KR102622673B1 - IAA15 mutant for increasing environmental stress tolerance of plant and uses thereof - Google Patents

Abstract

The present invention relates to an IAA15 variant that improves the environmental stress tolerance of plants and its use. Since the IAA15 protein variant of the present invention has an excellent effect of promoting main root elongation under environmental stress conditions, the IAA15 protein variant coding gene can be used to reduce environmental stress. It is expected that the productivity of crops can be improved by developing plants that are resistant to .

Description

IAA15 mutant for increasing environmental stress tolerance of plant and uses thereof}

The present invention relates to IAA15 variants that improve environmental stress tolerance in plants and their uses.

Plants suffer not only from biological stress such as germs, pests, and viruses, but also from high temperature, salt damage, dryness, pollution, wounds, cold damage, excessive light conditions, ozone, excessive UV exposure, and osmotic shock caused by the deterioration of the global environment. are subject to various environmental stresses. Among them, salt stress causes accumulation of toxic Na ⁺ ions and osmotic or oxidative stress, resulting in reduced productivity and growth inhibition of crops. In addition, it causes rapid changes in intracellular ion and water homeostasis, leading to plant death in severe cases. Drying stress due to lack of moisture is also a major factor in reducing crop productivity. Plants have a defense mechanism against salt, moisture, or oxidative stress, so when they are in an environment unsuitable for growth, they tend to adapt to the environment and survive by controlling their shape or physiological metabolic processes.

Reactive oxygen species (ROS) present in plants can cause extensive cell damage and photosynthesis inhibition. Generally, to prevent such damage, free radicals are removed by their own antioxidants, but when this antioxidant function is damaged by stress, free radicals accumulate in the plant. In addition to free radicals, plant responses to environmental stresses are mediated by plant hormones that regulate complex stress signaling cascades. In particular, the plant hormone abscisic acid (ABA) has been reported to act as an important regulator in the activation of plant cell adaptation to drought and salinity (Danquah et al., 2014, Biotechnol Adv. 32(1): 40-52).

Meanwhile, auxin is a plant growth hormone involved in the overall growth and development of plants, such as seed germination, flowering control, root and stem growth, and tissue aging. Auxin-related signaling pathways are mainly regulated by TIR1/AFB, Aux/IAA, and ARF. In particular, in Arabidopsis, the IAA (indole-3-acetic acid inducible) family is known to be the first gene to be strongly expressed by auxin.

Meanwhile, Korean Patent No. 1664943 discloses 'AtLRK10L1.2 gene that regulates environmental stress tolerance of plants and its uses', and Korean Patent No. 1664206 discloses 'Rice-derived gene that increases environmental stress tolerance of plants.' Although the 'OsWOX13 gene and its use' has been disclosed, there is no description of the 'IAA15 variant that improves environmental stress tolerance in plants and its use' of the present invention.

The present invention was developed in response to the above-mentioned needs, and the present inventors converted proline (P), the 75th amino acid of the Arabidopsis thaliana-derived IAA15 (indole-3-acetic acid inducible 15) protein, into serine (S). A substituted IAA15 protein variant was prepared, and the present invention was completed by confirming that the main root length of plants overexpressing the IAA15 protein variant increased compared to the control plant under environmental stress conditions.

In order to solve the above problem, the present invention proposes that proline (P), the 75th amino acid of the Arabidopsis thaliana-derived IAA15 (indole-3-acetic acid inducible 15) protein consisting of the amino acid sequence of SEQ ID NO: 1, is serine (S). ) provides a substituted IAA15 protein variant.

Additionally, the present invention provides a gene encoding the IAA15 protein variant.

Additionally, the present invention provides a recombinant vector containing the above gene.

Additionally, the present invention provides host cells transformed with the above recombinant vector.

In addition, the present invention provides a method for enhancing environmental stress tolerance of plants, comprising the step of transforming plant cells with the recombinant vector and overexpressing the gene encoding the IAA15 protein variant.

In addition, the present invention includes the steps of transforming plant cells with the recombinant vector and overexpressing the gene encoding the IAA15 protein variant; and redifferentiating plants from the transformed plant cells. A method for producing a transgenic plant with improved environmental stress tolerance compared to a non-transgenic plant is provided.

