KR20010022908A - Laundry detergent compositions comprising a saccharide gum degrading enzyme - Google Patents

Abstract

The present invention relates to laundry detergent compositions comprising saccharide degrading enzymes which provide good cleaning performance, in particular removal of food stains / dirt, dirty cleaning and whiteness benefits.

Description

Laundry detergent compositions comprising a saccharide gum degrading enzyme

<110> The Procter & Gamble Company

<120> Laundry detergent compositions comprising a saccharide gum degrading enzyme

<130> 5-1998-062118-8

<150> EP 97870120.9

<151> 1997-08-14

<160> 6

<170> KOPATIN 1.5

<210> 1

<211> 1407

<212> DNA

<213> Bacillus sp.

<220>

<221> CDS

<222> (1) .. (1482)

<223> nucleic acid, single, linear

<400> 1

atgaaaaaaa agttatcaca gatttatcat ttaattattt gcacacttat aataagtgtg 60

ggaataatgg ggattacaac gtccccatca gcagcaagta caggctttta tgttgatggc 120

aatacgttat atgacgcaaa tgggcagcca tttgtcatga gaggtattaa ccatggacat 180

gcttggtata aagacaccgc ttcaacagct attcctgcca ttgcagagca aggcgccaac 240

acgattcgta ttgttttatc agatggcggt caatgggaaa aagacgacat tgacaccatt 300

cgtgaagtca ttgagcttgc ggagcaaaat aaaatggtgg ctgtcgttga agttcatgat 360

gccacgggtc gcgattcgcg cagtgattta aatcgagccg ttgattattg gatagaaatg 420

aaagatgcgc ttatcggtaa agaagatacg gttattatta acattgcaaa cgagtggtat 480

gggagttggg atggctcagc ttgggccgat ggctatattg atgtcattcc gaagcttcgc 540

gatgccggct taacacacac cttaatggtt gatgcagcag gatgggggca atatccgcaa 600

tctattcatg attacggaca agatgtgttt aatgcagatc cgttaaaaaa tacgatgttc 660

tccatccata tgtatgagta tgctggtggt gatgctaaca ctgttagatc aaatattgat 720

agagtcatag atcaagacct tgctctcgta ataggtgaat tcggtcatag acatactgat 780

ggtgatgttg atgaagatac aatccttagt tattctgaag aaactggcac agggtggctc 840

gcttggtctt ggaaaggcaa cagtaccgaa tgggactatt tagacctttc agaagactgg 900

gctggtcaac atttaactga ttgggggaat agaattgtcc acggggccga tggcttacag 960

gaaacctcca aaccatccac cgtatttaca gatgataacg gtggtcaccc tgaaccgcca 1020

actgctacta ccttgtatga ctttgaagga agcacacaag ggtggcatgg aagcaacgtg 1080

accggtggcc cttggtccgt aacagaatgg ggtgcttcag gtaactactc tttaaaagcc 1140

gatgtaaatt taacctcaaa ttcttcacat gaactgtata gtgaacaaag tcgtaatcta 1200

cacggatact ctcagctcaa cgcaaccgtt cgccatgcca attggggaaa tcccggtaat 1260

ggcatgaatg caagacttta cgtgaaaacg ggctctgatt atacatggca tagcggtcct 1320

tttacacgta tcaatagctc caactcagga acaacgttat cttttgattt aaacaacatc 1380

gaaaatagtc atcatgttag ggaaataggc gtgcaatttt cagcggcaga taatagcagt 1440

ggtcaaactg ctctatacgt tgataacgtt actttaagat ag 1482

<210> 2

<211> 493

<212> PRT

<213> Bacillus sp.

<223> amino acid, linear

<400> 2

Met Lys Lys Lys Leu Ser Gln Ile Tyr His Leu Ile Ile Cys Thr Leu

1 5 10 15

Ile Ile Ser Val Gly Ile Met Gly Ile Thr Thr Ser Pro Ser Ala Ala

20 25 30

Ser Thr Gly Phe Tyr Val Asp Gly Asn Thr Leu Tyr Asp Ala Asn Gly

35 40 45

Gln Pro Phe Val Met Arg Gly Ile Asn His Gly His Ala Trp Tyr Lys

50 55 60

Asp Thr Ala Ser Thr Ala Ile Pro Ala Ile Ala Glu Gln Gly Ala Asn

65 70 75 80

Thr Ile Arg Ile Val Leu Ser Asp Gly Gly Gln Trp Glu Lys Asp Asp

85 90 95

Ile Asp Thr Ile Arg Glu Val Ile Glu Leu Ala Glu Gln Asn Lys Met

100 105 110

Val Ala Val Val Glu Val His Asp Ala Thr Gly Arg Asp Ser Arg Ser

115 120 125

Asp Leu Asn Arg Ala Val Asp Tyr Trp Ile Glu Met Lys Asp Ala Leu

130 135 140

Ile Gly Lys Glu Asp Thr Val Ile Ile Asn Ile Ala Asn Glu Trp Tyr

145 150 155 160

Gly Ser Trp Asp Gly Ser Ala Trp Ala Asp Gly Tyr Ile Asp Val Ile

165 170 175

Pro Lys Leu Arg Asp Ala Gly Leu Thr His Thr Leu Met Val Asp Ala

180 185 190

Ala Gly Trp Gly Gln Tyr Pro Gln Ser Ile His Asp Tyr Gly Gln Asp

195 200 205

Val Phe Asn Ala Asp Pro Leu Lys Asn Thr Met Phe Ser Ile His Met

210 215 220

Tyr Glu Tyr Ala Gly Gly Asp Ala Asn Thr Val Arg Ser Asn Ile Asp

225 230 235 240

Arg Val Ile Asp Gln Asp Leu Ala Leu Val Ile Gly Glu Phe Gly His

245 250 255

Arg His Thr Asp Gly Asp Val Asp Glu Asp Thr Ile Leu Ser Tyr Ser

260 265 270

Glu Glu Thr Gly Thr Gly Trp Leu Ala Trp Ser Trp Lys Gly Asn Ser

275 280 285

Thr Glu Trp Asp Tyr Leu Asp Leu Ser Glu Asp Trp Ala Gly Gln His

290 295 300

Leu Thr Asp Trp Gly Asn Arg Ile Val His Gly Ala Asp Gly Leu Gln

305 310 315 320

Glu Thr Ser Lys Pro Ser Thr Val Phe Thr Asp Asp Asn Gly Gly His

325 330 335

Pro Glu Pro Pro Thr Ala Thr Thr Leu Tyr Asp Phe Glu Gly Ser Thr

340 345 350

Gln Gly Trp His Gly Ser Asn Val Thr Gly Gly Pro Trp Ser Val Thr

355 360 365

Glu Trp Gly Ala Ser Gly Asn Tyr Ser Leu Lys Ala Asp Val Asn Leu

370 375 380

Thr Ser Asn Ser Ser His Glu Leu Tyr Ser Glu Gln Ser Arg Asn Leu

385 390 395 400

His Gly Tyr Ser Gln Leu Asn Ala Thr Val Arg His Ala Asn Trp Gly

405 410 415

Asn Pro Gly Asn Gly Met Asn Ala Arg Leu Tyr Val Lys Thr Gly Ser

420 425 430

Asp Tyr Thr Trp His Ser Gly Pro Phe Thr Arg Ile Asn Ser Ser Asn

435 440 445

Ser Gly Thr Thr Leu Ser Phe Asp Leu Asn Asn Ile Glu Asn Ser His

450 455 460

His Val Arg Glu Ile Gly Val Gln Phe Ser Ala Ala Asp Asn Ser Ser

465 470 475 480

Gly Gln Thr Ala Leu Tyr Val Asp Asn Val Thr Leu Arg

485 490

<210> 3

<211> 1407

<212> DNA

<213> Bacillus sp.

<223> nucleic acid, single, linear

<400> 3

atgaaaaaaa agttatcaca gatttatcat ttaattattt gcacacttat aataagtgtg 60

ggaataatgg ggattacaac gtccccatca gcagcaagta caggctttta tgttgatggc 120

aatacgttat atgacgcaaa tgggcagcca tttgtcatga gaggtattaa ccatggacat 180

gcttggtata aagacaccgc ttcaacagct attcctgcca ttgcagagca aggcgccaac 240

acgattcgta ttgttttatc agatggcggt caatgggaaa aagacgacat tgacaccatt 300

cgtgaagtca ttgagcttgc ggagcaaaat aaaatggtgg ctgtcgttga agttcatgat 360

gccacgggtc gcgattcgcg cagtgattta aatcgagccg ttgattattg gatagaaatg 420

aaagatgcgc ttatcggtaa agaagatacg gttattatta acattgcaaa cgagtggtat 480

gggagttggg atggctcagc ttgggccgat ggctatattg atgtcattcc gaagcttcgc 540

gatgccggct taacacacac cttaatggtt gatgcagcag gatgggggca atatccgcaa 600

tctattcatg attacggaca agatgtgttt aatgcagatc cgttaaaaaa tacgatgttc 660

tccatccata tgtatgagta tgctggtggt gatgctaaca ctgttagatc aaatattgat 720

agagtcatag atcaagacct tgctctcgta ataggtgaat tcggtcatag acatactgat 780

ggtgatgttg atgaagatac aatccttagt tattctgaag aaactggcac agggtggctc 840

gcttggtctt ggaaaggcaa cagtaccgaa tgggactatt tagacctttc agaagactgg 900

gctggtcaac atttaactga ttgggggaat agaattgtcc acggggccga tggcttacag 960

gaaacctcca aaccatccac cgtatttaca gatgataacg gtggtcaccc tgaaccgcca 1020

actgctacta ccttgtatga ctttgaagga agcacacaag ggtggcatgg aagcaacgtg 1080

accggtggcc cttggtccgt aacagaatgg ggtgcttcag gtaactactc tttaaaagcc 1140

gatgtaaatt taacctcaaa ttcttcacat gaactgtata gtgaacaaag tcgtaatcta 1200

cacggatact ctcagctcaa cgcaaccgtt cgccatgcca attggggaaa tcccggtaat 1260

ggcatgaatg caagacttta cgtgaaaacg ggctctgatt atacatggca tagcggtcct 1320

tttacacgta tcaatagctc caactcagga acaacgttat cttttgattt aaacaacatc 1380

gaaaatatca tcatgttagg gaaatag 1407

<210> 4

<211> 468

<212> PRT

<213> Bacillus sp.

<223> amino acid, linear

<400> 4

Met Lys Lys Lys Leu Ser Gln Ile Tyr His Leu Ile Ile Cys Thr Leu

1 5 10 15

Ile Ile Ser Val Gly Ile Met Gly Ile Thr Thr Ser Pro Ser Ala Ala

20 25 30

Ser Thr Gly Phe Tyr Val Asp Gly Asn Thr Leu Tyr Asp Ala Asn Gly

35 40 45

Gln Pro Phe Val Met Arg Gly Ile Asn His Gly His Ala Trp Tyr Lys

50 55 60

Asp Thr Ala Ser Thr Ala Ile Pro Ala Ile Ala Glu Gln Gly Ala Asn

65 70 75 80

Thr Ile Arg Ile Val Leu Ser Asp Gly Gly Gln Trp Glu Lys Asp Asp

85 90 95

Ile Asp Thr Ile Arg Glu Val Ile Glu Leu Ala Glu Gln Asn Lys Met

100 105 110

Val Ala Val Val Glu Val His Asp Ala Thr Gly Arg Asp Ser Arg Ser

115 120 125

Asp Leu Asn Arg Ala Val Asp Tyr Trp Ile Glu Met Lys Asp Ala Leu

130 135 140

Ile Gly Lys Glu Asp Thr Val Ile Ile Asn Ile Ala Asn Glu Trp Tyr

145 150 155 160

Gly Ser Trp Asp Gly Ser Ala Trp Ala Asp Gly Tyr Ile Asp Val Ile

165 170 175

Pro Lys Leu Arg Asp Ala Gly Leu Thr His Thr Leu Met Val Asp Ala

180 185 190

Ala Gly Trp Gly Gln Tyr Pro Gln Ser Ile His Asp Tyr Gly Gln Asp

195 200 205

Val Phe Asn Ala Asp Pro Leu Lys Asn Thr Met Phe Ser Ile His Met

210 215 220

Tyr Glu Tyr Ala Gly Gly Asp Ala Asn Thr Val Arg Ser Asn Ile Asp

225 230 235 240

Arg Val Ile Asp Gln Asp Leu Ala Leu Val Ile Gly Glu Phe Gly His

245 250 255

Arg His Thr Asp Gly Asp Val Asp Glu Asp Thr Ile Leu Ser Tyr Ser

260 265 270

Glu Glu Thr Gly Thr Gly Trp Leu Ala Trp Ser Trp Lys Gly Asn Ser

275 280 285

Thr Glu Trp Asp Tyr Leu Asp Leu Ser Glu Asp Trp Ala Gly Gln His

290 295 300

Leu Thr Asp Trp Gly Asn Arg Ile Val His Gly Ala Asp Gly Leu Gln

305 310 315 320

Glu Thr Ser Lys Pro Ser Thr Val Phe Thr Asp Asp Asn Gly Gly His

325 330 335

Pro Glu Pro Pro Thr Ala Thr Thr Leu Tyr Asp Phe Glu Gly Ser Thr

340 345 350

Gln Gly Trp His Gly Ser Asn Val Thr Gly Gly Pro Trp Ser Val Thr

355 360 365

Glu Trp Gly Ala Ser Gly Asn Tyr Ser Leu Lys Ala Asp Val Asn Leu

370 375 380

Thr Ser Asn Ser Ser His Glu Leu Tyr Ser Glu Gln Ser Arg Asn Leu

385 390 395 400

His Gly Tyr Ser Gln Leu Asn Ala Thr Val Arg His Ala Asn Trp Gly

405 410 415

Asn Pro Gly Asn Gly Met Asn Ala Arg Leu Tyr Val Lys Thr Gly Ser

420 425 430

Asp Tyr Thr Trp His Ser Gly Pro Phe Thr Arg Ile Asn Ser Ser Asn

435 440 445

Ser Gly Thr Thr Leu Ser Phe Asp Leu Asn Asn Ile Glu Asn Ile Ile

450 455 460

Met leu gly lys

465

<210> 5

<211> 1029

<212> DNA

<213> Bacillus sp.

<223> nucleic acid, single, linear

<400> 5

aattggcgca tactgtgtcg cctgtgaatc ctaatgccca gcagacaaca aaaacagtga 60

tgaactggct tgcgcacctg ccgaaccgaa cggaaaacag agtcctttcc ggagcgttcg 120

gaggttacag ccatgacaca ttttctatgg ctgaggctga tagaatccga agcgccaccg 180

ggcaatcgcc tgctatttat ggctgcgatt atgccagagg atggcttgaa acagcaaata 240

ttgaagattc aatagatgta agctgcaacg gcgatttaat gtcgtattgg aaaaatggcg 300

gaattccgca aatcagtttg cacctggcga accctgcttt tcagtcaggg cattttaaaa 360

caccgattac aaatgatcag tataaaaaca tattagattc agcaacagcg gaagggaagc 420

ggctaaatgc catgctcagc aaaattgctg acggacttca agagttggag aaccaaggtg 480

tgcctgttct gttcaggccg ctgcatgaaa tgaacggcga atggttttgg tggggactca 540

catcatataa ccaaaaggat aatgaaagaa tctctctata taaacagctc tacaagaaaa 600

tctatcatta tatgaccgac acaagaggac ttgatcattt gatttgggtt tactctcccg 660

acgccaaccg agattttaaa actgattttt acccgggcgc gtcttacgtg gatattgtcg 720

gattagatgc gtattttcaa gatgcctact cgatcaatgg atacgatcag ctaacagcgc 780

ttaataaacc atttgctttt acagaagtcg gcccgcaaac agcaaacggc agcttcgatt 840

acagcctgtt catcaatgca ataaaacaaa aatatcctaa aaccatttac tttctggcat 900

ggaatgatga atggagcgca gcagtaaaca agggtgcttc agctttatat catgacagct 960

ggacactcaa caagggagaa atatggaatg gtgattcttt aacgccaatc gttgagtgaa 1020

tccgggatc 1029

<210> 6

<211> 363

<212> PRT

<213> Bacillus sp.

<223> amino acid, linear

<400> 6

Leu Phe Lys Lys His Thr Ile Ser Leu Leu Ile Ile Phe Leu Leu Ala

1 5 10 15

Ser Ala Val Leu Ala Lys Pro Ile Glu Ala His Thr Val Ser Pro Val

20 25 30

Asn Pro Asn Ala Gln Gln Thr Thr Lys Thr Val Met Asn Trp Leu Ala

35 40 45

His Leu Pro Asn Arg Thr Glu Asn Arg Val Leu Ser Gly Ala Phe Gly

50 55 60

Gly Tyr Ser His Asp Thr Phe Ser Met Ala Glu Ala Asp Arg Ile Arg

65 70 75 80

Ser Ala Thr Gly Gln Ser Pro Ala Ile Tyr Gly Cys Asp Tyr Ala Arg

85 90 95

Gly Trp Leu Glu Thr Ala Asn Ile Glu Asp Ser Ile Asp Val Ser Cys

100 105 110

Asn Gly Asp Leu Met Ser Tyr Trp Lys Asn Gly Gly Ile Pro Gln Ile

115 120 125

Ser Leu His Leu Ala Asn Pro Ala Phe Gln Ser Gly His Phe Lys Thr

130 135 140

Pro Ile Thr Asn Asp Gln Tyr Lys Asn Ile Leu Asp Ser Ala Thr Ala

145 150 155 160

Glu Gly Lys Arg Leu Asn Ala Met Leu Ser Lys Ile Ala Asp Gly Leu

165 170 175

Gln Glu Leu Glu Asn Gln Gly Val Pro Val Leu Phe Arg Pro Leu His

180 185 190

Glu Met Asn Gly Glu Trp Phe Trp Trp Gly Leu Thr Ser Tyr Asn Gln

195 200 205

Lys Asp Asn Glu Arg Ile Ser Leu Tyr Lys Gln Leu Tyr Lys Lys Ile

210 215 220

Tyr His Tyr Met Thr Asp Thr Arg Gly Leu Asp His Leu Ile Trp Val

225 230 235 240

Tyr Ser Pro Asp Ala Asn Arg Asp Phe Lys Thr Asp Phe Tyr Pro Gly

245 250 255

Ala Ser Tyr Val Asp Ile Val Gly Leu Asp Ala Tyr Phe Gln Asp Ala

260 265 270

Tyr Ser Ile Asn Gly Tyr Asp Gln Leu Thr Ala Leu Asn Lys Pro Phe

275 280 285

Ala Phe Thr Glu Val Gly Pro Gln Thr Ala Asn Gly Ser Phe Asp Tyr

290 295 300

Ser Leu Phe Ile Asn Ala Ile Lys Gln Lys Tyr Pro Lys Thr Ile Tyr

305 310 315 320

Phe Leu Ala Trp Asn Asp Glu Trp Ser Ala Ala Val Asn Lys Gly Ala

325 330 335

Ser Ala Leu Tyr His Asp Ser Trp Thr Leu Asn Lys Gly Glu Ile Trp

340 345 350

Asn Gly Asp Ser Leu Thr Pro Ile Val Glu *

355 360

Current detergent compositions contain complex combinations of active ingredients that meet certain needs. In particular, current detergent formulations generally include detergent enzymes that provide cleaning and fabric protection benefits, and more particularly cellulase and amylase enzymes.

In view of fabric cleaners and roughness reducing agents for fabrics, the efficacy of cellulose degrading enzymes such as cellulase has been recognized for some time. The activity of cellulase refers to the activity in which cellulosic fibers or substrates are hydrolyzed by cellulase, which depends on the specific function of the cellulase, which may be an endo- or exo cellulase and each hemicellulase. The cellulose structure is depolymerized or cleaved smaller to become more soluble or dispersible fragments. In particular, the activity on the fabric provides cleanability, stretchability, softening and generally improved hand feel to the fabric structure.

It is known that amylases act on starch that is naturally present or added as a starch-containing food stain / dirt or processing agent to provide a benefit as a stain removal ability.

Food stains / dirts represent most consumer related stains / dirts and often include food additives. Nutraceuticals, acidifiers, antioxidants, preservatives, sweeteners, enzymes, thickeners / stabilizers and emulsifiers such as hydrocolloids are commonly used food additives. In particular, consumer demand for reducing fat and calories has increased the use of texturing agents as fat substitutes. The market for hydrocolloidal texture processors / stabilizers, called food gums, is expected to grow to about 4% per year. Xanthan gum growth is 6% to 8% per year and edible seaweed is about 3% per year (Chemical week, June 19 (1996) pp 32-34).

The term "gum" refers to a group of industrially useful polysaccharides (long chain polymers) or derivatives thereof that hydrate in hot or cold water to form a viscous solution, dispersion or gel. The gums are classified as natural gums and modified gums and include natural black seaweed extracts, plant extrudates, gums of seed or root origin and gums obtained by microbial fermentation. Modified (semisynthetic) gums include certain synthetic gums such as cellulose and starch derivatives and lower methoxyl pectin, propylene glycol alginate and carboxymethyl and hydropropyl guar gums. Gums in Encyclopedia Chemical Technology 4 ^th Ed Vol 12.pp 842-862. J. Baird, Kelco division of Merck, Carbohydrate Chemistry for Food Scientists (Eagan Press-1997) by RL Whistler and JN BeMiller. Chap 4, pp63-89 and Direct Food Additives in Fruit Processing by P. Laslo. Bioprinciples and Applications. Vol 1, Chapter II, pp 313-325 (1996) Technology publishing.

Some of these gums (eg, xanthan gum (E 415. CEE number), gellan gum (E416), guar gum (E412), locust bean (E410) and tragacanth (E413)) or many foods It has been widely used alone or in combination in applications. Gums in ECT 4 ^th Ed. Vol. 12 pp842-862. J. Baird. Kelco division of Merck]. In particular, guar gum is often used as a thickener in foods and as a binder of free water in sauces and salad dressings. Guar gum is also used as a free water binder and stabilizer in ice creams and frozen desserts. Free water in ice cream mixes causes grain-like structures, ice crystals, poor meltdown properties, and poor heat-shock resistance in processed ice cream. Incorporation of a stabilizer comprising guar gum in an amount of up to about 0.3% of the ice cream mix results in a soft-tissue chewable product that melts slowly and has good heat shock resistance. In particular, it is also suitable for instant pasteeurisation because of its rapid hydration properties. Another food item that can be stabilized with guar gum due to its ability to bind with water is frozen foods, cheeses, pies, icings and pet foods. Still other examples include algin gums known to be used in sherbets, canned and formulated foods, tragacanth gums used in salad dressings, and xanthan gum for dairy and beverages. Gellan is found in icing, confectionery and dairy products, and locust beans and agar are found in ice cream.

The characteristic of these food gums is that they give a very high viscosity to the solution when hydrated in water. Some of these gums (eg guar, algin, arabian, karaya, methyl cellulose locus bean gum) are also used in the paper industry and are selected because of their high affinity for cellulosic fibers. Industrial gums by RL Whistler and JN BeMiller (Academic Press-1973). Their efficacy in flocculating other inorganic materials such as clays and calcium salts is used in other applications such as water treatment. The high viscosity of these food gums is desired for the foods mentioned above and for other applications.

