KR102609984B1 - Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder - Google Patents

Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder Download PDF

Info

Publication number
KR102609984B1
KR102609984B1 KR1020210127390A KR20210127390A KR102609984B1 KR 102609984 B1 KR102609984 B1 KR 102609984B1 KR 1020210127390 A KR1020210127390 A KR 1020210127390A KR 20210127390 A KR20210127390 A KR 20210127390A KR 102609984 B1 KR102609984 B1 KR 102609984B1
Authority
KR
South Korea
Prior art keywords
kif5a
expression
flounder
infection
mir
Prior art date
Application number
KR1020210127390A
Other languages
Korean (ko)
Other versions
KR20230044816A (en
Inventor
김희수
박은경
Original Assignee
부산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 부산대학교 산학협력단 filed Critical 부산대학교 산학협력단
Priority to KR1020210127390A priority Critical patent/KR102609984B1/en
Publication of KR20230044816A publication Critical patent/KR20230044816A/en
Application granted granted Critical
Publication of KR102609984B1 publication Critical patent/KR102609984B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/315Assays involving biological materials from specific organisms or of a specific nature from bacteria from Streptococcus (G), e.g. Enterococci
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/26Infectious diseases, e.g. generalised sepsis

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 넙치의 스트렙토코커스 파라우베리스(Streptococcus parauberis) 감염에 의한 질병 진단용 바이오마커 조성물, 진단용 조성물, 진단 키트 또는 진단을 위한 정보 제공 방법에 관한 것으로, 본 발명에 따르면 스트렙토코커스 파라우베리스에 감염된 넙치의 경우, 정상 대조군보다 miR-140-3p의 발현 수준이 저하되며, 상기 miR-140-3P의 표적유전자인 KIF5A의 발현 수준이 높아지는 것을 확인하였으므로 이를 이용해 넙치의 스트렙토코커스 파라우베리스 감염 여부를 정확하게 진단할 수 있어, 넙치 양식 산업에 크게 기여할 수 있다.The present invention relates to a biomarker composition, diagnostic composition, diagnostic kit, or method for providing information for diagnosis of diseases caused by Streptococcus parauberis infection in flounder. According to the present invention, Streptococcus parauberis infected In the case of flounder, the expression level of miR-140-3p was confirmed to be lower than that of the normal control group, and the expression level of KIF5A, the target gene of the miR-140-3P, was confirmed to be higher. Therefore, this was used to determine whether flounder was infected with Streptococcus parauberis. By being able to diagnose accurately, it can greatly contribute to the flounder farming industry.

Description

넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 조성물{Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder}Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder}

본 발명은 넙치의 스트렙토코커스 파라우베리스(Streptococcus parauberis) 감염 여부를 진단할 수 있는 조성물에 관한 것이다.The present invention relates to a composition capable of diagnosing Streptococcus parauberis infection in flounder.

넙치(olive flounder)는 우리나라 수산업 및 양식업 시장에서 큰 부분을 차지하는 고부가가치 양식 생물이다. 하지만 매년 다양한 어류질병이 발생하는 바, 막대한 피해가 야기되고 있다.Flounder (olive flounder) is a high-value farmed organism that accounts for a large portion of Korea's fisheries and aquaculture markets. However, various fish diseases occur every year, causing enormous damage.

수산 양식에 있어, 어류질병의 발생은 양식 어류의 누적되는 폐사로 인한 직접적인 경제적 피해 초래와 더불어 수산용 약제의 사용 증가와 관리 비용 증가 등 제반 양식경비를 증가시켜 결과적으로 생산성을 저하시킬 뿐 아니라, 민감한 사회적 문제인 항생제 잔류 문제로부터 자유롭지 못하게 하여 고품질의 안전한 수산물 생산을 어렵게 한다. 이러한 양식 어류의 질병에 대한 예방 및 처치 대책 마련은 비단 우리나라뿐만 아니라 세계 여러 나라에서 주요한 관심사가 되고 있다.In aquaculture, the occurrence of fish diseases not only causes direct economic damage due to the cumulative death of farmed fish, but also increases overall aquaculture expenses such as increased use of aquatic chemicals and increased management costs, which ultimately reduces productivity. It makes it difficult to produce high-quality and safe marine products by preventing us from being free from the problem of antibiotic residues, which is a sensitive social issue. Preventing and treating diseases in farmed fish is becoming a major concern not only in Korea but also in many countries around the world.

스트렙토코커스 파라우베리스는 양식 어류에서 연쇄구균증(Streptococcosis)을 야기하는 대표적인 원인균으로 잘 알려져 있고, 스트렙토코커스 파라우베리스 외에도 스트렙토코커스 이니에(Streptococcus iniae, S. iniae), 스트렙토코커스 디피실리스(Streptococcus difficilis, S. difficilis), 스트렙토코커스 실로이(Streptococcus shiloi, S. shiloi), 및 락토코커스 가르비에(Lactococcus garvieae) 등의 다양한 세균들이 연쇄구균증의 원인균으로 보고되고 있다. 그러나, 이중 스트렙토코커스 파라우베리스가 가장 빈번하게 발견되는 연쇄구균증의 원인균으로 알려져 있다.Streptococcus parauberis is well known as a representative causative agent of streptococcosis in farmed fish. In addition to Streptococcus parauberis , Streptococcus iniae (S. iniae ) and Streptococcus difficile ( Various bacteria, such as Streptococcus difficilis, S. difficilis , Streptococcus shiloi, S. shiloi, and Lactococcus garvieae , have been reported as the causative agents of streptococcus pneumoniae. However, Streptococcus parauberis is known to be the most frequently discovered causative agent of streptococci.