In addition, the present invention provides transgenic plants with improved environmental stress tolerance and seeds thereof prepared by the above production method.

In addition, the present invention provides a composition for enhancing environmental stress tolerance in plants, comprising a gene encoding an IAA15 protein variant as an active ingredient.

Since the IAA15 protein variant of the present invention has an excellent effect of promoting main root elongation of plants under environmental stress conditions, using the IAA15 protein variant coding gene can develop plants resistant to environmental stress, thereby improving crop productivity. It is expected that

Figure 1 shows the results of confirming IAA15 expression in wild-type IAA15 overexpressing plants (IAA15 ^WT OX) and mutant IAA15 overexpressing plants (IAA15 ^P75S OX) under normal conditions by qRT-PCR (A, B) and Western blot (C, D) analysis. am. DEX is dexamethasone, MG132 is a protease inhibitor, and CBS is Coomassie blue staining.
Figure 2 shows the results of confirming the root growth of IAA15 ^WT OX and IAA15 ^P75S OX under normal conditions. A and B are photographs of each plant at 14 days of age, C is the result of measuring the length of the main root, and D is the lateral root. This is the result of measuring the number of .
Figure 3 shows the results of qRT-PCR analysis of the expression of the auxin response gene (A) and the lateral organ boundary domain (LBD) gene (B) of IAA15 ^P75S OX under normal conditions. NAA; α-naphthaleneacetic acid.
Figure 4 shows the results of measuring the length of the main root of IAA15 ^P75S OX under environmental stress conditions (salt, dryness, or abscisic acid). MOCK is a control group without any treatment, NaCl is sodium chloride that induces a salt stress state, mannitol is mannitol that induces a dry stress state, and ABA is abscisic acid.

In order to achieve the object of the present invention, the present invention is a method in which proline (P), the 75th amino acid of the Arabidopsis thaliana-derived IAA15 (indole-3-acetic acid inducible 15) protein consisting of the amino acid sequence of SEQ ID NO: 1, is serine (serine). , S) provides a substituted IAA15 protein variant.

When the IAA15 protein variant according to the present invention is overexpressed in a transformed plant, it can increase the length of the main root of the plant under environmental stress conditions.

The present invention also provides a gene or polynucleotide encoding the IAA15 protein variant. In the present specification, 'gene' encoding an IAA15 protein variant can be used interchangeably with 'polynucleotide' encoding an IAA15 protein variant.

The range of the gene encoding the IAA15 protein variant according to the present invention is that in the sequence of the wild-type IAA protein consisting of the amino acid sequence of SEQ ID NO: 1, the 75th amino acid, proline (P), is replaced with serine (S). To this end, the coding base for proline may be substituted with the coding base for serine (TCT, TCC, TCA or TCG), but is not limited thereto.

The gene encoding the IAA15 protein variant of the present invention may be composed of the base sequence of SEQ ID NO: 2, but is not limited thereto.

The present invention also provides a recombinant vector containing a gene encoding the IAA15 protein variant.

As used herein, the term “recombinant” refers to a cell that replicates a heterologous nucleic acid, expresses a heterologous nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene segments that are not found in the natural form of the cell, either in sense or antisense form. Additionally, recombinant cells can express genes found in cells in their natural state, but the genes have been modified and reintroduced into the cells by artificial means.

The term “vector” in the present invention is used to refer to DNA fragment(s) or nucleic acid molecules that are delivered into cells. Vectors replicate DNA and can reproduce independently in host cells. The term “vector” is often used interchangeably with “vector”. The term “expression vector” refers to a recombinant DNA molecule containing a coding sequence of interest and an appropriate nucleic acid sequence necessary to express the operably linked coding sequence in a particular host organism. The promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

A preferred example of a plant expression vector is the Ti-plasmid vector, which is capable of transferring part of itself, the so-called T-DNA region, into plant cells when present in a suitable host such as Agrobacterium tumefaciens . Another type of Ti-plasmid vector (see EP 0116718 B1) is currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced that properly integrate the hybrid DNA into the plant's genome. A particularly preferred form of Ti-plasmid vectors are the so-called binary vectors as claimed in EP 0120516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host include viral vectors, such as those that may be derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, geminiviruses, etc. For example, it may be selected from non-intact plant virus vectors. The use of such vectors can be particularly advantageous when it is difficult to properly transform plant hosts.