Surprisingly, however, it has been found that these food black fabrics are strongly adsorbed onto the cotton fibers to adhere stains / dirt onto the fabric. This is true even when the gum is present in the food composition at very low concentrations, for example 0.01 to 5%, more typically 0.01% to 0.8%.

It has also been surprisingly found that the ability of these food gums to agglomerate clays to stain and yellow fabrics. This is particularly important because the overall performance of the detergent is distinguished not only by its ability to remove dirt and stains, but also by its ability to prevent redeposits of degradation products or any insoluble salts from re-depositing on washed products. The redeposition effect causes the product to be covered with an inadequate membrane, which is covered or striped with visible stains that remain intact at the end of the cleaning process. These residues accumulate on the fabric, soiling and yellowing it.

As can be seen above, there is a continuing need to formulate laundry detergent compositions that provide good overall cleaning performance. It is therefore an object of the present invention to provide a laundry detergent composition that provides better cleaning and whitening performance gains and in particular removes good food stains / dirts and maintains dirt cleaning and whiteness.

This object has been met by formulating laundry detergent compositions containing saccharide gum degrading enzymes.

Surprisingly, the laundry detergent compositions of the present invention containing saccharide gum degrading enzymes hydrolyze food saccharide gum bound foods or clay stains / dirts on cotton fabrics to provide excellent food stains / dirt removal, dirt cleaning and whiteness retention. It was found to provide. In addition it has been found that the performance of the laundry detergent compositions of the present invention is enhanced by the addition of selected surfactants, another enzyme, builder and / or bleaching system.

GB2-169-393 is an enzyme preparation containing cellulose degradable and pectin degrading enzymes that reduces the concentration of H ₂ SO ₄ to less than 2% during the fabric carbonization process using conventional machinery and equipment of dyeing and processing plants. Treatment describes the removal of cellulose contaminants and other vegetable contaminants from the fabric.

WO96 / 06532 relates to compositions capable of killing or inhibiting proliferating microbial cells using basic proteins or peptides of biological origin, such as protamine or protamine sulfate. For certain bacteria or fungi, these compositions further contain cell wall degrading enzymes such as oxidoreductase or endoglycosidase type II, lysozyme and / or chitinase.

WO95 / 35362 describes cleaning compositions comprising laundry compositions, dishwashing compositions and especially household cleaning compositions containing pectinase and / or hemicelluloses and optionally cell wall degrading enzymes such as cellulase. These compositions are particularly suitable for removing dirt and dust having plant-like stains and similar structures. These plant cell wall degrading enzymes degrade structural components of the plant cell wall such as structured polysaccharides (eg, cellulose, hemicellulose and pectin) and include cellulose degrading enzymes, pectin degrading enzymes and hemicellulose degrading enzymes. Many plant cell wall degrading enzymes exist. Cellulolytic enzymes are classified into three classes: endoglucanase, exoglucanase or cellobiohydrolase and β-glucosidase. Many enzymes are known to degrade pectin and include, for example, pectin esterases, pectin lyases, pectate lyases and endo- or exo-polygalacturonases. In addition to these enzymes that degrade flat areas, enzymes and coenzymes that break down hair areas such as rhamnogalacturonas have also been found. Many enzymes are useful for degrading hemicellulose structure and include, for example, xylanase, galactanase, arabinase, liquenase and mannase.

However, the use of saccharide gum degrading enzymes for good cleaning performance in cotton fabrics in laundry detergent compositions has never been previously recognized.

Summary of the Invention

The present invention relates to laundry detergent compositions containing saccharide gum degrading enzymes and providing excellent cleaning performance for cotton fibers, in particular food stain / dirt removal, dirt cleaning and whiteness maintenance benefits.

The present invention relates to laundry detergent compositions containing saccharide gum degrading enzymes.

An essential component of the laundry detergent composition of the present invention is a saccharide gum degrading enzyme. These enzymes can hydrolyze non-starch, non-cellulose food polysaccharides having a viscosity of at least 800 cps in a 1% solution (measured in water at 25 ° C. with a Brookfield synchro-rectic viscometer at 20 rpm).

Surprisingly, the laundry detergent compositions of the present invention have been found to provide excellent cleaning and whitening performance and in particular significant food stain / dirt removal benefits and dirt stain / dirt cleaning.

Without being bound by theory, saccharide gum degrading enzymes are considered to hydrolyze food gum additives, which are present in food stains / dirt and adhere the stains / dirt onto cotton fibers. Practically these non-starch, non-cellulose food polysaccharides have a high affinity for cotton fibers and thereby bind stains / dirts to fabrics. Thus, hydrolysis of these non-starch, non-cellulose food polysaccharides releases stains / oil from cotton fabrics.

Moreover, it has been surprisingly found that the laundry detergent compositions of the present invention provide significant dirty cleaning and whiteness retention. Without being bound by theory, saccharides, degradation products resulting from the partial cleaning of these food stains / filths with current detergent formulations, are considered to be redeposited onto the fabric and react with particulate matter such as clay compounds to contaminate cotton fabrics. The saccharide gum degrading enzymes of the present invention hydrolyze saccharide membranes deposited on fabrics to prevent these compounds from clumping with certain soils.

Without wishing to be bound by theory, the enzymatic action of the saccharide degrading enzymes of the present invention is also considered to allow food and dirty stains / dirts to be more easily contacted with another detergent component in the laundry detergent composition. In particular, the performance of the laundry detergent compositions of the present invention has been found to be enhanced in combination with selected surfactants, other enzymes, builders and / or bleaching systems.

Enzymes of the present invention are non-starch, non-cellulose food polysaccharides (e.g., agar, algin, karawa, tragacanth, guar gum, locus bean, xanthan and / or mixtures thereof) having a viscosity of at least 800 cps in a 1% solution. ) Major or minor activity.

Examples of industrial gums used separately as food additives are:

Seed gums (e.g. guar gum, locust bean Queen seed Seed Psylium, flax seed and okra gum, tamarind, larch arabinocalactan),

Plant extrudates (e.g. Arabia, Gati, Karaya, Tragacanth),

Seaweed extracts (e.g. algin, agar, carrageenan, fucoidan, purcellane) and

Biosynthetic gums (eg xanthan).

Enzymes suitable for the purposes of the present invention have the following major or secondary enzymatic activities:

Arabinase: endo arabanase (EC 3.2.1.99) (e.g. endo a-1,5-arabinosidase), exo arabanase (EC 3.2.1.55), exo A (α-1,2) α-1,3) arabinofuranosidase, exo B (α-1,3; α1,5) arabinofuranosidase;

-(α-1,2; α1,3) fucosidase, a-1,6-fucosidase (E.C. 3.2.1.127);

-β-1,2-galactanase, β-1,3-galactanase (EC 3.2.1.90), β-1,4-galactanase, β-1,6-galactanase, galactanase Is also referred to as arabino galactan galactosidase (EC 3.2.1.89), α and β galactosidase (EC 3.2.1.22 & 23). (E.C 3.2.1.102) (E.C.3.2.1.103)

β-mannosidase (3.2.1.25), α-mannosidase (3.2.1.24), β-1,2-mannosidase, α-1,2-mannosidase (EC3.2.1.113) (EC 3.2.1.130), α-1,2-1,6-mannosidase (3.2.1.137), β-1,3-mannosidase (EC 3.2.1.77), β-1,4-mannosidase ( EC 3.2.1.78), β-1,6-mannosidase (EC 3.2.1.101), α-1,3-1,6-mannosidase (EC 3.2.1 114), β-1,4-manno Sidase (EC 3.2.1.100);

Glucuronosidase (E.C. 3.2.1.131), glucuronidase (E.C. 3.2.1.31), exo 1,2 or 1,4 glucuronidase.

Agarase (EC 3.2.1.81), carrageenase (EC 3.2.1.83), a-1,2-xanthanase, poly (α-L-guluronate) lyase, and also alginase II (EC 4.2) Referred to as .2.11).

Preferred saccharide gum degrading enzymes are:

Mannosidase: β-mannosidase, endo 1,4-β-D-mannosidase, endo 1,2-β-D-mannosidase and exo 1,3-β-D mannosidase:

Galactosidase: exo 1,6-β-D-galactosidase and 1,3-β-D-galactosidase;

-Glucuronidase: glucuronosidase and exo 1,2 or 1,4-glucuronidase;

Arabinase: endo a-1,5-arabinosidase, exo arabanase, exo A (α-1,2: α-1,3) arabinofuranosidase, exo B (α-1 , 3: α-1,5) arabinofuranosidase;

Xanthan lyase: poly (α-L guluronate) lyase, agarase and carrageenase.

In particular, the following enzymes are preferred saccharide gum degrading enzymes for certain non-starch non-cellulose food polysaccharides having a viscosity of at least 800 cps in 1% solution: guar gum (guar powder, jaguar gum), locust bean gum And enzymes that hydrolyze carob bean gum (known as food additives E 410, E 412 and 21 CFR 184,1339 and 13423) include mannosidase, galactomannosidase, preferably endo mannosidase and brown. Lactomannosidase enzymes such as gamanase ^R , a galactomannase of Aspergillus niger origin. Preferred enzymes for decomposing xanthan gum are mannosidase, glucuronosidase and glucosidase. Preferred enzymes are galactosidase, rhamnogalacturonase, which degrades karaya gum. Preferred enzymes are arabanases that degrade galacturonases, galactosidases, fucosidases, tragacanth gums. Preferred enzymes for breaking down gellan, agar and carrageenan are glucosidase, rhamnosidase and glucuronidase, aragase and carrageenase, respectively. Preferred enzymes are mannuronases and guluronases that degrade the mannofyranosyluronic acid and gulopyranosiluronic acid residues contained in alginates.

Enzymes encompassed by the present invention are the following three mannan-degrading enzymes: EC 3.2.1.25: β-mannosidase, EC 3.2.178: endo-1,4-β-mannosidase, followed by “mannase” And referred to as EC 3.2.1.100; 1,4-β-mannobiosidase (IUPAC Classified-Enzyme Nomenclature, 1992 ISBN 0-12-227165-3 Academic Press).

More preferably, the laundry detergent composition of the present invention contains β-1,4-mannosidase (E.C 3.2.1.78), referred to as mannase. The term "mannanase" or "galactomannase" is officially called endo-1,4-beta-mannosidase and is met under the names beta-mannase and endo1,4-mannase. By mannase enzymes as defined in the art, catalyzing the random hydrolysis of 1,4-beta-D-mannoside bonds in lactomannan, glucomannan and galactoglucomannan.

In particular, mannaase (EC 3.2.1.78) is glycosides in mannan, glucomannan, galactomannan and galactogluco-mannan, which can degrade mannan and cleave the polysaccharide chains containing mannose units. It constitutes a polysaccharase group that refers to an enzyme capable of cleaving a bond. Mannan is a polysaccharide with a backbone consisting of β-1,4-linked mannose and glucomannan is a polysaccharide with a backbone with a somewhat regular repeat of β-1,4-linked mannose and glucose, galactomannan and galactoglucomannan Are mannans and glucomannans with α-1,6 bound galactose side chains. These compounds can be acetylated.

The degradation of galactomannans and galactoglucomannans is facilitated by the complete or partial removal of galactose side chains. In addition, the degradation of acetylated mannan, glucomannan, galactomannan and galactoglucomannan is facilitated by complete or partial deacetylation. Acetyl groups can be removed by alkali or met acetylesterases. The oligomers released by the enzymes of mannase, or the combination enzyme of mannase and α-galactosidase and / or met acetyl esterase, are further degraded by β-mannosidase and / or β-glucosidase and released. Can drain maltose.

Mannase has been identified in several Bacillus microorganisms. See, eg, Talbot et al, Appl. Environ. Microbiol., Vol. 56. 11. pp. 3505-3510 (1990) describe beta-mannases originating from Bacillus stearothermophilus in dimer form having a molecular weight of 162 kDa and an optimal pH of 5.5 to 7.5. See Mendoza et al., World J. Microbiol, Biotech., Vol. 10. No. 5, pp. 551-555 (1994) describe beta-mannases originating from Bacillus subtilis with a molecular weight of 38 kDa, optimal activity at pH 5.0 and 55 ° C., and a pI of 4.8. JP-0304706 describes beta-mannase originating from Bacillus species with a molecular weight of 373 kDa, an optimal pH of 8 to 10 and a pi of 5.3 to 5.4, as measured by gel filtration. JP-63056289 describes, for example, the production of alkaline thermostable beta-mannanases that hydrolyze the beta-1,4-D-mannopyranoside bonds of mannan to produce manno-oligosaccharides. JP-63036774 relates to Bacillus microorganism FERM P-8856, which produces beta-mannase and beta-mannosidase at alkaline pH. JP-08051975 describes alkaline beta-mannases originating from the basophilic Bacillus species AM-001. Purified mannase originating from Bacillus amyloliquefaciens, useful for bleaching pulp and paper, and methods for its preparation are described in WO 97/11164. WO 91/18974 describes hemicelluloses (eg glucanase, xylanase or mannase) that are active at maximum pH and temperature. WO 94/25576 describes enzymes derived from Aspergillus aculeatus CBS 101.43, which exhibit mannase activity that may be useful for the degradation or modification of plant or algal cell wall material. WO 93/24622 describes mannase isolated from Trichoderma ressei, useful for bleaching lignocellulosic pulp. Hemicelluloses capable of degrading met-containing hemicellulose are described in WO91 / 18974 and mannase purified from Bacillus amyloliquee fashions is described in WO97 / 11164.

In particular, the mannase enzyme is an alkaline mannase, most preferably a mannase originating from bacteria, as defined below. In particular, the laundry detergent composition of the present invention contains an alkaline mannase selected from the mannase of gene yght of Bacillus agaradherens strain and / or Bacillus subtilis strain 168.

The term "alkaline mannase enzyme" refers to an enzyme activity wherein the enzyme activity is at least 10%, preferably at least 25%, more preferably at least 40% of the maximum activity at a given pH in the range of 7 to 12, preferably 7.5 to 10.5. It is meant to include enzymes having.

Most preferably, the laundry detergent composition of the present invention comprises alkaline mannase originating from Bacillus agaradherence. Said mannaze

Vi) Bacillus agaradherens, polypeptide produced by NCIMB 40482,

Ii) a polypeptide comprising an amino acid sequence as shown at positions 32 to 343 of SEQ ID NO: 2, or

Iii) immunogenic with a polyclonal antibody to said polypeptide that is at least 70% homologous to said polypeptide, derived from said polypeptide by substitution, deletion or addition of one or several amino acids, or in purified form. Is a homologue of a polypeptide as defined in iii) or ii), which is reactive.

The invention also

(a) a polynucleotide molecule encoding a polypeptide having mannase activity and comprising a sequence of nucleotides from nucleotide 97 to nucleotide 1029 as shown in SEQ ID NO: 1;

(b) the species homologues of (a);

(c) a polynucleotide molecule encoding a polypeptide having at least 70% homology with amino acid activity from amino acid residue 32 to amino acid residue 343 in SEQ ID NO: 2 and having a mannase activity;

(d) a molecule complementary to (a), (b) or (c); And

(e) an isolated polypeptide having a mannase activity selected from the group consisting of degenerate nucleotide sequences of (a), (b), (c) or (d).

Plasmid pSJ1678 comprising a polynucleotide molecule (DNA sequence) encoding a mannase of the present invention was transformed into an Escherichia coli strain, which is a Budapest treaty for the international approval of microbial deposits for the purpose of the patent procedure. Was deposited by the inventors with the accession number DSM 12180, dated May 18, 1998, in a depository institution of Deutsche sammlung von Mikroorganismen und Zellkulturen GmbH, De-38124 Braunschweig-Machecher-Beck, Germany.

The second most preferred enzyme is mannase originating from Bacillus subtilis strain 168, which is

Iii) encoded by the coding region of the DNA sequence shown in SEQ ID NO: 5 or an analog of said sequence,

Ii) a polypeptide comprising an amino acid sequence as shown in SEQ ID NO: 6;

Iii) immunogenic with a polyclonal antibody to said polypeptide that is at least 70% homologous to said polypeptide, derived from said polypeptide by substitution, deletion or addition of one or several amino acids, or in purified form. Is a homologue of the polypeptide as defined in ii).

The invention also

(a) a polynucleotide molecule encoding a polypeptide having mannase activity and comprising a sequence of nucleotides as shown in SEQ ID NO: 5;

(b) the species homologues of (a);

(c) a polynucleotide molecule encoding a polypeptide having a mannase activity that is at least 70% homologous to the amino acid sequence of SEQ ID NO: 6;

(d) a molecule complementary to (a), (b) or (c); And

(e) an isolated polypeptide having a mannase activity selected from the group consisting of degenerate nucleotide sequences of (a), (b), (c) or (d).

Justice

Before discussing the invention in more detail, the following terms are first defined.

The term "ortholog" (or "species homologue") refers to a polypeptide or protein obtained from one species that is homologous to homologous polypeptides or proteins from different species.

The term “paralog” refers to a polypeptide or protein obtained from a similar given species that is homologous to a unique polypeptide or protein from the same species.

The term "expression vector" refers to a linear or cyclic DNA molecule comprising a fragment encoding a polypeptide of interest operably linked to additional fragments provided for transcription. Such additional fragments may include promoter and terminator sequences, and may optionally include one or more replication origins, one or more optional markers, enhancers and polyadenylation signals, and the like. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both. The expression vector of the present invention can be any expression vector that is conveniently applied to recombinant DNA processes, and the vector is often chosen depending on the host cell into which the vector is introduced. Thus, the vector may be a spontaneously replicating vector, ie, a vector, eg, a plasmid, in which the replication is present as a non-chromosomal entity independent of chromosomal replication. In addition, the vector may be one that, when introduced into the host cell, replicates with the chromosome (s) integrated and integrated into the host cell genome.

The term "recombinant expression" or "recombinant expression" as used herein in connection with expression of a polypeptide or protein is defined according to standard definition in the art. Recombinant expression of the protein is generally performed by using the expression vector defined immediately above.

The term "isolated" means that when applied to a polynucleotide molecule, the polynucleotide is removed from its native genetic environment so that it does not contain another exogenous or unwanted coding sequence and is intended for use in a genetically engineered protein production system. Refers to a suitable form. Such isolated molecules are molecules isolated from their native environment and include cDNA and genomic clones. Isolated DNA molecules of the invention typically do not contain another gene to which they are associated, but may include naturally occurring 5 'and 3' non-translating regions, such as promoters and terminators. Identification of related areas will be apparent to those skilled in the art (Dynan and Tijan, Nature 316: 774-78, 1985).

The term “isolated polynucleotide” may also be referred to as “cloned polynucleotide”. When applied to a protein / polypeptide, the term “isolated” indicates that the protein is found under conditions other than its natural environment. In a preferred form, the isolated protein is substantially free of another protein, in particular another homologous protein (ie "homologous impurities" (see below)). It is preferred to provide the protein in at least 40% pure form, more preferably in at least 60% pure form. Even more preferably, as determined by SDS-PAGE, the protein is in highly purified form, ie, at least 80% pure form, more preferably at least 95%, even more preferably at least 99% pure form. It is desirable to provide.

The term “isolated protein / polypeptide” may also be referred to as “purified protein / polypeptide”.

The term "homologous impurity" means any impurity originating from the homologous cell from which the polypeptide of the invention is originally obtained (eg, another polypeptide other than the polypeptide of the invention).

As used herein in connection with a particular microbial origin, the term "obtained from" means that a polynucleotide and / or polypeptide is produced by a particular source or produced by a cell into which a gene from the source is inserted.

In the context of DNA fragments, the term “operably linked” means that the fragments are aligned such that, for example, transcription begins at the promoter and proceeds through the coding fragments to the terminator so that the fragments act in accordance with the intended purpose.

The term "polynucleotide" refers to single-chain or double-chain polymers of deoxyribonucleotides or ribonucleotide bases that are read from the 5 'to 3' end. Polynucleotides include RNA and DNA and can be isolated from natural sources and synthesized in vitro or produced in combination with natural and synthetic molecules.

The term “complement of polynucleotide molecule” refers to a polynucleotide molecule that has an inverse orientation with a complementary base sequence compared to a reference sequence. For example, the sequence 5 'ATGCACGGG 3' is complementary to 5 'CCCGTGCAT 3'.

The term “degenerate nucleotide sequence” refers to a sequence of nucleotides comprising one or more degenerate codons (compared to a reference polynucleotide molecule encoding a polypeptide). The degenerate codons include three different nucleotides, but encode the same amino acid residues (ie, the GAU and GAC triplets each encode Asp).

The term "promoter" refers to a portion of a gene comprising a DNA sequence provided for binding of RNA polymerase and initiation of transcription. Promoter sequences are typically found in the 5 'non-coding region of a gene, but not always.

The term "secretory signal sequence" refers to a DNA sequence that encodes a polypeptide ("secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide to pass through the secretory pathway of the cell from which the polypeptide is synthesized. Refers to. Larger peptides are typically cleaved and the secretory peptide is removed while traveling through the secretory pathway.

Methods of Obtaining Another Related Sequence Using Sequences of the Invention

The sequence information described herein relating to the polynucleotide sequence encoding the mannase of the present invention can be used as a tool to identify another homologous mannase. For example, polymerase chain reaction (PCR) can be used to amplify a sequence encoding another homologous mannase from a variety of microbial origins, particularly from different Bacillus species.

Assay for activity test

Polypeptides of the present invention having mannase activity can be prepared according to standard test procedures known in the art, for example, using a 0.2% AZCL galactomannan (carob) Endo-1,4-, available as CatNo.I-AZGMA (manufactured by Megazyme, Megazyme's Internet address: http://www.megazyme.com/Purchase/index.html) for US $ 110.00 per 3g Mannase activity can be tested by dispensing into 4 mm diameter holes drilled in agar plates containing substrates for analysis of beta-D-mannase.

Polynucleotides

Isolated polynucleotides of the invention can hybridize with regions of similar size or complementary sequences of SEQ ID NO: 1 under at least moderate stringent conditions.

In particular, the polynucleotides of the present invention have a complete sequence, or about 100 base pairs in length, shown at positions 97-1029 of SEQ ID NO: 1 under at least moderate stringent minimum conditions, preferably highly stringent conditions, as described in detail below. Hybridize with a denatured double helix DNA probe comprising any probe comprising a portion of the sequence of SEQ ID NO: 1. Suitable experimental conditions for determining hybridization between nucleotide probes and homologous DNA or RNA sequences at medium or high stringency conditions are DNA for hybridization at 5 × SSC (sodium chloride / sodium citrate, Sambrook et al., 1989) for 10 minutes. Pre-immersion of filters containing fragments or RNA, and 5 × SSC solution, 5 × Denhardt solution (Sambrook et al., 1989), 0.5% SDS and sonicated denatured salmon sperm DNA (Sambrook et al., 1989) 100 Prehybridization of the filter at μg / ml, followed by random-prime at a concentration of 10 ng / ml [Feinberg, AP] And Vogelstein, B. (1983) Anal. Biochem. 132: 6-13] and hybridization in the same solution containing 32P-dCTP-labeled (inactive above 1 × 10 9 cpm / μg) probe at about 45 ° C. for 12 hours. The filter is then 60 ° C. or higher (medium stringency), even more preferably 65 ° C. or higher (medium / high stringency), even more preferably 70 ° C. or higher (high stringency), even more preferably Is washed twice for 30 min in 2 × SSC, 0.5% SDS above 75 ° C. (very high stringency).

