KR101785095B1 - Transgenic plant overexpressing OsGRX1 gene with resistance for bacterial blight and method for producing the same - Google Patents

Abstract

The present invention relates to a recombinant vector containing an OsGRX1 gene which promotes resistance to rice blight blight, a method for enhancing resistance to blight of blight of a blight of a plant and a transgenic plant in which resistance to blight of blight of blight with blight is enhanced. By supplying the transgenic plants, it is possible to reduce the use of pesticides, thereby improving productivity and supplying safe agricultural products.

Description

[0002] Transgenic plant overexpressing OsGRX1 gene with resistance to bacterial blight and method for producing same [

The present invention relates to a recombinant vector containing an OsGRX1 gene which promotes resistance to rice blight blight, a method for enhancing resistance to blight of blight of a blight of a plant and a transgenic plant in which resistance to blight of blight of blight with blight is enhanced.

Damage caused by plant diseases or pests has been a major obstacle to the stable food supply of mankind along with natural disasters. According to general statistics, plant diseases or insect pests account for about 10% of the total production, respectively, and will be much higher if the pesticides produced by the crops are considered. In addition, large outbreaks of certain pests due to meteorological changes or special environmental changes may cause great social problems.

As part of efforts to control pests such as this, the method of developing artificial synthetic pesticides and using them for controlling has been mainly used in agriculture. However, due to the continuous increase in the population, it is necessary to secure a larger amount of food. Therefore, the mass cultivation of the same quality varieties leads to the mass production of pests and the destruction of natural ecosystems due to the abuse of synthetic pesticides Toxicity to human body, and the emergence of new pests that are drug resistant, have been caused in recent years. In order to replace this, research is underway for the development of new pesticides (low toxic pesticides, natural pesticides or biological pesticides), but the rate of development is not meeting the demand. In addition, the recent proliferation of environmental protection campaigns and the tendency of mankind to take clean, uncontaminated agricultural products are urgently demanding new methods that are harmless to mankind and free from residual toxicity and destruction of natural ecosystems.

Recently, as genetic engineering technology has been developed, disease-resistant transgenic plants have been proposed as an alternative to produce stable food crops while using less pesticides. In addition, research on the disease resistance mechanism of plants has been carried out and a new concept Of plants in the developed countries.

On the other hand, blight of rice blight is caused by X anthomonas oryzae pv . It is a botanical disease caused by oryzae , the edge of the leaf turns yellow and dries gradually and the leaf becomes dry and die.

Recently, the damage is spreading due to global warming, and in Korea, the incidence is increasing in the southern region.

The Xa1 and Xa3 genes, which are resistant to rice blight, are mainly found in Yi Mi-ra, Shin-dongjinbyeon, Dongjin-1, Ju-Nam-ra,

Accordingly, the inventors of the present invention have investigated a method for enhancing resistance to rice blight blight, and confirmed a novel gene capable of promoting resistance to rice blight blight and completed the present invention.

Korean Registered Publication No. 10-0809671

It is an object of the present invention to provide a transgenic vector containing the OsGRX1 gene which promotes rice blight blight resistance.

It is another object of the present invention to provide a transgenic plant improved in rice blight blight resistance using the gene.

It is another object of the present invention to provide a method for enhancing rice blight blight resistance in a plant using the gene.

One embodiment of the present invention provides a recombinant vector that promotes resistance to rice blight blight of a plant, and more particularly, to a blastomerase of Osgza sativa glutaredoxin-related protein (OsGRX1) comprising the nucleotide sequence of SEQ ID NO: 1 1) gene. ≪ / RTI >

As used herein, the term "rice blight blight" means a blight of Xanthomonas oryzae pv . It is a botanical disease caused by oryzae. It shows dryness of the edge of the leaf in yellow and gradually dryness of the leaf. Therefore, in the present invention, "enhancing the resistance of plants to blight of blight of blight of leaves " may mean enhancing resistance to oryzae infection.

According to the above embodiment, the plant capable of promoting resistance to blight of blight may include all the plants susceptible to blight pathogen infection with rice blast, preferably rice.

The OsGRX1 gene comprising the nucleotide sequence of SEQ ID NO: 1 may be expressed as a protein comprising the amino acid sequence of SEQ ID NO: 2.

