. The predicted new sequence of aptamers can be easily chemically synthesized, and whether or not the aptamers retain their activity can be confirmed by an existing assay system.

If the important part of the obtained aptamer for binding to the target substance can be identified by repeating the above trial and error, the activity often changes even if a new sequence is added to both ends of the sequence. do not do. The length of the new sequence is not particularly limited.

As with the sequence, modifications can be freely designed or modified by those skilled in the art.

As mentioned above, the aptamer can be highly designed or modified. The present invention also relates to a predetermined sequence (eg, a sequence corresponding to a portion selected from a stem portion, an internal loop portion, a bulge portion, a hairpin loop portion and a single chain portion: hereinafter, abbreviated as a fixed sequence as necessary. A method for producing an aptamer, which is capable of highly designing or modifying an aptamer containing).

For example, the manufacturing method of such an aptamer is as follows:

[In the above, (N) a indicates a nucleotide chain consisting of a N, (N) b indicates a nucleotide chain consisting of b N, and N is the same or different, respectively, A, G, A nucleotide selected from the group consisting of C, U and T (preferably A, G, C and U). A and b can be the same or different and can be any number, for example, 1 to about 100, preferably 1 to about 50, more preferably 1 to about 30, and even more preferably 1 to about. It can be 20 or 1 to about 10. ] Corresponds to a single type of nucleic acid molecule consisting of the nucleotide sequence represented by] or a plurality of types of nucleic acid molecules (eg, a library of nucleic acid molecules having different numbers of a and b, etc.), and primer sequences (i) and (ii), respectively. It involves producing an aptamer containing a fixed sequence using a pair of primers to be used.

The present invention also provides a complex containing the aptamer of the present invention and a functional substance bound thereto (hereinafter, also referred to as a complex of the present invention). The bond between the aptamer and the functional substance in the complex of the present invention can be covalent or non-covalent. The complex of the present invention may be a combination of the aptamer of the present invention and one or more (eg, 2 or 3) functional substances of the same type or different types. The functional substance is not particularly limited as long as it can newly add some function to the aptamer of the present invention or change (eg, improve) some property that can be retained by the aptamer of the present invention. Examples of functional substances include proteins, peptides, amino acids, lipids, carbohydrates, monosaccharides, polynucleotides, and nucleotides. Functional substances also include, for example, affinity substances (eg, biotin, streptavidin, polynucleotides having affinity for the target complementary sequence, antibodies, glutathione Sepharose, histidine), labeling substances (eg, fluorescent substances, etc.). Luminescent substances, radioactive isotopes), enzymes (eg, western wasabiperoxidase, alkaline phosphamide), drug delivery media (eg, liposomes, microspheres, peptides, polyethylene glycols), drugs (eg, calikeamycin, duocalmycin, etc.) Those used in missile therapy, nitrogen mustard analogs such as cyclophosphamide, melfaran, ifofamide or trophosphamide, ethyleneimines such as thiotepa, nitrosourea such as carmustin, alkylating agents such as temozolomide or dacarbazine, Folic acid-like metabolic antagonists such as methotrexate or larcitrexed, purine analogs such as thioguanine, cladribine or fludalabine, pyrimidine analogs such as fluorouracil, tegafur or gemcitabine, vinblastine and its analogs such as vinblastine, vincristine or binolerubin, etopocid , Podophilotoxin derivatives such as docetaxel or paclitaxel, anthracyclines and analogs such as doxorubicin, epirubicin, idarubicin and mitoxanthrone, other cytotoxic antibiotics such as bleomycin and mitomycin, platinum such as cisplatin, carboplatin and oxaliplatin Examples include compounds, pentostatin, myrtefosine, estramstine, topotecan, irinotecan and bicartamide), toxins (eg, lysine toxin, riatoxin and velotoxin). These functional molecules may eventually be removed. Further, it may be a peptide that can be recognized and cleaved by an enzyme such as thrombin, matrix metal protease (MMP), or Factor X, or a polynucleotide that can cleave a nuclease or a restriction enzyme.

The aptamer of the present invention or the complex of the present invention can be used, for example, as a medicine (hereinafter, also referred to as the medicine of the present invention).

The medicament of the present invention may contain a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, for example, excipients such as sucrose, starch, mannit, sorbit, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate, cellulose, methyl cellulose, hydroxypropyl cellulose, polypropylpyrrolidone. , Glue, gelatin, gum arabic, polyethylene glycol, sucrose, starch and other binders, starch, carboxymethyl cellulose, hydroxypropyl starch, sodium-glycol-starch, sodium hydrogen carbonate, calcium phosphate, calcium citrate and other disintegrants, magnesium stearate , Lubricants such as aerodil, starch, sodium lauryl sulfate, fragrances such as citric acid, menthol, glycyrrhizin / ammonium salt, glycine, orange powder, preservatives such as sodium benzoate, sodium hydrogen sulfite, methylparaben, propylparaben, citric acid , Stabilizers such as sodium citrate, acetic acid, suspending agents such as methyl cellulose, polyvinylpyrrolidone, aluminum stearate, dispersants such as surfactants, diluents such as water, physiological saline, orange juice, cacao butter, polyethylene. Examples thereof include base waxes such as glycol and white kerosene, but the present invention is not limited thereto.

The route of administration of the drug of the present invention is not particularly limited, and examples thereof include oral administration and parenteral administration. Suitable formulations for oral administration are liquids in which an effective amount of ligand is dissolved in a diluted solution such as water, physiological saline, orange juice, capsules containing an effective amount of ligand as solids or granules, sachets, or These include tablets, suspensions in which an effective amount of the active ingredient is suspended in an appropriate dispersion medium, and an emulsion in which a solution in which an effective amount of the active ingredient is dissolved is dispersed in an appropriate dispersion medium and emulsified.