Under these conditions, molecules that the oligonucleotide probe hybridizes are detected using x-ray films.

As mentioned above, the isolated polynucleotides of the present invention include DNA and RNA. Methods of separating DNA and RNA are well known in the art. DNA and RNA encoding the gene of interest can be cloned in a Gene Bank or DNA library by methods known in the art.

Polynucleotides encoding polypeptides having a mannase activity of the present invention can be identified and separated, for example, by hybridization or PCR.

The present invention also provides corresponding polypeptides and polynucleotides (orthologs or paralogs) from different bacterial strains. Particular preference is given to mannase polypeptides of Gram-positive basophil strain origin comprising Bacillus species.

Species homologues of polypeptides having mannase activity of the present invention can be cloned using the information and compositions provided by the present invention in combination with conventional cloning techniques. For example, the DNA sequences of the present invention can be cloned using chromosomal DNA obtained from cell types expressing proteins. Suitable sources of DNA can be identified by performing northern blots using probes designed from the sequences described herein. The library is then constructed from chromosomal DNA of the positive cell line. The DNA sequence of the present invention, which encodes a polypeptide having mannase activity, is then based on the described sequence using a variety of methods, for example, probes designed from sequences described in the specification and claims of the present invention. It can be isolated by probe using one or more sets of degenerate probes. The DNA sequences of the invention can also be cloned using polymerase chain reaction or PCR (Mullis, US Pat. No. 4,683,202) and using primers designed from the sequences described herein. Within further methods, the DNA library can be used to transform or transfect host cells, and the expression of the DNA of interest can be achieved. Polypeptides having an antibody (monoclonal or polyclonal) against mannase expressed or purified from Agaradherens, NCIMB 40482 and expressed and described as described in the materials and methods of Example 1 Can be detected by an activity test for.

DNA sequences cloned into plasmid pSJ1678 present in Escherichia coli DSM 12180 and / or the mannase coding portion of the homologous DNA sequence of the present invention are strains of Bacillus agaradherens, a bacterial species that produce enzymes with met degradation activity. , Preferably, strain NCIMB 40482 or another microorganism or related microorganism described herein.

In addition, homologous sequences can be constructed based on DNA sequences obtainable from plasmids present in Escherichia coli DSM 12180, which are believed to be identical to attached SEQ ID NO: 1, e.g., part of their sequence and / or DNA Does not generate another amino acid sequence of the mannase encoded by the sequence, but introduces a nucleotide substitution corresponding to the codon use of the host microorganism for the purpose of preparing the enzyme, or a different amino acid sequence (ie Can be constructed by the introduction of nucleotide substitutions that can generate).

Polypeptide

The sequences of amino acid numbers 32 to 343 of SEQ ID NO: 2 are mature mannase sequences.

The present invention also provides a mannase polypeptide that is substantially homologous to the polypeptide of SEQ ID NO: 2 and species homologues thereof (paralogue or ortholog). The term "substantially homologous" means herein 70%, preferably at least 80%, more preferably at least 85%, more than the sequence shown in amino acid numbers 32 to 343 of SEQ ID NO: 2 or orthologs or paralogs thereof More preferably at least 90% identical polypeptide. Such polypeptides may more preferably be at least 95%, most preferably at least 98% identical to the sequence shown in amino acid numbers 32 to 343 of SEQ ID NO: 2 or orthologs or paralogs thereof. Percent sequence homology is defined in Needleman, S.B., incorporated herein by reference in its entirety. and Wunsch, CD, (1970), Journal of Molecular Biology, 48, 443-453 (GCG Program Package (Program Manual of Wisconsin Package, Version 8, August 1994, Genetics Computer Group, USA 53711 Wisconsin) Measurement by conventional methods using computer programs known in the art, such as the GAP provided in Madison Science Drive 575. GAP is used with settings for polypeptide sequence comparison: GAP creation penalty of 3.0 and GAP extension penalty of 0.1.

Sequence homology of polynucleotide molecules is determined by the following setting for DNA sequence comparison: GAP creation penalty of 5.0 and similar method using GAP with GAP extension penalty of 0.3.

The enzyme preparations of the invention are preferably microorganisms, preferably bacteria, archeas or fungi, in particular bacteria, for example Bacillus, preferably Bacillus agaradherens, and all species preferably Derived from a bacterium belonging to a basophilic Bacillus strain which may be selected from the group consisting of highly related Bacillus species homologous to at least 95%, even more preferably at least 98% homologous to Bacillus agaradherence based on the 16S rDNA sequence .

Substantially homologous proteins and polypeptides are characterized by one or more amino acid substitutions, deletions or additions. These changes are preferably conservative amino acid substitutions (see Table 2) and other substitutions that do not significantly affect the folding or activity of the protein or polypeptide; Small deletions of typically 1 to about 30 amino acids; And small amino- or carboxyl-terminal extension, e.g., amino-terminal methionine residues, small linker peptides of about 20 to 25 or fewer residues, or purification such as, for example, poly-histidine tract, Protein A Is a minimally changing property, such as a small extension (affinity tag). Nilsson et al, EMBO J. 4: 1075, 1985, which is incorporated herein by reference; Nilsson et al, Methods Enzymol. 198: 3, 1991; Ford et al, Protein Expression and Purification 2: 95-107, 1991]. Affinity tag encoded DNA is commercially available from suppliers [manufacturer: Pharmacia Biotech, Piscataway, NJ; New England Biolabs, Beverly, MA].

However, although the changes described above are preferably changes in small properties, such changes are more likely, such as fusion of larger polypeptides of up to 300 amino acids or amino- or carboxyl-terminal expansion to the mannase polypeptide of the invention. It may be a big feature.

Conservative Amino Acid Substitutions Basic Arginine, lysine, histidine acid Glutamic acid, aspartic acid polarity Glutamine, Asparagine Hydrophobic Leucine, Isoleucine, Valine Aromatic Phenylalanine, Tryptophan, Tyrosine small type Glycine, alanine, serine, threonine, methionine

In addition to the twenty standard amino acids, non-standard amino acids, such as 4-hydroxyproline, 6-N-methyl lysine, 2-aminoisobutyric acid, isovaline and a-methylserine, may be used for amino acid residues of the polypeptides according to the invention. Can be substituted. A limited number of non-conservative amino acids and non-natural amino acids that are amino acids not encoded by the genetic code can be substituted for amino acid residues. “Non-natural amino acids” are modified after protein synthesis and / or have a chemical structure that is different in the side chain than that of the standard amino acid. Non-natural amino acids can be chemically synthesized or are preferably available and include pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline and 3,3-dimethylproline.

Amino acids essential for the mannase polypeptides of the invention can be identified according to methods known in the art, such as site-directed mutations or alanine-scanning mutations. Cunningham and Wells, Sciences 244: 1081- 1085, 1989]. In the latter technique, a single alanine mutation is introduced at every residue in the molecule, and the resulting mutant molecule is tested for biological activity (ie, mannase activity) to identify amino acid residues critical for the activity of the molecule. Hilton Et al., J. Biol. Chem. 271: 4699-4708, 1996. The active site or another biological interaction of the enzyme is also involved in physical analysis of the structure as measured by techniques such as nuclear magnetic resonance, crystal graphs, electron diffraction or photoaffinity labels in conjunction with putative mutations in the contact site amino acids. Can be determined by de Vos et al, Science 255: 306-312, 1992; Smith et al., J. Mol. Biol. 224: 899-904; Wlodaver et al., FEBS Lett. 309: 59-64, 1992. The presence of essential amino acids can also be deduced from homology analysis with polypeptides associated with the polypeptides according to the invention.

Multi-amino acid substitutions can be performed and tested using known methods of reorganization involving mutation, recombination and / or appropriate screening methods, which are described in Reidhaar-Olson and Sauer (Science 241: 53-57). , 1988), Bowie and Saucer (Proc. Natl. Acad. Sci. USA 86: 2152-2156, 1989), WO 95/17413 or WO 95/22625. In summary, these authors select methods for simultaneously randomizing two or more positions in a polypeptide or for recombination / recombination of different mutants [WO 95/17413, WO 95/22625], followed by selection of the functional polypeptides and mutations. A method of sequencing a polypeptide to determine the spectrum of acceptable substitutions at each position is described. Another method that can be used is phage display [Lowman et al, Biochem. 30: 10832-10837, 1991; Ladner et al., US Pat. No. 5,223,409; Huse, WIPO Publication WO 92/06024] and site-directed mutations (Derbyshire et al, Gene 46: 145, 1986; Ner et al, DNA 7: 127, 1988].

Mutation / reassortment methods as described above can be used in combination with high throughput throughput screening methods to detect the activity of cloned and mutated polypeptides in host cells. Mutated DNA molecules encoding active polypeptides can be recovered from host preparation and sequenced quickly using modern devices. These methods allow for the rapid determination of the importance of individual amino acid residues in a polypeptide of interest and can be applied to polypeptides of unknown structure. Using the methods described above, one of ordinary skill in the art can identify and / or prepare a variety of polypeptides that are substantially homologous to residues 32 to 343 of SEQ ID NO: 2 and maintain the mannase activity of the wild type protein.

Protein manufacturing:

Proteins and polypeptides of the invention, including full length proteins, fragments thereof and fusion proteins, can be produced in genetically engineered host cells according to conventional techniques. Suitable host cells are cell types that can be transformed or transfected using exogenous DNA and grown in media, including bacteria, fungal cells and cultured higher eukaryotic cells. Preferred are bacterial cells, especially cultured cells of Gram-positive microorganisms. Gram-positive cells from the genus Bacillus are particularly preferred, for example, Bacillus subtilis, Bacillus lentus, Bacillus brevis, Bacillus stearomophilus, Bacillus alkalophilus, Bacillus amyloliquefa Shunts, Bacillus cogulans, Bacillus circulane, Bacillus lautus, Bacillus serenigiensis, Bacillus rickenformis, and Bacillus agaradherences, in particular Bacillus agaradherens.

Techniques for manipulating cloned DNA molecules and introducing exogenous DNA into various host cells are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Ausubel et al., (Eds.), Current Protocols in Molecular Biology, John Wiley and Sons, Inc., NY, 1987; and "Bacillus subtilis and Other Gram-Positive Bacteria", Sonensheim et al, 1993, American Society for Microbiology, Washington D.C.

In general, a DNA sequence encoding a mannase of the present invention is operably linked to another genetic component, typically including a transcriptional promoter and terminator, required for its expression. Although those skilled in the art can recognize that within a particular system a selectable marker can be provided for a separate vector and exogenous DNA can be replicated by integrating into the host cell genome, the vector is also generally one Or more selective markers and one or more replication origins. The selection of promoters, terminators, selectable markers, vectors and other components is a matter of routine design within the level of ordinary skill in the art. Many of these components are described in the literature and are purchased from conventional manufacturers.

To direct the polypeptide to the secretory pathway of the host cell, a secretion signal sequence (also known as a leader sequence, prepro sequence or pre sequence) is provided to the expression vector. The secretory signal sequence can be the sequence of a polypeptide, or can be derived from another secreted protein or newly synthesized. Many suitable secretory signal sequences are known in the art and described in Bacillus subtilis for Microbio; ogy, Washington D.C .; and Cutting, S.M. (eds.) "Molecular Biological Methods for Bacillus", John Wiley and Sons, 1990, further describe secretion signal sequences suitable for secretion in Bacillus host cells. The secretory signal sequence is bound to the DNA sequence in the correct reading frame. Although specific signal sequences may be located anywhere in the DNA sequence of interest, secretory signal sequences are typically located 5 'to the DNA sequence encoding the polypeptide of interest. Welch et al., US Patent 5,037,743; 5,037,743; Holland et al, US Pat. No. 5,143,830.

Transformed or transfected host cells are cultured in a culture medium containing nutrients and other ingredients required for the growth of the selected host cells according to conventional methods. Various stable media, including synthetic media and composite media, are known in the art and generally include carbon sources, nitrogen sources, essential amino acids, vitamins, and minerals. The medium may also contain ingredients such as growth factors or serum if necessary. In general, growth media can select cells containing DNA exogenously added, for example, by deficiencies in essential nutrients supplemented with a selectable marker that is loaded into a drug selection or expression vector or transfected together with a host cell. .

Protein Isolation:

When the expressed recombinant polypeptide is secreted, the polypeptide can be purified from the growth medium. Preferably, the expression host cell is removed from the medium (eg, by centrifugation) prior to purification of the polypeptide.

If the expressed recombinant polypeptide is not secreted from the host cell, the host cell is preferably disrupted and the polypeptide is released into an aqueous “extract” which is the first step in this purification technique. Preferably, the expression host cell is recovered from the medium (eg, by centrifugation) prior to cell disruption.

Cell disruption can be performed by conventional techniques such as lysozyme digestion or pressurization of cells via high pressure. References: Robert K. Scobes, Protein Purification, Second edition, Springer-Verlag (these further describe these cell disruption techniques).

Depending on the secretion of the expressed recombinant polypeptide (or chimeric polypeptide), it may be fractionated and / or purified using conventional purification methods and media.

Ammonium sulfide precipitation and acid or chaotrope extraction can be used for fractionation of the sample. Exemplary purification steps can include hydroxyapatite, sized extraction, FPLC, and reversed phase high performance liquid chromatography. Suitable anion exchange media include dextran derivatives, agarose, cellulose, polyacrylamide, specialty silica and the like. PEI, DEAE, QAE and Q derivatives are preferred, DEAE Fast-flow Sepharose [PharmaPharma, Piscataway, NJ] is particularly preferred. Exemplary chromatography media include media derived from phenyl, butyl or octyl groups, for example phenyl-sepharose FF from Pharmacia, Toyo butyl 650 from Toso Haas, Montgomeryville, Pa., Octyl-ce Faros [manufacturer; Pharmacia] and the like, or polyacrylic acid resins such as amber chrome CG 71 (Toso Haas) and the like. Suitable solid supports include glass beads, silica-based resins, cellulosic resins, agarose beads, crosslinked agarose beads, polystyrene beads, crosslinked polyacrylamide resins, and the like, which are insoluble under the conditions used. These supports can be modified with reactive groups that allow the attachment of proteins by amino groups, carboxyl groups, sulfhydryl groups, hydroxyl groups and / or carbohydrate moieties. Examples of coupling agents include carboxyl and amino derivatives for cyanogen bromide activators, N-hydroxysuccinimide activators, epoxide activators, sulfhydryl activators, hydrazide activators, and carbodiimide coupling agents. These and other solid media are well known and are widely used in the art and commercially available from suppliers.

The choice of a particular method is a matter of routine design and is in part determined by the nature of the chosen support. Reference: Affinity Chromatography: Principle & Methods, Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988.

Polypeptides or fragments thereof of the invention can also be prepared via chemical synthesis. Polypeptides of the invention include monomers or multimers; Glycosylation or aglycosylation; It may be peglyzed or non-peglylated and may or may not include initial methionine amino acid residues.

Based on the sequence information described herein, a full length DNA sequence encoding the mannase of the present invention and comprising the DNA sequence shown in SEQ ID NO: 1, the minimal DNA sequence from position 97 to position 1029, will be cloned. Can be.

Cloning is performed by standard methods known in the art as follows:

■ Bacillus strains, especially strain ratios. Preparation of a genomic library from Agaradherens, NCIMB40482;

Plating of such libraries on suitable substrate plates;

■ identification of clones comprising the polynucleotide sequences of the invention by standard hybridization techniques using probes based on SEQ ID NO: 1; or

■ Identification of clones from the Bacillus agarardherens NCIMB 40482 genomic library by reverse PCR method using primers based on sequence information from SEQ ID NO: 1. Further explanation regarding reverse PCR is described in the following M.J. MCPherson et al., (“PCR A practical approach” Information Press Ltd, Oxford England).

A homologous polynucleotide sequence encoding a homologous mannase of the present invention by a similar method using a genomic library based on the sequence information described herein (SEQ ID NO: 1, SEQ ID NO: 2) can be used to identify a related microorganism, in particular of Bacillus. Separation from genomic libraries of other strains of the genus Bacillus, such as basic species, is routine to those skilled in the art.

Alternatively, the DNA encoding the metnan or galactomannan-degrading enzyme of the present invention may be obtained by DNA sequence obtainable from a plasmid present in Escherichia coli DSM 12180 from a suitable source such as all the microorganisms mentioned above according to well known methods. Can be cloned using synthetic oligonucleotide probes constructed on the basis.

Thus, the polynucleotide molecules of the present invention can be isolated from Escherichia coli, DSM 12180, where the plasmid obtained by cloning is deposited as described above. The invention also relates to a biological culture of the isolated and substantially pure strain Escherichia coli, DSM 12180.

As used herein, the term “enzyme preparation” refers to a conventional enzyme fermentation product, preferably isolated and purified from a single species of microorganism, eg, an agent comprising a variety of different enzyme activities, or from a single component enzyme, preferably a bacterial or fungal species Mixtures of enzymes derived using conventional recombinant techniques, wherein the enzymes are fermented and capable of isolation, each purified and may originate from different species, preferably fungal or bacterial species, or a host for the expression of recombinant mannase. Fermentation products of microorganisms acting as cells, wherein the microorganisms are present in another enzyme that is a naturally occurring fermentation product of the microorganism, for example, pectin degrading enzymes, proteases or cellulase, ie correspondingly naturally present microorganisms It is an enzyme complex that is commonly prepared by the.

The production method of the enzyme preparation of the present invention is a method comprising culturing a microorganism capable of producing mannase, for example, a wild-type strain, under conditions permitting the production of the enzyme, and recovering the enzyme from the culture. Cultivation can be carried out by conventional fermentation techniques, such as by culturing in shake flasks or fermentors with shaking to allow sufficient growth of the growth medium leading to the production of the mannase enzyme. The growth medium may be a conventional nitrogen source such as peptone, yeast extract or casamino acid, a reduced amount of conventional carbon source such as dextrose or sucrose, and an inducer such as guar gum or It may contain locust bean gum. Recovery is followed by conventional techniques such as separation of the biomass and supernatant by centrifugation or filtration, recovery of the supernatant or cell disruption when the desired enzyme is present in the cell (see EP 0 406 314). It can be carried out by further purification as described in or by crystallization as described in WO 97/15660.

Immunological Cross-Reactivity:

Polyclonal antibodies used in the determination of immune cross-reactivity can be prepared using purified mannase enzymes. More specifically, the antiserum against the mannase of the present invention is described in N. Axelsen et al., In A Manual of Quantitative Immunoelectrophoresis, Blackwell Scientific Publications, 1973, Chapter 23, or A. Johnstone and R. Thorpe, Immunochemistry in Practice, Blackwell Scientific Publications, 1982 (more specifically, p. 29-31). Purified immunoglobulins can be obtained from antisera, for example by salt precipitation ((NH ₄ ) ₂ SO ₄ ) followed by dialysis and ion exchange chromatography, for example on DEAE-Sepadex. Immunohistochemical properties of proteins are described in Outcherlony double-diffusion analysis [O.Ouchterlony in: Handbook of Experimental Immunology (DMWeir, Ed), Blackwell Scientific Publications, 1967, pp. 655-706], cross immunoelectrophoresis [N. Axelsen et al., Supra, Chapter 3 and 4] or rocket immunoelectrophoresis [N. Axelsen et al., Chapter 2] Can be.

Examples of useful bacteria which produce the enzymes or enzyme preparations of the invention are preferably Bacillus / Lactobacillus subdivision, preferably strains of the genus Bacillus, more preferably strains of Bacillus agaradherens, in particular Bacillus agaradherens Is a Gram-positive bacterium belonging to strain NCIMB 40482.

The present invention includes isolated mannaase having the properties described above and containing no homology impurities and produced using conventional recombinant techniques.

Measurement of Catalytic Activity (ManU) of Mannase

Colorimetric Analysis: Substrate: 0.2% AZCL-galactomannan (Australia, Megazine) from carob in 0.1 M glycine buffer at pH10.0. The analysis is carried out in a 1.5 ml volume of Eppendorf microtubes on a thermomixer with stirring and temperature control at 40 ° C. Incubation of the 0.750 ml substrate with 0.05 ml enzyme for 20 minutes is terminated by centrifugation for 4 minutes at 15000 rpm. The chromaticity of the supernatant is measured at 600 nm in a 1 cm cuvette. One ManU (mannase unit) shows 0.24 absorbance at 1 cm.

Acquisition of Bacillus agaradherence mannase NCIBM 40482

Strain

Bacillus agaradherens NCIMB 40482 contains a DNA sequence encoding a mannase enzyme.

this. E. coli SJ2 cells (Diderichsen, B., Wedsted, U., Hedegaard, L., Jensen, BR, Sjoholm, C. (1990), Bacillus brevis. Cloning of aldB, which encodes the extracellular enzyme alpha-acetolactate decarboxylase from J. bacteriols, 172, 4315-4321, was constructed and described by the supplier Gene Pulser ^™. Transformation is performed by electroporation using an electroporator (BIO-RAD).

B. Subtilis PL2306. These strains are decayed apr and npr genes that have collapsed in transcription units of known Bacillus subtilis cellulase genes to become cellulase negative cells [Diderichsen, B., Wedsted, U., Hedegaard, L., Jensen, BR, Sjoholm, C. (1990) Cloning of aldB, which encodes the extracellular enzyme alpha-acetolactate decabosilase from Bacillus brevis, J. Bacteriol., 172, 4315-4321]. Subtilis DN 1885. Collapse is essentially described in Eds. A.L. Sonenshein, J.A. Hoch and Richard Losick (1993) Bacillus subtilis and other Gram-Positive Bacteria, American Society for microbiology, p. 618.

Competent cells are described in Yasbin, R.E., Wilson, G.A. And Young, F.E. (1975), Transformation and transfection in lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage in competent cells. Bacterial, 121: 296-304, was constructed and transformed.

Plasmid

pSJ1678 (described in detail in WO 94/19454, which is hereby incorporated by reference in its entirety).

pMOL944: This plasmid is a pUB110 derivative that essentially contains the kanamycin resistance gene, a constituent of the replicable plasmid in Bacillus subtilis, and has a strong promoter and a signal peptide cloned from the amyL gene of B. rickeniformis ATCCA4580. The signal peptide contains a SacII site that facilitates cloning of the DNA encoding the mature portion of the protein fused with the signal peptide. This allows the pre-protein to be expressed extracellularly.

Plasmids are constructed by conventional genetic engineering techniques, which are briefly described below.

pMOL944's work:

pUB110 plasmid (McKenzie, T. et al, 1986, Plasmid 15: 93-103) is digested with a single restriction enzyme Ncil. Plasmid pDN1981 [see: P.L. PCR fragments amplified from the amyL promoter encoded by Jorgensen et al, 1990, Gene, 96, p37-41] were digested with Ncil and inserted into Ncil digested pUB110 to obtain plasmid pSJ2624.

The two PCR primers used have the following sequence:

# LWN5494 5'-

GTCGCCGGGGCGGCCGCTATCAATTGGTAACTGTATCTCAGC-3 '

# LWN5495 5'-

GTCGCCCGGGAGCTCTGATCAGGTACCAAGCTTGTCGACCTGCAGAA

TGAGGCAGCAAGAAGAT-3 '

Primer # LWN5494 is inserted at the NotI site in the plasmid.