The OsGRX1 gene is a GRX gene derived from rice ( Osyza sativa ), and may be a gene known in NCBI Accession number KP099431.

As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

As used herein, the term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is delivered into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "expression vector" is often used interchangeably with a "recombinant vector ". The term "recombinant vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed by using prokaryotic cells or eukaryotic cells as hosts. For example, when the recombinant vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter (for example, pL? Promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) , Ribosome binding sites for initiation of detoxification, and transcription / translation termination sequences.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as Bar, glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, Bleomycin, But are not limited to, antibiotic resistance genes such as hygromycin and chloramphenicol.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Since the selection of the transformant can be carried out by various tissues at various stages, the expression promoter is always preferable in the present invention. Thus, the constant expression promoter does not limit the selectivity.

In the example of the present invention, the recombinant vector OsGRX1-OE prepared by inserting the OsGRX1 gene into the vector pEarlyGate101 containing the p35S promoter is shown in FIG. 2. The OsGRX1-OE vector is downstream from the upstream, Direction, the construct resistance gene Bar, the p35S promoter, and the OsGRX1 gene, but the present invention is not limited to this specific vector.

Another embodiment of the present invention provides a transgenic plant having enhanced rice blight blight resistance resistance transformed with the above recombinant vector.

The plant may include any plant that can be infected by the rice blast fungus pathogen, preferably rice.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of mature pollen or vesicles into Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.

The plant cell into which the vector of the present invention is introduced is not particularly limited to a specific form as long as the cell can be regenerated as a plant. These cells include, for example, cultured cell suspension, protoplasts, leaf sections and callus. The present invention also provides a rice blight-resistant blight-resistant plant produced according to the above method and regenerated through tissue culture.

More specifically, the rice blight-resistant blight-resistant plant according to the present invention can be obtained by transforming a plant with a recombinant vector containing the OsGRX1 gene, followed by induction of callus, rooting and soil purification according to a conventional method. That is, the recombinant expression vector containing OsGRX1 gene was introduced into Agrobacterium and transformed into rice callus using the introduced Agrobacterium. Then, individuals surviving the herbicide can be selected to obtain rice blight-resistant blight-resistant plants.

Another embodiment of the present invention is a method for overexpressing a gene comprising the nucleotide sequence of SEQ ID NO: 1 to raise the intracellular level of the OsGRX1 protein comprising the amino acid sequence of SEQ ID NO: 2 And the like.

The method of overexpressing the gene includes, but is not limited to, a step of transforming a plant cell with a recombinant vector in which the gene is operably linked to a promoter.

The intracellular level refers to the amount present in a cell, which can be controlled by various methods known to those skilled in the art. For example, intracellular levels may be regulated through, but not limited to, regulation at the transcription stage or post-transcription stage. Regulation in the transcription step can be carried out by a method for promoting the expression of a gene known to a person skilled in the art, for example, by preparing a recombinant expression vector comprising the OsGRX1 gene of SEQ ID NO: 1 or a homologous gene thereof in the promoter, Or a method of inserting an expression control sequence for promoting the expression of the gene in the vicinity of the OsGRX1 gene of SEQ ID NO: 1 or a homologous gene thereof. Modulation in post-transcriptional steps may be accomplished by methods known in the art for promoting protein expression, for example, by promoting the stability of mRNA transcribed with the OsGRXl gene of SEQ ID NO: 1 or its functional equivalent, A method of promoting stability or a method of promoting the activity of a protein or protein.

Preferably, in the present invention, increasing the intracellular level of the protein having the amino acid sequence represented by SEQ ID NO: 2 or its equivalent can be performed by overexpressing the gene encoding the protein. Such overexpression may be carried out by methods known to those skilled in the art. For example, the promoter may include a protein having an amino acid sequence represented by SEQ ID NO: 2 or a gene encoding the same, preferably a nucleotide sequence represented by SEQ ID NO: 1 A recombinant expression vector operably linked to a gene having a sequence can be prepared and its expression can be promoted.

The protein equivalent includes homologous proteins having homology to the protein having the amino acid sequence represented by SEQ ID NO: 2.

The protein consisting of the amino acid sequence of SEQ ID NO: 2 consists of 185 amino acids.