The expression vector will preferably include one or more selectable markers. The marker is a nucleic acid sequence that has characteristics that can be generally selected by chemical methods, and includes all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate, phosphinothricin and glufosinate, kanamycin, G418, bleomycin, hygromycin, There are antibiotic resistance genes such as chloramphenicol, but it is not limited to this.

In the plant expression vector of the present invention, the promoter may be a dexamethasone-inducible promoter, but is not limited thereto. The term "promoter" refers to the region of DNA upstream from a structural gene and refers to the DNA molecule to which RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in plant cells. In the plant expression vector of the present invention, in addition to the above promoter, a constitutive promoter can also be used in the present invention because selection of transformants can be accomplished at various stages and by various tissues. A “constitutive promoter” is a promoter that is active under most environmental conditions and developmental states or cell differentiation. The constitutive promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, and does not limit the selection possibilities.

In the plant expression vector of the present invention, common terminators can be used, examples of which include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens tumefaciens ) terminator of the Octopine gene, but is not limited thereto. Regarding the necessity of terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly preferred in the context of the present invention.

The present invention also provides host cells transformed with the above recombinant vector.

When transforming the vector of the present invention into eukaryotic cells, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (e.g., CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2) are used as host cells. , 3T3, RIN and MDCK cell lines) and plant cells can be used. The host cell is preferably a plant cell.

In addition, the method of transporting the vector of the present invention into a host cell involves transferring the vector into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene bombardment. It can be injected internally.

The present invention also provides a method for enhancing environmental stress tolerance of plants, comprising the step of transforming plant cells with the recombinant vector and overexpressing the gene encoding the IAA15 protein variant.

In the method of improving environmental stress tolerance of plants of the present invention, the environmental stress may be stress caused by salt, drying, or abscisic acid, but is not limited thereto.

In the method of improving the environmental stress tolerance of plants according to an embodiment of the present invention, the stress tolerance may be induced by increasing the length of the main root when the IAA15 protein variant coding gene is overexpressed under stress conditions, thereby inducing growth and development. , but is not limited to this.

In addition, in the method of improving environmental stress tolerance of plants according to an embodiment of the present invention, the IAA15 protein variant is an Arabidopsis thaliana-derived IAA15 (indole-3-acetic acid inducible 15) protein consisting of the amino acid sequence of SEQ ID NO: 1. The 75th amino acid, proline (P), may have been replaced with serine (S).

The term “gene overexpression” means causing the gene to be expressed above the level expressed in wild-type plants. A method of introducing the gene into a plant includes transforming the plant using an expression vector containing the gene under the control of a promoter. In the above, the promoter is not particularly limited as long as it can overexpress the inserted gene in the plant.

Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily require a regeneration and/or tissue culture period. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts (Negrutiu et al., 1987, Plant Mol. Biol. 8:363-373), electroporation of protoplasts (Shillito et al., 1985, Bio/Technol. 3:1099) -1102), microinjection method into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), particle bombardment method (DNA or RNA-coated) of various plant elements (Klein et al. .,1987, Nature 327:70), suitable for infection by viruses (EP 0301316 B1), in Agrobacterium tumefaciens-mediated gene transfer by invasion of plants or transformation of mature pollen or spores (incomplete), etc. can be selected. A preferred method according to the invention involves Agrobacterium mediated DNA transfer. Particularly preferred is the use of so-called binary vector technology as described in EPA 120 516 and US Pat. No. 4,940,838.

The “plant cell” used for plant transformation can be any plant cell. Plant cells are cultured cells, cultured tissues, cultured organs, or whole plants. “Plant tissue” refers to differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used in culture, such as single cells and protoplasts. (protoplast), shoot and callus tissue. Plant tissue may be in planta or in organ culture, tissue culture, or cell culture.

The present invention also,

Transforming plant cells with the recombinant vector to overexpress the gene encoding the IAA15 protein variant; and

It provides a method for producing a transgenic plant with improved environmental stress tolerance compared to a non-transgenic plant, comprising the step of redifferentiating the plant from the transformed plant cell.