Subsequently, plasmid pSJ2624 is digested with SacI and NotI and a new PCR fragment amplified at the amyL promoter encoded on pDN1981 is digested with SacI and NotI and the DNA fragment is inserted into SacI-NotI digested pSJ2624 to obtain plasmid pSJ2670. .

This cloning uses the same promoter but replaces the first amyL promoter cloning in the reverse direction. The two primers used for PCR amplification have the following sequence:

# LWN5938 5'-

GTCGGCGGCCGCTGATCACGTACCAAGCTTGTCGACCTGCAGAATG

AGGCAGCAAGAAGAT-3 '

# LWN5939 5'-GTCGGAGCTCTATCAATTGGTAACTGTATCTCAGC-3 '

PCR fragments amplified from cloned DNA sequences that digest plasmid pSJ2670 with restriction enzymes PstI and BclI and encode alkaline amylase SP722 (described in International Patent Publication WO95 / 26397, which are hereby incorporated by reference in their entirety) with PstI and Digestion and insertion into BclI afford plasmid pMOL944. The two primers used for PCR amplification have the following sequence:

# LWN7864 5'-AACAGCTGATCACGACTGATCTTTTAGCTTGGCAC-3 '

# LWN7901 5'-AACTGCAGCCGCGGCACATCAATAATGGGACAAATGGG-3 '

Primer # LWN7901 is inserted at the SacII site in the plasmid.

Cloning of the Mannase Gene from Bacillus Agaradherence

Genomic DNA Preparation:

Bacillus agaradherens NCIMB 40482 strain is grown in liquid medium as described in WO94 / 01532. After 16 hours of incubation at 30 ° C. and 300 rpm, cells are harvested and genomic DNA is isolated by the method described by Pitcher, D.G., Saunders, N.A., Owen, R.J. (1989). Rapid extraction of bacterial genomic DNA using guanidium thiocyanate (Let. Appl. Microbiol., 8, 151-156).

Genome library construction:

Genomic DNA is partially digested using restriction enzyme Sau3A and size-fractionated by electrophoresis on 0.7% agarose gel. Fragments 2 to 7 kb in size are separated on DEAE-cellulose paper by electrophoresis [Dretzen, G., Bellard, M., Sassone-Corsi, P., Chambon, P. (1981) A reliable method for the recovery of DNA fragments from agarose and acrylamide gels. Anal. Biochem., 112, 295-298.

The isolated DNA fragments are linked to BamHI digested pSJ1678 plasmid DNA and the ligation mixture is used to transform E. coli SJ2.

Identification of positive clones:

DNA libraries in E. coli constructed as described above are screened in LB agar plates containing 0.2% AZCL-galactomannan (megazine) and 9 μg / ml chloramphenicol and incubated at 37 ° C. overnight. Clones that exhibit mannase activity appear as blue diffuse ore. Plasmid DNA from one of these clones is isolated with 1 ml of Qiagen plasmid spin peptides in liquid culture (cells incubated at 37 ° C. in TY with 9 μg / ml chloramphenicol and shaken at 250 rpm) overnight. .

This clone (MB525) is further characterized by sequencing the DNA of the cloned Sau3A DNA fragment. DNA sequencing is performed by primerworking using Taq deoxy-terminal cycle sequencing kit (Perkin-Elmer, USA), fluorescently labeled terminators and oligonucleotides suitable as primers.

Analysis of sequence data can be found in Devereux et al (1984) Nucleic Acids Res. 12, 387-395. The sequence encoding the mannase is shown in SEQ ID NO: 1. The derived protein sequence is shown in SEQ ID NO: 2.

Subcloning and Expression of Mannase in B. subtilis:

DNA sequences of the invention encoding mannase are PCR amplified using a set of PCR primers consisting of these two oligonucleotides:

Mannaze Upper SacII

5'-CAT TCT GCA GCC GCG GCA GCA AGT ACG GGC TTT TAT GTT GAT GG-3 '

Mannaze Bottom NotI

5'-GAC GAC GTA CAA GCG GCC GCG CTA TTT CCC TAA CAT GAT GAT ATT TTC G-3 '

Restriction sites SacII and NotII are underlined.

Chromosome DNA isolated from B. agaradherens NCIMB 40482 as described above is used as template in a PCR reaction using Amplitaq DNA polymerase (Perkin Elmer) according to the manufacturer's instructions. PCR reactions are performed in PCR buffer containing 200 μM of each dNTP, 2.5 units of Amplitaq polymerase (Perkin-Elmer, Setus, USA) and 100 pmol of each primer.

PCR reactions are performed using a DNA thermal cycler (landgraph, Germany). The PCR is rotated 30 times by incubating 1 minute at 94 ° C., then using a cycle profile that denatures at 94 ° C. for 30 seconds, annealed at 60 ° C. for 1 minute and extending 2 minutes at 72 ° C. 5 μl aliquots of amplification products are analyzed by electrophoresis on 0.7% agarose gel (NuSieve, FMC). The appearance of a DNA fragment of size 1.4 kb indicates a suitable amplification of the gene fragment.

Subcloning of PCR Fragments

45 μl aliquots of the PCR product generated as described above are purified using the QIAquick PCR Purification Kit (Qiagen, USA) according to the manufacturer's instructions. Purified DNA is eluted with 50 μl of 10 mM Tris-HCl at pH 8.5.

5 μg of pMOL944 and 25 μl of purified PCR fragment were digested with SacII and NotI, electrophoresed on 0.8% agarose gel (seaplaque GTG, FMC) with low gelling temperature and the corresponding fragments were cleaved from the gel, according to the manufacturer's instructions Purify using QIAquick gel extraction kit (Qiagen, USA). The isolated PCR DNA fragment was linked to pMOL944 digested and purified with SacII-NotI. 0.5 μg of each DNA fragment, 1 U of T4 DNA ligase and T4 ligase buffer (Boehringer Mannheim, Germany) are used to connect overnight at 16 ° C.

The ligation mixture is used to transform competent B. subtilis PL2306. Transformed cells are plated in LBPG-10 μg / ml of kanamycin plate. After 18 hours of incubation at 37 ° C, colonies were observed on the plates. Several colonies are analyzed by separating plasmid DNA from overnight liquid cultures.

One of these positive clones is again streaked several times on an agar plate as used above and this clone is named MB594. Clone MB594 was grown overnight at TY-10 μg / ml kanamycin at 37 ° C. and plasmid from cells using Qiaprep Spin Plasmid Miniprep Kit # 27106 following the manufacturer's recommendation for B. Bacillus plasmid construction using 1 ml of cells the next day. Disconnect. This DNA is sequenced and represents the mature portion of the mannase, ie, the DNA sequence corresponding to positions 94-1404 of attached SEQ ID NO: 3. The derived mature protein is shown in SEQ ID NO: 4. It can be seen that the 3 'end of the mannase encoded by the sequence of SEQ ID NO: 1 changed to that shown in SEQ ID NO: 3 due to the design of the lower primer used in the PCR. The amino acid sequence obtained is shown in SEQ ID NO: 4, and it is clear that the C terminus of SEQ ID NO: 2 (SHHVREIGVQFSAADNSSGQTALYVDNVTLR) was changed to the C terminus of SEQ ID NO: 4 (IIMLGK).

badge:

TY (as described in Ausubel, F.M. et al., (Eds.) "Current protocols in Molecular Biology". John Wiley and Sons, 1995).

LB agar (as described in Ausubel, F.M. et al., (Eds.) "Current protocols in Molecular Biology". John Wiley and Sons, 1995).

LBPG is LB agar supplemented with 0.05% calcium phosphate at 0.5% glucose and pH 7.0 (see above).

BPX medium is described in EP 0 506 780 (WO 91/09129).

Expression, Purification and Characterization of Mannase from Bacillus Agaradherens

Clone MB 594 obtained as described above under this material and method is grown in 25 × 200 ml BPX medium with 10 μg / ml of kanamycin for 5 days at 37 ° C. at 300 rpm in two 500 ml volumes of baffle shake flasks.

6500 ml of shake flask culture of clone MB 594 (batch 9813) is collected and the pH adjusted to 5.5. 146 ml of cationic (C521) and 292 ml of anionic (A130) are added while stirring the aggregates. The aggregated material is separated by centrifugation using a Sorval RC 3B centrifuge at 9000 rpm for 20 minutes at 6 ° C. The supernatant is washed using Whatman glass filters GF / D and C and finally concentrated on a piltron with a pore of 10 kDa.

750 ml of this concentrate is adjusted to pH 7.5 with sodium hydroxide. The clear liquid is subjected to anion-exchange chromatography using a 900 mL volume Q-Sepharose column equilibrated with 50 mmol Tris at pH7.5. The mannase active zone is eluted using a sodium chloride concentration gradient.

Pure enzymes show a single band on SDS-PAGE with a molecular weight of 38 kDa. The amino acid sequence of the mannase enzyme, ie the translated DNA sequence, is shown in SEQ ID NO: 2.

Measurement of dynamics constants:

Substrates: Locus Bean Gum (Carob) and Reducing Sugar Assay (PHBAH). Locus Bean Gum from Sigma (G-0753)

Kinetic measurements using different concentrations of Locus bean gum and incubation for 20 minutes at pH 10 and 40 ° C. provide the following results:

Kcat: 467 per second

K _m : 0.08g per ℓ

MW: 3.8kDa

pI (isoelectric point): 4.2

The optimum temperature of mannase was found to be 60 ° C.

The pH activity profile shows maximum activity at pH 8-10.

The DSC differential scanning calorimeter shows 77 ° C. as the melting point at pH 7.5 in Tris buffer, indicating that the enzyme is very thermally stable.

Detergent miscibility using 0.2% AZCL-galactomannan from carobs as a substrate and cultures at 40 ° C. described above shows excellent compatibility with conventional liquid detergents and good compatibility with conventional powdered detergents. .

Obtaining Bacillus subtilis mannase 168

Bacillus subtilis β-mannase is characterized and purified as follows: The Bacillus subtilis genome is examined for homology with the known Bacillus sp. Β-mannase gene sequence. Mendoza et al., Biochemica et Biophysica Acta 1243: 552-554, 1995). The coding region of ydhT, whose product is unknown, showed 58% similarity to the known Bacillus β-mannase. The following oligonucleotide sequences: 5'-GCT CAA TTG GCG CAT ACT GTG TCG CCT GTG-3 'and 5'-GAC GGA TCC CGG ATT CAC TCA ACG ATT GGC G-3' represent the mature part of the putative β-mannase It is designed to amplify the coding sequence. Total genomic DNA from Bacillus subtilis strain 1A95 is used as a template to amplify the ydhT mature region using the primers described above. PCR is performed using a Gene-AMP PCR Kit (Perkin Elmer, Applied Biosystems, Foster city, CA) with AMPLITAQ DNA polymerase. The initial melting time is 5 minutes at 95 ° C., followed by 25 cycles with a program of melting at 95 ° C. for 1 minute, annealing at 55 ° C. for 2 minutes and extending at 72 ° C. for 2 minutes. After the final cycle, the reaction is kept at 72 ° C. for 10 minutes to fully extend. PCR products are purified using QIAquick PCR Purification Kit (Qiagen, Chatsworth, CA).

The ydhT mature region amplified from Bacillus subtilis strain 1A95 is inserted into the expression vector pPG1524 (already described) as follows. The amplified 1028 bp fragment is digested with Mfe I and BamH I. The expression vector pPG1527 is digested with EcoR I and BamH I. The restriction digest product is purified using the QIAquick PCR Purification Kit (Qiagen, Chatsworth, CA). Two fragments were linked using T4 DNA ligase (13 hours, 16 ° C.) and competent E. coli. It is used to transform the coli strain DH5-α. Ampicillin resistant colonies are cultured during DNA preparation. DNA is then characterized by restriction analysis. Plasmid pPG3200 contains the mature region of the ydhT gene. The plasmid pPG3200 is then used to transform competent Bacillus subtilis strain PG 632 (Saunders et al., 1992).

20/20/5 medium supplemented with 7 kanamycin resistant Bacillus subtilis clones and one PG 632 control clone, supplemented with 1 ml of 25% maltrine, 120 μl of 10 mM MnCl ₂ and 20 μl of 50 mg / ml kanamycin (trip) 20 g / l ton, 20 g / l yeast extract, 5 g / l NaCl). In 250 ml baffle flasks for expression of the proteins, the clones are incubated overnight at 250 ° C. at 37 ° C. The cells are harvested at 14,000 rpm for 15 minutes. 1 μl of each supernatant is diluted in 99 μl of 50 mM sodium acetate (pH 6.0). 1 μl of this dilution is assayed using Endo-1,4-β-mannase beta-mannazyme taps (Megazyme, ireland) according to the manufacturer's instructions. Absorbance is measured at 590 nm on a Beckman DU640 spectrometer. Clone 7 shows the highest absorbance of 1.67. The PG 632 control showed no absorbance at 590 nm.

The supernatant is analyzed by SDS-PAGE on 10-20% Tris-glycine gel (Novex, San diego, Ca) to confirm the expected 38 kDa size protein. Samples are prepared as follows. 500 μl samples of ydhT clone 7 and PG 632 supernatant were precipitated with 55.5 μl of 100% trichloroacetic acid (Sigma), washed with 100 μl of 5% trichloroacetic acid and resuspended in Tris-glycine SDS sample buffer (Novex) Boil for 5 minutes. 1 μl of each sample is electrophoresed at 30 mA for 90 minutes on gel. Large protein bands for ydhT clone 7 appear at 38 kDa.

10 L fermentation of Bacillus subtilis ydhT clone 7 is carried out in a B. Braun Biostat C fermenter. Fermentation conditions are as follows. Cells are incubated for 18 hours at 37 ° C. in a nutrient rich medium similar to 20/20/5. At the end of the fermentation the cells are removed and the supernatant is concentrated to 1 L using a tangential flow filtration system. The final yield of β-mannase in the concentrated supernatant is 3 g / l.

Purification of β-mannase from the fermentation supernatant is carried out as follows. 500 ml of the supernatant is centrifuged at 10,000 rpm for 4 minutes at 10C. The centrifuged supernatant is then dialyzed overnight at 4 ° C. with 4 L of 10 mM potassium phosphate (pH 7.2) changed twice through Spectrapor 12,000 to 14,000 molar weight pore membrane (spectrum). The dialysed supernatant is centrifuged at 4O &lt; 0 &gt; C for 10 minutes at 10,000 rpm. The 200 mL Q Sepharose fast flow (Pharmacia) anion exchange column is equilibrated at 20 ° C. with 1 L of 10 mM potassium phosphate salt (pH 7.2) and 300 mL of the supernatant is loaded onto the column. Two 210 mL fractions (Sample A) and 175 mL fractions (Sample B) are collected. The two assays were assayed as before except diluting with 199 μl of 50 mM sodium acetate (pH 6.0) and their absorbances were 0.38 and 0.52, respectively. 2 μl of each sample is added to 8 μl of Tris-Glycine SDS Sample Buffer (Novex, CA) and boiled for 5 minutes. The obtained sample is electrophoresed at 30 mA for 90 minutes on a 10-20% Tris-glycine gel (Novex, Ca). A major band corresponding to 38 kDa is present in each sample and contains at least 95% total protein. BCA protein assays are performed on two samples according to the manufacturer's instructions, using bovine serum albumin as standard. Samples A and B contain 1.3 mg / ml and 1.6 mg / ml, respectively. Identification of proteins is confirmed by ion injection mass spectrometry and amino terminal amino acid sequence analysis.

Purified β-mannase samples are used to characterize enzymatic activity as follows. All assays use Endo-1,4-β-mannase beta manazime taps as previously described (Megazyme, Ireland). Activity measurements in the pH range 3.0 to 9.0 are performed in 50 mM phosphate citrate buffer and activity measurements in pH 9.5 are performed in 50 mM CAPSO (Sigma) and activity measurements in the pH range of 10.0 to 11.0 use 50 mM CAPS buffer. . The optimum pH for Bacillus subtilis β-mannase was found to be pH 6.0-6.5. The temperature activity profile is performed in 50 mM phosphate citrate buffer, pH 6.5. Enzymes exhibit optimal activity at temperatures between 40 and 45 ° C. Bacillus subtilis β-mannase maintains significant activity below 15 ° C and above 80 ° C. Inactivity to β-1,4-galactomannan was determined to be 160,000 μmol / min mg β-mannazein using Endo-1,4-β-mannase beta manzame taps (Megazyme, Ireland) according to the manufacturer's instructions. Is measured. The nucleotide and amino acid sequences of Bacillus subtilis β-mannase are shown in SEQ ID NOs: 5 and 6.

The saccharide degrading enzyme is a pure enzyme, based on the composition, preferably from 0.0001% to 2% by weight, more preferably from 0.0001% to 0.1% by weight, most preferably from 0.0006% to 0.02% by weight. Incorporated into laundry detergent compositions of the present invention.

In addition to an enzyme core comprising a catalytic domain, the saccharide gum degrading enzymes of the present invention include a cellulose binding domain (CBD), a cellulose binding domain of an enzyme that is operably linked, and an enzyme core (catalytically active domain). The cellulose binding domain (CBD) can be present as an integral part of the encoded enzyme or CBD of another origin can be introduced into the enzyme to form an enzyme hybrid. As used herein, the term "cellulose binding domain" is described by Peter Tomme et al. In "Cellulose-Binding Domains: Classification and Properties" in "Enzyme Degradation of Insoluble Carbohydrates", John N. Saddler and Michael H. Penner (Eds.), ACS Symposium Series, No. 618, 1996. In this definition, more than 120 cellulose-binding domains are classified into 10 classes (IX) and CBD is a variety of enzymes such as cellulase, xylanase, mannase, arabinofuranosidase, acetyl esterase and chitinase. Prove that it is found in CBD has also been found in algae (eg, Porphyra purpurea, a red algae as a non-hydrolyzable polysaccharide-binding protein) (Tomme et al., Op.cit.). However, most CBDs are present in cellulase and xylanase and CBDs are found at or inside the N and C termini of the protein. Enzyme hybrids are known in the art (see WO 90/00609 and WO 95/16782) and encode the cellulose binding domain linked to the DNA sequence encoding the saccharide degradation enzyme, in the presence or absence of a linker. DNA constructs comprising the above DNA fragments can be produced by transforming a host cell and growing the host cell to express the fused gene. Enzyme hybrids can be described by the following formula.

CBD-MR-X

In the above formula,

CBD is at least the N-terminal or C-terminal region of the amino acid sequence corresponding to the cellulose-binding domain,

MR is an intermediate region (linker) and is a bond or preferably a short linking group of about 2 to about 100 carbon atoms, more preferably 2 to 40 carbon atoms, or preferably about 2 to about 100 amino acids, more preferably 2 to 40 amino acids,

X is the N-terminal or C-terminal region of the enzyme of the invention.

Such enzymes may be present in any of the suitable origins such as plant, animal, bacterial, fungal and yeast origin. The origin may further be mesophilic or polar (cooling, thermophilic, thermophilic, basophilic, basophilic, eosinophil, basophilic, etc.). Such enzymes in purified or unpurified form may be used. Recently, modification of wild-type enzymes through protein / genetic engineering techniques is generally practiced to optimize performance efficiency in the cleaning compositions of the present invention. For example, variants may be designed to increase the miscibility of enzymes for components generally present in such compositions. In addition, the variant may be designed such that the optimum pH, bleaching or chelate stability, catalytic activity, etc. of the enzyme variant can be manipulated to suit particular cleaning applications.

In particular, the bleaching stability should be focused on surface charge for amino acid sensitivity and surfactant miscibility with oxygen. The isoelectric point of such enzymes can be modified by substitution of some charged amino acids, for example increasing the isoelectric point can help to improve miscibility with anionic surfactants. The stability of the enzyme can be further enhanced, for example, by forming metal binding sites to form additional salt bridges and increase chelating stability.

Detergent ingredients

Laundry detergent compositions of the present invention may contain additional detergent components. The exact nature of these additional components and the degree of incorporation thereof will vary depending on the physical form of the composition and the nature of the cleaning action on the composition to be used.

The laundry detergent composition of the present invention preferably further comprises a detergent component selected from selected surfactants, another enzyme, builder and / or bleaching system.

Laundry detergent compositions according to the invention may be in the form of liquids, pastes, gels, bars, tablets, sprays, foams, powders or granules. The granular composition may also be in "dense" form and the liquid composition may be in "concentrated" form.

One preferred type of gel detergent is (i) 5% to 25% by weight of alkylpolyethoxylate sulfate, wherein the alkyl group has from about 10 to about 22 carbon atoms and the polyethoxylate chain is from 0.5 to 15, preferably Comprises 0.5 to about 5, more preferably 0.5 to about 4 ethylene oxide residues) and (ii) 15% to 40% by weight of anionic surfactant component comprising 5% to 20% by weight of fatty acids. Heavy duty gel laundry detergent composition comprising a.

Gel compositions herein include non-citrate builders, optical brighteners, dirt release polymers, dye transfer inhibitors, polymer dispersants, enzymes, foam inhibitors, dyes, flavorings, colorants, fillers, salts, perfumes, anti-deposition agents, antifading agents It may further contain one or more additives selected from the group consisting of dye binders, prill / fuge reducing agents and mixtures thereof.

The gel composition herein has a viscosity of about 100 cps to about 4,000 cps, preferably about 300 cps to about 3,000 cps, more preferably about 500 cps to about 2,000 cps at a shear rate of 20 s ⁻¹ and is stable upon storage.

Without being bound by theory, it is believed that the presence of the electrolyte acts to control the viscosity of the gel composition. Thus, the gel properties of the compositions herein are influenced by the amount of surfactant selected and the amount of electrolyte present. In a preferred embodiment herein, the composition further comprises from 0% to about 10%, more preferably from about 2% to about 6%, even more preferably from about 3% to about 5% of a suitable electrolyte or acid equivalent thereof. . Sodium citrate is a very preferred electrolyte for use herein.

The compositions herein optionally contain about 0% to about 10% by weight of solvent and hydrotropes. Without being bound by theory, it is believed that the presence of solvents and hydrotropes can affect the structure and isotropy of the composition. "Solvent" means a solvent commonly used in the detergent industry, including alkyl monoalcohols, di- and tri-alcohols, ethylene glycol, propylene glycol, propanediol, ethanediol, glycerin and the like. "Hydrotrop" means hydrotropes commonly used in the detergent industry, including short-chain surfactants that aid in solubilizing another surfactant. Still other examples of hydrotropes include cumene, xylene or toluene sulfonate, urea, C ₈ or less short chain alkyl carboxylates and C ₈ or less short chain alkyl sulfates and ethoxylated sulfates.

Fatty acids as used herein include saturated and / or unsaturated fatty acids obtained or synthesized from natural sources. Examples of fatty acids include capric acid, lauric acid, myristic acid palmitic acid, stearic acid, arachidic acid and behenic acid. Still other fatty acids include palmitoleic acid, oleic acid, linoleic acid, linolenic acid and ricinoleic acid.

The composition of the present invention may be formulated as a hand wash and washing machine detergent composition comprising a laundry additive composition and a composition suitable for use in dipping and / or pretreating stained fabrics and a fabric softening composition with a rinse added.