연쇄구균증에 걸린 넙치의 외부소견으로는 채색흑화, 안구 돌출 및 충혈, 복부 팽만, 탈장 등을 보이며, 내부적으로는 복수가 고이거나 복벽의 출혈, 심장내 농양 등의 소견을 보이게 된다. 또한 특이적으로 어떤 경우는 별다른 소견 없이 아가미만 부식되는 경우도 가끔 관찰되기도 한다. 연쇄구균증은 주로 치어보다는 성어에서 발병률이 높아 경제적인 피해가 다른 세균성 질병에 비해 상대적으로 높게 나타난다.External findings of flatfish infected with streptococcus include darkening of color, eye protrusion and bloodshot eyes, abdominal distension, and hernia, while internal findings include accumulation of ascites, bleeding in the abdominal wall, and intracardiac abscess. Additionally, in some cases, only the gills are corroded without any special findings. The incidence of streptococci is higher in adult fish than in fry, so the economic damage is relatively high compared to other bacterial diseases.

따라서 스트렙토코커스 파라우베리스에 의한 질병은 넙치 양식 산업에 막대한 피해를 야기하는 바, 넙치의 스트렙토코커스 파라우베리스 감염 여부를 정확하게 파악할 수 있는 기술이 요구되고 있다.Therefore, diseases caused by Streptococcus parauberis cause enormous damage to the flounder farming industry, and a technology that can accurately determine whether flounder is infected with Streptococcus parauberis is required.

한편 바이러스와 박테리아를 비롯한 여러 병원균에 감염되었을 때 생체 내에서 마이크로RNA(MicroRNA, miRNA)의 발현 패턴에 변화가 일어나게 되는데, 이렇게 감염 전후에 그 발현 패턴에 차이가 있는 miRNA를 DEmiRNA(differentialy expressed miRNA)라고 한다.Meanwhile, when infected with various pathogens, including viruses and bacteria, changes occur in the expression pattern of microRNA (miRNA) in vivo. MiRNAs with differences in expression patterns before and after infection are called DEmiRNA (differentially expressed miRNA). It is said.

현재 넙치의 miRNA에 대하여 많은 연구가 행해졌으나, 스트렙토코커스 파라우베리스 감염 시 넙치의 miRNA 발현 변화에 대해서는 명확하게 보고된 바 없다.Currently, many studies have been conducted on the miRNAs of flatfish, but there has been no clear report on changes in the expression of miRNAs in flatfish during Streptococcus parauberis infection.

본 발명자들은 스트렙토코커스 파라우베리스에 감염된 넙치를 정확하게 진단할 수 있는 방법에 대하여 연구하던 중, 스트렙토코커스 파라우베리스에 감염된 넙치의 특정 유전자의 발현 변화를 확인하여 본 발명을 완성하였다.While researching a method for accurately diagnosing flatfish infected with Streptococcus parauberis, the present inventors completed the present invention by confirming changes in the expression of specific genes in flatfish infected with Streptococcus parauberis.

따라서 본 발명의 목적은 넙치의 스트렙토코커스 파라우베리스(Streptococcus parauberis) 감염에 의한 질병 진단용 바이오마커 조성물을 제공하는 것이다.Therefore, the purpose of the present invention is to provide a biomarker composition for diagnosing diseases caused by Streptococcus parauberis infection in flounder.

본 발명의 다른 목적은 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 조성물을 제공하는 것이다. Another object of the present invention is to provide a composition for diagnosing diseases caused by Streptococcus parauberis infection in flounder.

본 발명의 또 다른 목적은 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 키트를 제공하는 것이다. Another object of the present invention is to provide a kit for diagnosing diseases caused by Streptococcus parauberis infection in flounder.

본 발명의 또 다른 목적은 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단을 위한 정보 제공 방법을 제공하는 것이다. Another object of the present invention is to provide a method of providing information for diagnosing diseases caused by Streptococcus parauberis infection in flounder.

상기 목적을 달성하기 위하여, 본 발명은 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 넙치의 스트렙토코커스 파라우베리스(Streptococcus parauberis) 감염에 의한 질병 진단용 바이오마커 조성물을 제공한다.In order to achieve the above object, the present invention provides a biomarker composition for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising at least one selected from the group consisting of miR-140-3p and KIF5A. .

또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상의 발현 또는 활성을 측정하는 제제를 포함하는, 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 조성물을 제공한다.In addition, in order to achieve the above other object, the present invention is a disease caused by Streptococcus parauberis infection in flounder, comprising an agent for measuring the expression or activity of one or more selected from the group consisting of miR-140-3p and KIF5A. A diagnostic composition is provided.

또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 바이오마커 조성물 또는 진단용 조성물을 포함하는 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 키트를 제공한다.In addition, in order to achieve the above other object, the present invention provides a kit for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising the biomarker composition or diagnostic composition according to the present invention.

또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 시료로부터 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상의 발현 또는 활성을 측정하는 단계를 포함하는 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단을 위한 정보 제공 방법을 제공한다.In addition, in order to achieve the above other object, the present invention is a method of measuring the expression or activity of one or more selected from the group consisting of miR-140-3p and KIF5A from a sample. Provides a method of providing information for disease diagnosis.

본 발명은 스트렙토코커스 파라우베리스(Streptococcus parauberis)에 감염된 넙치와 정상 개체의 특정 유전자의 발현 변화를 확인한 것으로, 스트렙토코커스 파라우베리스에 감염된 넙치의 경우, 정상 대조군보다 miR-140-3p의 발현 수준이 저하되며, KIF5A의 발현 수준이 높아지는 것을 확인하였으므로 이를 넙치의 스트렙토코커스 파라우베리스(Streptococcus parauberis) 감염 여부를 진단하기 위한 바이오마커 조성물, 진단용 조성물, 진단용 키트 또는 정보 제공 방법 등에 유용하게 활용할 수 있어 넙치 양식 산업에 크게 기여할 수 있다.The present invention confirmed changes in the expression of specific genes in flounder infected with Streptococcus parauberis and normal individuals. In the case of flounder infected with Streptococcus parauberis , the expression level of miR-140-3p was higher than that in the normal control group. Since it was confirmed that this decreases and the expression level of KIF5A increases, it can be usefully used in biomarker compositions, diagnostic compositions, diagnostic kits, or information provision methods for diagnosing Streptococcus parauberis infection in flounder. It can greatly contribute to the flounder aquaculture industry.