In the method for producing a transgenic plant with improved environmental stress tolerance according to an embodiment of the present invention, the IAA15 protein variant is Arabidopsis-derived IAA15 (indole-3-acetic acid inducible 15) consisting of the amino acid sequence of SEQ ID NO: 1. Proline (P), the 75th amino acid of the protein, may be substituted with serine (S), and the plant transformation method and plant cells used for plant transformation are the same as described above.

Transformed plant cells must be redifferentiated into whole plants. Techniques for redifferentiation of mature plants from callus or protoplast cultures are well known in the art for many different species (Handbook of Plant Cell Culture, Volumes 1-5, 1983-1989 Momillan, N.Y.).

The present invention also provides a transgenic plant with improved environmental stress tolerance prepared by the above production method and a transformed seed thereof.

The length of the main root of the transgenic plant of the present invention may be increased by 10 to 40% compared to the control under environmental stress conditions.

Additionally, the transgenic plant according to the present invention may be a dicotyledonous plant or a monocotyledonous plant, and is preferably a dicotyledonous plant. Examples of dicotyledonous plants include, but are not limited to, Arabidopsis thaliana, eggplant, tobacco, pepper, tomato, burdock, mugwort, lettuce, bellflower root, spinach, Swiss chard, sweet potato, celery, carrot, water parsley, parsley, Chinese cabbage, cabbage, leaf radish, These include watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean and pea.

The present invention also provides a composition for enhancing environmental stress tolerance in plants, comprising a gene encoding an IAA15 protein variant as an active ingredient.

The composition for improving environmental stress resistance of plants of the present invention contains, as an active ingredient, proline (P), the 75th amino acid of the IAA15 (indole-3-acetic acid inducible 15) protein derived from Arabidopsis thaliana, which consists of the amino acid sequence of SEQ ID NO: 1. It contains a gene encoding an IAA15 mutant protein substituted with serine (S), and by transforming the gene into a plant, environmental stress tolerance of the plant can be improved.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Plants and cultivation conditions

Soak seeds of Arabidopsis ( Arabidopsis thaliana, Columbia-0 ecotype) in 70% (v/v) ethanol for 1 minute and sterilize the surface by soaking them in general bleach (0.4% sodium hypochlorite) diluted 1/10 for 10 minutes. After that, it was washed three times with sterilized water. Surface-sterilized seeds were planted on 1/2 MS (Murashige and Skoog) solid medium containing 2% (w/v) sucrose and 0.8% (w/v) agar and cultured under dark conditions at 4°C for 3 days. Afterwards, the cells were cultured in a 22°C growth chamber under a 16-hour light/8-hour dark cycle. Seedlings that were 10 to 12 days old were transplanted into soil and cultured under the same conditions as above. Afterwards, 14-day-old seedlings were cultured for 24 hours in MS medium containing 50 μM dexamethasone to analyze IAA15 expression and root growth, and 10 μM to analyze auxin-responsive gene and LBD (lateral organ boundary domain) gene expression. The cells were cultured for 24 hours in MS medium containing NAA (α-naphthaleneacetic acid) and 50 μM dexamethasone. Additionally, for root growth analysis under stress conditions, sodium chloride (50 or 100 mM), mannitol (200 or 300 mM), or abscisic acid (0.1 or 0.2 μM) was added to MS medium containing 50 μM dexamethasone and incubated for 14 days. Germination was induced and cultured.

2. IAA15 Mutant plant production

To prepare IAA15 (indole-3-acetic acid inducible 15) mutant plants, the IAA15 gene was amplified from the cDNA of Arabidopsis seedlings using the primers shown in Table 1 below and cloned into a T-blunt vector (Solgent, Korea). To induce a specific site mutation in which proline (P), the 75th amino acid of IAA15 domain II, is replaced with serine (S), the primers in Table 1 below and the QuikChange Site-directed Mutagenesis Kit (Stratagene, USA) are used. did. IAA15 ^WT without IAA15 mutation and IAA15 ^P75S with IAA15 mutation were inserted between the BamH I and Spe I sites of the pBlueScript II KS(+) vector containing 3XFLAG, creating 3XFLAG-IAA15 ^WT and 3XFLAG-IAA15 ^P75S . was prepared and cloned into the pTA7002 binary vector (Aoyama and Chua, 1997, Plant J. 11(3):605-612) containing the dexamethasone-inducible 35S promoter.