When formulated as a composition suitable for use in a washing machine washing method, the compositions of the present invention comprise both surfactant compounds and builder compounds and additionally organic polymeric compounds, bleaches, additional enzymes, foam inhibitors, dispersants, lime-soap dispersants, It may contain one or more detergent ingredients selected from dirt suspensions, anti-deposition agents, corrosion inhibitors. Laundry compositions may also contain emollients as additional detergent components. Compositions containing saccharide gum hydrolase can provide fabric cleaning, stain removal, whiteness maintenance, softening, color development and dye transfer inhibition.

The composition of the present invention can be used as a detergent addition product. Such additive products tend to supplement or increase the performance of conventional detergent compositions.

If necessary, the density of the laundry detergent composition herein is in the range of 400 to 1200 g / l, preferably 500 to 950 g / l of the composition as measured at 20 ° C.

The "dense" form of the composition herein is well reflected by density and by the amount of inorganic filler salt in terms of the composition, the inorganic filler salt is a common ingredient in detergent compositions in powder form, in conventional detergent compositions, fillers Salt is present in substantial amounts, typically 17-35% by weight of the total composition. In the dense composition, the filler salt is present in an amount of no greater than 15% by weight of the total composition, preferably in an amount not exceeding 10% by weight, most preferably in an amount of no greater than 5% by weight. Inorganic filler salts as meant in the compositions are selected from alkali and alkaline earth metal salts of sulfates and chlorides. Preferred filler salts are sodium sulfate.

The liquid detergent composition according to the invention may be present in "concentrated form", in which case the liquid detergent composition according to the invention contains a small amount of water compared to conventional liquid detergents. Typically the water content of the concentrated liquid detergent is preferably 40% by weight or less, more preferably 30% by weight or less and most preferably 20% by weight or less of the detergent composition.

Surfactant system

Laundry detergent compositions according to the present invention comprise surfactant systems in which the surfactant may be selected from nonionic and / or anionic and / or cationic and / or amphoteric and / or zwitterionic and / or semipolar surfactants. It may generally include. Laundry detergent compositions of the present invention preferably comprise nonionic, anionic and / or cationic surfactants.

The laundry detergent compositions of the present invention further comprising nonionic, anionic surfactants and / or cationic surfactants have been found to surprisingly enhance food stain / dirt removal, dirty cleaning and whiteness retention.

Without being bound by theory, it is considered that small particles are easily removed by nonionic surfactants known to particle dirt through enzymatic hydrolysis. In addition, the combination of textile cationic surfactants with enzymatic hydrolysis of saccharide degrading enzymes is believed to improve performance.

Surfactants are typically present at levels of 0.1% to 60% by weight. More preferred incorporation levels are from 1% to 35%, most preferably from 1% to 30% by weight of the laundry detergent composition according to the invention.

The surfactant is preferably formulated to be compatible with the enzyme components present in the composition. In liquid or gel compositions, the surfactant is most preferably formulated to enhance or at least reduce the stability of the enzymes in such compositions.

Nonionic surfactant

Polyethylene, polypropylene and polybutylene oxide condensates of alkyl phenols are suitable for use as nonionic surfactants in the surfactant systems of the present invention and preference is given to using polyethylene oxide condensates. Such compounds include condensation products of alkyl phenols having alkyl groups containing about 6 to about 14 carbon atoms, preferably about 8 to about 14 carbon atoms in a straight or branched chain configuration with an alkylene oxide. In a preferred embodiment, the ethylene oxide is present in an amount equal to about 2 to about 25 moles, more preferably about 3 to about 15 moles of ethylene oxide per mole of alkyl phenol. Commercially available nonionic surfactants of this type include lgepal ™ CO-630 (GAF corporation) and Triton ™ X-45, X-114, X-100 and X-102 (Rohm & Hass Company). Such surfactants are commonly referred to as alkylphenol alkoxylates such as alkyl phenol ethoxylates.

Condensation products of primary and secondary aliphatic alcohols with about 1 to about 25 moles of ethylene oxide are suitable for use as nonionic surfactants in the nonionic surfactant systems of the present invention. The alkyl chain of aliphatic alcohol may be straight or branched, primary or secondary alcohol and generally contains about 8 to about 22 carbon atoms. Preference is given to condensation products of alcohols having alkyl groups containing from about 8 to about 20 carbon atoms, more preferably from about 10 to about 18 carbon atoms, and from about 2 to about 10 moles of ethylene oxide per mole of alcohol. About 2 to about 7 moles, most preferably 2 to 5 moles of ethylene oxide per mole of alcohol are present in the condensation product. Examples of commercially available nonionic surfactants of this type are both condensation of Tergitol ™ 15-S-9 (C ₁₁ -C ₁₅ straight chain alcohols with 9 moles of ethylene oxide, manufactured by Union Carbide Corporation). Product), Tergitol ™ 24-L-6 NMW (condensation product with narrow molecular weight distribution of C ₁₂ -C ₁₄ primary alcohol and 6 moles of ethylene oxide); Neodol ™ 45-9 from Shell Chemical Company (condensation product of 9 moles of C ₁₄ -C ₁₅ linear alcohol with ethylene oxide), Neodol ™ 23-3 (C ₁₂ -C ₁₃ Condensation product of linear alcohol with 3.0 moles of ethylene oxide), Neodol ™ 45-7 (C ₁₄ -C ₁₅ condensation product of 7 moles of straight alcohol with ethylene oxide), Neodol ™ 45-5 (C ₁₄ -C ₁₅ Condensation products of linear alcohols with 5 moles of ethylene oxide); Kyro ™ EOB (condensation product of 9 moles of C ₁₃ -C ₁₅ alcohol with ethylene oxide) from The Procter & Gamble Company; And a Zhenst product, Genapol LA O 3 O or O 5 O (condensation product of C ₁₂ -C ₁₄ alcohol with 3 or 5 moles of ethylene oxide). The preferred range of HLB in such products is 8 to 11 and most preferably 8 to 10.

Useful as nonionic surfactants of the surfactant systems of the present invention are hydrophobic groups and polysaccharides containing from about 6 to about 30 carbon atoms, preferably from about 10 to about 16 carbon atoms, such as polyglycosides, saccharide units of about 1.3. Alkylpolysaccharides having hydrophilic groups containing from about 10 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7 (US Pat. No. 4,565,647 to Llenado (January 21, 1986) Huh)]. Any reducing saccharide containing 5 or 6 carbon atoms may be used, for example glucose, galactose and galactosyl residues may be substituted with glucosyl residues (any hydrophobic group being 2-, 3-, 4- To bind glucose and galactose as opposed to glucoside or galactose). Internal saccharide bonds may be present, for example, between one position of additional saccharide units and the 2-, 3-, 4- and / or 6-positions of previous saccharide units. Preferred alkylpolyglycosides are of the formula R ² O (C _n H _2n O) _t (glycosyl) _x , wherein R ² contains an alkyl group having from about 10 to about 18 carbon atoms, preferably from about 12 to about 14 carbon atoms. Is selected from the group consisting of alkyl, alkylphenyl, hydroxyalkyl, hydroxyalkylphenyl and mixtures thereof, n is 2 or 3, preferably 2, t is from 0 to about 10, preferably 0, and x Is about 1.3 to about 10, preferably about 1.3 to about 3, most preferably about 1.3 to about 2.7). Glycosyl is preferably derived from glucose. To prepare such compounds, alcohols or alkylpolyethoxy alcohols are first formed and then reacted with glucose or glucose sources to form glucosides (bonds at the 1-position). The further glycosyl units can then be bound between the 1-position and the previous glycosyl units 2-, 3-, 4- and / or 6-position, preferably mainly 2-position.

Condensation products of hydrophobic bases and ethylene oxide formed by condensation of propylene oxide with propylene glycol are also suitable for use as further nonionic surfactant systems of the invention. The hydrophobic sites of these compounds preferably have a molecular weight of about 1500 to about 1800 and exhibit water insolubility. The addition of polyethylene moieties to these hydrophobic moieties tends to increase the water solubility of the entire molecule and the liquidity of the product is about 50% by weight of the total condensation product whose polyoxyethylene content corresponds to up to about 40 moles of ethylene oxide. Is maintained below. Examples of this type of compound include commercially available Flurafac ™ LF404 and Pluronic ™ surfactants (BASF).

Also suitable for use as nonionic surfactants of the nonionic surfactant systems of the present invention are condensation products of products obtained from the reaction of ethylene oxide with propylene oxide and ethylenediamine. The hydrophobic moiety of this product consists of the reaction product of ethylenediamine and excess propylene oxide and generally has a molecular weight of about 2500 to about 3000. The hydrophobic moiety is condensed with ethylene oxide such that the condensation product contains about 40% to about 80% by weight polyoxyethylene and has a molecular weight of about 5,000 to about 11,000. Examples of nonionic surfactants of this type include certain commercially available Tetronic ™ compounds (BASF).

Preferred for use as nonionic surfactants of the surfactant systems of the invention are polyethylene oxide condensates of alkyl phenols, condensation products of primary and secondary aliphatic alcohols with ethylene oxide from about 1 to about 25 moles, alkylpolysaccharides and mixtures thereof to be. Most preferred are ethoxy groups 3 to 15 C ₈ -C ₁₄ alkyl phenol ethoxylates and ethoxy groups 2 to 10 C ₈ -C ₁₈ alcohol ethoxylates (preferably average C ₁₀ ).

Very preferred nonionic surfactants are represented by the formula Wherein R ¹ is H or R ¹ is C _1-4 hydrocarbyl, 2-hydroxy ethyl, 2-hydroxy propyl or a mixture thereof, R ² is C _5-31 hydrocarbyl, and Z is 3 Polyhydroxy fatty acid amide surfactants of polyhydroxyhydrocarbyl or alkoxylated derivatives thereof, wherein at least one hydroxyl is a straight chain hydrocarbyl chain bonded directly to the chain. Preferably, R ¹ is methyl, R ² is a straight chain C _11-15 alkyl or C _16-18 alkyl or alkenyl chain such as coconut alkyl or mixtures thereof, and Z is glucose, fructose, mal in a reductive amination reaction. It is derived from reducing sugars such as toss and lactose.

Anionic surfactant

Preferred anionic surfactants for the purposes of the present invention are alkyl ester sulfates and straight chain alkyl benzene surfactants. Suitable anionic surfactants to be used are C ₈ -C ₂₀ carboxylic acids (ie, sulfonated with gaseous SO ₃ according to “The Journal of the American Oil Chemists Society”, 52 (1975), pp 323-329). Linear alkyl benzene sulfonates, alkyl ester sulfonate surfactants, including straight chain esters of fatty acids). Suitable starting materials include tallow and natural fatty materials derived from palm oil and the like.

Particularly preferred alkyl ester sulfonate surfactants for laundry applications are Wherein R ³ is C ₈ -C ₂₀ hydrocarbyl, preferably alkyl or a combination thereof, R ⁴ is C ₁ -C ₆ hydrocarbyl, preferably alkyl or a combination thereof, M is an alkyl ester sulfo Alkyl ester sulfonate surfactants). Suitable salt forming cations include metals such as sodium, potassium and lithium, and substituted or unsubstituted ammonium cations such as monoethanolamine, diethanolamine and triethanolamine. Preferably R ³ is C ₁₀ -C ₁₆ alkyl and R ⁴ is methyl, ethyl or isopropyl. Particular preference is given to methyl ester sulfonates wherein R ³ is C ₁₀ -C ₁₆ alkyl.

Other suitable anionic surfactants are of the formula ROSO ₃ M, wherein R is preferably alkyl or hydroxyalkyl having a C ₁₀ -C ₂₄ hydrocarbyl, preferably C ₁₀ -C ₂₀ alkyl component, more preferably C ₁₂ -C ₁₈ alkyl or hydroxyalkyl, M is H or a cation such as an alkali metal cation such as sodium, potassium, lithium or ammonium or substituted ammonium such as methyl-, dimethyl- and trimethyl ammonium Cations, and quaternary ammonium cations such as tetramethyl ammonium and dimethyl piperidinium cations, and quaternary ammonium cations derived from alkylamines such as ethylamine, diethylamine, triethylamine, and mixtures thereof). Or alkyl sulfate surfactants that are acids. Typically alkyl chains of C ₁₂ -C ₁₆ are preferred at lower wash temperatures (eg below about 50 ° C.) and C ₁₆ -C ₁₈ alkyl chains are preferred at higher wash temperatures (eg above about 50 ° C.).

Other anionic surfactants useful for detergent purposes may also be included in the laundry detergent compositions of the present invention. These include salts of soaps (eg, sodium, potassium, ammonium, and substituted ammonium salts such as mono-, di- and triethanolamine salts), primary or secondary alkanesulfonates of C ₈ -C ₂₂ , C _8- C ₂₄ olefinsulfonates, for example sulfonated polycarboxylic acids, C ₈ -C ₂₄ alkylpolyglycolethersulfates prepared by sulfonation of pyrrolation products of alkaline earth metal citrate described in British Patent Specification 1,082,179 (Containing 10 mol or less of ethylene oxide); Alkyl glycerol sulfonates, fatty acyl glycerol sulfonates, fatty oleyl glycerol sulfates, alkyl phenol ethylene oxide ether sulfates, paraffin sulfonates, alkyl phosphates, isethionates such as acyl isethionates, N-acyl taurates, alkyl succinas Mates and sulfosuccinates, monoesters of sulfosuccinates (particularly saturated and unsaturated C ₁₂ -C ₁₈ monoesters) and diesters of sulfosuccinates (particularly saturated and unsaturated C ₆ -C ₁₂ diesters) , Sulfates of alkylpolysaccharides such as acyl salcosinates, sulfates of alkylpolyglucosides (nonionic nonsulfated compounds described below), side chain primary alkyl sulfates and the formula RO (CH ₂ CH ₂ O) _k -CH ₂ COO- Alkyl polyethoxy, such as a compound of M +, wherein R is C ₈ -C ₂₂ alkyl, k is an integer from 1 to 10 and M is a soluble salt forming cation Carboxylates. Also suitable are resinous acids and hydrogenated resinous acids, such as resinic acids and hydrogenated resinous acids present in or derived from rosin, hydrogenated rosin, and tall oil.

Additional examples are described in "Surface Active Agents and Detergents" (Vol. I and II, Schwartz, Perry and Berch). These various surfactants are also generally described in US Pat. No. 3,929,678 to Laughlin, et al., Issued December 30, 1975, column 23, 58 to column 29, 23. It is described in

When included herein, the laundry detergent compositions of the present invention typically contain from about 1% to about 40% by weight, preferably from about 3% to about 20% by weight of the anionic surfactant.

Highly preferred anionic surfactants include alkyl alkoxylated sulfates and the surfactants thereof are water soluble salts or formula RO (A) _m SO ₃ M, wherein R is unsubstituted C ₁₀ -C ₂₄ alkyl or C ₁₀ -C ₂₄ A hydroxyalkyl group having an alkyl component, preferably C ₁₂ -C ₂₀ alkyl or hydroxyalkyl, more preferably C ₁₂ -C ₁₈ alkyl or hydroxyalkyl, A is an ethoxy or propoxy unit, m Is greater than 0, typically from about 0.5 to about 6, more preferably from about 0.5 to about 3 and M is H or, for example, metal cations (e.g. sodium, potassium, lithium, calcium and magnesium, etc.), ammonium or substituted Cation, which may be an ammonium cation. Alkyl ethoxylated sulfates and alkyl propoxylated sulfates are contemplated herein. Specific examples of substituted ammonium cations include methyl-, dimethyl, trimethyl-ammonium cations and quaternary ammonium cations (e.g. tetramethyl-ammonium) and dimethyl pipedinium cations and alkyl amines (e.g. ethylamine, diethylamine, Cation derived from triethylamine), mixtures thereof, and the like. For example, the surfactant may be C ₁₂ -C ₁₈ alkyl polyethoxylate (1.0) sulfate (C ₁₂ -C ₁₈ E (1.0) M), C ₁₂ -C ₁₈ alkyl polyethoxylate (2.25) sulfate (C _12- C ₁₈ E (2.25) M), C ₁₂ -C ₁₈ alkyl polyethoxylate (3.0) sulfate (C ₁₂ -C ₁₈ E (3.0) M) and C ₁₂ -C ₁₈ alkyl polyethoxylates (4.0 ) Sulfate (C ₁₂ -C ₁₈ E (4.0) M), where M is conveniently selected from sodium and potassium.

Cationic surfactant

Suitable cationic detergent surfactants for use in the laundry detergent compositions of the present invention are surfactants having one long chain hydrocarbyl group. For example, the cationic surfactants include ammonium surfactants such as alkyltrimethylammonium halogenides and the formula [R ² (OR ³ ) _y ] [R ⁴ (OR ³ ) _y ] ₂ R ⁵ N + X- [ Wherein R ² is an alkyl or alkyl benzyl group having about 8 to about 18 carbon atoms in the alkyl chain, and each R ³ is —CH ₂ CH ₂ —, —CH ₂ CH (CH ₃ ) —, CH ₂ CH (CH ₂ OH)-, -CH ₂ CH ₂ CH ₂ -and mixtures thereof, each R ⁴ is C ₁ -C ₄ alkyl, C ₁ -C ₄ hydroxyalkyl, two R ⁴ groups are bonded A benzyl ring structure formed by: -CH ₂ CHOH-CHOHCOR ⁶ CHOHCH ₂ OH (wherein R ⁶ is a polymer having a molecular weight of about 1000 or less) and hydrogen (where y is non-zero) and R is selected from ⁵ is an alkyl chain that is the same as R ⁴ or has a total carbon number of R ² and R ⁵ of about 18 or less, each y is 0 to about 10, the sum of the y values is about 0 to 15, and X is any miscibility Anion] And a surfactant.

Quaternary ammonium surfactants suitable for the present invention are compounds of formula (I).

In the above formula,

R ₁ is short chain length alkyl (C ₆ to C ₁₀ ) or alkylamidoalkyl of formula II;

y is 2 to 4, preferably 3;

R ₂ is H or C ₁ to C ₃ alkyl;

x is 0 to 4, preferably 0 to 2, most preferably 0;

R ₃ , R ₄ and R ₅ are the same or different and are short chain alkyl (C ₁ to C ₃ ) or alkoxylated alkyl of formula III;

X- is a reverse ion, preferably a halide, for example chloride or methylsulfate;

R ₆ is C ₁ to C ₄ ;

z is 1 or 2.

Preferred quaternary ammonium surfactants are the interfaces defined in Formula I wherein R ₁ is C ₈ to C ₁₀ or a mixture thereof, x is 0, R ₃ and R ₄ are CH ₃ , and R ₅ is CH ₂ CH ₂ OH. Active agent.

Highly preferred cationic surfactants are water soluble quaternary ammonium compounds of formula i useful in the compositions of the present invention:

_{R 1 R 2 R 3 R 4} N + X -

In the above formula,

R ₁ is C ₈ to C ₁₆ alkyl;

Each R ₂ , R ₃ and R ₄ is independently C ₁ -C ₄ alkyl, C ₁ -C ₄ hydroxy alkyl, benzyl and — (C ₂ H ₄₀ ) _X H, wherein x is 2 to 5 ego;

X is an anion;

Provided that only one of R ₂ , R ₃ or R ₄ must be benzyl.

Preferred alkyl chain lengths for R ₁ are in particular C ₁₂ to C ₁₅ , wherein the alkyl group is a mixture of chain lengths derived from coconut or palm kernel fats or synthetically derived by olefin condensation or OXO alcohol synthesis. Preferred groups for R ₂ , R ₃ and R ₄ are methyl and hydroxyethyl groups and the anion X can be selected from halide, methosulfate, acetate and phosphate ions. For example, suitable quaternary ammonium compounds of formula i for use herein are as follows:

Coconut trimethyl ammonium chloride or bromide,

Coconut methyl dihydroxyethyl ammonium chloride or bromide,

Decyl triethyl ammonium chloride,

Decyl dimethyl hydroxyethyl ammonium chloride or bromide,

C _12-15 dimethyl hydroxyethyl ammonium chloride or bromide,

Coconut dimethyl hydroxyethyl ammonium chloride or bromide,

Myristyl trimethyl ammonium methyl sulfate,

Lauryl dimethyl benzyl ammonium chloride or bromide,

La (not tenok a) lauryl dimethyl _quaternary ammonium chloride or bromide,

Choline esters (R ₁ is A compound of formula i wherein alkyl is R ₂ , R ₃ and R ₄ are methyl),

Di-alkyl imidazolines [compounds of formula i].

Still other cationic surfactants useful in the present invention are described in US Pat. No. 4,228,044 and European Patent Application No. 000,224, issued October 14, 1980.

Typical cationic fabric softening components include water-insoluble quaternary-ammonium fabric softening actives or their corresponding amine precursors and the most commonly used components are di-long chain alkyl ammonium chloride or methyl sulfate.

Preferred cationic softeners among these include the following compounds:

1) ditallow dimethylammonium chloride (DTDMAC);

2) dihydrogenated tallow dimethylammonium chloride;

3) dihydrogenated tallow dimethylammonium methylsulfate;

4) distearyl dimethylammonium chloride;

5) dioleyl dimethylammonium chloride;

6) dipalmityl hydroxyethyl methylammonium chloride;

7) stearyl benzyl dimethylammonium chloride;

8) tallow trimethylammonium chloride;

9) hydrogenated tallow trimethylammonium chloride;

10) C _12-14 alkyl hydroxyethyl dimethylammonium chloride;

11) C _12-18 alkyl dihydroxyethyl methylammonium chloride;

12) di (stearoyloxyethyl) dimethylammonium chloride (DSOEDMAC);

13) di (tallow-oxy-ethyl) dimethylammonium chloride;

14) ditallow imidazolinium methylsulfate;

15) 1- (2-tallowylamidoethyl) -2-tallowyl imidazolinium methyl sulfate.

Biodegradable quaternary ammonium compounds are provided as substitutes for the commonly used di-long chain alkyl ammonium chlorides and methyl sulfates. The quaternary ammonium compound includes long chain alk (en) yl groups blocked by functional groups such as carboxy groups. Such materials and fabric softening compositions comprising these materials are described in numerous publications (eg EP-A-0,040,562, EP-A-0,239,910).

Quaternary ammonium compounds and amine precursors herein are compounds of Formula 1 or 2:

In the above formula,

Q is selected from —OC (O) —, —C (O) —O—, —OC (O) —O—, —NR ⁴ —C (O) —, —C (O) —NR ⁴ —;

R ¹ is (CH ₂ ) _n -QT ² or T ³ ;

R ² is (CH ₂ ) _m -QT ⁴ or T ⁵ or R ³ ;

R ³ is C ₁ -C ₄ alkyl or C ₁ -C ₄ -hydroxyalkyl or H;

R ⁴ is H or C ₁ -C ₄ alkyl or C ₁ -C ₄ hydroxyalkyl;

T ¹ , T ² , T ³ , T ⁴ and T ⁵ are independently C ₁₁ -C ₂₂ alkyl or alkenyl;

n and m are integers from 1 to 4;

X ⁻ is a softener-miscible anion.

For example, non-limiting softener-compatible anions include chloride or methyl sulfate.