도 1은 스트렙토코커스 파라우베리스에 감염된 넙치와 정상 넙치의 특정 유전자 발현 수준을 비교한 결과로, 도 1 중 A는 miR-140-3p의 발현 수준을 비교한 결과이고, 도 1 중 B는 KIF5A 발현 수준을 비교한 결과이다.
도 2는 뇌조직 유래 세포주에서 miR-140-3p와 KIF5A 유전자의 발현 상관관계를 확인한 결과이다.
Figure 1 shows the results of comparing the expression levels of specific genes between flounder infected with Streptococcus parauberis and normal flounder. A in Figure 1 is the result of comparing the expression levels of miR-140-3p, and B in Figure 1 is the result of comparing the expression levels of KIF5A. This is the result of comparing expression levels.
Figure 2 shows the results of confirming the expression correlation between miR-140-3p and KIF5A gene in brain tissue-derived cell lines.

이하, 본 발명에 대해 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 넙치의 스트렙토코커스 파라우베리스(Streptococcus parauberis) 감염에 의한 질병 진단용 바이오마커 조성물을 제공한다.The present invention provides a biomarker composition for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising at least one selected from the group consisting of miR-140-3p and KIF5A.

본 발명에 있어서, 상기 스트렙토코커스 파라우베리스(Streptococcus parauberis, S. parauberis)는 국내 넙치 양식장에서 높은 분리율을 보이며 연쇄상구균 감염증의 주요 원인체로 떠오르고 있다. S. parauberis에 감염된 넙치는 체색흑화, 무안측출혈, 비정상적인 유영과 섭식이 불량해지며 만성소모성(cachexia)으로 폐사가 발생한다. 특히 S. parauberis 감염 질병은 감염성을 지닌 바, 이를 정확하게 진단할 수 있는 기술 개발이 반드시 필요하다.In the present invention, Streptococcus parauberis ( S. parauberis ) shows a high isolation rate in domestic flounder farms and is emerging as a major cause of streptococcal infection. Flounder infected with S. parauberis suffers from blackening of the body, anophthalmic hemorrhage, abnormal swimming and poor feeding, and death due to chronic wasting (cachexia). In particular, since S. parauberis infectious diseases are infectious, it is essential to develop technology to accurately diagnose them.

본 발명에 있어서, "miRNA(microRNA)"는, mRNA의 3' 비번역 영역(UTR) 부위와의 염기결합을 통해 전사 후 억제자 역할을 하는 대략 22 nt의 비번역 RNA를 의미한다.In the present invention, "miRNA (microRNA)" refers to an untranslated RNA of approximately 22 nt that acts as a post-transcriptional repressor through base binding to the 3' untranslated region (UTR) region of mRNA.

본 발명의 일실시예에 다르면, 스트렙토코커스 파라우베리스에 감염된 넙치의 경우 miRNA인 miR-140-3p의 발현이 정상 개체 대비 현저히 감소하였으며, 이의 표적유전자인 KIF5A의 발현은 정상 개체 대비 증가한 것을 확인하였다.According to one embodiment of the present invention, in the case of flounder infected with Streptococcus parauberis, the expression of the miRNA, miR-140-3p, was significantly decreased compared to normal individuals, and the expression of its target gene, KIF5A, was confirmed to be increased compared to normal individuals. did.

따라서 본 발명은 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병인 연쇄상구균감염증 감염 여부를 진단하는데 사용할 수 있다.Therefore, the present invention can be used to diagnose streptococcal infection, a disease caused by Streptococcus parauberis infection in flounder.

본 발명에 있어서, "진단"은 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 상기 진단은 발병 여부뿐만 아니라 예후, 경과, 병기 등의 모니터링에 필요한 객관적인 기초정보를 제공할 수 있으며, 의사의 임상학적 판단 또는 소견은 제외된다. 본 발명의 목적상, 진단은 스트렙토코커스 파라우베리스에 의한 질병, 즉 연쇄상구균감염증의 발병, 경과, 병기 상태 또는 특징을 확인하는 것을 의미한다.In the present invention, “diagnosis” means confirming the presence or characteristics of a pathological condition. The above diagnosis can provide objective basic information necessary for monitoring not only the occurrence of the disease but also the prognosis, progress, stage, etc., and excludes the doctor's clinical judgment or opinion. For the purposes of the present invention, diagnosis means confirming the onset, course, stage, or characteristics of a disease caused by Streptococcus parauberis, that is, streptococcal infection.

본 발명에 있어서, "바이오마커"는 진단용 마커로도 쓰일 수 있으며, 생물학적 시료에서 스트렙토코커스 파라우베리스에 의한 질병의 발생 여부를 구분하여 진단할 수 있는 물질로, 정상 시료에 비하여 스트렙토코커스 파라우베리스 감염 개체에서 채취한 시료에서 발현 증가 또는 감소를 보이는 특정 인자를 의미한다.In the present invention, a "biomarker" can also be used as a diagnostic marker, and is a substance that can diagnose and distinguish whether a disease caused by Streptococcus parauberis has occurred in a biological sample. Compared to a normal sample, a "biomarker" is a substance that can diagnose the occurrence of a disease caused by Streptococcus parauberis. It refers to a specific factor that shows increased or decreased expression in samples collected from Rhys-infected individuals.

또한 본 발명은 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상의 발현 또는 활성을 측정하는 제제를 포함하는, 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 조성물을 제공한다.The present invention also provides a composition for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising an agent for measuring the expression or activity of at least one selected from the group consisting of miR-140-3p and KIF5A.

상기 제제는 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상에 특이적으로 결합하는 올리고펩타이드, 모노클로날 항체, 폴리클로날 항체, 키메릭(chimeric) 항체, 리간드, PNA(Peptide nucleic acid), 앱타머(aptamer), 안티센스 올리고뉴클레오티드, 프라이머 또는 프로브일 수 있으나, 이에 제한되는 것은 아니다.The agent includes oligopeptides, monoclonal antibodies, polyclonal antibodies, chimeric antibodies, ligands, and PNA (peptide nucleic acids) that specifically bind to one or more selected from the group consisting of miR-140-3p and KIF5A. It may be an acid), an aptamer, an antisense oligonucleotide, a primer, or a probe, but is not limited thereto.