Further, the medicament of the present invention can be coated by a method known per se for the purpose of masking taste, enteric acidity or persistence, if necessary. Examples of the coating agent used for coating include hydroxypropylmethylcellulose, ethylcellulose, hydroxymethylcellulose, hydroxypropylcellulose, polyoxyethylene glycol, Tween 80, Pluronic F68, cellulose acetate phthalate, hydroxypropylmethylcellulose phthalate, hydroxymethylcellulose acetate succinate, and the like. Eudragit (manufactured by Roam, Germany, acrylate copolymer of methacrylic acid) and dyes (eg, red iron oxide, titanium dioxide, etc.) are used. The drug may be either a rapid-release preparation or a sustained-release preparation. Examples of the sustained-release substrate include liposomes, atelocollagen, gelatin, hydroxyapatite, PLGA and the like.

Suitable formulations for parenteral administration (eg, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, nasal, pulmonary, etc.) are aqueous and non-aqueous isotonic. There are sterile injection solutions, which may contain antioxidants, buffers, antibacterial agents, isotonic agents and the like. In addition, aqueous and non-aqueous sterile suspensions may be mentioned, which may include suspending agents, solubilizing agents, thickeners, stabilizers, preservatives and the like. The formulation can be encapsulated in single doses or multiple doses, such as ampoules and vials. In addition, the active ingredient and a pharmaceutically acceptable carrier can be freeze-dried and stored in a state where it can be dissolved or suspended in a suitable sterile solvent immediately before use. In addition, sustained-release preparations can also be mentioned as suitable preparations. Sustained-release preparations include artificial bone, biodegradable or non-degradable sponges, bags, drug pumps, osmotic pumps, and other sustained-release forms from carriers or containers embedded in the body, or continuous or intermittent from outside the body. Examples include devices that are delivered internally or locally. Examples of the biodegradable substrate include liposomes, cationic liposomes, Poly (lactic-co-glycolic) acid (PLGA), atelocollagen, gelatin, hydroxyapatite, and polysaccharide schizophyllan. Further, in addition to injection solutions and sustained-release preparations, inhalants and ointments are also possible. In the case of an inhalant, the lyophilized active ingredient is miniaturized and administered by inhalation using an appropriate inhalation device. Further, if necessary, a conventionally used surfactant, oil, seasoning, cyclodextrin or a derivative thereof and the like can be appropriately added to the inhalant.

Here, examples of the surfactant include oleic acid, lecithin, diethylene glycol dioleate, tetrahydrofurfuryl oleate, ethyl oleate, isopropyl myristate, glyceryl trioleate, glyceryl monolaurate, glyceryl monooleate, and glyceryl monosteer. Rate, glyceryl monolithinoate, cetyl alcohol, stearyl alcohol, polyethylene glycol 400, cetylpyridinium chloride, sorbitan trioleate (trade name Span 85), sorbitan monooleate (trade name Span 80), sorbitan monora Weight (trade name Span 20), polyoxyethylene hydrogenated castor oil (trade name HCO-60), polyoxyethylene (20) sorbitan monolaurate (trade name Tween 20), polyoxyethylene (20) ) Solbitan monooleate (trade name Tween 80), natural resource-derived lecithin (trade name Epiclon), oleyl polyoxyethylene (2) ether (trade name Brij 92), stearyl polyoxy Ethylene (2) ether (trade name Brij 72), lauryl polyoxyethylene (4) ether (trade name Brij 30), oleyl polyoxyethylene (2) ether (trade name Genapol 0- 020), a block copolymer of oxyethylene and oxypropylene (trade name Synperonic) and the like can be mentioned. Span, Tween, Epicron, Brij, Genapol and Synperonic are trademarks.
Examples of the oil include corn oil, olive oil, cottonseed oil, sunflower oil and the like. In the case of ointments, appropriate pharmaceutically acceptable bases (yellow petrolatum, white petrolatum, paraffin, plastic base, silicone, white ointment, beeswax, pig oil, vegetable oil, hydrophilic ointment, hydrophilic petrolatum, purified lanolin, hydrous lanolin , Water-absorbing ointment, hydrophilic plastic base, macrogol ointment, etc.), mix with the active ingredient, formulate and use.

The inhalant can be manufactured according to the conventional method. That is, it can be produced by powdering or liquidating the aptamer of the present invention or the composite of the present invention, blending it in an inhalation propellant and / or a carrier, and filling it in an appropriate inhalation container. Further, when the aptamer of the present invention or the complex of the present invention is powder, a normal mechanical powder inhaler can be used, and when the complex is liquid, an inhaler such as a nebulizer can be used. Here, conventionally known propellants can be widely used, and CFC-11, CFC-12, CFC-21, CFC-22, CFC-113, CFC-114, CFC-123, CFC-142c, CFC-134a , Freon-227, Freon-C318, Freon compounds such as 1,1,1,2-tetrafluoroethane, hydrocarbons such as propane, isobutane, n-butane, ethers such as diethyl ether, nitrogen gas, carbon dioxide A compressed gas such as a gas can be exemplified.

The dose of the medicament of the present invention varies depending on the type of active ingredient, activity, severity of disease, animal species to be administered, drug acceptability to be administered, body weight, age, etc., but is usually per adult per day. The amount of active ingredient can be from about 0.0001 to about 100 mg / kg, such as from about 0.0001 to about 10 mg / kg, preferably from about 0.005 to about 1 mg / kg.

The aptamer of the present invention or the complex of the present invention can specifically bind to FGF9. Therefore, the aptamer of the present invention or the complex of the present invention is useful as a detection reagent for FGF9 (hereinafter, also referred to as a detection reagent of the present invention). The detection reagent is useful for in vivo imaging of FGF9, blood concentration measurement, tissue staining, ELISA and the like.

Further, based on the specific binding to FGF9, the aptamer of the present invention or the complex of the present invention can be used as a ligand for separation and purification of FGF9 (hereinafter, also referred to as a ligand for separation and purification of the present invention).