The alkyl or alkenyl chains T ¹ , T ² , T ³ , T ⁴ and T ⁵ must contain at least 11 carbon atoms, preferably at least 16 carbon atoms. The chain may be straight or branched. Tallow is a simple and inexpensive source of long chain alkyl and alkenyl materials. Particular preference is given to compounds in which T ¹ , T ² , T ³ , T ⁴ and T ⁵ are mixtures of long chain materials typical for tallow.

Specific examples of quaternary ammonium compounds suitable for use in the aqueous textile softening compositions herein include the following compounds:

1) N, N-di (tallowyl-oxy-ethyl) -N, N-dimethyl ammonium chloride;

2) N, N-di (tallowyl-oxy-ethyl) -N-methyl, N- (2-hydroxyethyl) ammonium methyl sulfate;

3) N, N-di (2-tallowyl-oxy-2-oxo-ethyl) -N, N-dimethyl ammonium chloride;

4) N, N-di (2-tallowyl-oxy-ethylcarbonyl-oxy-ethyl) -N, N-dimethyl ammonium chloride;

5) N- (2-tallowyl-oxy-2-ethyl) -N- (2-tallowyl-oxy-2-oxo-ethyl) -N, N-dimethyl ammonium chloride;

6) N, N, N-tri (tallowyl-oxy-ethyl) -N-methyl ammonium chloride;

7) N- (2-tallowyl-oxy-2-oxo-ethyl) -N- (tallowyl-N.N-dimethyl-ammonium chloride;

8) 1,2-ditalylyl-oxy-3-trimethylammonoprovane chloride; And mixtures of any of the above.

When included herein, the laundry detergent compositions of the present invention typically contain from 0.2% to about 25% by weight, preferably from about 1% to about 8% by weight cationic surfactant.

Conventional detergent enzymes

The laundry detergent composition preferably contains not only saccharide gum degrading enzyme but also one or more enzymes, preferably cellulase and / or amylase, which provide cleaning performance, fabric protection and / or sanitary benefits.

Surprisingly, the laundry detergent compositions of the present invention, which further contain another enzyme, in particular cellulase and / or amylase, have been found to promote food stain / dirt removal, dirty cleaning and whiteness retention. In particular, it has been found that cellulose degrading enzymes are useful for degrading cellulose polysaccharide food additives and thus cleaning food stains / dirts from cotton fabrics.

Without being bound by theory, the improved performance is due to the combined enzymatic hydrolysis of cellulase enzymes acting on cotton fabric supports and saccharide degrading enzymes acting on polysaccharides that deposit stains on cotton fabric supports. It is considered to be. Similarly, the combined action of amylase acting on the starch based processing agent covering the surface of the cotton fabric and the saccharide degrading enzyme acting on the polysaccharides that adhere the dirt to the cotton fabric enhances performance.

The enzymes include cellulase, hemicellase, peroxidase, protease, glucoamylase, amylase, xylanase, lipase, phospholipase, esterase, cutinase, pectinase, keratanase, reductase , Oxidase, phenol oxidase, lipoxygenase, ligninase, pullulanase, tanase, pentosanase, β-glucanase, arabinosidase, hyaluronidase, chondroitinase, laca Enzymes selected from the agent or combinations thereof.

Cellulase useful in the present invention includes both bacterial or fungal cellases. Preferably they have a pH optimum of 5 to 12 and a specific activity of 50 CEVU / mg (cellulose viscosity units). Suitable cellulases are produced from US Pat. No. 4,435,307, J61078384 to Barbesgoard et al., And Humicola insolens, Trichoderma, Thielvia and Sporotrichum, respectively. It is described in WO96 / 02653 which describes fungal cellulase. EP 739 982 describes cellulase isolated from novel Bacillus species. Suitable cellulases are also described in GB-A-2,075,028, GB-A-2,095,275, DE-OS-2,247,832 and WO95 / 26398.

An example of such cellulase is a cellulase produced by a strain of Humicola insolene (Humicola grisea var. Thermoidea), in particular Humicola strain DSM 1800.

Still other suitable cellulases are cellulase consisting of 415 amino acids with a molecular weight of about 50 KDa and an isoelectric point of 5.5 and 43 kD endoglucanase originating from Humicola insolen DSM 1800, which are derived from Humicola insolene and are preferred. Endoglucanase is disclosed in PCT Patent Application No. Amino acid sequence as described in WO 91/17243. Also suitable cellulases are EGIII cellulases of Trichoderma longgibrachytum origin as described in WO94 / 21801, Genencor, Published September 29, 1994. Particularly suitable cellulases are those that have color protection benefits. Examples of such cellulases are described in European patent application No. 91202879.2 filed November 6, 1991 (Novo). Carezyme and Celluzyme (Novo Nordisk A / S) are particularly useful (WO91 / 17244 and WO91 / 21801). Another suitable cellulase for fabric protection and / or cleaning properties is described in WO 96/34092, WO96 / 17994 and WO95 / 24471.

The cellulase is generally incorporated into the detergent composition in a detergent composition at a concentration of 0.0001% to 2% pure enzyme.

Amylases (α and / or β) may be included to remove carbohydrate stains. WO 94/02597, Novo Nordisk A / S published February 03, 1994 describes cleaning compositions incorporating mutant amylase [WO 95/10603, Novo Nordisk A / S published April 20, 1995]. ]. Another amylase known for use in the cleaning composition includes both α-amylase and β-amylase. α-amylases are known in the art and described in US Pat. No 5,003,257, EP 252,666, WO / 91/08353, FR 2,676,456, EP 285,123, EP 525,610, EP 368,341 and British Patent specification No. 1,296,839 (Novo). Still other suitable amylases have been described in the enhanced amylase and literature described in WO94 / 18314, published August 18, 1994 and WO96 / 05295, Genencor, published February 22, 1996. WO95 / 10603, published April 95 is an amylase variant with additional modifications to the directly related parent marketed by Novo Nordisk A / S.

Examples of commercially available α-amylase products are Purafect Ox Am ^R from Genencor and Termamyl ^R , Ban ^R , Fungamyl ^R and Duramyl ^R from Novo Nordisk A / S Denmark. WO95 / 26397 is another suitable amylase, i.e., at least 25% higher than the inactivation of Termamyl ^R in the temperature range of 25 ° C. to 55 ° C. and the pH value range of 8 to 10 as measured by the Phadebas ^R α-amylase activity assay. Α-amylase with Variants of this enzyme described in WO96 / 23873 (Novo Nordisk) are suitable. Another amylose degrading enzyme having improved properties for activity levels and combined thermal stability and higher activity levels is described in WO95 / 35382.

Amylose degrading enzyme is incorporated into the detergent composition of the present invention as a pure enzyme at a concentration of 0.0001% to 2%, preferably 0.00018% to 0.06%, more preferably 0.00024% to 0.048% in the detergent composition of the present invention.

Preferred combinations are laundry detergent compositions having a cocktail of commonly applied enzymes of the protease, amylase, lipase, cutinase and / or cellulase family associated with one or more plant wall degrading enzymes.

Peroxidase enzymes are used in combination with phenolic substrates as oxygen sources, such as percarbonates, perborates, persulfates and hydrogen peroxide, and as bleaching elongation molecules. These are used to prevent the "solution bleaching", for example, the migration of dyes or pigments removed from a substrate to another substrate during the washing process. Peroxidase enzymes are known in the art and include, for example, horseradish peroxidase, riginase and haloperoxidases such as chloro- and bromo-peroxidase. Peroxidase-containing detergent compositions are described, for example, in PCT International Application WO 89/099813, WO089 / 09813, European Patent application EP No 91202882.6 filed on November 6, 1991 and EP No 96870013.8 filed February 20 1996. It is. Also suitable are laccase enzymes.

Enhancers are contained at concentrations of 0.1% to 5% by weight based on the total composition. Preferred brighteners are substituted penthiazine and phenoxasine 10-phenopazinepropionic acid (PPT), 10-ethylphenothiazine-4-carboxylic acid (EPC), 10-phenozinpropionic acid (POP) and 10-methylphenoazine ( As described in WO94 / 12621) and substituted syringes (C ₃ -C ₅ substituted alkyl syringes) and phenols. Sodium percarbonate or sodium perborate is a preferred source of hydrogen peroxide.

The peroxidase is generally incorporated into the detergent composition as a pure enzyme at a concentration of 0.0001% to 2% by weight in the detergent composition.

Another preferred enzyme that may be included in the detergent composition of the present invention includes a lipase. Lipase enzymes suitable for use in detergents include lipase enzymes produced by microorganisms of the Pseudomonas group (eg, Pseudomonas stutzeri ATCC 19.154), as described in British Patent No. 1,372,034. Suitable lipases include lipases that exhibit an immunologically positive cross-reaction with the antibodies of lipase produced by Pseudomonas leuorogenic IAM 1057 microorganisms. Such pyrazes are manufactured by Amano Pharmaceutical Co. under the trade name Lipase P "Amano", hereinafter referred to as "Amino-P". Ltd., Nagoya, Japan]. Another suitable commercial lipase is Amano-CES, manufactured by Toyo Jozo Co., Tagata. Japan, Chromobacter viscosum, for example Chromobacter viscosum var. lipases of lipolyticum NRRLB 3673, and chromases of Pseudomonas gladioli origin, Chromobacter biskosum lipase, commercially available from US Biochemical Corp., USA and Disoynth Co., The Netherland. Particularly suitable lipases are lipases such as M1 lipase ^R and Lipomax ^R (Gist-Brocades) and Lipolase ^R and Lipolase Ultre ^R (Novo) which have been found to be very effective when used in combination with the compositions of the present invention. Also suitable are lipolytic enzymes described in references EP 258068, WO 92/05249 and WO 95/22615 by Novo Nordisk and WO 94/03578, WO 95/35381 and WO 96/00292 by Unilever.

Also suitable are cutinases [EC 3.3.1.50], which can be regarded as lipases of a certain kind, ie lipases that do not require interfacial activation. Addition of cutinase to the detergent composition is described in WO-A-88 / 09367 (Genencor); WO 90/09446 to Plant Genetic System and WO 94/14963 and WO 94/14964 (Unilever).

Lipase and / or cutinase are typically incorporated into the detergent composition at a level of 0.0001% to 2% pure enzyme by weight of the detergent composition.

Suitable proteases are non. B. subtilis and b. Subtilsin (subtylsin BPN and BPN ') obtained from certain strains of B.licheniformis. One suitable protease is Bacillus, which has a maximum activity in the range of pH 8-12, developed by the Danish NOVO industry (hereinafter referred to as "Novo") and sold under the trade name Esperase ^R (ESPERASE). ) Is obtained from the strain. The production of this and cognate enzymes is described in Novo's GB 1,243,784. Other suitable proteases Novo's Alcala the ^R (ALCALASE), dura load ^R (DURAZYM) and Sabina the ^R (SAVINASE) and Geest-Broca des ^R (Gist-Brocades)'s barracks hydratase ^R (MAXATASE), barracks knife there may be mentioned ^R (MAXACAL), Pro Blow the ^R (PROPERASE) and barracks Femtocell ^R (MAXAPEM) (protein operation the knife barracks). Proteolytic enzymes also include modified bacterial serine proteases, such as those described in European Patent Application No. 87 303761.8 (particularly pages 17, 24 and 98), filed April 28, 1987 (hereinafter “Protease B”). And those described in European Patent Application No. 199.404 to Venegas, published October 29, 1986 (modified bacterial serine protease referred to herein as “protease A”). ). Proteases referred to herein as “protease C” are suitable, such as lysine arginine at position 27, tyrosine valine at position 104, serine asparagine at position 123, alanine threonine at position 274, It is a variant of alkaline serine protease of Bacillus origin. Protease C is described in EP 90915958.4 published May 16, 1991 in the corresponding application of WO 91/06637. In particular, genetically modified variants of protease C are also included herein.

Preferred proteases referred to as “protease D” are variants of carbonyl hydrolases having amino acid sequences that are not found naturally, and are disclosed in WO 95/10591 and October 13, 1994 in precursor carbonyl hydrolases. A position corresponding to +76, preferably according to the numbering of Bacillus amyloliquefaciens subtilisin described in "Bleaching Compositions Containing Protease Enzymes" of US Application No. 08 / 322.677 to Ghosh et al. +99, +101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204 Multiple amino acid residues in combination with one or more amino acid residues at the same position as those selected from the group consisting of: +206, +210, +216, +217, +218, +222, +260, +265 and / or +274 Is obtained from the precursor carbonyl hydrolase by replacing with different amino acids. Also at least one of the following residues in the precursor enzyme: +33, +62, +67, +76, +100, +101, +103, +104, +107, +128, +129, +130, +132, +135 The amino acid residue at the position corresponding to the position +210 along with +156, +158, +164, +166, +167, +170, +209, +215, +217, +218 and +222 Preferred are variants of the carbonyl hydrolase of the protease described in WO 95.10591, having an amino acid sequence derived by replacement with a subtilisin naturally occurring in Bacillus amyloliquefaciene. Corresponding amino acid residues of other carbonyl hydrolase or subtilisin, for example Bacillus lentus subtilisin (co-pending US application No. 60 / 048,550, filed June 4, 1997).

Also suitable herein are the proteases described in patent applications EP 251 446 and WO 91/06637, the proteases BLAP ^R described in WO 91/02792 and variants thereof described in WO 95/23221.

(See high pH protease from Bacillus sp. NCIMB 40338 described in WO 93/18140 A of Novo). Enzymatic detergents comprising proteases, one or more other enzymes and reversible protease inhibitors are described in WO 92 / 03529A from Novo. If desired, proteases with reduced water absorption and increased hydrolyzability described in WO 95/07791 by Procter & Gamble may be used. Recombinant trypsin-type proteases suitable for detergents herein are described in WO 94/25583 from Novo. Other suitable proteases are described in EP 516 200 from Unilever.

Proteolytic enzymes are incorporated into the detergent compositions herein at 0.0001% to 2% pure enzyme, preferably 0.001% to 0.2%, more preferably 0.005% to 0.1% by weight of the composition.

The enzyme may be of any suitable origin, for example of plant, animal, bacterial, fungal and yeast origin. The origin can also be mesophilic or polar (cooling, thermophilic, thermophilic, basophilic, basophilic, eosinophil, basophilic, etc.). Purified or non-purified forms of such enzymes can be used. Nowadays, it is common practice to modify wild type enzymes with protein / genetic engineering techniques to optimize their performance efficiency in the inventive cleaning compositions. For example, variants may be devised to enhance the miscibility of components and enzymes commonly added to such compositions. On the one hand, variants can be devised to manipulate the optimum pH, bleach or chelant stability, catalytic activity, etc. of the enzyme variant to suit particular cleaning applications.

In particular, in the case of bleaching stability, the focus should be on the surface charge for oxidation sensitive amino acid and surfactant miscibility. The isoelectric point of such enzymes can be changed by substituting with some charged amino acids, for example, increasing the isoelectric point can help increase miscibility with anionic surfactants. The stability of the enzyme can also be enhanced, for example, by creating additional salt bridges or by creating enhanced calcium binding sites to increase Kelant stability. Particular attention should be paid to cellulase because most cellulase have a separate binding domain (CBD). These domains can be altered to change the properties of these enzymes.

Generally, the enzyme is incorporated into the detergent composition at 0.0001% to 2% pure enzyme by weight of the detergent composition. Such enzymes may be added as separate single components (prills, granules, stabilized liquids, etc. comprising one enzyme) or as two or more mixed enzymes (eg co-granules).

Another suitable detergent component that may be added is the enzymatic oxidation scavenger described in co-pending European patent application No. 92870018.6, filed January 31, 1992. Examples of such enzymatic oxidation scavengers include ethoxylated tetraethylene polyamines.

The scope of enzyme preparations and methods of incorporating them into synthetic detergent compositions are also described in international applications WO 9307263 A and WO 9307260 A by Genencor, WO 8908694 A by Novo and McCarty et al. US 3,553,139 (1971.1.5) It is described in Enzymes are also described in Place et al. US 4,101,457 (1978.7.18) and Hughes US 4,261,868 (March 26, 1985). Enzyme materials useful for formulating liquid detergents and incorporating them in such formulations are described in US Pat. No. 4,261,868 (1981.4.14) to Hora et al. Enzymes for use in detergents can be stabilized by a variety of techniques. Enzyme stabilization techniques are described and illustrated in US 3,600,319 (August 17, 1971) in Gedge, EP 199,405 and EP 200,586 (October 29, 1986) in Venegas et al. Enzyme stabilization systems are also described, for example, in U.S. 3,519,570. A useful bacillus species, AC13, which provides proteases, xylanases and cellulases, is described in WO 9401532 A by Novo.

bleach

It has been surprisingly found that the laundry detergent compositions of the present invention further comprising bleach, in particular bleach activator bleach systems, promote food stain / dirt removal, dirty cleaning and whiteness retention. Without wishing to be bound by theory, it is believed that smaller chromophore particles produced by hydrolytic action of hydrolysis of saccharide gumases can be more readily acted upon by bleach-activated bleaching systems, especially at low temperatures.

Another optional detergent component that may be included in the laundry detergent composition of the present invention is bleach such as hydrogen peroxide, PB1, PB4 and percarbonate having a particle size of 400 to 800 microns.

Such bleach components may include one or more oxygen bleaches and one or more bleach activators, depending on the bleach selected. When present, the oxygen bleach compound is typically present at about 1% to about 25%.

The bleach component for use herein may be any bleach useful in laundry detergent compositions including oxygen bleach as well as others known in the art. Bleaches suitable for the present invention may be activated or inactivated bleaches.

One type of oxygen bleach that can be used includes percarboxylic acid bleach and salts thereof. Suitable examples of such bleaches are magnesium monoperoxyphthalate hexahydrate, magnesium salts of meta-chloro perbenzoic acid, 4-nonylamino-4-oxopoxybutyric acid and diperoxydodecanedioic acid. Such bleaches are described in US Pat. No. 4,483,781, US Pat. No. 740,446, European Patent Application No. 0,133,354 and US Pat. No. 4,412,934. Also highly preferred bleaches include the 6-nonylamino-6-oxoperoxycaproic acid described in US Pat. No. 4,634,551.

Another type of bleach that can be used is halogen bleach. Examples of hypohalite bleaches are, for example, trichlorocyanuric acid and sodium and potassium dichloroisocyanurate and N-chloro and N-bromo alkanesulfonamides. Such materials are usually added at 0.5-10%, preferably 1-5%, of the final product weight.

Bleach activators such as tetraacetylethylenediamine (TAED), nonanoyloxybenzene-sulfonate (NOBS, described in US 4,412,934), 3,5-trimethylhexanoloxybenzenesulfonate (ISONOBS, EP 120,591) Hydrogen peroxide releasing agent can be used in conjunction with or) pentaacetylglucose (PAG) or N-nonanoyl-6-aminocaproic acid (NACA-OBS, disclosed in WO 94/28106), As an active bleach, peracids are formed to increase the bleaching effect. Suitable activators also include, for example, the acylated citrate esters disclosed in co-pending European patent application No. 91870207.7 and the pending patent applications US 60 / 022,786 (filed at 16.7.30) and 60 by Procter & Gamble. There is an asymmetric acyclic imide bleach activator having the structure shown in / 028,122 (filed Oct. 15, 1996).

In the above,

R ₁ is a C ₇ to C ₁₃ straight or branched chain saturated or unsaturated alkyl group,

R ₂ is a C ₁ to C ₈ straight or branched chain saturated or unsaturated alkyl group,

R ₃ is a C ₁ to C ₄ straight or branched chain saturated or unsaturated alkyl group.

Useful bleaching agents comprising a bleaching system comprising a peroxy acid and a bleach activator and a peroxygen bleach compound for use in the detergent composition according to the invention are co-pending application Nos. USSN 08 / 136,626, PCT / US95 / 07823, WO 95 / 27772, WO 95/27773, WO 95/27774 and WO 95/27775.

Enzymatic hydrogen peroxide may also be present by adding an enzyme system (ie, enzyme and its substrate) that can produce hydrogen peroxide early or during the wash and / or rinse process. Such an enzyme system is described in European patent application 91202655.6, filed October 9, 1991.

Metal-containing catalysts for use in bleach compositions include cobalt-containing catalysts such as pentaamine acetate cobalt (III) salts and manganese containing catalysts such as EPA 549 271, EPA 549 272, EPA 458 397, US 5,246,621, And those described in EPA 458 398, US 5,194,416 and US 5,114,611. Bleaching compositions comprising peroxy compounds, manganese-containing bleach catalysts and chelating agents are described in patent application 94870206.3.

Bleaches other than oxygen bleaches are also known and can be used herein. One type of non-oxygen bleach that is of particular interest includes photoactivated bleaches such as sulfonated zinc and / or aluminum phthalocyanine. Such materials may be deposited on the substrate during the washing process. When irradiated with light, such as drying clothing to sunlight in the presence of oxygen, sulfonated zinc phthalocyanine is activated, resulting in bleaching of the substrate. Preferred zinc phthalocyanine and photoactivated bleaching procedures are described in US Pat. No. 4,033,718. Typically, the detergent composition contains about 0.025% to about 1.25% by weight of sulfonated zinc phthalocyanine.

Builder system

The laundry detergent composition of the present invention preferably comprises a builder, more preferably an inorganic builder, most preferably zeolite A, layered silicates and / or sodium tripolyphosphate. It has been surprisingly found that the laundry detergent compositions of the present invention further comprising builders promote food stain / dirt removal, dirty cleaning and whiteness retention. Without wishing to be bound by theory, it is believed that saccharide gums can trap calcium and limit the hydrolysis of enzymes. Thus, builders are expected to remove trapped calcium and improve the action of saccharide degradation enzymes.

Any conventional builder system includes aluminosilicate materials, silicates, polycarboxylates, alkyl- or alkenyl-succinic acids and materials such as fatty acids, for example ethylenediamine tetraacetate, diethylene triamine pentamethylene acetate, metal ion sequestration Agents, for example aminopolyphosphonates, in particular ethylenediamine tetramethylene phosphonic acid and diethylene triamine pentamethylenephosphonic acid, suitable for use herein. Phosphate builders can also be used herein.

Suitable builders can be inorganic ion exchange materials, typically inorganic hydrated aluminosilicate materials, more particularly hydrated synthetic zeolites such as hydrated zeolites A, X, B, HS or MAP.

Another suitable inorganic builder material is laminated silicates, for example SKS-6 (Hoechst). SKS-6 is a crystalline laminated silicate consisting of sodium silicate (Na ₂ Si ₂ O ₅ ).

Suitable polycarboxylates comprising one carboxy group include lactic acid, glycolic acid and ether derivatives thereof described in Belgian patents 831.368, 821.369 and 821.370. Polycarboxylates comprising two carboxy groups include water soluble salts of succinic acid, malonic acid, (ethylenedioxy) diacetic acid, maleic acid, diglycolic acid, tartaric acid, tartronic acid and fumaric acid, as well as in German Laid-Open Publication Nos. 2,446,686 and Ether carboxylates described in US Pat. No. 2,446,687 and US Pat. No. 3,935,257 and sulfinyl carboxylates described in Belgian Patent 840,623. Particularly polycarboxylates comprising three carboxy groups include water-soluble citrate, aconitrate and citraconate as well as succinate derivatives such as carboxymethyloxysuccinate described in British Patent No. 1,379,241, Dutch Patent Application No. 7205873 Oxypolycarboxylate materials such as lactic oxysuccinate described in the following and 2-oxa-1,1,3-propane tricarboxylate described in British Patent No. 1,387,447.

