KR20240048578A - Method for producing salt-stress resistant plants using PgGH18 gene from Panax ginseng - Google Patents

Abstract

The present invention relates to a method for producing salt stress-tolerant plants using the ginseng gene PgGH18 (Pg_S7804.4). For the first time in ginseng, the relationship between genes belonging to the GH18 family was analyzed, and among these, Pg_S7804.4 (PgGH18) was identified. Salt stress tolerance function was identified through overexpression transformation. The GH18 gene of the present invention is a gene that plays an important role in environmental stress, and can be usefully applied to the breeding industry by inducing plants resistant to abiotic stress.

Description

Method for producing salt-stress resistant plants using PgGH18 gene from Panax ginseng}

The present invention relates to a method for producing salt stress-tolerant plants using the ginseng gene PgGH18 (Pg_S7804.4).

Ginseng has a long cultivation period of 4-6 years and is exposed to continuous environmental stress. As a result, ginseng, the most commonly used plant, becomes susceptible to diseases that cause its roots to rot, which also affects production. It is well known that cultivated ginseng is very vulnerable to abiotic stress (salt, drought, heavy metal stress, etc.). These stress factors can reduce the quality of ginseng during the 4-6 year cultivation period, and one such stress is salt stress. When growing crops in the soil, fertilizers are used to promote the growth of the crops. If these fertilizers are used excessively, the nutrients contained in the fertilizers accumulate in the soil, and the salts accumulated in the soil are absorbed into the soil. By changing the pH, it ultimately has the effect of inhibiting the growth of crops.

Therefore, in order to increase the stability of ginseng production, it is necessary to breed new varieties that are resistant to environmental stresses such as salt, moisture, and dryness. By finding salt resistance genes in ginseng and confirming that plants have resistance when there are many genes, it can be used to develop an evaluation system that can select breeding materials for cultivating new varieties.

Korean Patent Publication No. 10-2021-0085328 (published on July 8, 2021)

The purpose of the present invention is to provide a composition for enhancing salt stress tolerance in plants containing the Pg_S7804.4 protein, a member of the GH18 series derived from ginseng, or the gene encoding it, as an active ingredient.

In addition, another object of the present invention is to transform a plant with a recombinant vector containing a gene encoding the Pg_S7804.4 protein, which is a member of the ginseng-derived GH18 series, and overexpress the Pg_S7804.4 gene. Salt stress tolerance of the plant. The aim is to provide a method for improving or producing a transgenic plant with improved salt stress tolerance.

In addition, another object of the present invention is to provide a transgenic plant with improved salt stress tolerance prepared according to the above method and a transformed seed thereof.

In order to achieve the above object, the present invention provides a composition for enhancing salt stress tolerance in plants containing the ginseng-derived GH18 series Pg_S7804.4 protein or the gene encoding it as an active ingredient.

In addition, the present invention provides a method for improving the salt stress tolerance of plants, which includes the step of transforming plants with a recombinant vector containing a gene encoding the Pg_S7804.4 protein, which is a member of the ginseng-derived GH18 series, and overexpressing the Pg_S7804.4 gene. Provides a method.

In addition, the present invention is a transformation with improved salt stress tolerance comprising the step of transforming a plant with a recombinant vector containing a gene encoding the Pg_S7804.4 protein, a ginseng-derived GH18 series, and overexpressing the Pg_S7804.4 gene. Provides a method for producing plants.

Additionally, the present invention provides transgenic plants with improved salt stress tolerance prepared according to the above method.

Additionally, the present invention provides transformed seeds of the transgenic plant with improved salt stress tolerance.

The present invention relates to a method for producing salt stress-tolerant plants using the ginseng gene PgGH18 (Pg_S7804.4). For the first time in ginseng, the relationship between genes belonging to the GH18 family was analyzed, and among these, Pg_S7804.4 (PgGH18) was identified. Salt stress tolerance function was identified through overexpression transformation. The GH18 gene of the present invention is a gene that plays an important role in environmental stress, and can be usefully applied to the breeding industry by inducing plants resistant to abiotic stress.