The present invention also provides a solid phase carrier on which the aptamer of the present invention or the complex of the present invention is immobilized (hereinafter, also referred to as the solid phase carrier of the present invention). Examples of the solid phase carrier include substrates, resins, plates (eg, multi-well plates), filters, cartridges, columns, and porous materials. The substrate may be one used for a DNA chip, a protein chip, or the like. For example, a nickel-PTFE (polytetrafluoroethylene) substrate, a glass substrate, an apatite substrate, a silicon substrate, an alumina substrate, or the like. Is coated with a polymer or the like. Examples of the resin include agarose particles, silica particles, a copolymer of acrylamide and N, N'-methylenebisacrylamide, polystyrene-crosslinked divinylbenzene particles, particles obtained by cross-linking dextran with epichlorohydrin, cellulose fibers, and allyl dextran. Examples thereof include crosslinked polymers of N, N'-methylenebisacrylamide, monodisperse synthetic polymers, monodisperse hydrophilic polymers, sepharose, toyopearl, and resins in which various functional groups are bonded to these resins. .. The solid phase carrier of the present invention can be useful, for example, for purification of FGF9 and detection and quantification of FGF9.

The aptamer of the present invention or the complex of the present invention can be immobilized on a solid phase carrier by a method known per se. For example, an affinity substance (eg, as described above) or a predetermined functional group is introduced into an aptamer of the present invention or a complex of the present invention, and then the affinity substance or a predetermined functional group is used as a solid phase carrier. A method of immobilization can be mentioned. The present invention also provides such a method. The predetermined functional group can be a functional group that can be subjected to a coupling reaction, and examples thereof include an amino group, a thiol group, a hydroxyl group, and a carboxyl group. The present invention also provides an aptamer into which such a functional group has been introduced.

The present invention also provides a method for purifying and concentrating FGF9 (hereinafter, also referred to as the method for purifying and concentrating the present invention). In particular, the present invention is capable of separating FGF9 from other family proteins. The purification and concentration method of the present invention may include adsorbing FGF9 on the solid phase carrier of the present invention and eluting the adsorbed FGF9 with an eluate. Adsorption of FGF9 onto the solid phase carrier of the present invention can be carried out by a method known per se. For example, a sample containing FGF9 (eg, bacterial or cell culture or culture supernatant, blood) is introduced into the solid phase carrier of the invention or its content. The elution of autotaxine can be performed using an eluate such as a neutral solution. The neutral eluate is not particularly limited, but may have, for example, a pH of about 6 to about 9, preferably about 6.5 to about 8.5, and more preferably about 7 to about 8. Neutral solutions also include, for example, urea, chelating agents (eg, EDTA), sodium salts (eg, NaCl), potassium salts (eg, KCl), magnesium salts (eg, MgCl ₂ ), surfactants (eg, Tween20). , Triton, NP40), glycerin. The purification and concentration method of the present invention may further include washing the solid phase carrier with a washing solution after adsorption of autotaxin. Examples of the cleaning solution include urea, a chelating agent (eg, EDTA), Tris, an acid, an alkali, a surface active agent such as Tranfer RNA, DNA, Tween 20, and a salt such as NaCl. The purification and concentration methods of the present invention may further include heat treating the solid phase carrier. By this step, the solid phase carrier can be regenerated and sterilized.

The present invention also provides a method for detecting and quantifying FGF9 (hereinafter, also referred to as a method for detecting and quantifying FGF9 of the present invention). In particular, the present invention can be detected and quantified separately from FGF9 and other family proteins. The detection and quantification methods of the present invention may include measuring FGF9 using the aptamers of the present invention (eg, by using the complex and solid phase carriers of the present invention). The method for detecting and quantifying FGF9 can be carried out by the same method as the immunological method except that the aptamer of the present invention is used instead of the antibody. Therefore, by using the aptamers of the present invention as probes instead of antibodies, enzyme-linked immunosorbent assay (EIA) (eg, direct-competitive ELISA, indirect-competitive ELISA, sandwich ELISA), radioimmunoassay (RIA), fluorescence immunoassay. Detection and quantification can be performed by the same method as the method (FIA), Western blot method, immunohistochemical staining method, cell sorting method and the like. It can also be used as a molecular probe for PET and the like.

The following are examples of specific embodiments for the practice of the present invention. The examples are provided for illustration purposes only and are by no means intended to limit the scope of the invention.

Example 1: Preparation of RNA aptamer that binds to FGF9 (1)
RNA aptamers that bind to FGF9 were prepared using the SELEX method. SELEX was performed with reference to the method of Ellington et al. (Ellington and Szostak, Nature 346, 818-822, 1990) and the method of Tuerk et al. (Tuerk and Gold, Science 249, 505-510, 1990). As a target substance, FGF9 (manufactured by R & D systems) immobilized on a carrier of NHS-activated Sepharose 4 Fast Flow (manufactured by GE Healthcare) was used. The method for immobilizing FGF9 on the carrier was performed according to the specifications of GE Healthcare Japan. The amount of immobilization was confirmed by examining the FGF9 solution before immobilization and the supernatant immediately after immobilization by SDS-PAGE. As a result of SDS-PAGE, no band of FGF9 was detected from the supernatant, and it was confirmed that almost all of the FGF9 used was coupled. About 217 pmol of FGF9 was immobilized on about 3 μL of resin.

The RNA (35N) used in the first round was obtained by transcribing the DNA obtained by chemical synthesis using mutant T7 RNA polymerase (Sousa and Padilla, EMBO J. 14,4609-4621, 1995). The substrate for this transcription reaction was selected so that the purine nucleotide of the transcript was RNA and the pyrimidine nucleotide was DNA. As the DNA template, a 71-nucleotide long DNA having primer sequences at both ends of the 35-nucleotide random sequence shown below was used. DNA templates and primers were made by chemical synthesis.

DNA template:
5'-AGGAGCTACGCAGGCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTCGACGGAGCTTCCC-3'(SEQ ID NO: 39)

Primer Fwd:
5'-TAATACGACTCACTATAGGGAAGCTCCGTCGAGCT-3'(SEQ ID NO: 40)
Primer Rev:
5'-AGGAGCTACGCAGGCGTA-3' (SEQ ID NO: 41)

The sequence of N in the DNA template (SEQ ID NO: 39) is any combination of 35 nucleotides (35N: each N is A, C, G or T) and the resulting aptamer-specific sequence region. Occurs. Primer Fwd contains the promoter sequence of T7 RNA polymerase. The variation of the RNA pool used in the first round was theoretically 10 ¹⁴ .