The term "homologous protein" means a homologous protein having a sequence homology of preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, and most preferably 99% or more homologous to the amino acid sequence of SEQ ID NO: 2 Refers to a protein having substantially the same function as the OsGRX1 protein of the present invention.

In addition, the gene equivalent includes a homologous gene having homology with the gene having the nucleotide sequence shown in SEQ ID NO: 1.

The OsGRX1 gene having the nucleotide sequence shown in SEQ ID NO: 1 or its homologous gene is encoded by a protein. The OsGRX1 gene having the nucleotide sequence shown in SEQ ID NO: 1 is composed of 558 nucleotides.

The "homologous gene" is a gene having a sequence homology of preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, and most preferably 99% or more, with the nucleotide sequence of SEQ ID NO: Refers to a gene having a function substantially equivalent to the OsGRX1 gene of the present invention. Sequence homology can be analyzed by methods known in the art.

The "substantially homogeneous function" means that it is involved in resistance to rice blight blight. Such functional equivalents include, for example, amino acid sequence variants in which some of the amino acids of the amino acid sequence of SEQ ID NO: 2 are substituted, deleted or added. Substitution of amino acids is preferably conservative substitution. Examples of conservative substitutions of amino acids present in nature are as follows: (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of the amino acid is preferably located at a site that is not directly involved in the activity of OsGRX1 of the present invention. The functional equivalents also include protein derivatives in which some of the chemical structures of the proteins are modified while maintaining the basic skeleton of OsGRX1 and its physiological activity. These include, for example, fusion proteins made by fusion with other proteins such as GFP, while retaining the structural modification and physiological activity to change the stability, storage stability, volatility or solubility of the protein of the present invention.

In one embodiment of the present invention, a recombinant vector comprising the OsGRX1 gene comprising the nucleotide sequence of SEQ ID NO: 1 was prepared and transformed into plant cells to increase the intracellular expression level of rice-derived OsGRX1 protein.

The transformant according to the present invention is not only a gene having the nucleotide sequence of SEQ ID NO: 1 but also a modified sequence in which some nucleotides of SEQ ID NO: 1 are substituted, deleted or added, A base sequence encoding a protein exhibiting an activity equivalent to the activity of the protein expressed from the rice blast, that is, the resistance to rice blight blight, can be used.

The present invention can provide a method for enhancing rice blight blight resistance in a plant using the OsGRX1 gene, and can finally provide a transgenic plant having increased blast resistance to rice blast. By supplying these transgenic plants, it is possible to reduce the use of pesticides, thereby improving productivity and supplying safe agricultural products.

Fig. 1 is a graph showing the results of a comparison between the rice bran blight pathogen Xanthomonas oryzae pv . (1, 3, 6, 12, 24, 48) after oryzae treatment.
FIG. 2 is a schematic diagram showing a recombinant vector OsGRX1-OE containing the OsGRX1 gene. FIG.
FIG. 3 shows the results of analysis of OsGRX1 expression of rice and non-transformant (Dongjin) transformed with OsGRX1-OE vector (A) and Xanthomonas oryzae pv . (B and C) as a result of testing the resistance to oryzae .
FIG. 4 is a graph showing the results of assaying resistance to abiotic stress (ABA) of rice and non-transformant (Dongjin) transformed with OsGRX1-OE vector.

Hereinafter, the present invention will be described in more detail in the following Examples. It should be noted, however, that the following examples are illustrative only and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

< Example  1> Origin of rice OsGRX1  Genetic Isolation and Overexpression Vector Production

<1-1> Origin of rice OsGRX1  Isolation of genes

Genes that were specifically induced by rice blight blight in rice were selected.