본 발명에 있어서, 상기 "항체"는 당해 분야에서 공지된 용어로서 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 의미한다. 본 발명의 목적상, 항체는 본 발명의 바이오마커인 KIF5A에 특이적으로 결합하는 항체를 의미하며, 이러한 항체는, 각 유전자를 통상적인 방법에 따라 발현벡터에 클로닝하여 상기 마커 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 단백질로부터 통상적인 방법에 의해 제조될 수 있다. 여기에는 상기 단백질에서 만들어질 수 있는 부분 펩티드도 포함된다. 본 발명의 항체의 형태는 특별히 제한되지 않으며 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이면 그것의 일부도 본 발명의 항체에 포함되고 모든 면역 글로불린 항체가 포함된다. In the present invention, the “antibody” is a term known in the art and refers to a specific protein molecule directed to an antigenic site. For the purpose of the present invention, an antibody refers to an antibody that specifically binds to KIF5A, a biomarker of the present invention, and such an antibody is encoded by the marker gene by cloning each gene into an expression vector according to a conventional method. Proteins can be obtained and manufactured from the obtained proteins by conventional methods. This also includes partial peptides that can be made from the above proteins. The form of the antibody of the present invention is not particularly limited, and as long as it is a polyclonal antibody, monoclonal antibody, or has antigen binding properties, a portion thereof is also included in the antibody of the present invention, and all immunoglobulin antibodies are included.

본 발명의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 바이오마커의 검출에 사용되는 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 뜻하며 Fab, F(ab'), F(ab') 2 및 Fv 등이 있다.The antibodies used for the detection of biomarkers for diagnosing diseases caused by Streptococcus parauberis infection of the present invention include intact forms with two full-length light chains and two full-length heavy chains, as well as functional fragments of the antibody molecule. . Functional fragments of antibody molecules refer to fragments that possess at least an antigen-binding function and include Fab, F(ab'), F(ab') 2, and Fv.

본 발명에 있어서, "프라이머"는 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시할 수 있다. 구체적으로, miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상의 폴리뉴클레오티드의 센스 및 안티센스 프라이머를 이용한 PCR 증폭을 실시하여 원하는 생성물의 생성 여부를 통해 스트렙토코커스 파라우베리스 감염 여부를 진단할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다.In the present invention, a "primer" is a nucleic acid sequence with a short free 3' hydroxyl group that can form a base pair with a complementary template and serves as a starting point for copying the template strand. refers to a short nucleic acid sequence that functions as a Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. Specifically, Streptococcus parauberis infection can be diagnosed by performing PCR amplification using sense and antisense primers of one or more polynucleotides selected from the group consisting of miR-140-3p and KIF5A to determine whether the desired product is produced. there is. PCR conditions and lengths of sense and antisense primers can be modified based on those known in the art.

본 발명에 있어서, "프로브"는 mRNA와 특이적 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며 라벨링 되어 있어서 특정 mRNA의 존재 유무를 확인할 수 있다.In the present invention, "probe" refers to a nucleic acid fragment, such as RNA or DNA, ranging from a few bases to several hundred bases in length, capable of forming a specific binding to mRNA, and is labeled to confirm the presence or absence of a specific mRNA. You can.

프로브는 올리고뉴클로타이드(oligonucleotide) 프로브, 단일가닥 DNA(single stranded DNA) 프로브, 이중가닥 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 적당한 프로브의 선택 및 혼성화 조건은 당업계에 공지된 것을 기초로 변형할 수 있다.Probes may be manufactured in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, etc. Selection of appropriate probes and hybridization conditions can be modified based on those known in the art.

본 발명의 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.Primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, “capsation,” substitution of a native nucleotide with one or more homologs, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidate, carbamate, etc.) or charged linkages (e.g. phosphorothioate, phosphorodithioate, etc.).

더불어 본 발명은 본 발명에 따른 바이오마커 조성물 또는 진단용 조성물을 포함하는 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 키트를 제공한다.In addition, the present invention provides a kit for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising the biomarker composition or diagnostic composition according to the present invention.

본 발명의 구체예에서, 상기 키트는 RT-PCR 키트, DNA 칩 키트 또는 단백질 칩 키트일 수 있으며, 이에 제한되지 않는다.In an embodiment of the present invention, the kit may be an RT-PCR kit, a DNA chip kit, or a protein chip kit, but is not limited thereto.

상기 키트에는 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상을 포함하는 바이오마커 조성물, 또는 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상의 발현 또는 활성을 측정하는 제제뿐만 아니라, 면역학적 분석에 사용되는 당 분야에서 일반적으로 사용되는 도구, 시약 등이 포함될 수 있다.The kit includes a biomarker composition containing at least one selected from the group consisting of miR-140-3p and KIF5A, or an agent for measuring the expression or activity of at least one selected from the group consisting of miR-140-3p and KIF5A. , tools and reagents commonly used in the art used for immunological analysis may be included.

상기 도구 또는 시약의 일 예로, 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 발색단(chromophores), 용해제, 세정제, 완충제, 안정화제 등이 포함되나 이에 제한되지 않는다. 표지물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다. 담체는 가용성 담체, 불용성 담체가 있고, 가용성 담체의 일 예로 당 분야에서 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS가 있고, 불용성 담체의 일 예로 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로오스 및 이들의 조합일 수 있다.Examples of the tools or reagents include, but are not limited to, suitable carriers, labeling substances capable of generating detectable signals, chromophores, solubilizers, detergents, buffers, stabilizers, etc. If the labeling substance is an enzyme, it may include a substrate that can measure enzyme activity and a reaction stopper. Carriers include soluble carriers and insoluble carriers. Examples of soluble carriers include physiologically acceptable buffers known in the art, such as PBS, and examples of insoluble carriers include polystyrene, polyethylene, polypropylene, polyester, and polyester. It may be acrylonitrile, fluororesin, cross-linked dextran, polysaccharide, polymers such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof.

본 발명의 키트는 상술한 바이오마커 조성물 또는 진단용 조성물을 구성으로 포함하므로, 중복된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.Since the kit of the present invention includes the above-described biomarker composition or diagnostic composition, duplicate content is omitted to avoid excessive complexity of the specification.