An RNA pool was added to the carrier on which FGF9 was immobilized, and the mixture was kept at room temperature for 30 minutes, and then the resin was washed with Solution A to remove RNA that did not bind to FGF9. Here, Solution A is a mixed solution of 145 mM sodium chloride, 5.4 mM potassium chloride, 1.8 mM calcium chloride, 0.8 mM magnesium chloride, 20 mM tris (pH 7.6), and 0.05% Tween 20. RNA bound to FGF9 was recovered from the supernatant after adding solution B as an eluate and heat-treating at 85 ° C. for 3 minutes. Here, solution B is a mixed solution of 7M Urea, 5mM EDTA, and 20mM tris (pH 6.6). The recovered RNA was amplified by reverse transcription PCR, transcribed with mutant T7 RNA polymerase, and used as a pool for the next round. The above was regarded as one round, and the same work was repeated multiple times. After the completion of SELEX, the base sequence was analyzed using a next-generation sequencer. The Ion PGM ^TM system (manufactured by Thermo) was used for the next-generation sequencer, and the analysis was performed according to the specifications of Thermo.

After performing SELEX for 6 rounds, 40,314 types of clone sequences were identified by the next-generation sequencer, and it was confirmed that they converged to 25,205 types of sequences. The nucleotide sequence represented by SEQ ID NO: 1 is one of the representative sequences of those clonal sequences, and there were 65 copies in the clonal sequence. The nucleotide sequence represented by SEQ ID NO: 1 contained common sequence 1. Common sequence 1 was present in at least 28 of the 25,205 sequences. When the secondary structure of these 28 types of sequences was predicted using the MFOLD program (Zukker, Nucleic Acids Res. 31, 3406-3415, 2003), the common sequence 1 formed a similar loop structure. The secondary structure of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 is shown in FIG.

The nucleotide sequence represented by SEQ ID NO: 1 and the common sequence 1 are shown below. Unless otherwise stated, the individual sequences listed below shall be represented in the 5'to 3'direction, with purine nucleotides (A and G) being 2'-OH (ie, ribonucleotides) and pyrimidine nucleotides (ie, ribonucleotides). T and C) are 2'-H (ie, deoxyribonucleotides). In addition, H in the sequence indicates T, C or A.

SEQ ID NO: 1:
GGGAAGCTCCGTCGAGCTGAGGGCACCCAAGGCTGCCGGGTGCCATGCACACATACGCCTGCGTAGCTCCT

Common sequence:
CAAGGHTGCCG (SEQ ID NO: 37)

The binding activity of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 to FGF9 was evaluated by the surface plasmon resonance method. A Biacore T200 manufactured by GE Healthcare was used for the measurement. As the sensor chip, an SA chip on which streptavidin was immobilized was used. About 740 RU of 16 nucleotides of PolydT to which biotin was bound at the 5'end was bound to this. For the nucleic acid serving as a ligand, 16 nucleotides of PolyA was added to the 3'end and immobilized on the SA chip by annealing T and A. Nucleic acid was injected for 30 seconds at a flow rate of 10 μL / min to immobilize approximately 370 RU of nucleic acid. FGF9 for analysis was prepared to 0.1 μM and injected at a flow rate of 30 μL / min for 60 seconds. Solution C was used as the running buffer. Here, the solution C is a mixed solution of 300 mM sodium chloride, 5.4 mM potassium chloride, 1.8 mM calcium chloride, 0.8 mM magnesium chloride, 20 mM tris (pH 7.6), and 0.05% Tween 20.

As a result of the measurement, it was found that the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 binds to FGF9 (Fig. 2). Nucleic acid pool (35N) used in the first round containing a random sequence of 35 nucleotides used as a negative control did not show binding to FGF9.

Whether or not the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 inhibits the activity of FGF9 was evaluated by the following method. A fusion protein of FGFR3c and the Fc portion of IgG (manufactured by R & D systems) was selected as the receptor for FGF9. Biacore T200 manufactured by GE Healthcare was used. The sensor chip used was a protein A immobilized on CM5. FGFR3c was immobilized there at about 500 RU. A mixture of FGF9 (0.1 μM), heparin (0.1 μM) (manufactured by Calbiochem) and aptamer (0.5 μM) was flowed as an analyzer. Solution D was used as the running buffer. Here, solution D is a mixed solution of 295 mM sodium chloride, 5.4 mM potassium chloride, 1.8 mM calcium chloride, 0.8 mM magnesium chloride, 20 mM tris (pH 7.6), and 0.05% Tween 20. Prior to the inhibition test, it was confirmed that a mixture of FGF9 and heparin binds to FGFR3c. As a result of the test, the aptamer represented by SEQ ID NO: 1 showed strong inhibitory activity. FIG. 3 shows a sensorgram showing that the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 inhibits the binding between FGF9 and FGFR3c.

The inhibition rate of the test substance was calculated using the following formula.

Inhibition rate (%) = (R _Max -R _apt ) / R _Max x100

Here, R _Max and R _apt are the RU values indicated by the mixture of FGF9 and heparin with and without the addition of the test substance.

The inhibition rate of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 was 95.7%. In addition, 35N, which is a negative control, showed no inhibitory activity (inhibition rate 0%).
From the above results, it can be said that the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 exhibits an excellent inhibitory effect on FGF9.

Example 2: Shortening the aptamer (1)
The aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 1 was shortened to obtain an aptamer consisting of the nucleotide sequence represented by SEQ ID NOs: 2-9. FIG. 4 shows a prediction of the secondary structure of the aptamer consisting of the nucleotide sequences represented by SEQ ID NOs: 2 to 9.

The nucleotide sequences represented by SEQ ID NOs: 2 to 9 are shown below. Unless otherwise stated, the individual sequences listed below shall be represented in the 5'to 3'direction, with purine nucleotides (A and G) being 2'-OH (ie, ribonucleotides) and pyrimidine nucleotides (ie, ribonucleotides). T and C) are 2'-H (ie, deoxyribonucleotides).