Specifically, rice seedlings such as Xanthomonas oryzae pv . After processing oryzae, respectively, the leaf samples were isolated using the following, RT-PCR of total RNA the RNeasy Plant Mini kit (Qiagen) for liver in liquid nitrogen. At first, DNase I (deoxyribonuclease I, Sigma for total RNA, Saint Louis) was treated at room temperature for 15 minutes and then inactivated at 70 ° C for 10 minutes. First-strand cDNA was synthesized from the final 20 μl reaction mixture by adding 1 μl of reverse transcriptase SuperScript III (200 units / μl, Invitrogen, CA), 1 μg of total RNA and oligo Respectively. 1 μl of the first strand cDNA and rTaq polymerse (5 units / μl, Takara) were used. After preheating at 95 ° C for 2 minutes, the mixture was incubated at 95 ° C for 30 seconds, at 55 ° C for 30 seconds, 25 cycles were performed, and the final amplification was performed at 72 ° C for 10 minutes. The PCR products were observed after electrophoresis on 1% agarose gel. As the primers for carrying out the PCR, primers shown in Table 1 below were used, and the expression level of OsGRX1 gene was analyzed using the actin gene OsActin as a control (FIG. 1).

SEQ ID NO: primer  designation primer  direction The sequence (5 '- &gt; 3') 3 OsGRX1 RT-F Forward CACCATGGCGAGATTGATGTCGTC 4 OsGRX1 RT-R Reverse TCATGATGATTCGTTTTGTTCAC 5 OsActin-F Forward TGCTATGTACGTCGCCATCCAG 6 OsActin-R Reverse AATGAGTAACCACGCTCCGTCA

As a result, it was found that Xanthomonas oryzae pv . The expression of OsGRX1 gene was greatly increased by treatment with oryzae . Particularly, rice bloom, Xanthomonas oryzae pv . The expression of OsGRX1 gene was increased 3 hours after oryzae treatment (Fig. 1).

Therefore, the OsGRX1 gene (Locus tag: Os01g0530400, NCBI Accession number: KP099431) was predicted to be related to the blast resistance of rice blast fungus, and the cDNA of OsGRX1 gene was isolated from rice. The isolated rice-derived OsGRX1 gene is shown in SEQ ID NO: 1, and the corresponding amino acid sequence is shown in SEQ ID NO: 2.

<1-2> OsGRX1  Generation of gene overexpression vector

A vector overexpressing the rice-derived OsGRX1 gene was constructed.

Specifically, cDNA was amplified by PCR using a OsGRX1-attB1 primer (SEQ ID NO: 7) and an OsGRX1-attB2 primer (SEQ ID NO: 8) from rice samples, and the primers contained AttR1 and AttR2 recombination sites, respectively 2). PCR was performed for 30 cycles of 94 ° C for 30 seconds - 58 ° C for 1 minute - 72 ° C for 1 minute, and then extended at 72 ° C for 10 minutes. The amplified cDNA was cloned into the pDONR201 vector (Invitrogen, Carlsbad, Calif.) Through a BP clonase reaction (Invitrogen, Carlsbad, Calif.) To produce an entry clone. OsGRX1-OE was transformed through the LR clonase reaction between the OsGRX1 entry clone into which the OsGRX1 gene was introduced and the pEarlyGate101 (Gateway ™, Belgium) vector (FIG. 2).

SEQ ID NO: primer  designation primer  direction The sequence (5 '- &gt; 3') 7 OsGRX1-attB1 Forward AAAAAGCAGGCTTGATGGCGAGATTGATGTCGTC 8 OsGRX1-attB2 Reverse AGAAAGCTGGGTTCCATGATGATTCGTTTTGTTCAC

< Example  2> rice OsGRX1  Genetically overexpressing transformants and overexpression assays

The OsGRX1-OE vector prepared in Example 1-2 was transformed into rice and the overexpression of the OsGRX1 gene was confirmed in the transformed plants.

Specifically, in order to construct a transformant overexpressing the OsGRX1 gene, the OsGRX1-OE overexpression vector prepared in the above 1-2 was transformed into Agrobacterium-mediated transformation (Hiei et al., 1994) Respectively.