또한 본 발명은 시료로부터 넙치의 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상의 발현 또는 활성을 측정하는 단계를 포함하는 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단을 위한 정보 제공 방법을 제공한다.In addition, the present invention provides a method for providing information for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising measuring the expression or activity of one or more selected from the group consisting of flounder's miR-140-3p and KIF5A from a sample. provides.

본 발명의 정보 제공 방법에 있어서, 상기 miR-140-3p의 발현 또는 활성이 정상 대조군 대비 낮은 경우 질병이 발생한 것으로 진단하며, 상기 KIF5A의 발현 또는 활성이 정상 대조군 대비 높은 경우 질병이 발생한 것으로 진단할 수 있다.In the information provision method of the present invention, the disease is diagnosed when the expression or activity of the miR-140-3p is low compared to the normal control group, and the disease is diagnosed when the expression or activity of the KIF5A is high compared to the normal control group. You can.

본 발명에 있어서, "시료"란 본 발명의 유전자 또는 단백질의 발현이 검출될 수 있는 대상 개체로부터 얻어지는 모든 시료를 의미한다.In the present invention, “sample” refers to any sample obtained from a subject in which expression of the gene or protein of the present invention can be detected.

바람직하게는, 상기 시료는 생검(biopsy), 혈액, 혈청, 혈장, 림프액, 뇌척수액, 복수, 피부 조직, 액체 배양물, 분변 및 소변으로 이루어진 군에서 선택된 1 종 이상일 수 있으며, 특별히 이에 제한되지 않고, 본 발명의 기술분야에서 통상적으로 사용되는 방법으로 처리하여 준비될 수 있다.Preferably, the sample may be one or more selected from the group consisting of biopsy, blood, serum, plasma, lymph, cerebrospinal fluid, ascites, skin tissue, liquid culture, feces and urine, but is not particularly limited thereto. , it can be prepared by processing by a method commonly used in the technical field of the present invention.

본 발명에 있어서 "miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상의 발현 또는 활성을 측정"이란, 예컨대, 스트렙토코커스 파라우베리스 감염 여부를 진단하기 위하여 생물학적 시료에서의 본 발명에 따른 바이오마커 유전자에서 발현된 단백질 또는 이를 코딩하는 mRNA의 존재 여부와 발현 정도를 확인하는 과정일 수 있으며, 상기 단백질 또는 이를 코딩하는 mRNA에 대하여 특이적으로 결합하는 분자를 이용하여 단백질 또는 이를 코딩하는 mRNA의 양을 확인하는 것이다.In the present invention, “measuring the expression or activity of any one or more selected from the group consisting of miR-140-3p and KIF5A” means, for example, measuring the biochemical test according to the present invention in a biological sample to diagnose Streptococcus parauberis infection. It may be a process of confirming the presence and expression level of a protein expressed from a marker gene or the mRNA encoding it, and the expression of the protein or the mRNA encoding it can be determined by using a molecule that specifically binds to the protein or the mRNA encoding it. To check the quantity.

상기 측정은 miR-140-3p 및 KIF5A로 이루어진 군에서 선택된 어느 하나 이상을 코딩하는 mRNA 양을 확인할 수 있는 공지의 어느 방법이든 사용하여 수행할 수 있다. 이를 위하여 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(competitive RT-PCR), 실시간 중합효소반응(real time RT-PCR), 실시간 역전사효소 중합효소반응(real time quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Northern blotting) 및 DNA칩으로 이루어진 군에서 선택된 1종 이상으로 수행될 수 있으나, 이에 제한되는 것은 아니다.The measurement can be performed using any known method that can confirm the amount of mRNA encoding one or more selected from the group consisting of miR-140-3p and KIF5A. For this purpose, reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real time polymerase reaction (real time RT-PCR), real time quantitative RT- It may be performed with one or more types selected from the group consisting of PCR), RNase protection method, Northern blotting, and DNA chip, but is not limited thereto.

또는 상기 측정은 KIF5A 유전자에서 발현된 단백질을 측정하는 것을 의미하는 것일 수 있으며, 공지의 어느 방법이든 사용하여 수행할 수 있다. 이를 위하여 웨스턴 블랏팅, ELISA(enzyme linked immunosorbent assay), ELLA (enzyme-linked lectin assay), 방사선면역분석(Radioimmunoassay,RIA), 방사 면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(rocket) 면역전기영동, 면역조직화학염색, 면역침전 분석법(Immunoprecipitation Assay), 보체고정분석(Complement Fixation Assay), FACS 및 단백질 칩(protein chip)로 이루어진 군에서 선택된 1종 이상으로 수행될 수 있으나, 이에 제한되는 것은 아니다.Alternatively, the measurement may mean measuring the protein expressed from the KIF5A gene, and can be performed using any known method. For this purpose, Western blotting, ELISA (enzyme linked immunosorbent assay), ELLA (enzyme-linked lectin assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion method, and rocket (rocket) It can be performed with one or more types selected from the group consisting of immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, FACS, and protein chip. , but is not limited to this.

상술한 본 발명의 내용은 상호 모순되지 않는 한, 서로 동일하게 적용되며, 당해 기술분야의 통상의 기술자가 적절한 변경을 가해 실시하는 것 또한 본 발명의 범주에 포함된다.The contents of the present invention described above are applied equally to each other unless they contradict each other, and implementation by a person skilled in the art with appropriate changes is also included in the scope of the present invention.

이하 본 발명을 실시예를 통해 상세하게 설명하나 본 발명의 범위가 하기 실시예로만 한정되는 것은 아니다. Hereinafter, the present invention will be described in detail through examples, but the scope of the present invention is not limited to the following examples.