SEQ ID NO: 2: (Sequence in which the nucleotide sequence represented by SEQ ID NO: 1 is shortened to 25 nucleotides including a common sequence)
GGGCACCCAAGGCTGCCGGGTGCCA
SEQ ID NO: 3: (Sequence in which the nucleotide sequence represented by SEQ ID NO: 1 is shortened to 59 nucleotides including a common sequence)
GGAGCTGAGGGCACCCAAGGCTGCCGGGTGCCATGCACACATACGCCTGCGTAGCTCCT
SEQ ID NO: 4: (Sequence in which the nucleotide sequence represented by SEQ ID NO: 1 is shortened to 43 nucleotides including a common sequence)
GGGCACCCAAGGCTGCCGGGTGCCATGCACACATACGCCTGCG
SEQ ID NO: 5: (Sequence obtained by shortening the nucleotide sequence represented by SEQ ID NO: 1 to 57 nucleotides including a common sequence)
GGGAAGCTCCGTCGAGCTGAGGGCACCCAAGGCTGCCGGGTGCCATGCGTAGCTCCT
SEQ ID NO: 6: (Sequence obtained by shortening the nucleotide sequence represented by SEQ ID NO: 1 to 53 nucleotides including a common sequence)
GGCTGAGGGCACCCAAGGCTGCCGGGTGCCATGCACACATACGCCTGCGTAGC
SEQ ID NO: 7: (The nucleotide sequence represented by SEQ ID NO: 1 is shortened to 69 nucleotides obtained by deleting A of nucleotide No. 29 of SEQ ID NO: 1 and A of nucleotide No. 30).
GGGAAGCTCCGTCGAGCTGAGGGCACCCGGCTGCCGGGTGCCATGCACACATACGCCTGCGTAGCTCCT
SEQ ID NO: 8: (A sequence obtained by shortening the nucleotide sequence represented by SEQ ID NO: 1 to 39 nucleotides including a partial sequence of the common sequence).
GGGCTGCCGGGTGCCATGCACACATACGCCTGCGTAGCC
SEQ ID NO: 9: (Sequence obtained by shortening the nucleotide sequence represented by SEQ ID NO: 1 to 31 nucleotides including a partial sequence of the common sequence)
GGCCGGGTGCCATGCACACATACGCCTGCGT

Whether these aptamers bind to FGF9 was evaluated by the same surface plasmon resonance method as in Example 1. As a result, it was clarified that all aptamers having a common sequence (SEQ ID NO: 37) retain the binding activity to FGF9 (SEQ ID NOs: 1 to 6). On the other hand, aptamers containing only a partial common sequence had no binding activity to FGF9 (SEQ ID NOs: 8 and 9). The results are shown in Table 1. In addition, whether these aptamers inhibit the enzymatic activity of FGF9 was also evaluated by the same method as in Example 1. However, the final concentration of aptamer was fixed at 0.3 μM for evaluation. The results are shown in Table 1.

From the results of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 7, it was found that the inhibitory activity of FGF9 by the aptamer was lost due to the deletion of AA in the common sequence. In addition, from the results of the aptamer consisting of the nucleotide sequences represented by SEQ ID NOs: 8 and 9, it was found that the inhibitory activity of FGF9 by the aptamer is lost in the sequence lacking a part of the common sequence. On the other hand, it was revealed that the aptamer having the common sequence 1 retains at least the binding activity to FGF9 even if it has no inhibitory activity (SEQ ID NOS: 2 to 4, 6).
From the above results, it was suggested that the inclusion of a common sequence is important for maintaining the binding activity of aptamers.

Example 3: Preparation of RNA aptamer that binds to FGF9 (2)
In the SELEX method of Example 1, the total length of the aptamer obtained was about 70 bases, and then the work of shortening the chain was required. However, the shortened form was often significantly reduced in activity. Therefore, SELEX was performed with reference to the Tailored-SELEX method developed by NOXXON (Vater et al. Nucleic Acids Res. 31, 2003, el30; Jarosch et al. Nucleic Acids Res. 34, 2006, e86).
The target immobilization and washing method was substantially the same as in Example 1, and FGF9 (manufactured by R & D systems) immobilized on a carrier of NHS-activated Sepharose 4 Fast Flow (manufactured by GE Healthcare) was used. DNA templates and primers were prepared by chemical synthesis. The substrate for the transcription reaction was selected so that the purine nucleotide was RNA and the pyrimidine nucleotide was DNA with reference to Example 1. Two SELEXs were performed with different molds and primer sets. The sequences of the templates and primers used are shown below.
DNA template 1:
5'-TCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTATAGTGAGTCGTATTA-3' (SEQ ID NO: 42)
Forward ligate 1:
5'-UAAUACGACUCACUAUA-3' (SEQ ID NO: 43)
Forward primer 1:
5'-TAGACCATTCGACTATAATACGACTCACTATAGGGC-3' (SEQ ID NO: 44)
Forward bridge 1:
5'-GCCCTATAGTGAGTCGTATT-NH _2-3 ' (SEQ ID NO: 45)
Reverse bridge 1:
5'-TTACGTCTTGTTTTTCTCGAG-3' (SEQ ID NO: 46)
Reverse ligate 1:
5'-p-GAAAAACAAGACGTAA-NH _2-3 ' (SEQ ID NO: 47)
DNA template 2:
5'-TCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTATAGTGAGTCGTATTA-3' (SEQ ID NO: 48)
Forward ligate 2:
(Same as Forward ligate 1)
Forward primer 2:
5'-TACGAGGTAGCATGATAATACGACTCACTATAGGGA-3' (SEQ ID NO: 49)
Forward bridge 2:
5'-TCCCTATAGTGAGTCGTATT-NH ₂ -3' (SEQ ID NO: 50)
Reverse bridge 2:
5'-TACGCTTTGTATTTTTTCTCGAG-3' (SEQ ID NO: 51)
Reverse ligate 2:
5'-p-GAAAAAATACAAAGCGTA-NH ₂ -3'(SEQ ID NO: 52)

After performing SELEX for 6 rounds, sequence analysis was performed using the next-generation sequencer in the same manner as in Example 1. From SELEX using DNA template 1, 12,737 types of clone sequences were identified, and it was confirmed that they converged to 353 types of sequences. From SELEX using DNA template 2, 28,646 types of clone sequences were identified, and it was confirmed that they converged to 3,852 types of sequences. There were clone sequences having a common sequence in these clone sequences. The nucleotide sequences represented by SEQ ID NOs: 10 to 27 are representative sequences of those clonal sequences. FIG. 5 shows a secondary structure prediction of an aptamer consisting of the nucleotide sequences represented by SEQ ID NOs: 10 to 27.