Polycarboxylates comprising four carboxy groups include oxydisuccinates described in British Patent No. 1,261,829, 1,1,2,2-ethane tetracarboxylate, 1,1,3,3-propane tetracarboxylate and 1,1,2,3-propane tetracarboxylate. Polycarboxylates comprising sulfo substituents include the sulfosuccinate derivatives described in UK Pat. Nos. 1,398,421 and 1,398,422 and US Pat. No. 3,936,448, and the sulfonated pyrroled citrate described in UK Pat. No. 1,082,179. And polycarboxylates comprising phosphone substituents are described in British Patent No. 1,439,000.

Alicyclic and heterocyclic polycarboxylates include cyclopentane cis, cis, cis-tetracarboxylate, cyclopentadienide pentacarboxylate, 2,3,4,5-tetrahydro-furan, -cis, cis, cis -Tetracarboxylate, 2,5-tetrahydro-furan, -cis-dicarboxylate, 2,2,5,5-tetrahydrofuran-tetracarboxylate, 1,2,3,4,5,6-hexane Hexacarboxylates and carboxymethyl derivatives of polyhydric alcohols such as sorbitol, mannitol and xylitol. Aromatic poly-carboxylates include the melic acid, pyromellitic acid and phthalic acid derivatives described in British Patent No. 1,425,343.

Among them, preferred polycarboxylates are hydroxycarboxylates, more particularly citrate, comprising up to three carboxy groups per molecule.

Preferred builder systems for use in the present compositions include water soluble aluminosilicate builders such as zeolite A or laminated silicates (SKS-6), and mixtures of water soluble carboxylate chelating agents such as citric acid. Other preferred builder systems include water insoluble aluminosilicate builders such as zeolite A and water soluble carboxylate chelating agents such as citric acid. Preferred builder systems for use in the liquid detergent compositions of the present invention are soaps and polycarboxylates.

Other builder materials that may form part of a builder system for use in granular compositions include inorganic materials such as alkali metal carbonates, bicarbonates, silicates and organic materials such as organic phosphonates, amino polyalkylene phosphates Phosphates and amino polycarboxylates.

Other suitable water soluble organic salts are mono- or co-polymeric acids or salts thereof, wherein the polycarboxylic acid comprises at least two carboxyl radicals separated from each other by up to two carbon atoms. Polymers of this type are described in GB-A-1,596,756. Examples of such salts are polyacrylates of molecular weight 2000 to 5000 and maleic anhydride and copolymers thereof, for example copolymers having a molecular weight of 20,000 to 70,000, in particular about 40,000.

Detergent builder salts are usually included in amounts of 5% to 80%, preferably 10% to 70%, most typically 30% to 60% by weight of the composition.

Other surfactant systems

Laundry detergent compositions of the invention may also include cationic, amphoteric, zwitterionic and semipolar surfactants, as well as nonionic and / or anionic surfactants, other than those already described herein.

Amphoteric surfactants are also suitable for use in the laundry detergent compositions of the present invention. Such surfactants may also be broadly referred to as aliphatic derivatives of secondary or tertiary amines, or aliphatic derivatives of heterocyclic secondary and tertiary amines in which the aliphatic radical may be straight or branched. One of the aliphatic substituents contains at least about 8 carbon atoms, typically about 8 to about 18 carbon atoms, and at least one includes an anionic water soluble group such as carboxy, sulfonate, sulfate (from the amphoteric surfactant See, eg, US Pat. No. 3,929,678, column 19, lines 18-35, published by Laughlin et al., December 30, 1975).

When included herein, laundry detergent compositions of the present invention generally comprise from 0.2% to about 15% by weight of the amphoteric surfactant, preferably from about 1% to about 10% by weight.

Zwitterionic surfactants are also suitable for use in laundry detergent compositions. Such surfactants can be broadly described as secondary and tertiary amine derivatives, derivatives of heterocyclic secondary and tertiary amines or derivatives of quaternary ammonium, quaternary phosphonium or tertiary sulfonium compounds (Zwitter Examples of warm surfactants are described in U.S. Patent Nos. 3,929,678, 19, column 38 to 22, column 35 of Raulin et al., Registered December 30, 1975).

When included herein, laundry detergent compositions of the present invention generally comprise from 0.2% to about 15% by weight of the zwitterionic surfactant, preferably from about 1% to about 10% by weight.

The semipolar nonionic surfactant has two moieties selected from the group consisting of one alkyl moiety having from about 10 to about 18 carbon atoms and an alkyl group and a hydroxyalkyl group containing from about 1 to about 3 carbon atoms: about carbon number One alkyl moiety having from 10 to about 18 and two moieties selected from the group consisting of an alkyl group having from about 1 to about 3 carbon atoms and a hydroxyalkyl group: and one alkyl moiety having from about 10 to about 18 carbon atoms and about carbon atoms A particular class of nonionic surfactants comprising water soluble amine oxides comprising residues selected from the group comprising alkyl and hydroxyalkyl residues having from 1 to about 3.

Semipolar nonionic detergent surfactants include amine oxide surfactants having the general formula:

In the above,

R ³ is an alkyl, hydroxyalkyl, or alkyl phenyl group comprising about 8 to about 22 carbon atoms or mixtures thereof;

R ⁴ is an alkenyl or hydroxyalkenyl group having from about 2 to about 3 carbon atoms or a mixture thereof;

x is 0 to about 3;

Each R ⁵ is an alkyl or hydroxyalkyl group comprising about 1 to about 3 carbon atoms or a polyethylene oxide group comprising about 1 to about 3 ethylene oxide groups. R <^5> can form a ring structure by attaching, for example through oxygen or a nitrogen atom, respectively.

In particular these amine oxide surfactants include C ₁₀ to C ₁₈ alkyl dimethyl amine oxides and C ₈ to C ₁₂ alkoxy ethyl dihydroxy ethyl amine oxides.

When included herein, the cleaning compositions of the present invention generally comprise from 0.2% to about 15% by weight of the semi-polar nonionic surfactant, preferably from about 1% to about 10% by weight.

Laundry detergent compositions of the present invention may also comprise a cosurfactant selected from primary or tertiary amine groups. Suitable primary amines for use herein are amines according to formula R ₁ NH 2, wherein R ₁ is C ₆ to C ₁₂ , preferably C ₆ to C ₁₀ alkyl chain or R ₄ X (CH ₂ ) _n (wherein X is —O—, —C (O) NH— or —NH—, R ₄ is a C ₆ to C ₁₂ alkyl chain, n is 1 to 5, preferably 3). The R ₁ alkyl chain can be straight or branched and up to 12, preferably up to 5 ethylene oxide residues can be introduced. Preferred amines according to the above formula are n-alkyl amines. Suitable amines that may be used herein may be selected from 1-hexylamine, 1-octylamine, 1-decylamine and laurylamine. Other preferred primary amines include C ₈ to C ₁₀ oxypropylamine, octyloxypropylamine, 2-ethylhexyl-oxypropylamine, lauryl amido propylamine and amido propylamine.

Suitable tertiary amines for use herein include tertiary amines having the formula R ₁ R ₂ R ₃ N. Wherein R ₁ and R ₂ are C ₁ to C ₈ alkyl R ₃ is C ₆ to C ₁₂ , preferably C ₆ to C ₁₀ alkyl chain or R ₃ is one of R ₄ X (CH ₂ ) _n , wherein X is -O-, -C (O) NH- or —NH—, R ₄ is C ₄ to C ₁₂ , n is 1 to 5, preferably 2 to 3) R ₅ is H or C ₁ -C ₂ alkyl and x is 1 to 6 . R ₃ and R ₄ may be straight or branched; The R ₃ alkyl chain may be blocked with up to 12, preferably up to 5 ethylene oxide residues.

Preferred tertiary amines are R ₁ R ₂ R ₃ N wherein R ₁ is a C ₆ to C ₁₂ alkyl chain, R ₂ and R ₃ are C ₁ to C ₃ alkyl or (Wherein R ₅ is H or CH ₃ and x is 1 to 2).

Also preferred are amidoamines of the general formula

Wherein R ₁ is C ₆ to C ₁₂ alkyl; n is 2 to 4, preferably n is 3;

R ₂ and R ₃ are C ₁ to C ₄ .

Most preferred amines of the present invention include 1-octylamine, 1-hexylamine, 1-decylamine, 1-dodecylamine, C ₈ to C ₁₀ oxypropylamine, N coco 1-3 diaminopropane, coconutalkyldimethylamine , Lauryldimethylamine, lauryl bis- (hydroxyethyl) amine, coco bis (hydroxyethyl) amine, 2 moles propoxylated lauryl amine, 2 moles propoxylated octyl amine, lauryl amidopropyl Dimethylamine, C ₈ to C ₁₀ amidopropyldimethylamine and C ₁₀ amidopropyldimethylamine.

Most preferred amines for use in the compositions herein are 1-hexylamine, 1-octylamine, 1-decylamine, 1-dodecylamine. Particular preference is given to n-dodecyldimethylamine and bishydroxyethylcoconutalkylamine and oleylamine 7-fold ethoxylated lauryl amido propylamine and cocoamido propylamine.

Color protection and fabric protection gain

Techniques that provide some sort of color protection benefit can also be introduced. Examples of such techniques include metal catalysts for color retention. Such metal catalysts are described in pending European patent application 92870181.2. Dye fasteners, polyolefin dispersants for anti-wrinkle and enhanced water absorption, fragrance and amino-functional polymers for color protection treatment and fragrance permanence are also examples of color protection / fabric protection technology and pending patent application 96870140.9 (1996.11.7) Filed).

Fabric softeners may also be incorporated into laundry detergent compositions with the present invention. Such agents may be of inorganic or organic type. Inorganic softeners are exemplified by smectite muds disclosed in GB-A 1 400 898 and USP 5,019,292. Organic fabric softeners include the water soluble tertiary amines disclosed in GB-A1 514 276 and EP-B0 011 340, and C ₁₂ to C ₁₄ quaternary ammonium salts and combinations thereof in EP-B-0 260 527 and EP-B Di long chain amides described in -0 026 528 and also described in EP-B-0 242 919 are also included. Other useful organic components of fabric softening systems include the high molecular weight polyethylene oxide materials disclosed in EP-A-0 299 575 and 0 313 146.

While the amount of smectite clay is added to the remaining components of the formulation as a dry blending component, the amount is usually 2% to 20% by weight, more preferably 5% to 15% by weight. While adding a high molecular weight polyethylene oxide material and a water soluble cationic material at 0.1% to 2%, usually 0.15% to 1.5% by weight, the organic fabric softener such as water-insoluble tertiary amine or di long chain amide material is 0.5% by weight. % To 5% by weight, usually 1% to 3% by weight. In some cases it may be more convenient to add the materials as dry mixed particles or to spray on other solid components of the composition with a melt, but they are usually added to the spray drying component of the composition.

Chelating agent

Laundry detergent compositions herein may also optionally include one or more iron and / or manganese chelating agents. Such chelating agents can be selected from the group consisting of aminocarboxylates, aminophosphonates, polyfunctional substituted aromatic chelating agents and mixtures thereof as defined below. Without wishing to be bound by theory, it is believed that the benefit of these materials is due to their unexpected activity of removing iron or manganese ions from the wash solution by forming water soluble chelates.

Amino carboxylates useful as any chelating agent include ethylenediaminetetraacetate, N-hydroxyethylethylenediaminetriacetate, nitrilotriacetate, ethylenediamine tetrapropionate, triethylenetetraamine-hexaacetate, diethylenetriaminepentaacetate And ethanol diglycine, alkali metals thereof, ammonium and substituted ammonium salts, and mixtures thereof.

If at least the minimum concentration of total phosphorus is incorporated into the detergent composition, amino phosphate is also suitable for use as a chelating agent of the composition of the present invention, which includes ethylenediaminetetrakis (methylenephosphonate) as DEQUEST. Preferably these amino phosphates do not comprise alkyl or alkenyl groups having at least about 6 carbon atoms.

Multifunctionally substituted aromatic chelating agents are also useful in the compositions herein (see US Pat. No. 3,812,044, filed May 21, 1974 to Connor et al.). Preferred compounds of this type in acid form are dihydroxydisulfobenzenes such as 1,2-dihydroxy-3,5-disulfobenzene.

Preferred biodegradable chelating agents for use herein include ethylenediamine disuccinate (“EDDS”), in particular the [S, S,] isomer disclosed in US Pat. No. 4,704,233 to Hartman and Perkins.

The compositions herein may also include a water soluble methyl glycine diacetic acid (MDGA) salt as a chelant or co-builder useful with, for example, insoluble builders such as zeolites, laminated silicates and the like.

If used, these chelating agents will generally comprise from 0.1% to about 15% by weight of the detergent compositions herein. If more preferably used, these chelating agents comprise from about 0.1% to about 3.0% by weight of such a composition.

Foam inhibitor

Another optional ingredient is a foam inhibitor and is, for example, a silicone and silica-silicon mixture. Silica is usually used in subdivided forms such as silica aerogels and xerogels and various forms of hydrophobic silicas, while silicones are typically represented by alkylated polysiloxane materials. Advantageously, the foam inhibitor can incorporate these materials into particles that are detachably soluble or water-dispersible, and incorporated into a substantially non-surfactant detergent impermeable carrier. On the other hand, the foam inhibitor can be dissolved or dispersed in the liquid, or can be introduced by spraying on one or more other components.

Preferred silicone foam modifiers are disclosed in US Pat. No. 3 933 672 to Bartollota et al. Another particularly advantageous foam inhibitor is the self emulsifying silicone foam inhibitor disclosed in German patent application DTOS 2 646 126 (published April 28, 1977). One example of such a compound is the commercial DC-544 from Dow Corning, which is a siloxane-glycol copolymer. Particularly preferred foam control agents are foam inhibitor systems comprising silicone oil and 2-alkyl-alkanols. Suitable 2-alkyl-alkanols are 2-butyl-octanol, sold under the trade name Isopol ^R (Isofol) 12.

Such a foam inhibitor system is disclosed in pending European patent application 92870174 (filed November 10, 1992).

Particularly preferred silicone foam modifiers are disclosed in pending European patent application 92201649.8. The composition may comprise a silicone / silica mixture with fumed nonporous silica, for example aerosil ^R.

The foam inhibitors described above are usually used in 0.001% to 2% by weight, preferably 0.01% to 1% by weight of the composition.

Etc

Other components used in laundry detergent compositions may be used, such as dirt suspensions, dirt release agents, optical brighteners, abrasives, bactericides, discoloration agents, colorants and / or encapsulated or non-encapsulated fragrances.

Particularly suitable encapsulating materials are water soluble capsules consisting of a matrix of polysaccharide and polyhydroxy compounds as described, for example, in GB 1,464,616. Other suitable water soluble encapsulating materials include dextrins formed from ungelatinized starch acid-esters of substituted dicarboxylic acids, such as those described in US 3,455,838. Preferably these acid-ester dextrins are prepared from starches such as lead corn, lead sugar cane, sago, tapioca and potatoes. Suitable examples of such encapsulating materials include N-Lok from National Starch. The N-lock encapsulating material consists of modified cornstarch and glucose. The starch is modified by adding a monofunctional substituted group such as octenyl succinic anhydride.

Suitable antideposition agents and dirt suspensions herein include cellulose derivatives such as methylcellulose, carboxymethylcellulose and hydroxyethylcellulose and mono- or co-polymerizable polycarboxylic acids or salts thereof. Polymers of this type include polyacrylates and maleic anhydrides, copolymers of maleic anhydride with ethylene, methylvinyl ether or methacrylic acid, as well as the acrylic acid copolymers mentioned above as builders. At least 20 mol% of the copolymer. These materials are usually used at 0.5% to 10% by weight, more preferably at 0.75% to 8% by weight and most preferably at 1% to 6% by weight of the composition.

Preferred optional brighteners are those having anionic properties, such as disodium 4,4'-bis- (2-diethanolamino-4-anilino-s-triazin-6-ylamino) stilbene- 2,2'-disulfonate, disodium 4,4'-bis- (2-morpholino-4-anilino-s-triazin-6-ylamino) stilben-2,2'-disulfo Nate, Disodium 4,4'-bis- (2,4-Dianilino-s-triazin-6-ylamino) stilben-2,2'-disulfonate, monosodium 4,4 "-bis -(2,4-Dianilino-s-triazin-6-ylamino) stilben-2-sulfonate, disodium 4,4'-bis- (2-anilino-4- (N-methyl- N-2-hydroxyethylamino) -s-triazin-6-ylamino) stilben-2,2'-disulfonate, disodium 4,4'-bis- (4-phenyl-2,1, 3-triazol-2-yl) -stilben-2,2'-disulfonate, disodium 4,4'-bis- (2-anilino-4- (1-methyl-2-hydroxyethylamino ) -s-triazin-6-ylamino) stilben-2,2'-disulfonate, sodium-2- (stilville-4 "-(naphtho-1 ', 2 ', 4,5) -1,2,3-triazole-2 "-sulfonate and 4,4'-bis (2-sulphostyryl) biphenyl. Highly preferred brighteners are pending European patent applications. No. 95201943.8 is a specific brightener.

Other useful polymerizable materials include polyethylene glycols, especially those having a molecular weight of 1000 to 10000, more preferably 2000 to 8000, most preferably about 4000. They are used at 0.20% to 5% by weight, more preferably 0.25% to 2.5% by weight. These polymers and the aforementioned mono- or co-polymer polycarboxylate salts are effective in maintaining whiteness, decomposing remnants of fabrics and enhancing cleaning performance on mud and proteinaceous and oxidizable dirt in the presence of transition metal impurities.

Soil removers useful in the compositions of the invention are usually copolymers of terephthalic acid with ethylene glycol and / or propylene glycol units in various arrangements. Examples of such polymers are disclosed in assigned US Pat. Nos. 4116885 and 4711730 and European Publication Application No. 0 272 033. Particularly preferred polymers according to EP-A 0 272 033 have the formula:

(CH ₃ (PEG) ₄₃ ) _0.75 (POG) _0.25 [(T-PO) _2.8 (T-PEG) _0.4 ] T (POH) _0.25 (PEG) ₄₃ CH ₃ ) _0.75

In the above formula,

PEG is-(OC ₂ H ₄ ) O-, PO is (OC ₃ H ₆ O) and T is (pcOC ₆ H ₄ CO).

Also very useful are polyesters modified with random copolymers of dimethyl terephthalate, dimethyl sulfoisophthalate, ethylene glycol and 1,2-propane diol, the terminal group consisting primarily of sulfobenzoates and secondary ethylene Consisting of a mono ester of glycol and / or propane-diol. The aim is to obtain a polymer that is terminated at both ends with sulfobenzoate groups, and when "primarily" herein, most of the polymers herein will be end-sealed with sulfobenzoate groups. However, some copolymers will not be fully sealed and therefore their end groups will be composed of these species “secondarily” since they will consist of monoesters of ethylene glycol and / or propane 1,2-diol.

The selected polyester herein comprises about 46% by weight of dimethyl terephthalic acid, about 16% by weight of propane 1,2-diol, about 10% by weight of ethylene glycol, about 13% by weight of dimethyl sulfobenzoic acid and about 15 of sulfoisophthalic acid. It is included in weight percent and has a molecular weight of about 3,000. Such polyesters and methods for their preparation are described in detail in EPA 311 342.

It is known in the art that free chlorine on tap water rapidly deactivates the enzymes contained in the detergent composition. Therefore, using chlorine scavengers such as perborate, ammonium sulfate, sodium sulfite or polyethyleneimine at least 0.1% by weight of the total composition will increase the wash stability of the detergent enzyme in such formulations. Compositions comprising a chlorine scavenger are disclosed in a European patent application (filed on March 1, 1992).

Those made from alkoxylated polycarboxylates, such as polyacrylates, are effective herein to provide additional fat removal performance. Such materials are disclosed in WO 91/08281 and PCT 90/01815 of page 4, incorporated herein by reference. Chemically, these materials include polyacrylates with one ethoxy side chain per every 7-8 acrylate units. The side chain is of the formula-(CH ₂ CH ₂ O) _m (CH ₂ ) _n CH ₃ , where m is 2-3 and n is 6-12. The side chains are ester crosslinked to the polyacrylate “backbone” to provide a “” polymer form of structure. The molecular weight is variable but generally ranges from about 2000 to about 50,000. Such alkoxylated polycarboxylates may comprise from about 0.05% to about 10% by weight of the present compositions.

Dispersant

Laundry detergent compositions of the invention may also include a dispersant. Suitable water soluble organic salts are mono- or co-polymerizable acids or salts thereof, wherein the polycarboxylic acid comprises at least two carboxyl radicals separated from one another by up to two carbon atoms. Polymers of this type are disclosed in GB-A-1,596,756. Examples of such salts are polyacrylates having a molecular weight of 2000 to 5000 and maleic anhydride having a molecular weight of 1,000 to 100,000 and copolymers thereof.

In particular, copolymers of acrylates and methacrylates, such as 480N, having a molecular weight of 4000 and comprised between 0.5 and 20% by weight of the composition, may be added to the laundry detergent composition of the present invention.

The composition of the present invention may comprise up to 8, preferably up to 7 and most preferably up to 6 lime soap colloidal compounds as defined below and preferably comprise lime soap dispersion powder (LSDP). The lime soap colloid compound is preferably present at 0% to 20% by weight.

The numerical measurement of lime soap colloidal efficacy was made with lime soap dispersant powder (LSDP), which is described by HC Bergetty and CA Bergman in J. Am. Oil. Chem. Soc., Vol. 27, pp. 88-90 (1950). Such lime soap dispersion test methods are mentioned, for example, in the literature and are mainly used by those skilled in the art; WN Linfield, Surjactant Science Series, Vol. 7, No. 3; WN Lynnfield, Tenside surf. det. Vol. 27, pp. 159-163 (1990); And WK Nagarajan, WF Masler (Cosmetics and Toiletries, Vol. 104, pp. 71-73 (1989)). The LSDP is the weight percent ratio of sodium oleate required to disperse the lime soap deposit formed by the dispersant and 0.025 g of sodium oleate in 30 ml of water of equal hardness to 333 ppm CaCO ₃ (Ca: Mg = 3: 2). .

Surfactants with good lime soap collating ability include any amine oxide, betaine, sulfobetaine, alkyl ethoxysulfate and ethoxylated alcohols.

Exemplary surfactants having an LSDP of 8 or less for use in the present invention include C ₁₆ to C ₁₈ dimethyl amine oxides having an average degree of ethoxylation of 1 to 5, C ₁₂ to C ₁₈ alkyl ethoxysulfates, especially 3 C ₁₂ to C ₁₅ alkyl ethoxysulfate surfactants having an average degree of ethoxylation (LSDP = 4), and ₁₂ (LSDP) sold under the trade names Lutensol A012 and Lutensol A030 by BASF GmbH, respectively. = 6) or C ₁₄ to C ₁₅ ethoxylated alcohols having an average degree of ethoxylation of 30.

Polymerizable lime soap colloids suitable for use herein are disclosed in Ms. Nagaraya, M.F. Masler, Cosmetics and Toiletries, Vol. 104, pp. 71-73 (1989).

Hydrophobic bleach such as 4- [N-octanoyl-6-aminohexanoyl] benzene sulfonate, 4- [N-nonanoyl-6-aminohexanoyl] benzene sulfonate, 4- [N-decanoyl -Nonaminoyloxy benzene sulfonate can also be used as lime soap colloid compound with -6-aminohexanoyl] benzene sulfonate and mixtures thereof and hydrophilic / hydrophobic bleach formulations.

Dye transfer inhibition

The laundry detergent composition of the present invention may also include a compound for preventing dye transfer of the dyes dissolved and suspended from one fabric to another when encountered during a fabric washing process comprising colored fabrics.

Polymeric Dye Transfer Inhibitor

Laundry detergent compositions according to the invention may also comprise from 0.001% to 10% by weight, preferably from 0.01% to 2% by weight, more preferably from 0.05% to 1% by weight of a polymerizable dye transfer inhibitor. Such polymerizable dye transfer inhibitors are generally incorporated into laundry detergent compositions to inhibit dye transfer from colored fabric to fabric. These polymers retain the ability to form complexes or absorb washed off dyes from dyed fabrics in an instant upon washing.

Particularly suitable polymeric dye transfer inhibitors include polyamine N-oxide polymers, copolymers of N-vinylpyrrolidone and N-vinylimidazole, polyvinylpyrrolidone polymers, polyvinyloxazolidone and polyvinylimidazole. Or mixtures thereof.

The addition of the polymer also increases the performance of the enzymes according to the invention.

a) polyamine N-oxide polymer

Suitable polyamine N-oxide polymers for use include units having the structure

From above

P is a polymerizable unit, to which an R-N-O group can be attached or an R-N-O group

Form part of a polymerizable unit or a complex thereof.

A is NC, , N; x is 0 or 1;

R is aliphatic, ethoxylated aliphatic, aromatic, heterocyclic or

The N-O group may be attached to an alicyclic group or any complex thereof

Nitrogen in the N—O group may be part of these groups.

The N-O group may be represented by the following general structure;

In the above,

R ₁ , R ₂ and R ₃ are aliphatic groups, aromatic, heterocyclic or alicyclic groups or complexes thereof,

x and / or y and / or z are 0 or 1,

The nitrogen of the N-O group forms part of these groups.

The N-O group can be part of the polymerizable unit (P) or can be attached to the polymerizable backbone or a complex thereof.

Suitable polyamine N-oxides that form part of the polymerizable units include N-oxides, wherein R is selected from aliphatic, aromatic, alicyclic or heterocyclic groups.

One class of such polyamine N-oxides includes polyamine N-oxide groups in which the N-O groups form part of the R-group. Preferred polyamine N-oxides are those in which R is a heterocyclic group such as pyridine, pyrrole, imidazole, pyrrolidine, piperidine, quinoline, acridine and derivatives thereof.

Another class of polyamine N-oxides is the group of polyamine N-oxides wherein the nitrogen of the N-O group is attached to the R-group.

Another suitable polyamine N-oxide is a polyamine oxide having an N-O group attached to a polymerizable unit.

A preferred class of these polyamine N-oxides are polyamine N-oxides having the formula (I) in which R is an aromatic, heterocyclic or alicyclic group and the nitrogen of the N-O functional group is part of said R group. Examples of these classes are polyamine oxides where R is a heterocyclic compound such as pyridine, pyrrole, imidazole and mixtures thereof. Another preferred class of polyamine N-oxides are polyamine oxides of formula (I) in which R is an aromatic, heterocyclic or alicyclic group and the nitrogen of the N-O functional group is attached to said R group.

Examples of these classes are polyamine oxides which may be aromatic in the R group, such as phenyl.

Any polymer backbone can be used as long as the amine oxide polymer formed is water soluble and has dye transfer inhibition properties. Examples of suitable polymerizable backbones are polyvinyl, polyalkylene, polyesters, polyethers, polyamides, polyimides, polyacrylates and mixtures thereof.

The amine N-oxide polymers of the present invention generally have a ratio of amine to amine N-oxide of 10: 1 to 1: 1000000. However, the amount of amine oxide groups present in the polyamine oxide polymer can be varied by appropriate copolymerization or by appropriate N-oxidation degrees. Preferably the ratio of amine to amine N-oxide is 2: 3 to 1: 1000000. More preferably, it is 1: 4-1: 1000000, Most preferably, it is 1: 7-1: 1000000. The polymers of the present invention comprise random or block copolymers, in which one type of monomer is amine N-oxide and the other type of monomer is amine N-oxy or not. The amine oxide units of the polyamine N-oxides have a pK _a of less than 10, preferably less than pK _a 7, more preferably less than pK _a 6.

Polyamine oxides can be obtained with almost any polymerization. The degree of polymerization is not critical as long as the material contains the desired water soluble and dye suspended powders.

In general, the average molecular weight is in the range of 500 to 1000,000, preferably 1,000 to 50,000, more preferably 2,000 to 30,000 and most preferably 3,000 to 20,000.

b) copolymers of N-vinylpyrrolidone and N-vinylimidazole

The N-vinylimidazole and N-vinylpyrrolidone polymers used in the present invention have an average molecular weight of 5,000 to 1,000,000, preferably 5,000 to 200,000.

Very preferred polymers for use in the detergent compositions according to the invention are selected from N-vinylimidazole N-vinylpyrrolidone copolymers, said polymers being from 5,000 to 50,000, more preferably from 8,000 to 30,000, most preferably Has an average molecular weight in the range of 10,000 to 20,000.

The average molecular weight was determined by the light dispersion method described in Barth H.G and Mays J.W., Chemical Analysis, Vol. 113, “Modern Methods of Polymer Characterization”.

N-vinylimidazole N-vinylpyrrolidone copolymers characterized as having the above average molecular weight provide excellent dye transfer inhibition properties without adversely affecting the cleaning performance of the formulated detergent composition.

The N-vinylimidazole N-vinylpyrrolidone copolymers of the present invention have a molar ratio of N-vinylimidazole to N-vinylpyrrolidone of 1 to 0.2, more preferably 0.8 to 0.3, most preferably 0.6 to 0.4.

c) polyvinylpyrrolidone

Detergent compositions of the present invention also contain polyvinylpyrrolidone having an average molecular weight of about 2,500 to about 400,000, preferably about 5,000 to about 200,000, more preferably 5,000 to 50,000 and most preferably about 5,000 to about 15,000 ( "PVP") can be used. Suitable polyvinylpyrrolidones are available from ISP Corporation under the trade names PVP K-15 (average molecular weight 10,000), PVP K-30 (average molecular weight 40,000), PVP K-60 (average molecular weight 160,000) and PVP K- in New York, Montreal, Canada. It is marketed as 90 (average molecular weight 360,000). Other suitable polyvinylpyrrolidones available from BASF Corporation include Sokalan HP 165 and Sokalan HP 12, which are polyvinylpyrrolidones known to those skilled in the detergent field (EP-A-262,897 and EP-A-256,696). Reference).

d) polyvinyloxazolidone

The detergent composition of the present invention may also use polyvinyloxazolidone as a polymerizable dye transfer inhibitor. The polyvinyloxazolidone has an average molecular weight of about 2,500 to 400,000, preferably about 5,000 to about 200,000, more preferably about 5,000 to about 50,000 and most preferably about 5,000 to about 15,000.

e) polyvinylimidazole

The detergent composition of the present invention may also use polyvinylimidazole as a polymerizable dye transfer inhibitor. The polyvinylimidazole has a molecular weight of about 2,500 to about 400,000, preferably about 5,000 to about 200,000, more preferably about 5,000 to about 50,000 and most preferably about 5,000 to about 15,000.

f) crosslinked polymers

Crosslinked polymers are interconnected to any degree; These crosslinks may have chemical or physical properties and may have active groups in the backbone or side chains; Crosslinked polymers are described in the Journal of Polymer Science, Vol. 22, pp. 1035-1039.

In one embodiment, the crosslinked polymer is made in such a way as to form a three-dimensional shoulder structure capable of trapping dye in the pores formed in the three-dimensional structure. In another embodiment, the crosslinked polymer captures the dye by swelling. Such crosslinked polymers are described in pending patent application 948770213.9.

Washing method

The compositions of the present invention can be used in essentially any washing or cleaning method, including dipping methods, pretreatment methods and washing steps through which a separate cleaning aid composition can be added.

The methods described herein include contacting the fabric with the wash solution in a conventional manner and in the manner illustrated below.

The process of the invention is conveniently carried out during the cleaning process. The cleaning method is preferably carried out at a temperature of 5 ° C to 95 ° C, in particular 10 ° C to 60 ° C. The pH of the treatment solution is preferably 7-11. Preferably, the laundry detergent composition of the present invention has a pH of 7 to 9.5 (referred to as alkaline detergent) in a 1% solution in water.

The following examples illustrate the compositions of the invention but should not be construed as limiting or limiting the scope of the invention.

Enzyme concentrations in detergent compositions are expressed as pure enzymes based on the weight of the total composition and unless otherwise stated the detergent components are expressed in weight of the total composition. The abbreviation of each component in this application has the following meaning.

LAS: Sodium Linear C _11-13 Alkyl Benzene Sulfonate

TAS: Sodium Tallow Alkyl Sulfate

CoxyAS: Sodium C _1X -C _1y Alkyl Sulfate

CxySAS: Sodium C _1x -C _1y Secondary (2,3) Alkyl Sulfate

CxyEz: mainly linear primary alcohol of C _1x -C _1y condensed with an average z mole of ethylene oxide

CxyEzS: C _1x -C _1y sodium alkyl sulfates condensed with an average z mole of ethylene oxide

QAS: R ₂ is C ₁₂ to C ₁₄ in _{R 2 N + (CH 3)} 2 (C 2 H 4 OH)

QAS 1: R ₂ is a C ₈ to _{C 11 R 2 N + (CH} 3) 2 (C 2 H 4 OH)

APA: amido propyl dimethyl amine of C ₈ to C ₁₀

Soap: Sodium linear alkyl carboxylate derived from 80/20 mixture of tallow and coconut fatty acids

Nonionic: C ₁₃ to C ₁₅ mixed ethoxylated / propoxylated fatty alcohols with an average degree of ethoxylation of 3.8 and an average degree of propoxylation of 4.5

Neodol 45-13: Linear primary alcohol ethoxylates of C ₁₄ or C ₁₅ sold by Shell Chemical CO.

Grade 4: lauryl trimethyl ammonium chloride, myristyl trimethyl ammonium chloride, palmityl trimethyl ammonium chloride, coconut trimethylammonium chloride, coconut dimethyl-monohydroxyethyl-ammonium chloride, coconut dimethyl-monohydroxyethyl-ammonium chloride, coconut dimethyl -Monohydroxyethylammonium methylsulfate, sterilyl dimethyl-monohydroxy-ethylammonium chloride, steryl dimethylmonohydroxy-ethylethylammonium methylsulfate, di-C ₁₂ -C ₁₄ alkyl dimethyl ammonium chloride selected from Quaternary Surfactant

STS: Sodium Toluene Sulfonate

CFAA: C ₁₂ to C ₁₄ Alkyl N-methyl Glucamide

TFAA: C ₁₆ to C ₁₈ alkyl N-methyl glucamide

TPKFA: C ₁₂ to C ₁₄ fatty acids cleaved at the top of the gun

DEQA: di- (tallow-oxy-ethyl) dimethyl ammonium chloride

DEQA (2): di- (soft-tallowyloxyethyl) hydroxyethyl methyl ammonium methyl sulfate

DTDMAMS: Ditallow Dimethyl Ammonium Methylsulfate

SDASA: stearyldimethyl amine in a 1: 2 ratio: triple-pressurized ammonium methylsulfate

Silicate: amorphous sodium silicate (ratio of SiO ₂ : Na ₂ O = 1.6 to 3.2)

Zeolite A: Formula Na ₁₂ (A ₁ O ₂ SiO ₂ ) ₁₂ having a major particle size of 0.1 to 10 micrometers (weight based on anhydride). Hydrated Sodium Aluminosilicate Of 27H ₂ O

Na-SKS-6: Silicate Laminated with Crystals of Formula δ-Na ₂ Si ₂ O ₅

Citrate: 86.4% active tri-sodium citrate dihydrate with a particle size distribution of 425 to 850 microns

Citric Acid: Citric Acid Anhydride

Borate: Sodium Borate

Carbonate: Sodium Carbonate Anhydride with particle size 200-900 micrometers

Bicarbonate: Sodium bicarbonate anhydride with a particle size distribution of 400 to 1200 micrometers

Sulfate: Sodium Sulfate Anhydride

Mg Anhydride: Magnesium Sulfate Anhydride

STPP: Sodium Tripolyphosphate

TSPP: tetrasodium pyrophosphate

MA / AA: random copolymer of 4: 1 acrylate / maleate having an average molecular weight of about 70,000 to 80,000

MA / AA 1: random copolymer of acrylate / maleate with an average molecular weight of about 10,000 dls 6: 4

AA: sodium polyacrylate polymer having an average molecular weight of 4,500

PB1: Sodium perborate monohydrate anhydride of the standard chemical formula NaBO ₂ .H ₂ O ₂

PB4: standard formula _{2Na 2 BO 2 .3H 2 OH 2} O 2 with a boronic acid sodium trihydrate

Percarbonate: Sodium percarbonate anhydride of standard formula 2Na ₂ CO ₃ .3H ₂ O ₂

NaDCC: Sodium Dichloroisocyanurate

TAED: tetraacetylethylenediamine

NOBS: nonanoyloxybenzene sulfonate in the form of sodium salt

NACA-OBS: (6-nonamidocaproyl) oxybenzene sulfonate

DTPA: diethylene triamine pentaacetic acid

HEDP: 1,1-hydroxyethane diphosphonic acid

DETPMP: Diethyltriamine penta (methylene) phosphonate sold by the manufacturer Monsanto under the trade name Dequest 2060.

EDDS: ethylenediamine-N, N'-disuccinic acid in the sodium salt form, (S, S) isomer

Photoactivated Bleach: Sulfonated Zinc Phthalocyanine Encapsulated in Dextrin Soluble Polymer

Photoactivated Bleach 1: Sulfonated Alumino Phthalocyanine Encapsulated in Dextrin Soluble Polymer

PAAC: pentaamine acetate cobalt (III) salt

Mannase: Mannase sold by the manufacturer Novo Nordisk A / S under the trade name Gamanase and / or galactomannase extracted from an enzyme product sold by the manufacturer Rohmec under the trade name Rohapec B1L.

Alkaline Mannase: Bacillus agardherens, Mannase originated from NCIMB 40482

Protease: proteolytic enzymes and patents WO91 / 06637 and / or WO95 sold by the manufacturer (Novo Nordisk A / S) under the trade names Savinase, Alcalase, Durazym and marketed by the Gist-Brocades under the trade names Maxacal, Maxapem. Protease as described in / 10591 and / or EP 251 446

Amylase: marketed by Genencor under the trade name Purafact Ox Am ^R described in WO 94/18314, WO96 / 05295 and from Novo Nordisk A / S under the trade names Termamyl ^R , Fungamyl ^R and Duramyl ^R Amylose degrading enzymes and amylose degrading enzymes described in WO95 / 26397.

Lipases: lipolytic enzymes marketed by Novo Nordisk A / S under the trade name Lpolase, Lipolase Ultra and marketed by Gist-Brocades under the trade name Lipomax.

Cellulase: Cellulose degrading enzyme sold by Novo Nordisk A / S under the trade names Carezyme, Celluzyme and / or Endolase.

CMC Sodium Carboxymethyl Cellulose

PVP: polyvinyl polymer with a molecular weight of 60,000

PVNO: polyvinylpyridine-N-oxide with an average molecular weight of 50,000

PVPVI: Copolymer of vinylimidazole and vinylpyrrolidone with an average molecular weight of 20,000

Brightener 1: Disodium 4,4'-bis (2-sulphostyryl) biphenyl

Brightener 2: Disodium 4,4'-bis (4-anilino-6-morpholino-1,3,5-triazin-2-yl) stilben-2: 2'-disulfonate

Silicone Defoamer: A siloxaneoxyalkylene copolymer and a polydimethylsiloxane foam regulator as a dispersant in which the ratio of the foam regulator to the dispersant is from 10: 1 to 100: 1.

Antifoam: 12% silicone / silica, 18% stearyl alcohol, 70% starch in granular form

Whitening agents: Water based monostyrene latex mixtures marketed by BASF Aktiengesellshaft under the trade name Lytron 621.

SRP 1: Anionic end capped polyester

SRP 2: diethoxylated poly (1,2-propylene terephthalate) short block polymer

QEA: bis ((C ₂ H ₅ O) (C ₂ H ₄ O) _n ) (CH ₃ ) -N ⁺ -C ₆ H ₁₂ -N ⁺ -(CH ₃ ) bis ((C ₂ H ₅ O)- (C ₂ H ₄ O)) _n (where n is 20 to 30)

PEI: Polyethylenimine with an average molecular weight of 1800 and an average degree of ethoxylation of 7 ethyleneoxy moieties per nitrogen

Polymer A: Modified polyamine of PEI (molecular weight = 182) having an average degree of ethoxylation of 15

Polymer B: Modified polyamine of PEI (molecular weight = 600) having an average degree of ethoxylation of 20

Polyamide-polyamines: Polyamide-polyamines sold under the trade names Kymene ^R , Kymene 557H ^R , Kymene 557LX ^R , Reten ^R and Cartaretin ^R

SCS: Sodium Cumene Sulfonate

HMWPEO: high molecular weight polyethylene oxide

PEGx: polyethylene glycol of x molecular weight

PEO: polyethylene oxide with an average molecular weight of 5,000

TEPAE: tetraethylenepentaamine ethoxylate

Example 1

The following high density laundry detergent compositions are prepared according to the method of the present invention.

Example 2

The following granular laundry detergent compositions having specific uses under European instrument washing conditions are prepared according to the process of the present invention:

Example 3

The following detergent compositions having specific uses under European instrument washing conditions are prepared according to the process of the invention:

Example 4

The following granular detergent compositions are prepared according to the method of the present invention:

Example 5

The following detergent compositions which do not contain bleach with a particular use in the washing of colored garments are prepared according to the process of the present invention:

Example 6

The following detergent composition is prepared according to the method of the present invention.

Example 7

The following granular detergent composition is prepared according to the method of the present invention.

Example 8

The following detergent compositions are prepared according to the method of the present invention:

Example 9

The following detergent compositions are prepared according to the method of the present invention:

Example 10

The following liquid detergent formulations are prepared according to the method of the present invention (concentrations in parts by weight and enzymes in pure enzymes):

Example 11

The following liquid detergent formulations are prepared according to the method of the present invention (concentrations in parts by weight and enzymes in pure enzymes):

Example 12

The following liquid detergent compositions are prepared according to the method of the present invention (concentrations in parts by weight and enzymes in pure enzymes):

Example 13

The following liquid detergent compositions are prepared according to the method of the present invention (concentrations in parts by weight and enzymes in pure enzymes):

Example 14

The following gel detergent composition is prepared according to the method of the present invention.

Example 15

The following gel detergent compositions are prepared according to the method of the present invention:

Example 16

The following granular fabric detergent compositions, which provide the ability to soften through washing, are prepared according to the method of the present invention.

Example 17

The following detergents added to the fabric softener composition are prepared according to the method of the present invention.

Example 18

The following fabric softeners and desiccants added to the fabric conditioner composition are prepared according to the method of the present invention.

Example 19

The following laundry bar detergent compositions are prepared according to the method of the present invention (concentrations are expressed in parts by weight and enzymes are shown as pure enzymes):

Example 20

The following detergent additive compositions are prepared according to the method of the present invention.

Claims (17)

A laundry detergent composition comprising a detergent component which is a saccharide gum degrading enzyme that degrades non-starch non-cellulose food polysaccharides having a viscosity of at least 800 cps in a 1% solution. The laundry detergent composition of claim 1, wherein the polysaccharide is selected from agar, algin, karawa, tragacanth, guar gum, locus bean, xanthan, and / or mixtures thereof. The method according to claim 1 or 2, wherein the saccharide degrading enzyme is a mannosidase, in particular β-mannosidase, endo 1,4-β-D mannosidase, endo 1,2-β-D mannosidase And exo 1,3-β-D mannosidase; Galactosidase, in particular exo 1,6-β-D-galactosidase and 1,3-β-D-galactosidase; Glucuronidase, glucuronosidase, exo 1,2 or 1,4-glucuronidase; Arabinase, in particular endo a-1,5-arabinosidase, exo arabanase, exo A (α-1,2; α-1,3) arabinofuranosidase, exo B (α-1 A-1,5) arabinofuranosidase; Xanthanase; Poly (α-L-gluronate) lyase; Laundry detergent composition selected from agarase, carrageenase and / or mixtures thereof. The laundry detergent composition according to any one of claims 1 to 3, wherein the saccharide gum degrading enzyme is β-mannosidase (EC 3.2.1.78-mannase). The method according to any one of claims 1 to 4, wherein the saccharide gum degrading enzyme is 0.0001 to 2% by weight, preferably 0.0005 to 0.1% by weight, more preferably 0.0006% by weight, based on the total composition. To 0.015% by weight of a pure enzyme present in a laundry detergent composition. The laundry detergent composition of claim 1, further comprising a surfactant selected from nonionic, anionic surfactants, cationic surfactants, and / or mixtures thereof. The laundry detergent composition according to any one of the preceding claims, further comprising another enzyme, preferably cellulase and / or amylase. 8. The builder according to claim 1, further comprising a builder, preferably an inorganic builder, more preferably a builder selected from zeolite A, layered silicates, sodium tripolyphosphate, and / or mixtures thereof. Laundry detergent composition. The laundry detergent composition of claim 1, further comprising an activated bleaching system. 10. The laundry detergent composition of claim 1, wherein the composition is in the form of a liquid, paste, gel, bar, tablet, spray, foam, powder or granules. The ethylene oxide moiety according to claim 10, wherein (i) the alkyl group has 10 to 22 carbon atoms and the polyethoxylate chain has 0.5 to 15, preferably 0.5 to 5, more preferably 0.5 to 4 ethylene oxide residues. Laundry gel detergent composition comprising 5 wt% to 25 wt% of alkyl polyethoxylate sulfate and (ii) 15 wt% to 40 wt% of anionic surfactant component comprising 5 wt% to 20 wt% of fatty acid. . Detergent additives comprising saccharide degrading enzymes. A fabric softening composition comprising a non-starch having a viscosity of at least 800 cps in a 1% solution, a saccharide gum degrading enzyme that degrades non-cellulose food polysaccharides and a cationic surfactant comprising two long chain lengths. A laundry detergent composition having a viscosity of at least 800 cps in a 1% solution for fabric cleaning and / or fabric stain removal and / or maintaining fabric whiteness and / or fabric softening and / or fabric color development and / or fabric dye transfer inhibition Use of saccharide gum degrading enzymes to degrade non-starch non-cellulose food polysaccharides. 15. The use of saccharide gumase for removal of non-starch non-cellulose food polysaccharides having a viscosity of at least 800 cps in a 1% solution. Use according to claim 14 or 15, wherein the polysaccharide is selected from agar, algin, karawa, tragacanth, guar gum, locus bean, xanthan and / or mixtures thereof. Use of the saccharide gum degrading enzyme and cellulase according to any one of claims 14 to 16 for removing non-starch food polysaccharides having a viscosity of at least 800 cps in a 1% solution.