실시예 1. 스트렙토코커스 파라우베리스에 감염된 넙치 준비Example 1. Preparation of flounder infected with Streptococcus parauberis

일주일간의 순치 과정이 끝난 넙치들을 각 실험군과 대조군으로 나눈 후 스트렙토코커스 파라우베리스 균 감염이 잘 일어나게 되는 고온의 환경에 적응시킬 수 있도록 수조의 온도가 26℃가 될 때까지 매일 1℃씩 올려주었다. 그 후 실험군의 넙치에 스트렙토코커스 파라우베리스 균이 9x103 CFU가 되도록 배양한 배양액 100μl을 피하주사를 통해 주입하고 대조군의 넙치에는 같은 양의 PBS(phosphate buffer saline)를 주입하였다. 균 감염 후 1일 그리고 3일이 지났을 때 대조군과 실험군에서 무작위로 세 마리의 넙치를 선택하여 뇌 조직을 적출하였다. 적출한 뇌 조직은 트리졸(trizol)에 담가 -80℃에서 RNA를 추출하기 전까지 보관하였다. After a week of acclimatization, the flounder was divided into experimental and control groups, and the temperature of the water tank was raised by 1°C every day until it reached 26°C to allow the fish to adapt to the high-temperature environment where Streptococcus parauberis infection occurs easily. . Afterwards, 100 μl of a culture medium containing 9x10 3 CFU of Streptococcus parauberis was injected into the flounder of the experimental group via subcutaneous injection, and the same amount of PBS (phosphate buffer saline) was injected into the flounder of the control group. One and three days after bacterial infection, three flatfish were randomly selected from the control and experimental groups and brain tissue was extracted. The extracted brain tissue was soaked in trizol and stored at -80°C until RNA extraction.

실시예 2. 스트렙토코커스 파라우베리스 감염 넙치와 정상 넙치의 유전자 발현 차이 확인 Example 2. Confirmation of gene expression differences between Streptococcus parauberis-infected flounder and normal flounder

상기 실시예 1의 스트렙토코커스 파라우베리스 감염 넙치와 정상 넙치의 뇌 조직을 채취하고 이로부터 RNA를 추출하였다. 그 후 특정 유전자인 miR-140-3p의 발현 차이를 확인하기 위하여 하임바이오텍사의 HB_I RT Reaction kit를 이용하여 추출한 RNA를 상보적 DNA(complementary DNA, cDNA)로 합성한 후 이를 이용해 실시간 중합효소 연쇄반응(real-time polymerase chain reaction)을 수행하였다. 이 때 실시간 중합효소 연쇄반응은 하임바이오텍사의 HB_I Real-Time PCR Master Mix kit를 사용하여 제조사의 지시에 따라 수행하였고, miR-140-3p의 발현의 정도를 비교하기 위한 참조유전자(reference gene)으로는 RN_U6를 사용하였다. 그 결과 도 1 중 A에 나타낸 바와 같이, 스트렙토코커스 파라우베리스 감염 후 1일 및 3일이 지난 개체의 뇌 조직에서(day post-infection, DPI) miR-140-3p의 발현이 정상 넙치 대비 현저히 감소한 것을 확인하였다.Brain tissues of the Streptococcus parauberis-infected flounder and normal flounder of Example 1 were collected, and RNA was extracted from them. Then, in order to confirm the difference in the expression of a specific gene, miR-140-3p, the extracted RNA was synthesized into complementary DNA (cDNA) using Heim Biotech's HB_I RT Reaction kit, and then real-time polymerase chain reaction was performed using this. (real-time polymerase chain reaction) was performed. At this time, real-time polymerase chain reaction was performed using Heim Biotech's HB_I Real-Time PCR Master Mix kit according to the manufacturer's instructions, and was used as a reference gene to compare the level of expression of miR-140-3p. used RN_U6. As a result, as shown in A in Figure 1, the expression of miR-140-3p in the brain tissue of individuals 1 and 3 days after Streptococcus parauberis infection (day post-infection, DPI) was significantly higher than that of normal flounder. It was confirmed that there was a decrease.

한편, 수지상세포가 항원제시세포로서의 기능을 하는데 기여하는 단백질인 키네신-1(Kinesin-1)의 구성 인자 중 하나인 KIF5A를 miR-140-3p의 표적 유전자 후보로 선정하고, 이의 발현 변화도 확인하였다. 이때 SmartGene사의 SYBR Green Q-PCR Master Mix with High Rox kit를 이용하여 실시간 중합효소 연쇄반응을 수행하였으며, 하기 표 1의 프라이머를 사용하였다.Meanwhile, KIF5A, one of the components of Kinesin-1, a protein that contributes to the function of dendritic cells as antigen-presenting cells, was selected as a target gene candidate for miR-140-3p, and changes in its expression were also confirmed. did. At this time, real-time polymerase chain reaction was performed using SmartGene's SYBR Green Q-PCR Master Mix with High Rox kit, and the primers shown in Table 1 below were used.

프라이머primer 서열(5'-3')Sequence (5'-3') 온도(℃)Temperature (℃) KIF5A_3’UTRKIF5A_3’UTR TGACCCAGTGTCTGTTGCTCTGACCCAGTGTTCTGTTGCTC 6060 TATCTCCCGAATGTGCTTGGTATCTCCCGAATGTGCTTGG GAPDHGAPDH CAACGGCGACACTCACTCCTCCAACGGCGACACTCACTCCTC 6060 TCGCAGACACGGTTGCTGTAGTCGCAGACACGGTTGCTGTAG

그 결과 도 1 중 B에 나타낸 바와 같이, 스트렙토코커스 파라우베리스 감염시 KIF5A의 발현이 증가되는 것을 확인한 바, KIF5A가 miR-140-3p의 유의미한 표적유전자이며 스트렙토코커스 파라우베리스 감염 여부를 판별할 수 있는 진단 마커가 될 수 있음을 확인하였다. As a result, as shown in B of Figure 1, it was confirmed that the expression of KIF5A increased during Streptococcus parauberis infection. KIF5A is a significant target gene of miR-140-3p and can be used to determine whether Streptococcus parauberis is infected. It was confirmed that it could be a possible diagnostic marker.