The nucleotide sequences represented by SEQ ID NOs: 10 to 27 are shown below. Unless otherwise stated, the individual sequences listed below shall be represented in the 5'to 3'direction, with purine nucleotides (A and G) being 2'-OH (ie, ribonucleotides) and pyrimidine nucleotides (ie, ribonucleotides). T and C) are 2'-H (ie, deoxyribonucleotides).
SEQ ID NO: 10:
GGGCGGACGCAAGGTTGCCGCGTCCAGGAAGTAGCTCGA
SEQ ID NO: 11:
GGGCCAAGGATGCCGGTCCTGTGTAAAGTAGTGACTCGA
SEQ ID NO: 12:
GGGAGAGACCAAGGCTGCCGGTCTATATAGCAAGCTCGA
SEQ ID NO: 13:
GGGAGGAGATACCAAGGTTGCCGGTATCACTAGGCTCGA
SEQ ID NO: 14:
GGGAGAGGCCAAGGTTGCCGGTCTCGGATATGAGCTCGA
SEQ ID NO: 15:
GGGAGAGTGCCAAGGCTGCCGGCACTGATTATAGCTCGA
SEQ ID NO: 16:
GGGAGACAGCCAAGGTTGCCGGATTGTCCAACAGCTCGA
SEQ ID NO: 17:
GGGAGGAGACCAAGGCTGCCGGTCATCATGCATGCTCGA
SEQ ID NO: 18:
GGGAGTAGACCAAGGTTGCCGGTCACACAATATGCTCGA
SEQ ID NO: 19:
GGGAGGAGACCAAGGCTGCCGGTCTTACTAGTAGCTCGA
SEQ ID NO: 20:
GGGAAGATACCAAGGTTGCCGGTATTATTAATAGCTCGA
SEQ ID NO: 21:
GGGAAGATGCAAGGCTGCCGCATCTGGAAATAGGCTCGA
SEQ ID NO: 22:
GGGAGGATCCAAGGTTGCCGGATCGCACAGGTAGCTCGA
SEQ ID NO: 23:
GGGAGAAGACTGCAAGGTTGCCGCAGTCACGTGGCTCGA
SEQ ID NO: 24:
GGGAAGGACCAAGGTTGCCGGTCCACGGTACTAGCTCGA
SEQ ID NO: 25:
GGGAGAATAAGACCAAGGTTGCCGGTCCATGTAGCTCGA
SEQ ID NO: 26:
GGGAGGAGGGGCAAGGCTGCCGCCCCTGTAGTAGCTCGA
SEQ ID NO: 27:
GGGAGGTGCCAAGGTTGCCGGTACCAATAATGTGCTCGA

Whether these aptamers bind to FGF9 was evaluated by the same surface plasmon resonance method as in Example 1. As a result, it was clarified that all aptamers having a common sequence retain the binding activity to FGF9. The results are shown in Table 2. In addition, whether these aptamers inhibit the enzymatic activity of FGF9 was also evaluated by the same method as in Example 1. The final concentration of aptamer was fixed at 0.3 μM for evaluation. The results are shown in Table 2.

From these results, it is formed by a nucleotide sequence containing C at the 5'end of the common sequence and a nucleotide adjacent to its 5'side, and a nucleotide sequence containing G at the 3'end of the common sequence and a nucleotide adjacent to its 3'side. In the shortest case, the stem to be produced was found to be a 4-base pair stem. In addition, the result of SEQ ID NO: 11 showed that the nucleotide sequence adjacent to the 5'side of the stem can be deleted.

Example 4: Shortening the aptamer (2)
The aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 27 was shortened to obtain an aptamer consisting of the nucleotide sequence represented by SEQ ID NOs: 28 to 35. FIG. 6 shows a secondary structure prediction of an aptamer consisting of the nucleotide sequences represented by SEQ ID NOs: 28 to 35.

The nucleotide sequences represented by SEQ ID NOs: 28 to 35 are shown below. Unless otherwise stated, the individual sequences listed below shall be represented in the 5'to 3'direction, with purine nucleotides (A and G) being 2'-OH (ie, siribonucleotides) and pyrimidine nucleotides. (T and C) are 2'-H (ie, deoxyribonucleotides).
SEQ ID NO: 28: (A sequence in which the 3'end of the nucleotide sequence represented by SEQ ID NO: 27 is shortened by 2 nucleotides)
GGGAGGTGCCAAGGTTGCCGGTACCAATAATGTGCTC
SEQ ID NO: 29: (A sequence in which the 3'end of the nucleotide sequence represented by SEQ ID NO: 27 is shortened by 4 nucleotides)
GGGAGGTGCCAAGGTTGCCGGTACCAATAATGTGC
SEQ ID NO: 30: (A sequence in which the 3'end of the nucleotide sequence represented by SEQ ID NO: 27 is shortened by 5 nucleotides)
GGGAGGTGCCAAGGTTGCCGGTACCAATAATGTG
SEQ ID NO: 31: (A sequence in which the 3'end of the nucleotide sequence represented by SEQ ID NO: 27 is shortened by 6 nucleotides)
GGGAGGTGCCAAGGTTGCCGGTACCAATAATGT
SEQ ID NO: 32: (A sequence in which the 3'end of the nucleotide sequence represented by SEQ ID NO: 27 is shortened by 7 nucleotides)
GGGAGGTGCCAAGGTTGCCGGTACCAATAATG
SEQ ID NO: 33: (A sequence in which the 3'end of the nucleotide sequence represented by SEQ ID NO: 27 is shortened by 8 nucleotides)
GGGAGGTGCCAAGGTTGCCGGTACCAATAAT
SEQ ID NO: 34: (A sequence in which the 3'end of the nucleotide sequence represented by SEQ ID NO: 27 is shortened by 9 nucleotides)
GGGAGGTGCCAAGGTTGCCGGTACCAATAA
SEQ ID NO: 35: (A sequence in which the 3'end of the nucleotide sequence represented by SEQ ID NO: 27 is shortened by 10 nucleotides)
GGGAGGTGCCAAGGTTGCCGGTACCAATA

Whether these aptamers inhibit the enzymatic activity of FGF9 was evaluated by the same method as in Example 1. The final concentration of aptamer was fixed at 0.3 μM for evaluation. The results are shown in Table 3.