Figure 1 shows the results of genome-wide identification and tissue expression of the ginseng-derived GH18 family. The yellow color of the heatmap indicates high level expression, and the blue color indicates low level expression. The right side shows the classification of the GH18 family according to Table 2. PgGH18, whose functional properties were confirmed in the present invention and named Pg_S7804.4, is indicated with a red box.
Figure 2 shows the results of phylogenetic tree and gene structure analysis of the GH18 family of ginseng and Arabidopsis thaliana. Pink represents the ginseng gene, and yellow represents the exon structure of the Arabidopsis gene.
Figure 3 shows the results of multiple alignment of Class III GH18 proteins derived from ginseng and Arabidopsis thaliana. The black line represents the signal peptide, and the blue line represents the catalytic domain. The red box is the DXDXE motif.
Figure 4 shows the multiple alignment results of the ginseng-derived Class IIIb GH18 member. The red box is the DXDXE motif, and proteins of this class contain the DIDYE conserved sequence.
Figure 5 shows the results of multiple alignment of Class V GH18 members derived from ginseng and Arabidopsis thaliana.
Figure 6 shows the expression profile of PgGH18 in ginseng.
Figure 7 shows the results of cloning and overexpressing PgGH18 and producing Arabidopsis thaliana.
Figure 8 shows the results of intracellular localization analysis.
Figure 9 shows the results of germination experiments of WT and PgGH18 overexpression lines in response to salt stress.
Figure 10 shows the response results of WT and PgGH18 overexpressing plants to salt stress.

The present invention provides a composition for enhancing salt stress tolerance in plants containing the ginseng-derived GH18 series protein Pg_S7804.4 or the gene encoding it as an active ingredient.

The “Pg_S7804.4 protein” used in the present invention may consist of the amino acid sequence of SEQ ID NO: 1, and the “Pg_S7804.4 gene” may consist of the nucleic acid sequence of SEQ ID NO: 2.

In addition, the present invention provides a method for improving the salt stress tolerance of plants, which includes the step of transforming plants with a recombinant vector containing a gene encoding the Pg_S7804.4 protein, which is a member of the ginseng-derived GH18 series, and overexpressing the Pg_S7804.4 gene. Provides a method.

In addition, the present invention is a transformation with improved salt stress tolerance comprising the step of transforming a plant with a recombinant vector containing a gene encoding the Pg_S7804.4 protein, a ginseng-derived GH18 series, and overexpressing the Pg_S7804.4 gene. Provides a method for producing plants.

Preferably, the transgenic plant may be Arabidopsis thaliana, but is not limited thereto.

The term “recombinant” herein refers to a cell that replicates a heterologous nucleic acid, expresses a heterologous nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene segments that are not found in the natural form of the cell, either in sense or antisense form. Additionally, recombinant cells can express genes found in cells in their native state, but the genes have been modified and reintroduced into the cells by artificial means.

The term “recombinant expression vector” herein refers to a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector. Broadly speaking, any plasmid and vector can be used as long as it can replicate and stabilize within the host. Important characteristics of the expression vector are that it has an origin of replication, a promoter, a marker gene, and a translation control element.

An expression vector containing the gene sequence of the present invention and appropriate transcription/translation control signals can be constructed by methods well known to those skilled in the art. The methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombinant technology. The DNA sequence can be effectively linked to an appropriate promoter within an expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

Expression vectors of the invention will preferably contain one or more selectable markers. The marker is a nucleic acid sequence that has characteristics that can be generally selected by chemical methods, and includes all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, Bleomycin, hygromycin, and chloramphenicol. Resistance genes, aadA genes, etc. are included, but are not limited to these.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, histone promoter, or Clp promoter, but is not limited thereto. The term "promoter" refers to the region of DNA upstream from a structural gene and refers to the DNA molecule to which RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in plant cells. A “constitutive promoter” is a promoter that is active under most environmental conditions and developmental states or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of transformants can be accomplished at various stages and by various tissues. Therefore, constitutive promoters do not limit selection possibilities.

In the recombinant vector of the present invention, common terminators can be used, examples of which include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens ), the terminator of the Octopine gene, and the rrnB1/B2 terminator of E. coli, but are not limited thereto. Regarding the necessity of terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly preferred in the context of the present invention.

Additionally, the present invention provides transgenic plants with improved salt stress tolerance prepared according to the above method.

The transgenic plant of the present invention can be produced through the introduction of a target gene into a plant, which can be done using a vector containing the target gene, and a method of transporting the vector of the present invention into a plant host cell is known in the art. It is known. For example, gene gun-mediated transformation method (bombardment), Agrobacterium-mediated transformation method, microinjection method, calcium phosphate precipitation method, electroporation method, liposome-mediated transfection method, and DEAE-dextran treatment method. However, it is not limited to this.

Additionally, the present invention provides transformed seeds of the transgenic plant with improved salt stress tolerance.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

< Experiment example >

1. GH18 family gene discovery and sequence analysis

To find genes belonging to the GH18 family, we searched the Ginseng genome database ( http://ginsengdb.snu.ac.kr/index.php ) for protein sequences containing the Pfam (PF00704) of GH18, and domain analysis was performed using SMART. did. Arabidopsis GH18 family genes were retrieved from TAIR ( https://www.arabidopsis.org/ ) and used for phylogenetic analysis. Multiple amino acid sequences were aligned using ClustalX and a phylogenetic tree was constructed by the neighbor-joining method using MEGA4. Conserved motifs were analyzed through Multiple Em for Motif Elicitation (MEME) ( http://meme-suite.org/tools/meme ).

2. Ginseng materials, growth conditions and processing

P. ginseng cv. Chunpung seeds and 2- and 4-year-old plants grown in ginseng fields of the Rural Development Administration were used to collect various tissues 3 weeks after germination. Zygotic embryos from seeds were germinated in Murashige and Skoog (MS) medium (Duchefa Biochemie, The Netherlands) containing 30 ppm gibberellins. Three-week-old ginseng seedlings were treated in 100mM NaCl solution for 0, 6, 12, 24, and 48 hours. Seedlings and various ginseng tissues were immediately frozen in liquid nitrogen after each treatment and stored at -80°C for RNA extraction. The growth temperature conditions for ginseng plants were maintained at 22°C.

3. Arabidopsis growth conditions

Wild-type Arabidopsis thaliana was used as a control. Arabidopsis seeds were surface sterilized with sodium hypochlorite and 70% ethanol and rinsed five times with distilled water. Seeds were sown on medium containing 1/2 MS, 1% (w/v) sucrose, MES and 0.8% (w/v) plant agar. Seeds were dormant at 4°C for 3 days and then transferred to a 22°C incubator and placed under 16-hour light and 8-hour dark conditions.

4. PgGH18 Generation of overexpression transgenic Arabidopsis plants.

To create a GH18 overexpressing 35S:HA-PgGH18 transformant, a Hemagglutinin (HA) tag sequence and a linker sequence (GGGGS) were added in front of the CDS using GH18-F (ATGGCAGCCTTGTCACAAG) and GH18-R (CTAGATACTGCCTTTGATAGCAGAGCTA) primers. For cloning, the 35S:HA-GH18 vector was created by inserting the HA-GH18 PCR product into the pH7WG2 binary vector. The GH18 overexpression vector was introduced into Agrobacterium tumefaciens strain GV3101 using electroporation. To introduce the 35S:HA-GH18 vector from Agrobacterium to Arabidopsis, a transformation method called floral dip was used. The floral dip transformation method is a method of infecting Arabidopsis flowers with Agrobacterium strains and then harvesting the formed seeds. Transgenic plants were selected on a medium containing hygromycin and screened based on the expression level of the PgGH18 gene.

5. RNA extraction, cDNA synthesis and gene expression analysis

Total RNA was extracted using the RNeasy kit (Qiagen) with additional DNase I treatment. Then, 1 μg of total RNA was used for cDNA synthesis using PrimeScript reverse transcriptase (Takara). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was analyzed with a CFX96 connect Real-time PCR machine (Bio-Rad) using 200 μg of cDNA in a volume of 20 μl using SYBR Green Master Mix (Qiagen). According to the conditions recommended by the manufacturer, 39 cycles of 95°C for 2 minutes, 95°C for 5 seconds, and 60°C for 15 seconds were performed. The relative expression level is It was calculated using the formula.

The PgActin gene was used as a control to normalize relative gene expression levels and analyze the expression levels of ginseng. Gene-specific primer (qGH18-R, qGH18-F) sequences are described in Table 1. In Arabidopsis, AtActin and IPP2 genes were used to control their relative expression.

Name 5’ - Sequence - 3’ Notes GH18-F CACCATG TACCCATACGATGTTCCAGATTACGCT
GGAGGAGGAGGGAACAATGGCAGCCTTGTCACAAG HA tag sequence was underlined linker sequence was typed in bold GH18-R CTAGATACTGCCTTTGATAGCAGAGCTA For gateway cloning GH18-pGreen F ATGGCAGCTTGTCACAA For tobacco infiltration GH18-pGreen R GATACTGCCTTTGATAGC For tobacco infiltration qGH18-F TCGCCTAAGCGCTGATATTT For qRT_ PCR qGH18-R AAGTCGATGCCATCCAAAAC For qRT_ PCR qPgActin_F AGAGATTCCGCTGTCCAGAA For qRT_ PCR qPgActin_R ATCAGCGATACCAGGGAACA For qRT_ PCR qAtActin_F CAGTGTCTGGATCGGAGGAT For qRT_ PCR qAtActin_R TGAACAATCGATGGACCTGA For qRT_ PCR qIPP2-F GTATGAGTTGCTTCTCCAGCAAAG For qRT_ PCR qIPP2-R GAGGATGGCTGCAACAAGTGT For qRT_ PCR

6. Overexpression and Confocal Microscopic analysis

The pGreen vector containing C-terminal green fluorescent protein (GFP) for fluorescence detection was used for gene cloning to observe intracellular protein localization. The vector was cut with restriction enzymes Hind3 and BamH1, and PgGH18 CDS was cloned into the cut site. For overexpression, a double 35S promoter was attached in front of CDS. This vector was introduced into A. tumefaciens strain GV3101 and Nicotiana benthamiana was infected. After infection, the cells were left in dark conditions at 22°C for 24 hours, and GFP was observed using a confocal microscope (K1-Fluo, Nanoscope systems, Korea) 3 days after infection.

< Example 1> Discovery of GH18 family genes in ginseng

To find all genes containing the GH18 domain in ginseng, protein sequences were searched based on Pfam (PF00704) in the Ginseng genome database. Twenty-eight GH18 genes were found, and SMART confirmed that 26 genes had a GH18 domain. Pg_S 4659.1 and Pg_S3332.5 have steroid binding domains, so these two genes were excluded from Table 2. Sequence analysis shows that, excluding one gene, the amino acid length of GH18 varies from 189 to 3376, with an average of 284 amino acids (Table 2). Only one gene, Pg_S5173.2, has 838 amino acids, and as a result of sequence comparison with other genes, it was found to have an incorrect sequence. Excluding this gene, the remaining 25 genes had predicted molecular masses ranging from 20.9 to 41.4 kDa. The isoelectric point of GH18 protein varied from 4.62 to 8.35. Similarly, the amino acid range of the GH18 family genes of Cucumis sativus ranged from 132 to 429 with an average of 307, the molecular weight ranged from 14.80 to 48.5 kDa, and the isoelectric point ranged from 4.6 to 9.53 (Bartholomew et al . 2019).

To determine whether the transcription of 26 GH18 family genes differed between tissues, bioinformatic expression was predicted using ginseng transcriptome data published in the ginseng genome database. The results showed that the expression of ginseng genes varied depending on the organ and tissue (Figure 1). Some genes were expressed rarely, and some were expressed in almost all tissues, such as Pg_S7804.4.

Gene ID Class Gene position pfam CDS(bp) Size(aa) MW(kDa) pi Start End(+/-) Pg_S0302.44 Ⅲ 783515 789738(+) PF00704 813 270 30.4 5.29 Pg_S0614.43 Ⅴ 685225 686693(+) PF00704 1131 376 41.4 6.99 Pg_S0614.44 Ⅴ 693046 693921(-) PF00704 876 291 31.8 4.88 Pg_S0857.50 Ⅲ 736029 736937(-) PF00704 909 302 33.8 5.17 Pg_S1047.4 Ⅲ 43775 44662(+) PF00704 888 295 31.7 5.39 Pg_S1055.35 Ⅲ 514307 514993(-) PF00704 687 228 25.0 4.93 Pg_S1055.36 Ⅲ 528803 529489(-) PF00704 687 228 25.0 4.63 Pg_S1055.37 Ⅲ 531389 532087(-) PF00704 699 232 25.6 5.18 Pg_S3332.3 Ⅲ 20986 21882(+) PF00704 897 298 31.4 4.74 Pg_S3332.4 Ⅲ 23769 24665(+) PF00704 897 298 31.4 4.74 Pg_S3580.12 Ⅲ 111054 112106(-) PF00704 576 191 21.1 5.89 Pg_S3824.11 Ⅲ 158989 159894(-) PF00704 906 301 33.5 5.39 Pg_S3912.1 Ⅲ 51958 52770(-) PF00704 813 270 30.5 4.90 Pg_S4646.4 Ⅴ 40585 41376(-) PF00704 792 263 22.8 5.87 Pg_S4659.2 Ⅲ 17588 18484(-) PF00704 897 298 31.4 4.62 Pg_S4659.3 Ⅲ 24549 25445(-) PF00704 897 298 31.3 4.64 Pg_S4975.6 Ⅲ 92194 98366(-) PF00704 960 319 35.4 5.97 Pg_S5104.4 Ⅲ 42642 43211(+) PF00704 570 189 20.9 5.21 Pg_S5104.5 Ⅲ 44435 45355(+) PF00704 921 306 33.9 4.74 Pg_S5104.6 Ⅲ 47663 48589(+) PF00704 927 308 34.0 5.07 Pg_S5173.2 Ⅲ 12327 27645(+) PF00704 2517 838 91.8 8.80 Pg_S5375.3 Ⅲ 46724 48092(-) PF00704 864 287 31.1 5.75 Pg_S6123.6 Ⅲ 38756 41433(+) PF00704 1059 352 37.7 7.53 Pg_S7269.1 Ⅲ 3611 4507(-) PF00704 897 298 31.5 5.00 Pg_S7655.1 Ⅲ 9436 10332(+) PF00704 897 298 31.5 4.78 Pg _S7804.4 Ⅲ 27346 29407(-) PF00704 978 325 35.2 8.35

< Example 2> Phylogenetic and motif analysis of GH18 protein

To understand the evolutionary relationships of GH18 proteins in plant species, the amino acid sequences of 26 GH18 family proteins from ginseng and 10 GH18 family proteins from Arabidopsis were isolated and aligned. The GH18 families of ginseng and Arabidopsis thaliana have similar protein sequences. Therefore, a phylogenetic tree was constructed to determine the classification of the ginseng GH18 gene (Figure 2). However, among the genes in Table 2, Pg_S5173.2 and At4G01040 were excluded from the phylogenetic tree due to incorrect alignment.

The chitinase class of the ginseng GH18 gene was classified using the 10 GH18 family genes of Arabidopsis that had already been classified into classes, and was largely divided into Class III and V. In ginseng, chitinase class was classified for the first time. Ginseng genes were classified into 23 class III and 3 class V. Comparing ginseng genes with Arabidopsis thaliana, only 1 out of 10 genes in Arabidopsis belongs to class IIIa. On the other hand, more than half of the GH18 family genes in ginseng belong to class III. Additionally, there are no Arabidopsis thaliana sequences belonging to Class IIIb, and while there are 9 Arabidopsis genes belonging to Class V, there are only 4 genes in ginseng.

To study the structural conservation and diversity of the GH18 gene, we examined the exon-intron structure and the distribution of conserved motifs. Class IIIa and V have one or two exons, and Class IIIb has only one exon and no intron (Figure 2b). The number of introns in Class V varies from 0, 1, 2, or 6 (Figure 2b).

To determine the degree of conservation of gene sequences of ginseng and Arabidopsis thaliana belonging to chitinase, multiple alignment was performed on class proteins. Analysis of the amino acid sequence revealed a GH18 catalytic domain (PF00704) with CHITINASE_18 (PS01095) activity characteristics in class III and V chitianse (Figures 3, 4, and 5). The GH18 family has a conserved motif called DXDXE. Pg_S6123.6 is similar in sequence and pattern to PgGH18, but the difference is that the N-terminal part is longer.

Looking at Figure 5, you can see that both classes III and V have the DXDXE motif. In Class III, this motif is divided into DFDIE and DIDYE, which becomes the standard for division into IIIa and IIIb (Figure 4). On the other hand, in Class V, there is only one gene (Pg_S0302.44) without DXDXE, so if only this gene is removed and aligned, the conserved motif can be confirmed (Figure 5).

< Example 3> of PgGH18 Expression analysis

Recently, it was confirmed that Pg_S7804.4 showed high reactivity when ginseng was treated with salt. Through non-targeted proteomic analysis, this gene was identified as a protein highly expressed in ginseng leaves after exposing ginseng roots to a salt solution. Therefore, we selected this gene for further characterization as PgGH18 .

First, to confirm the expression of PgGH18 in ginseng tissues, real-time PCR was performed using seeds, leaves, stems, roots, root hairs, rhizomes, flowers, internal roots, and external roots of 2-year-old and 4-year-old roots. The transcription level of PgGH18 varied among tissues, with the highest expression in root hairs (Figure 6a). The root expression level of PgGH18 was higher than that in leaves and stems. Among root tissues, the highest expression was shown in external roots containing the epidermis and cortex. In contrast, the inner roots containing the mesocarp had almost no expression (Figure 6a).

Next, we investigated the molecular mechanism of stress tolerance adapted by ginseng plants to survive salt exposure by examining the expression of PgGH18 using qRTPCR. The expression of PgGH18 increased 10-fold in NaCl-treated ginseng seedlings when exposed for 48 hours (Figure 6b). These data show that PgGH18 can respond to salt stress.

< Example 4> PgGH18 overexpression

To determine whether PgGH18 has salt tolerance, the PgGH18 gene was overexpressed in Arabidopsis. Insertion of PgGH18 was confirmed in the Arabidopsis genome by PCR. A total of 30 independent homozygous overexpressor lines were generated, of which #20, 22, and 28 with high expression values were selected. Their phenotype was no different from the wild type, and it was confirmed that PgGH18 was overexpressed through qRT-PCR and Western blot (Figure 7).

The GFP-conjugated PgGH18 structure was created to experimentally confirm the location of PgGH18. Blank GFP protein was used as a control, and GFP of the control was found in the nucleus, cell membrane, and cytoplasm (Figure 8). PgGH18 protein was mainly found in the cytoplasm and nuclear periphery (Figure 8b-e). Compared to the nuclear marker NLS-mcherry, fluorescence was observed at the periphery of the nuclear membrane rather than inside the nucleus. When tobacco cells were stained with FM4-64, which stains the cell membrane red, a yellow signal appeared in the cell membrane, partially overlapping with the PgGH18-GFP signal (Figure 8f). To determine whether the signal was located in the cell wall, infected leaves were treated with 1 M NaCl, resulting in protoplast detachment ( Fig. 8E ). PgGH18-GFP signals were mainly found in the cytoplasm and membrane, as well as in the apoplast, predicting that they may also be present in the cell wall (Figure 8e). Similarly, in sugarcane, ScChi, a chitinase class III gene, was reported to be located in the nucleus, cytoplasm, and cell membrane (Su et al . 2014).

< Example 5> Resistant to salt stress PgGH18 overexpression line

To study the effect of PgGH18 overexpression on salt stress tolerance, transgenic plants treated with NaCl were used. To determine the germination rate under salt stress, wild type and overexpressed PgGH18ox #20, 22, and 28 were grown in 1/2MS medium containing 0mM and 150mM NaCl for 10 days (Figure 9a). Under normal conditions, the wild type showed a germination rate of 81.3%, and the transgenic plants showed a germination rate of 96.7%, 97.3%, and 98%, respectively. The germination rate of Arabidopsis thaliana grown in medium treated with 150mM NaCl was reduced compared to that in untreated medium in all lines. However, while the wild type significantly decreased by about 15% from 81.3% to 66%, the overexpression lines decreased to within 5%, and the germination rate of PgGH18ox #28 actually increased (Figure 9b).

To determine the cause of the higher germination rate, wild-type and overexpression lines were grown vertically in medium containing 100mM NaCl. After 7 days, differences in root length were confirmed. Arabidopsis plants treated with NaCl had shorter roots than those without treatment. However, among seedlings grown in medium treated with 100mM NaCl, it was observed that the overexpression lines had longer roots than the control group (Figure 10a). Since salt stress tolerance is related to ROS signaling, ROS accumulation was confirmed. As a result of DAB staining, a staining reagent sensitive to hydrogen peroxide (H ₂ O ₂ ), salt-treated roots had a darker color than untreated roots, and the PgGH18ox lines accumulated darker root colors than the wild type (FIG. 10b). We also used H2DCF-DA, an intracellular ROS staining reagent that stains hydroxyl, peroxyl and other ROS production within living cells, and observed more fluorescence in the root tips of the PgGH18ox line compared to the wild type upon NaCl treatment.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred implementation examples and do not limit the scope of the present invention.

Claims (6)

A composition for enhancing salt stress tolerance in plants comprising the Pg_S7804.4 protein, a member of the GH18 series derived from ginseng, or the gene encoding it, as an active ingredient. A method for enhancing salt stress tolerance of a plant, comprising the step of transforming a plant with a recombinant vector containing a gene encoding the Pg_S7804.4 protein, a member of the ginseng-derived GH18 series, and overexpressing the Pg_S7804.4 gene. A method for producing a transgenic plant with improved salt stress tolerance, comprising the step of transforming the plant with a recombinant vector containing a gene encoding the Pg_S7804.4 protein, a GH18 family member derived from ginseng, and overexpressing the Pg_S7804.4 gene. The method of claim 3, wherein the transgenic plant is Arabidopsis thaliana. A transgenic plant with improved salt stress tolerance prepared according to the method of claim 3 or 4. A transformed seed of the transgenic plant with improved salt stress tolerance according to claim 5.