실시예 3. miR-140-3p와 KIF5A 유전자의 발현 상관관계 확인Example 3. Confirmation of expression correlation between miR-140-3p and KIF5A gene

뇌 조직 유래 세포주인 U373에서 발광효소분석(Luciferase assay)을 통해 miR-140-3p와 KIF5A 유전자의 발현 상관관계를 확인하였다. 유전자 클로닝 (gene cloning) 과정을 통해 KIF5A 유전자의 3’UTR 부분을 포함하는 증폭 부위가 삽입된 psi-CHECK2 벡터 플라스미드(psi-CHECK2 + KIF5A)와 음성대조군을 위한 negative control, miR-140-3p의 시퀀스를 가지는 미믹(mimic), 그리고 미믹에 상보적으로 결합하여 그 기능을 억제하는 억제제(inhibitor)를 발광효소 분석에 이용하였다. 이들을 U373 세포주에 공동-형질주입(co-transfection)하여 결과를 확인하였을 때 도 2와 같이, miR-140-3p 미믹(mimic)을 처리했을 때 KIF5A의 발현이 감소하고, miR-140-3p의 억제제(inhibitor)를 처리했을 때 KIF5A의 발현이 증가하는 것을 확인하였다. 또한 미믹과 억제제를 함께 처리한 경우, 플라스미드만 처리한 컨트롤과 비교시 발현값이 차이가 없을만큼 회복된 것을 확인하였다. 따라서 KIF5A가 miR-140-3p에 의하여 발현이 조절되는 유의미한 표적 유전자임을 확인하였다. The correlation between the expression of miR-140-3p and KIF5A gene was confirmed through luciferase assay in U373, a brain tissue-derived cell line. Through the gene cloning process, the psi-CHECK2 vector plasmid (psi-CHECK2 + KIF5A) into which an amplification site containing the 3'UTR part of the KIF5A gene was inserted and the negative control for the negative control, miR-140-3p A mimic with a sequence and an inhibitor that binds complementary to the mimic and inhibits its function were used in the luminescent enzyme analysis. When these were co-transfected into the U373 cell line and the results were confirmed, as shown in Figure 2, when treated with the miR-140-3p mimic, the expression of KIF5A decreased, and the expression of miR-140-3p was decreased. It was confirmed that the expression of KIF5A increased when treated with an inhibitor. In addition, when the mimic and inhibitor were treated together, it was confirmed that the expression value was recovered to the extent that there was no difference compared to the control treated with only the plasmid. Therefore, it was confirmed that KIF5A is a significant target gene whose expression is regulated by miR-140-3p.

종합적으로 본 발명은 스트렙토코커스 파라우베리스(Streptococcus parauberis)에 감염된 넙치와 정상 개체의 특정 마커의 발현 변화를 확인한 것으로, 스트렙토코커스 파라우베리스에 감염된 넙치의 경우, 정상 대조군보다 miR-140-3p의 발현 수준이 저하되며, 상기 miR-140-3P의 표적유전자인 KIF5A의 발현 수준이 높아지는 것을 확인하였으므로 이를 넙치의 스트렙토코커스 파라우베리스(Streptococcus parauberis) 감염 여부를 진단하기 위한 바이오마커 조성물, 진단용 조성물, 진단용 키트 또는 정보 제공 방법 등에 유용하게 활용할 수 있다.Overall, the present invention confirmed changes in the expression of specific markers in flounder infected with Streptococcus parauberis and normal individuals. In the case of flounder infected with Streptococcus parauberis, the level of miR-140-3p was higher than that in the normal control group. Since it was confirmed that the expression level of KIF5A, a target gene of the miR-140-3P, was decreased and the expression level of KIF5A was increased, a biomarker composition for diagnosing Streptococcus parauberis infection in flounder, a diagnostic composition, It can be useful for diagnostic kits or information provision methods.

Claims (10)