From the results of the aptamer consisting of the nucleotide sequences represented by SEQ ID NOs: 28 to 35, the nucleotide sequence containing the 5'end C of the common sequence and the nucleotide adjacent to the 5'side thereof and the 3'end G of the common sequence and its It has been shown that the aptamers of the invention can be shortened to at least 29 mer while maintaining a 6 base pair stem formed by a nucleotide sequence containing nucleotides adjacent to the 3'side.

Example 5: Modification of aptamer Chemical modification of the aptamer consisting of the nucleotide sequence represented by SEQ ID NO: 30 was examined, and an aptamer consisting of the nucleotide sequence represented by SEQ ID NOs: 30 (1) to 30 (22) was obtained. ..

The nucleotide sequences represented by SEQ ID NOs: 30 (1) to 30 (22) are shown below. The individual sequences listed below shall be represented in the 5'to 3'direction, and unless otherwise noted, purine nucleotides (A and G) are 2'-OH (ie, ribonucleotides) and pyrimidine nucleotides (ie, ribonucleotides). T and C) are 2'-H (ie, deoxyribonucleotides). In addition, A (M), G (M), C (M), and U (M) indicate that the nucleotides 2'of A, G, C, and U are methoxylated, respectively. U is uridine (ribonucleotide). Also, _ (T) indicates Inverted dT.
SEQ ID NO: 30 (1): (sequence in which 2'of the first, second, third, and fourth nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 is methoxylated)
G (M) G (M) G (M) A (M) GGTGCCAAGGTTGCCGGTACCAATAATGTG_ (T)
SEQ ID NO: 30 (2): (sequence in which 2'of the

nucleotides

5, 6, 24, and 25 of the nucleotide sequence represented by SEQ ID NO: 30 is methoxylated)
GGGAG (M) G (M) TGCCAAGGTTGCCGGTAC (M) C (M) AATAATGTG_ (T)
SEQ ID NO: 30 (3): (The 7th nucleotide of the nucleotide sequence represented by SEQ ID NO: 30 is replaced with uridine in which the carbon at the 2'position is methoxylated, and the 2'position of the 8th, 22nd, and 23rd nucleotides is replaced. Carbon methoxylated sequence)
GGGAGGU (M) G (M) CCAAGGTTGCCGGU (M) A (M) CCAATAATGTG_ (T)
SEQ ID NO: 30 (4): (Sequence in which 2'of the 9, 10, 20, and 21 nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 is methoxylated)
GGGAGGTGC (M) C (M) AAGGTTGCCG (M) G (M) TACCAATAATGTG_ (T)
SEQ ID NO: 30 (5): (sequence in which 2'of the 11th and 12th nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 is methoxylated)
GGGAGGTGCCA (M) A (M) GGTTGCCGGTACCAATAATGTG_ (T)
SEQ ID NO: 30 (6): (sequence in which 2'of the 13th and 14th nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 is methoxylated)
GGGAGGTGCCAAG (M) G (M) TTGCCGGTACCAATAATGTG_ (T)
SEQ ID NO: 30 (7): (Sequence in which the 15th nucleotide of the nucleotide sequence represented by SEQ ID NO: 30 is replaced with uridine in which the carbon at the 2'position is methoxylated)
GGGAGGTGCCAAGGU (M) TGCCGGTACCAATAATGTG_ (T)
SEQ ID NO: 30 (8): (sequence in which 2'of the 17th nucleotide of the nucleotide sequence represented by SEQ ID NO: 30 is methoxylated)
GGGAGGTGCCAAGGTTG (M) CCGGTACCAATAATGTG_ (T)
SEQ ID NO: 30 (9): (sequence in which the 2'of the 18th and 19th nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 is methoxylated)
GGGAGGTGCCAAGGTTGC (M) C (M) GGTACCAATAATGTG_ (T)
SEQ ID NO: 30 (10): (2'of the 26th and 27th nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 are methoxylated, and the 28th nucleotide is replaced with uridine in which the carbon at the 2'position is methoxylated. Array)
GGGAGGTGCCAAGGTTGCCGGTACCA (M) A (M) U (M) AAT GTG_ (T)
SEQ ID NO: 30 (11): (2'of the 29th and 30th nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 are methoxylated, and the 31st nucleotide is replaced with uridine in which the carbon at the 2'position is methoxylated. Array)
GGGAGGTGCCAAGGTTGCCGGTACCAATA (M) A (M) U (M) GTG_ (T)
SEQ ID NO: 30 (12): (2'of the 32nd and 34th nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 are methoxylated, and the 33rd nucleotide is replaced with uridine in which the carbon at the 2'position is methoxylated. Array)
GGGAGGTGCCAAGGTTGCCGGTACCAATAATG (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (13): (includes all modifications of SEQ ID NO: 30 (1), 30 (2), 30 (3), 30 (4), 30 (10), 30 (11), 30 (12)' Array)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) AAGGTTTGCCG (M) G (M) U ( M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (14): (sequence in which 2'of the nucleotides 11, 12, 13, 14, and 17 of the nucleotide sequence represented by SEQ ID NO: 30 (13) is methoxylated)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) A (M) A (M) G ( M) G (M) TTG (M) CCG (M) G (M) U (M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (15): (sequence in which the 2'of the nucleotides 11, 12, 14, and 17 of the nucleotide sequence represented by SEQ ID NO: 30 (13) is methoxylated)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) A (M) A (M) GG ( M) TTG (M) CCG (M) G (M) U (M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (16): (sequence in which 2'of the nucleotides 11, 12, 13, and 17 of the nucleotide sequence represented by SEQ ID NO: 30 (13) is methoxylated)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) A (M) A (M) G ( M) GTTG (M) CCG (M) G (M) U (M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (17): (sequence in which 2'of the nucleotides 11, 12, and 17 of the nucleotide sequence represented by SEQ ID NO: 30 (13) are methoxylated)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) A (M) A (M) GGTTG ( M) CCG (M) G (M) U (M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (18): (sequence in which 2'of the nucleotides 12, 14, and 17 of the nucleotide sequence represented by SEQ ID NO: 30 (13) are methoxylated)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) AA (M) GG (M) TTG ( M) CCG (M) G (M) U (M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (19): (sequence in which 2'of the nucleotides 11, 14, and 17 of the nucleotide sequence represented by SEQ ID NO: 30 (13) is methoxylated)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) A (M) AGG (M) TTG ( M) CCG (M) G (M) U (M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (20): (sequence in which 2'of the nucleotides 12, 13, and 17 of the nucleotide sequence represented by SEQ ID NO: 30 (13) is methoxylated)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) AA (M) G (M) GTTG ( M) CCG (M) G (M) U (M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (21): (sequence in which 2'of the nucleotides 11, 13, and 17 of the nucleotide sequence represented by SEQ ID NO: 30 (13) is methoxylated)
G (M) G (M) G (M) A (M) G (M) G (M) U (M) G (M) C (M) C (M) A (M) AG (M) GTTG ( M) CCG (M) G (M) U (M) A (M) C (M) C (M) A (M) A (M) U (M) A (M) A (M) U (M) G (M) U (M) G (M) _ (T)
SEQ ID NO: 30 (22): (Sequence in which the 16th nucleotide of the nucleotide sequence represented by SEQ ID NO: 30 is replaced with uridine in which the carbon at the 2'position is methoxylated)
GGGAGGTGCCAAGGTU (M) GCCGGTACCAATAATGTG_ (T)