Primer Information Usage Primer sequence (5'-3') sequence number
mutation
plant body
For manufacturing IAA15 amplification F: GGATCCATGTCACCGGAGGAATACGT 3 R: ACTAGTTCACTTACATATTGTTATTA 4 IAA15 ^P75S induction F: GTGGGCTGGTCGCCGGTAGCGACAGCGAGG 5 R: CGCTACCGGCGACCAGCCCACCAACTGGTC 6






qRT-PCR
For analysis IAA5 F: AAGAGTCAAGTTGTGGGTTGGGC 7 R: AATGCAGCTCCATCTACACTCACT 8 IAA14 F: GAATTCATGAACCTTAAGGAGACGGA 9 R: CCCGGGTGATCTGTTCTTGAACTTCT 10 GH3.3 F: ATGGAGGAGTCGTTGAACTCTGTG 11 R: AAGCTCCATTATTGGCGTGAAAACTC 12 SAUR10 F: CGAAGTCGGTACATCGTTCCTATC 13 R: CATGGAGATAAGAGACCTGAAGAAGA 14 LBD16 F:GAGAGACTCATCATCAAACC 15 R: CTAAGAGCCAAAGCCTGAAG 16 LBD29 F: AAGTTCTGGGACGGTTCAAC 17 R: GCTGATTGAAGCTCTTTGAG 18 LBD33 F: ACCAATTTCGTCGACGAGAG 19 R: TCCATGTTCTGGAGCCATTG 20 Tubulin F: CCAACAACGTGAAATCGACAG 21 R: TCTTGGTATTGCTGGTACTCT 22

The recombinant vector was transformed and selected into wild-type Arabidopsis by a method using Agrobacterium GV3101 (pMP90) (Clough et al. 1998, Plant J. 16:735-743), and third-generation plants were used for subsequent experiments.

3. qRT-PCR

Total RNA was extracted from 14-day-old Arabidopsis plants using an RNA purification kit (Macherey-Nagel, Germany), and cDNA was synthesized using SuperScript II RNase-Reverse Transcriptase (Invitrogen, USA). Afterwards, PCR analysis was performed with the CFX384 Real-Time System (Bio-Rad, USA) using the primers in Table 1 above: 5 minutes at 94°C, 30 seconds (45 cycles) at 94°C, 40 seconds at 72°C. , 55°C in increments of 0.5°C per cycle (90 cycles), 10 minutes at 72°C.

4. Western blot

The plant was immersed in liquid nitrogen, the tissue was pulverized, and the protein extraction buffer (50mM HEPES, pH 7.5, 5mM EDTA, 5mM EGTA, 1mM Na _{3 VO4} , 25mM NaF, 50mM-glycerophosphate, 2mM DTT, 2mM Proteins were extracted using (mM PMSF, 5% glycerol, 1% Triton X-100, and protease inhibitor). Afterwards, the supernatant obtained by centrifugation at 12,000 g for 10 minutes was quantified using the Bio-Rad Protein Assay kit (Bio-Rad), and then Western blot was performed with 50 μg of protein. Anti-Flag antibody (1:5,000, Sigma, USA) was used as the primary antibody, and HRP-anti-mouse antibody (1:5,000, Sigma, USA) was used as the secondary antibody.

Example 1. IAA15 expression analysis under normal conditions

The expression of IAA15 in wild-type IAA15 overexpressing plants (IAA15 ^WT OX) and mutant IAA15 overexpressing plants (IAA15 ^P75S OX), whose expression is regulated by a dexamethasone inducible promoter, was analyzed at the transcript and protein levels.

As a result of performing qRT-PCR analysis for IAA15 using total RNA isolated from IAA15 ^WT OX and IAA15 ^P75S OX, the expression level of IAA15 transcript in IAA15 ^WT OX and IAA15 ^P75S OX when treated with dexamethasone was found to be It was confirmed that there was a significant increase compared to when it was not done (Figure 1A, B).