The seeds of the peeled rice (variety: Dongjin) were sterilized in 70% EtOH for 1 minute, in 50% Clorox solution in 15 minutes for 15 minutes, and for 3 minutes in sterilized water. The disinfected seeds were exposed to 2N6 medium (Hiei, Y. et al., 1994) and incubated for 4 weeks at 28 ° C in a dark state to form an embryogenic callus. The seeds were transferred to fresh 2N6 medium, Lt; / RTI &gt; Agrobacterium LBA4404 prepared by introducing the pEarlyGate101 / OsGRX1 vector prepared in the above <1-2> into Agrobacterium tumefaciens LBA4404 by electroporation was suspended in an AB agar medium (50 mg (50 mg / l of spectinomycin, 10 mg / l of tetracycline) to obtain an OD600 of 1.8 to 2.0 &lt; RTI ID = 0.0 &gt; . The suspension of the callus cultured in the new medium for 4 days and the Agrobacterium LBA4404 species were co-cultured for 10 minutes and then transferred to 2N6-AS medium (Hiei, Y. et al., 1994) Lt; / RTI &gt; for 3 days. After 3 days, the callus was washed several times with sterilized water containing 250 mg / L cell cefotaxime and transferred to 2N6-CP medium supplemented with 250 mg / L cell TAM and 6 mg / L L-phosphinothricin And cultured for 3 weeks in a dark state at 28 캜. After 3 weeks, the unfiltered callus was transferred to fresh 2N6-CP and cultured for another 2 weeks. After two weeks, the surviving calli were resuspended in MSR-CP (1 ml) containing 30 g / l sucrose, 2 mg / l kinetine, 0.5 mg / l NAA, 250 mg / pH 5.8) and cultured at 26 ° C for one month under constant light conditions. One month later, the cells were transferred to a new MSR-CP and further cultured. The shoots thus formed were transferred to MS0 (pH 5.8) containing 30 g / l sucrose and cultured at 27 to 29 ° C / light to form roots. After 7 days of root formation, they were planted in a pot and cultured in a greenhouse. One week after transfer to the greenhouse, 0.3% of Basta was treated to select survivors. OsGRX1 overexpressing transformants were transferred to the greenhouse and cultured for another 2 weeks. Then, 0.1% of Basta was treated to select one more transformant and cultured for another 4 weeks.

As a result, 16 overexpressed transformants were selected. Total RNA was isolated from selected transformants, and RTase was used to generate cDNA. RT-PCR was performed with OsGRX1 gene-specific primers (SEQ ID NOS: 3 and 4) to examine over-expression of OsGRX1 gene.

As a result, it was confirmed that OsGRX1 was overexpressed in the transformant than in the non-transformant Dongjin (Fig. 3A).

< Example  3> OsGRX1  Of over-expressing transformants Blight of rice blight  Resistance test

The resistance of the overgrown rice of OsGRX1 gene produced in Example 2 to rice blight of rice blast was confirmed.

Specifically, Xanthomonas oryzae pv. oryzae ( XOO ) (KACC10859) was cultured in Peptone Sucrose agar medium (PSA) at 28 DEG C for 2 days to an OD600 = 1.0. The Xanthomonas oryzae pv. oryzae (Xoo) (KACC10859) then diluted with the MgCl ₂ of 10 mM, control rice soaked in the solution and the scissors (O. sativa L. cv. Dongjin) and transformants selected by the object 16 in the <Example 2> (Karganilla et al ., 1973; Kauffman et al., 1973). The disease progression of the inoculated rice was observed for 14 days and samples were taken and the length of the lesion was measured with a ruler.

As a result, it was confirmed that all 16 transgenic plants overexpressing the OsGRX1 gene were more resistant to blight of blight than those of the control group (Figs. 3B and 3C).

< Example  4> OsGRX1  Overexpression of rice Abiotic  Resistance to stress

In order to confirm whether OsGRX1 is resistant to abiotic stress, ABA was treated with OsGRX1 gene to confirm the growth of rice.

Specifically, three days after the germination of OsGRX1 gene-transformed rice, the cells were transferred to a 1/2-MS (Murashige & Skoog, 1962) medium supplemented with 5 μM ABA. Five days later, the lengths of the rice stem and root were measured. As a result, it was confirmed that the growth conditions in the stem and root of the non-transformed Dongjin rice and the transformant after ABA treatment were excellent in the transformant (FIG. 4).

These results indicate that OsGRX1 is also involved in resistance to abiotic stress.