Whether these aptamers inhibit the enzymatic activity of FGF9 was evaluated by the same method as in Example 1. The final concentration of aptamer was fixed at 0.15 μM for evaluation. The results are shown in Table 4.

From the results of the aptamer consisting of the nucleotide sequences represented by SEQ ID NOs: 30 (1) to 30 (22), FGF9 is obtained even when 2'of any of the nucleotides of the nucleotide sequence represented by SEQ ID NO: 30 is methoxylated. It was clarified that the inhibitory activity against

The aptamers or complexes of the present invention may also be useful for purification and enrichment of FGF9, labeling of FGF9, and detection and quantification of FGF9. This application is based on Japanese Patent Application No. 2019-072337 filed in Japan (Filing date: April 4, 2019), the contents of which are all incorporated herein by reference.

Claims

Aptamer that binds to FGF9.
Equation (I):
CAAGGHTGCCG (SEQ ID NO: 37) (I)
(In the formula, H represents A, C or T)
The aptamer according to claim 1, which comprises a nucleotide sequence represented by.
The aptamer according to claim 2, which is either (a) or (b) below:
(a) In the nucleotide sequence contained in the aptamer,
(i) Each pyrimidine nucleotide is deoxyribose,
(ii) Each purine nucleotide is ribose;
(b) In the nucleotide sequence contained in the aptamer
(i) Each pyrimidine nucleotide is deoxyribose, and the hydrogen atom at the 2'position of the deoxyribose is independently unsubstituted or substituted with a methoxy group.
(ii) Each purine nucleotide is ribose, and the hydroxy group at the 2'position of the ribose is independently unsubstituted or substituted with a methoxy group.
The nucleotide sequence represented by the formula (I), the nucleotides X1, X2, X3 and the nucleotides X4, X5, X6 adjacent to the 5'end of the nucleotide sequence are represented by the formula (II):

(In the formula, H represents A, C or T;
X1 to X6 are nucleotides selected from the group consisting of A, G, C and T, which are the same or different, respectively;
X1 and X6, X2 and X5, X3 and X4, and the 5'end C and 3'end G of the nucleotide sequence represented by formula (I) form Watson-Crick base pairs, respectively)
The aptamer according to claim 3, which forms a potential secondary structure represented by.
In formula (II), nucleotide number 4th G and nucleotide number 10th C, nucleotide number 5th G and nucleotide number 9th C in the nucleotide sequence represented by formula (I) are further Watson clicks, respectively. The aptamer according to claim 4, which forms a base pair.
The following (A), (B) or (C):
(A) Nucleotide sequences selected from the group consisting of SEQ ID NOs: 1-6, 10-15, 17, 18, 20, 21 and 23-35,
(B) In a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 6, 10 to 15, 17, 18, 20, 21 and 23 to 35, one to several nucleotides are substituted, deleted, inserted or added. (However, excluding the nucleotide sequence represented by the formula (I)), the nucleotide sequence,
(C) Has 95% or more identity with the creothide sequence selected from the group consisting of SEQ ID NOs: 1-6, 10-15, 17, 18, 20, 21 and 23-35 (however, in formula (I)). The aptamer according to claim 4, which comprises any of the nucleotide sequences of the nucleotide sequences (the nucleotide sequences represented are identical).
In the nucleotide sequence contained in the aptamer,
(i) Each pyrimidine nucleotide is deoxyribose,
(ii) An aptamer in which each purine nucleotide is ribose.
The aptamer according to claim 4 or 5, wherein the inverted dT is bound to the 3'end of the aptamer.
The aptamer according to any one of claims 1 to 7, which further inhibits the binding between FGF9 and its receptor.
A complex containing the aptamer and the functional substance according to any one of claims 1 to 8.
The complex according to claim 9, wherein the functional substance is an affinity substance, a labeling substance, an enzyme, a drug delivery medium or a drug.
A pharmaceutical agent comprising the aptamer according to any one of claims 1 to 8 or the complex according to claim 9 or 10.
A reagent for detecting FGF9, which comprises the aptamer according to any one of claims 1 to 8 or the complex according to claim 9 or 10.