As a result of performing Western blot on IAA15 using protein isolated from IAA15 ^WT OX, IAA15 protein was not detected in IAA15 ^WT OX when it was not treated with MG132 (a protease inhibitor), but when it was treated with MG132, IAA15 protein was detected. was detected, and it was found that the IAA15 protein, the expression of which was induced by dexamethasone treatment, was degraded by proteolytic enzymes (Figure 1C). On the other hand, as a result of performing a Western blot on IAA15 using the protein isolated from IAA15 ^P75S OX, the expression of IAA15 protein was induced in IAA15 ^P75S OX by dexamethasone treatment, and IAA15 protein was present in the plant regardless of the presence or absence of MG132 treatment. It was confirmed that (Figure 1D).

Based on the above results, it was found that IAA15 protein was stabilized and accumulated in IAA15 ^P75S OX plants compared to IAA15 ^WT OX plants under normal conditions.

Example 2. IAA15 under normal conditions ^WT OX and IAA15 ^P75S Root growth assay in OX

After treating wild type (WT), IAA15 ^WT OX and IAA15 ^P75S OX with dexamethasone, root growth was observed. When dexamethasone was not treated, the main root length of wild type (WT), IAA15 ^WT OX and IAA15 ^P75S OX and It was confirmed that there was no difference in the number of lateral roots. However, when treated with dexamethasone, the main root length and number of lateral roots of IAA15 ^P75S OX were confirmed to be significantly reduced compared to wild type (WT) or IAA15 ^WT OX. In particular, when treated with dexamethasone, the main root length and number of lateral roots of IAA15 ^P75S OX were confirmed to be reduced by 40% and 90%, respectively, compared to the wild type (WT) (Figure 2).

Based on the above results, it was found that under normal conditions, main root and lateral root development of IAA15 ^P75S OX plants was reduced by dexamethasone treatment.

Example 3. Auxin-responsive genes under normal conditions and LBD Gene expression analysis

Total RNA isolated from IAA15 ^P75S OX was used to perform qRT-PCR analysis for auxin-responsive genes ( IAA5 , IAA14 , GH3.3 , and SAUR10 ) and LBD genes ( LBD16 , LBD29 , and LBD33 ) involved in lateral root development.

As a result, when NAA, a synthetic auxin, was not treated, there was little change in the expression levels of the auxin-responsive genes and LBD genes regardless of the presence or absence of dexamethasone treatment, whereas when NAA was treated, the expression levels of the auxin-responsive genes and LBD genes were increased by dexamethasone treatment. It was confirmed that expression was significantly reduced (Figure 3).

Based on the above results, it was found that under normal conditions, the expression of auxin-responsive genes and LBD genes in IAA15 ^P75S OX plants was inhibited by dexamethasone treatment.

Example 4. Root growth analysis under environmental stress conditions

IAA15 ^P75S OX was treated with sodium chloride, mannitol, or abscisic acid to induce various environmental stresses, and then the main root length was measured.

As a result, in the IAA15 ^P75S OX (MOCK) condition, which did not induce stress, there was no change in main root length regardless of the presence or absence of dexamethasone treatment, but in each stress condition, IAA15 ^P75S treated with dexamethasone was longer than IAA15 ^P75S OX, which was not treated with dexamethasone. It was confirmed that the main root length of OX significantly increased (Figure 4).

Based on the above results, it was found that under environmental stress conditions, IAA15 ^P75S OX plants can have environmental stress tolerance by inducing growth and development by increasing the main root length by dexamethasone treatment.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> IAA15 mutant for increasing environmental stress tolerance of plant and uses it <130> PN21155 <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 179 <212> PRT <213> Arabidopsis thaliana <400> 1 Met Ser Pro Glu Glu Tyr Val Arg Val Trp Pro Asp Ser Gly Asp Leu 1 5 10 15 Gly Gly Thr Glu Leu Thr Leu Ala Leu Pro Gly Thr Pro Thr Asn Ala 20 25 30 Ser Glu Gly Pro Lys Lys Phe Gly Asn Lys Arg Arg Phe Leu Glu Thr 35 40 45 Val Asp Leu Lys Leu Gly Glu Ala His Glu Asn Asn Tyr Ile Ser Ser 50 55 60 Met Val Thr Asn Asp Gln Leu Val Gly Trp Pro Pro Val Ala Thr Ala 65 70 75 80 Arg Lys Thr Val Arg Arg Lys Tyr Val Lys Val Ala Leu Asp Gly Ala 85 90 95 Ala Tyr Leu Arg Lys Val Asp Leu Gly Met Tyr Asp Cys Tyr Gly Gln 100 105 110 Leu Phe Thr Ala Leu Glu Asn Met Phe Gln Gly Ile Ile Thr Ile Cys 115 120 125 Arg Val Thr Glu Leu Glu Arg Lys Gly Glu Phe Val Ala Thr Tyr Glu 130 135 140 Asp Lys Asp Gly Asp Leu Met Leu Val Gly Asp Val Pro Trp Met Met 145 150 155 160 Phe Val Glu Ser Cys Lys Arg Met Arg Leu Met Lys Thr Gly Asp Ala 165 170 175 Ile Gly Leu <210> 2 <211> 540 <212> DNA <213> Arabidopsis thaliana <400> 2 atgtcaccgg aggaatacgt tagggtttgg ccggattccg gtgatcttgg aggaactgag 60 ctgaccctag ctttgcctgg cactccgaca aatgcatcgg aaggtccaaa aaagttcggg 120 aacaaacgta gattcctcga gaccgttgat ttaaaactcg gggaagcaca cgagaacaat 180 tatatctcaa gcatggtcac taatgaccag ttggtgggct ggccgccggt agcgacagcg 240 aggaaaaacag tgaggcggaa atacgtgaaa gtggcgttgg atggtgcggc ctatctcaga 300 aaggttgatc ttgggatgta cgattgctat ggacagcttt tcaccgctct agaaaacatg 360 tttcagggga taataacaat atgtagagtg acagagttgg agaggaaggg agagtttgtt 420 gctacttacg aggataagga cggtgacttg atgttagtcg gagatgtgcc gtggatgatg 480 tttgtggaat cttgcaaacg tatgaggtta atgaaaaccg gagatgctat tggattatag 540 540 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggatccatgt caccggagga atacgt 26 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 actagttcac ttacatattg ttatta 26 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gtgggctggt cgccggtagc gacagcgagg 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cgctaccggc gaccagccca ccaactggtc 30 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 aagagtcaag ttgtgggttg gc 22 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aatgcagctc catctacact cact 24 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gaattcatga accttaagga gacgga 26 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cccgggtgat ctgttcttga acttct 26 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 atggaggagt cgttgaactc tgtg 24 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 aagctccatt attggcgtga aactc 25 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 cgaagtcggt acatcgttcc tatc 24 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 catggagata agagacctga agaaga 26 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gagagactca tcatcaaacc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ctaagagcca aagcctgaag 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 aagttctggg acggttcaac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gctgattgaa gctctttgag 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 accaatttcg tcgacgagag 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 tccatgttct ggagccattg 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ccaacaacgt gaaaatcgaca g 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tcttggtatt gctggtactc t 21

Claims (10)

An IAA15 protein variant in which proline (P), the 75th amino acid of the Arabidopsis thaliana-derived IAA15 (indole-3-acetic acid inducible 15) protein consisting of the amino acid sequence of SEQ ID NO: 1, is replaced with serine (S). A gene encoding the IAA15 protein variant of claim 1. A recombinant vector containing the gene of claim 2. A host cell transformed with the recombinant vector of claim 3. A method for enhancing environmental stress tolerance of plants under dexamethasone treatment conditions, comprising the step of transforming plant cells with the recombinant vector of claim 3 to overexpress the gene encoding the IAA15 protein variant. The method of claim 5, wherein the environmental stress is stress caused by salt, dryness, or abscisic acid. Transforming plant cells with the recombinant vector of claim 3 and overexpressing the gene encoding the IAA15 protein variant; and
A method for producing a transgenic plant with improved environmental stress tolerance compared to a non-transgenic plant under dexamethasone treatment conditions, comprising the step of redifferentiating the plant from the transformed plant cell. A transgenic plant with improved environmental stress tolerance under dexamethasone treatment conditions, prepared by the production method of claim 7. A transformed seed of the plant according to claim 8. A composition for enhancing environmental stress tolerance of plants under dexamethasone treatment conditions, comprising the gene of claim 2 as an active ingredient.