<110> Republic of Korea <120> Transgenic plant overexpressing OsGRX1 gene with resistance for          bacterial blight and method for producing same <130> p16r12d1627 <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 558 <212> DNA <213> Artificial Sequence <220> <223> OsGRX1 gene <400> 1 atggcgagat tgatgtcgtc cgccctcatc aggggtctcg tgagatcgag ctgctcgccg 60 accgtagctg ctgtggccca accaactatc catcagttta ggaactactc atcaggactt 120 ggtggcgatt ctactgcaac tggggactca agttcaacac gagttgctgc tgatcctgat 180 acacatcaag atttccagcc tacaaccaaa agttccaaca tgtcttttga tgacattgtt 240 tctcaggata tcaaggagaa cccagtcctg atctacatga agggttatcc tgatgctcct 300 aggtgtgggt tcagtgcgtt ggcagttaga gtcctcaagc aatatgatgt ccctatcagt 360 gctagggata ttttgggaga cctcaagctc aaagagagtg tcaaagccca caccaactgg 420 cctacatttc cacaaatatt tatcaaagga gagtttgttg ggggatctga tatcatatta 480 gatatgcatc agaagggtca gcttaaggat gtgcttggtg atattgcaca aaagcgtgaa 540 caaaacgaat catcatga 558 <210> 2 <211> 185 <212> PRT <213> Artificial Sequence <220> <223> OsGRX1 <400> 2 Met Ala Arg Leu Met Ser Ser Ala Leu Ile Arg Gly Leu Val Arg Ser   1 5 10 15 Ser Cys Ser Pro Thr Val Ala Ala Val Ala Gln Pro Thr Ile His Gln              20 25 30 Phe Arg Asn Tyr Ser Ser Gly Leu Gly Gly Asp Ser Thr Ala Thr Gly          35 40 45 Asp Ser Ser Thr Arg Val Ala Ala Asp Pro Asp Thr His Gln Asp      50 55 60 Phe Gln Pro Thr Thr Lys Ser Ser Asn Met Ser Phe Asp Asp Ile Val  65 70 75 80 Ser Gln Asp Ile Lys Glu Asn Pro Val Leu Ile Tyr Met Lys Gly Tyr                  85 90 95 Pro Asp Ala Pro Arg Cys Gly Phe Ser Ala Leu Ala Val Val Leu             100 105 110 Lys Gln Tyr Asp Val Pro Ile Ser Ala Arg Asp Ile Leu Gly Asp Leu         115 120 125 Lys Leu Lys Glu Ser Val Lys Ala His Thr Asn Trp Pro Thr Phe Pro     130 135 140 Gln Ile Phe Ile Lys Gly Glu Phe Val Gly Gly Ser Asp Ile Ile Leu 145 150 155 160 Asp Met His Gln Lys Gly Gln Leu Lys Asp Val Leu Gly Asp Ile Ala                 165 170 175 Gln Lys Arg Glu Gln Asn Glu Ser Ser             180 185 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsGRX1 RT-F <400> 3 caccatggcg agattgatgt cgtc 24 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OsGRX1 RT-R <400> 4 tcatgatgat tcgttttgtt cac 23 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OsActin-F <400> 5 tgctatgtac gtcgccatcc ag 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> OsActin-R <400> 6 aatgagtaac cacgctccgt ca 22 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> OsGRX1-attB1 <400> 7 aaaaagcagg cttgatggcg agattgatgt cgtc 34 <210> 8 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> OsGRX1-attB2 <400> 8 agaaagctgg gttccatgat gattcgtttt gttcac 36

Claims (6)

A recombinant vector comprising OsGR1 (Osyza sativa glutaredoxin-related protein 1) gene comprising the nucleotide sequence of SEQ ID NO: 1, which promotes resistance of the plant to blight of blight of blight. 2. The recombinant vector according to claim 1, wherein the gene is expressed as a protein consisting of the amino acid sequence of SEQ ID NO: 2. A transgenic plant having enhanced blight resistance to rice blight transformed with the recombinant vector of claim 1 or 2. 4. The plant according to claim 3, wherein the plant is a rice plant. 2. A method for promoting resistance to blight of rice blast foliage comprising over-expressing a gene comprising the nucleotide sequence of SEQ ID NO: 1 to increase the expression level of OsGRX1 protein comprising the amino acid sequence of SEQ ID NO: 2. 6. The method according to claim 5, wherein the gene overexpressing method comprises transforming a plant cell with a recombinant vector operably linking the gene to a promoter.

Images