KIF5A; 또는 miR-140-3p 및 KIF5A;을 포함하는 넙치의 스트렙토코커스 파라우베리스(Streptococcus parauberis) 감염에 의한 질병 진단용 바이오마커 조성물.
KIF5A; Or a biomarker composition for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising miR-140-3p and KIF5A.
제 1항에 있어서,
상기 질병은 연쇄상구균감염증인 것을 특징으로 하는, 바이오마커 조성물.
According to clause 1,
A biomarker composition, wherein the disease is a streptococcal infection.
KIF5A의 발현 또는 활성을 측정하는 제제; 또는
miR-140-3p의 발현 또는 활성을 측정하는 제제 및 KIF5A 발현 또는 활성을 측정하는 제제;를 포함하는, 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 조성물.
Agents that measure the expression or activity of KIF5A; or
A composition for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising an agent for measuring the expression or activity of miR-140-3p and an agent for measuring the expression or activity of KIF5A.
제 3항에 있어서,
상기 제제는 miR-140-3p 또는 KIF5A에 특이적으로 결합하는 올리고펩타이드, 모노클로날 항체, 폴리클로날 항체, 키메릭(chimeric) 항체, 리간드, PNA(Peptide nucleic acid), 앱타머(aptamer), 안티센스(anti-sense) 뉴클레오티드, 프라이머 또는 프로브인 것을 특징으로 하는, 진단용 조성물.
According to clause 3,
The agent is an oligopeptide, monoclonal antibody, polyclonal antibody, chimeric antibody, ligand, peptide nucleic acid (PNA), and aptamer that specifically binds to miR-140-3p or KIF5A. , A diagnostic composition, characterized in that it is an anti-sense nucleotide, primer, or probe.
제 1항의 바이오마커 조성물 또는 제 3항의 진단용 조성물을 포함하는 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단용 키트.
A kit for diagnosing diseases caused by Streptococcus parauberis infection in flounder, comprising the biomarker composition of claim 1 or the diagnostic composition of claim 3.
시료로부터 KIF5A; 또는 miR-140-3p 및 KIF5A;의 발현 또는 활성을 측정하는 단계를 포함하는 넙치의 스트렙토코커스 파라우베리스 감염에 의한 질병 진단을 위한 정보 제공 방법.
KIF5A from the sample; Or a method of providing information for diagnosing a disease caused by Streptococcus parauberis infection in flounder, comprising measuring the expression or activity of miR-140-3p and KIF5A.
제 6항에 있어서,
상기 miR-140-3p의 발현 또는 활성이 정상 대조군 대비 낮은 경우 및 KIF5A의 발현 또는 활성이 정상 대조군 대비 높은 경우 질병이 발생한 것으로 진단하는 것을 특징으로 하는, 정보 제공 방법.
According to clause 6,
A method of providing information, characterized in that the disease is diagnosed when the expression or activity of the miR-140-3p is low compared to the normal control and the expression or activity of KIF5A is high compared to the normal control.
제 6항에 있어서,
상기 KIF5A의 발현 또는 활성이 정상 대조군 대비 높은 경우 질병이 발생한 것으로 진단하는 것을 특징으로 하는, 정보 제공 방법.
According to clause 6,
A method of providing information, characterized in that it is diagnosed that a disease has occurred when the expression or activity of KIF5A is higher than that of the normal control group.
제 6항에 있어서,
상기 측정은 역전사 중합효소반응, 경쟁적 역전사 중합효소반응, 실시간 역전사 중합효소반응, RNase 보호 분석법(RPA), 노던 블랏팅 및 DNA 칩으로 구성된 군으로부터 선택된 1 종 이상의 mRNA 검출 방법으로 측정되는 것을 특징으로 하는, 정보 제공 방법.
According to clause 6,
The measurement is characterized in that it is measured by one or more mRNA detection methods selected from the group consisting of reverse transcription polymerase reaction, competitive reverse transcription polymerase reaction, real-time reverse transcription polymerase reaction, RNase protection assay (RPA), Northern blotting, and DNA chip. How to provide information.
제 6항에 있어서,
상기 측정은 웨스턴 블랏팅, ELISA (Enzymelinked immunosorbent assay), ELLA (enzyme-linked lectin assay), 방사선 면역분석법, 방사선 면역확산법, 오우크테로니(Ouchterlony) 면역확산법, 로케트 면역전기영동, 면역조직화학염색, 면역침전분석, 보체고정분석, FACS 및 단백질 칩으로 구성된 군으로부터 선택된 1 종 이상의 단백질 검출 방법으로 측정되는 것을 특징으로 하는, 정보 제공 방법.
According to clause 6,
The measurements include Western blotting, ELISA (Enzymelinked immunosorbent assay), ELLA (enzyme-linked lectin assay), radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, and immunohistochemical staining. , A method of providing information, characterized in that it is measured by one or more protein detection methods selected from the group consisting of immunoprecipitation analysis, complement fixation analysis, FACS, and protein chip.
KR1020210127390A 2021-09-27 2021-09-27 Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder KR102609984B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020210127390A KR102609984B1 (en) 2021-09-27 2021-09-27 Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020210127390A KR102609984B1 (en) 2021-09-27 2021-09-27 Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder

Publications (2)

Publication Number Publication Date
KR20230044816A KR20230044816A (en) 2023-04-04
KR102609984B1 true KR102609984B1 (en) 2023-12-05

Family

ID=85928667

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020210127390A KR102609984B1 (en) 2021-09-27 2021-09-27 Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder

Country Status (1)

Country Link
KR (1) KR102609984B1 (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
"Discovery of differentially expressed miRNAs in response to Streptococcus parauberis infection in zebrafish(Danio rerio)" Thiloma Dhilrukshi Liyanage, 충남대학교 대학원 수의학과 석사학위논문 (2020. 08.) 1부.*

Also Published As

Publication number Publication date
KR20230044816A (en) 2023-04-04

Similar Documents

Publication Publication Date Title
RU2654587C2 (en) Method for predicting breast cancer recurrent during endocrine treatment
EP3082840A1 (en) Methods and assays relating to circulating tumor cells
KR101966493B1 (en) Biomarkers for Predicting Triple Negative Breast Cancer Prognostication
JPWO2012147800A1 (en) Composition and method for predicting therapeutic sensitivity to trastuzumab in breast cancer patients
KR101416147B1 (en) Use of ADCY3 for the Diagnosis and Treatment of Gastric Cancer
KR101418139B1 (en) Compisition and method for diagnosting sex of Pa-ralichthyidae
KR20190114298A (en) Biomarkers for Predicting gastric cancer prognostication or drug reactivity
KR102609984B1 (en) Composition for diagnosing diseases caused by Streptococcus parauberis infection of olive flounder
KR101929009B1 (en) composition for diagnosing stroke and method for diagnosing stroke
KR101657051B1 (en) Marker composition for diagnosis of chronic obstructive pulmonary disease
JP5757032B2 (en) Method for testing fibrosis of chronic liver disease using miRNA
CN112029864B (en) Breast cancer miRNA detection kit and application thereof
KR102505618B1 (en) Urinary exosome-derived miRNA gene biomarkers for diagnosis of antibody-mediated rejection in kidney allografts and use thereof
KR102505617B1 (en) Urinary exosome-derived miRNA gene biomarkers for diagnosis of T cell-mediated rejection in kidney allografts and use thereof
CN108753790B (en) BAVM-associated gene markers and mutations thereof
CN108728531B (en) Application of biomarker CBX8 in preeclampsia diagnosis and treatment
CN116194118A (en) Biomarkers for diagnosing non-alcoholic steatohepatitis using microRNA combinations
KR101871847B1 (en) A biomarker composition for diagnosis of lupus nephritis comprising Immunoglobulin binding protein 1
CN107034272B (en) Application of CXCL2 in preparation of tool for diagnosing or treating lung adenocarcinoma
US20120156681A1 (en) Composition for diagnosis of liver metastasis of colorectal cancer and the use thereof
KR20140147920A (en) Biomaker miR-34a for distinguishing non-alcoholic steatohepatitis
KR102341302B1 (en) COMPOSITION FOR DIAGNOSING LEUKEMIA USING TMEM57 OR NudC
KR102545543B1 (en) Urinary exosome-derived miRNA gene biomarkers for diagnosis of BK virus nephropathy in kidney allografts and use thereof
KR102199000B1 (en) A novel biomarker for diagnosing liver cancer
KR20180099123A (en) Biomarker for predicting resistance to anticancer agent

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant