KR102595837B1 - Cosmetic composition comprising spore oil extracted from antler-shaped Ganoderma lucidum and the method for preparing the same - Google Patents

Abstract

It relates to a cosmetic composition for improving skin condition containing deer antler reishi mushroom spore oil, a food composition, and a method for producing the same.

Description

Cosmetic composition comprising antler-shaped Ganoderma lucidum and the method for preparing the same}

It relates to a cosmetic composition containing deer antler reishi mushroom spore oil or deer antler reishi mushroom spore oil nanoliposomes, a food composition, and a method for producing the same.

Mushrooms belong to the taxonomically higher class of Basidiomycota (some of which are Ascomycota), and about 15,000 species are known worldwide, of which about 2,000 species can be developed for food. Mushrooms are composed of mycelium and fruiting bodies in which metabolites obtained from nutrient metabolism are accumulated. Compared to regular plants, the mycelium corresponds to the roots, stems, and leaves, and the fruiting body corresponds to the flower. The mycelium contains about 4 times more nutrients and about 50 to 60 times more medicinal ingredients than the fruiting body, making mushrooms more effective. It is also referred to as an entity. Recently, extracts of fruiting bodies and mycelia or mycelium cultures have been found to be effective in improving constitution and preventing and treating various diseases, and their use as health foods or medicines is increasing significantly. In particular, polysaccharides of a specific structure produced by mushrooms have long been reported to exhibit anti-cancer effects as immunotherapy agents by activating the immune function in the host, unlike conventional chemotherapy agents. Mushroom polysaccharides can be divided into three types: cell wall polysaccharides that make up the cytoskeleton, intracellular polysaccharides that exist in the form of nutrient storage within the cells, and extracellular polysaccharides that are secreted outside the fungal body. Polysaccharides that make up cell walls and membranes include α-glucan, β-glucan, heteroglucan, and chitin.

Recently, many cosmetics using natural products have been developed to reduce skin irritation caused by external chemicals. Natural materials not only have fewer side effects on the skin, but their development value as cosmetic raw materials is increasing as consumer demand for cosmetics using natural materials increases. Korean Patent No. 10-0863890 describes a cosmetic composition containing mixed extracts of Chaga mushroom, Horseshoe Mushroom, Holy Mushroom, and Helicoptera Mushroom. Additionally, Korean Patent Publication No. 10-2014-0101875 describes maitake mushroom extract and a composition containing the same for promoting sebum production.

Against this background, the present inventors completed the present invention by confirming that spore oil extracted from deer antler reishi mushroom exhibits excellent anti-inflammatory effects, skin wrinkle improvement effects, and moisturizing effects.

One aspect provides a cosmetic composition for improving skin condition comprising deer antler reishi mushroom spore oil.

Another aspect provides a food composition for improving skin condition comprising deer antler reishi mushroom spore oil.

Another aspect provides a method of preparing deer antler reishi mushroom spore oil.

Another aspect provides deer antler reishi mushroom spore oil nanoliposomes.

Another aspect provides a method of preparing deer antler reishi mushroom spore oil nanoliposomes.

Another aspect provides a cosmetic composition for improving skin condition comprising deer antler reishi mushroom spore oil nanoliposomes.

Another aspect provides a food composition for improving skin condition comprising deer antler reishi mushroom spore oil nanoliposomes.

One aspect provides a composition for improving skin condition comprising deer antler reishi mushroom spore oil.

In this specification, the term “skin condition improvement” may be used to collectively mean improving skin condition. Specifically, the skin condition improvement may be anti-inflammatory, skin wrinkle improvement, or skin moisturizing, but is not limited thereto.

The composition may exhibit anti-inflammatory effects. The anti-inflammatory effect refers to the action of suppressing inflammation, and the inflammation may be dermatitis. The dermatitis refers to eczematous dermatitis. In the acute stage, eczema is characterized by itchy vesicles (small blisters), erythema (red changes in the skin), and edema. In the chronic stage, edema and blisters are reduced, while lichenification (lichniscation) causes dryness and swelling. It is a skin disease in which lines that normally exist on the skin (such as palm lines) become more distinct due to hardened skin, scales, and changes in skin color are formed. The dermatitis is, for example, contact dermatitis, atopic dermatitis, and seborrheic dermatitis. In one embodiment, it was confirmed through NO assay and IL-6 ELISA analysis that deer antler reishi mushroom spore oil exhibits a significantly excellent anti-inflammatory effect.

The composition may exhibit an effect of improving skin wrinkles. The term “skin wrinkle improvement” is interpreted not only to mean the action of reducing the number or depth of skin wrinkles, but also to include suppressing skin aging through wrinkle improvement. To improve skin wrinkles, it may contain substances that activate skin fibroblasts and promote collagen production in the dermis. In one embodiment, through procollagen production analysis and Col1a1 mRNA expression level analysis, it was confirmed that deer antler reishi mushroom spore oil exhibited a significantly excellent skin wrinkle improvement effect.

The composition may exhibit a skin moisturizing effect. The term “skin moisturizing” means increasing moisture in the skin and maintaining a moist state. The skin moisturizing effect can help improve skin wrinkles and increase elasticity. In one embodiment, through analysis of the expression level of aquaporin-3 (AQP-3), it was confirmed that deer antler reishi mushroom spore oil exhibits a significantly excellent moisturizing effect.

In this specification, the term " Ganoderma lucidum (Lingzhi mushroom)" is a type of Ganoderma lucidum whose fruiting body resembles an antler (deer horn) and has the characteristic of not rotting and not changing its luster even after death. The types of reishi mushrooms include, in addition to deer antler reishi mushrooms, red reishi mushrooms, black reishi mushrooms, white reishi mushrooms, white reishi mushrooms, washi reishi mushrooms, blue reishi mushrooms, plank reishi mushrooms, and Tsuga reishi mushrooms. The present inventors completed the present invention by confirming that, among many reishi mushrooms, deer antler reishi mushrooms exhibit significantly superior effects in anti-inflammatory, skin wrinkle improvement, and moisturizing. The deer antler reishi mushroom has a gloss like lacquer on the surface of the mushroom cap and mushroom stem. The surface of the mushroom cap is initially yellowish white, then turns yellowish brown or reddish brown, and then turns chestnut brown as it ages. The flesh is corky and has two layers, upper and lower. The upper layer is almost white and the lower layer near the pores is light orange. The lower surface of the cap is yellowish white, has a single layer of 5-10mm long pores, and the pores are round. The mushroom stalk is 3~15Х1~2cm, red brown to black brown, covered with hard cuticle, and slightly curved. The spore seeds are double-layered and the spore pattern is light brown. The deer antler reishi mushroom is also called the elixir of old age, eternal mushroom, longevity antler, and longevity antler reishi mushroom.

As used herein, the term "spore oil" refers to an oil form obtained after drying mushroom spores and crushing them by a physical method. It mainly contains ingredients such as beta-glucan, and contains the active ingredient of deer antler reishi mushroom spores. It is a collection of

The spore oil is extracted from deer antler reishi mushrooms and can be prepared according to conventional methods known in the art, that is, under conventional conditions of temperature and pressure, using conventional solvents, for example, ( a) Water, anhydrous or hydrous lower alcohols having 1-4 carbon atoms (e.g. methanol, ethanol, propanol and butanol), propylene glycol, 1,3-butylene glycol, glycerin, acetone, diethyl ether, ethyl acetate, Solvent extraction using a solvent selected from the group consisting of butyl acetate, dichloromethane, chloroform, hexane, and mixtures thereof (b) supercritical extraction using reduced pressure and high temperature using carbon dioxide, (c) ultrasonic extraction, or (d) fermentation process It can be extracted using .

In one embodiment, the deer antler reishi mushroom spore oil may be produced by supercritical extraction. The supercritical fluid is defined as “a fluid that exists above critical temperature and pressure,” and has unique characteristics that differentiate it from existing general solvent extraction methods. When the pressure of a substance in a supercritical state is changed near its critical point, many physical properties such as density, viscosity, diffusion coefficient, and polarity continuously change significantly from a state close to a gas to a state close to a liquid. If you put liquid carbon dioxide in a sealed container and heat it, you can see that the gas-liquid interface gradually disappears as the temperature and pressure increase. Supercritical fluid can be said to be a heavy fluid that fills a closed space like a gas. Supercritical fluid technology is a technology that utilizes the advantages of supercritical fluids, such as high dissolving power, fast mass transfer and heat transfer, low viscosity, high diffusion coefficient, and fast penetration into micropores due to low surface tension.

In one embodiment, the deer antler reishi mushroom spore oil may be produced by supercritical extraction under conditions of 30 to 50°C and 250 to 400 atm. For example, the deer antler reishi mushroom spore oil supplies a supercritical fluid to the deer antler reishi mushroom spores in a mixed fluid of one or two or more selected from ethanol, methanol, water, ethyl acetate, hexane, and ethyl ether. , can be obtained by supercritical extraction under conditions of 30 to 50°C and 250 to 400 atmospheres.

Various extraction solvents used in the above extraction method, such as water, anhydrous or hydrous lower alcohols having 1-4 carbon atoms (e.g. methanol, ethanol, propanol and butanol), propylene glycol, 1,3-butylene glycol , glycerin, acetone, diethyl ether, ethyl acetate, butyl acetate, dichloromethane, chloroform, hexane, and mixtures thereof. Meanwhile, it is obvious to those skilled in the art that the Ganoderma lucidum extract of the present invention can be obtained using not only the above-mentioned extraction solvent but also other extraction solvents that exhibit substantially the same effect. In addition, the Ganoderma lucidum extract of the present invention includes not only extracts using the above-described extraction solvent, but also extracts that have undergone conventional purification and fermentation processes. For example, decompression with carbon dioxide, extraction by supercritical extraction at high temperature, extraction by ultrasonic extraction, separation using an ultrafiltration membrane with a certain molecular weight cut-off value, and various chromatography methods (size, charge, hydrophobicity or affinity). Active fractions obtained through various additional purification and extraction methods, such as separation by (designed for separation according to gender) or extracts from fermentation products using natural conditions or various microorganisms, may also be included in the extract of the present invention.

The composition contains less than 1% (v/v), more than 0.0001% (v/v) to less than 1% (v/v), more than 0.001% (v/v) of deer antler reishi mushroom spore oil relative to the total weight of the composition. Less than 1% (v/v), 0.01% (v/v) or more to less than 1% (v/v), 0.1% (v/v) or more to less than 1% (v/v), 0.0001% (v/ v) to 0.9% (v/v), 0.0001% (v/v) to 0.8% (v/v), 0.0001% (v/v) to 0.7% (v/v), 0.0001% (v/v) to 0.6% (v/v), 0.0001% (v/v) to 0.5% (v/v), 0.001% (v/v) to 0.5% (v/v), 0.01% (v/v) to 0.5 % (v/v), or 0.1% (v/v) to 0.5% (v/v). If the content of deer antler reishi mushroom spore oil is more than 1% (v/v) relative to the total weight of the composition, cytotoxicity problems may occur.

The term "included as an active ingredient" means that the deer antler reishi mushroom spore oil of the present specification is added to the extent that it can exhibit the effects mentioned above, and various ingredients are added as sub-ingredients for drug delivery and stabilization, etc. to form various forms. This means that it includes being formulated.

The composition may be a cosmetic composition.

The cosmetic composition may further add ingredients such as surfactants, antioxidants, preservatives, pH adjusters, moisturizers, and lubricants as needed. In addition, the cosmetic composition may additionally contain substances that can supplementally provide essential nutrients to the skin. The cosmetic composition may contain adjuvants including, but not limited to, natural fragrances, cosmetic fragrances, or plant extracts.

The cosmetic composition can be prepared in any formulation commonly prepared in the art, for example, solution, emulsion, suspension, paste, cream, lotion, gel, powder, spray, surfactant-containing cleansing, oil. , soap, liquid detergent, bath additive, foundation, makeup base, essence, lotion, foam, pack, softening water, sunscreen cream, sun oil, etc., preferably ointment for external use, softening lotion, and nutrition. It can be manufactured in the form of lotion, nutritional cream, massage cream, essence, pack, emulsion or oil gel. At this time, the carrier used can be selectively used depending on the formulation of the cosmetic. For example, when manufacturing cosmetics in the form of ointments, pastes, creams or gels, wax, paraffin, starch, tracant, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. are used as carrier ingredients. Can be used alone or in combination; When manufacturing cosmetics in the form of powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silcate, polyamide powder, chlorofluorohydrocarbon, propane/butane, dimethyl ether, etc. are used alone as carrier ingredients. Or it can be used in combination; When manufacturing cosmetics in the form of a solution or emulsion, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, cottonseed oil, and peanut are used as carrier ingredients. oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol fatty ester, polyethylene glycol, or sorbitan fatty acid ester, etc. can be used alone or in combination; When preparing cosmetics in the form of a suspension, water, ethanol or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, polyoxyethylene sorbitan ester, microcrystalline cellulose, and aluminum metahydroxide are used as carrier ingredients. , bentonite, agar, tracant, etc. can be used alone or in combination; When manufacturing cosmetics in the form of toilet soap, alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolysates, isethionates, lanolin derivatives, fatty alcohols, vegetable oils, glycerol, sugars, etc. are used as carrier ingredients. It can be used alone or in combination.

Additionally, the composition may be a composition for external skin application.

In this specification, the external skin agent may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof. The skin external preparations include ingredients commonly used in external skin preparations such as cosmetics and medicines, such as aqueous ingredients, oil-based ingredients, powder ingredients, alcohols, moisturizers, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, and fragrances. , colorants, various skin nutrients, or a combination thereof may be appropriately mixed according to need. The skin external preparations include metal sequestrants such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belafamil, licorice extract, glablidin, and calin. Hot water extract of fruit, various herbal medicines, drugs such as tocopherol acetate, glytylitinic acid, tranexamic acid and its derivatives or salts, vitamin C, magnesium ascorbate phosphate, ascorbate glucoside, arbutin, kojic acid, glucose, fructose, Sugars such as trehalose can also be appropriately mixed.

The composition may be a pharmaceutical composition.

The pharmaceutical composition may additionally include a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, or mannitol, and the lubricant may be magnesium stearate, talc, or a combination thereof. The carrier may be an excipient, disintegrant, binder, lubricant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be calcium carboxymethylcellulose, sodium starch glycolate, calcium monohydrogen phosphate anhydride, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

The pharmaceutical composition may be formulated as an oral or parenteral dosage form. Oral dosage forms may be granules, powders, solutions, tablets, capsules, dry syrup, or combinations thereof. Parenteral dosage forms may be injectable.

The composition may be a food composition, health supplement, functional food, or food additive composition.

In the present invention, the term "functional food" refers to a group of foods or processed foods to which added value has been added to the food to function and express the function of the food for a specific purpose using physical, biochemical, biotechnological methods, etc. When the composition of the present invention is included in functional food for the purpose of improving skin, etc., the composition can be used as is or together with other functional food ingredients, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use.

The formulation of the functional food is not particularly limited, but may be prepared and used in the form of, for example, liquid, granule, powder, capsule, tablet, pill, suspension, or gel.

The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment). In general, when manufacturing food or beverages, the composition of the present specification may be added in an amount of 15 parts by weight or less based on the raw materials. There are no particular restrictions on the types of health functional foods. Among the types of health functional foods, beverage compositions may contain various flavoring agents or natural carbohydrates as additional ingredients like ordinary beverages. The natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a sweetener, natural sweeteners such as thaumatin and stevia extract or synthetic sweeteners such as saccharin and aspartame can be used. The health food composition also contains nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, and carbonated beverages. It may contain the carbonating agent used, or a combination thereof. The health functional food composition may also contain pulp for the production of natural fruit juice, fruit juice beverage, vegetable beverage, or a combination thereof.

Another aspect provides a method of preparing the deer antler reishi mushroom spore oil.

The method includes supercritical extraction of deer antler reishi mushroom spores.

The supercritical extraction may be performed under conditions of 30 to 50°C and 250 to 400 atmospheres. The supercritical extraction may be performed for 10 to 120 minutes.

In one embodiment, the method includes preparing a mixed fluid by mixing deer antler reishi mushroom spores with one or two or more selected from ethanol, methanol, water, ethyl acetate, hexane, and ethyl ether; and

It may include supplying a supercritical fluid to the mixed fluid and performing supercritical extraction under conditions of 30 to 50°C and 250 to 400 atmospheres.

Another aspect provides deer antler reishi mushroom spore oil nanoliposomes.

The deer antler reishi mushroom spore oil nanoliposome may contain deer antler reishi mushroom spore oil, lecithin, xanthan gum, and purified water.

The deer antler reishi mushroom spore oil may be antler reishi mushroom spore oil according to one aspect. The deer antler reishi mushroom spore oil may be prepared by a supercritical extraction method under conditions of 30 to 50°C and 250 to 400 atmospheres.

The deer antler reishi mushroom spore oil is 3.0 to 7.0% by weight, 3.0 to 6.5% by weight, 3.0 to 6.0% by weight, 3.0 to 5.5% by weight, 4.0 to 7.0% by weight, 4.0 to 6.5% by weight, 4.0% by weight, based on the total weight of nanoliposomes. It may be included in an amount of from 6.0% by weight, 4.0 to 5.5% by weight, 4.5 to 7.0% by weight, 4.5 to 6.5% by weight, 4.5 to 6.0% by weight, or 4.5 to 5.5% by weight.

The lecithin may be soy lecithin. The lecithin may be hydrogenated soy lecithin.

The lecithin is 2.0 to 6.0% by weight, 2.0 to 5.0% by weight, 2.0 to 4.5% by weight, 3.0 to 6.0% by weight, 3.0 to 5.0% by weight, 3.0 to 4.5% by weight, 3.5 to 6.0% by weight, based on the total weight of nanoliposomes. , 3.5 to 5.0% by weight, 3.5 to 4.5% by weight, or 3.6 to 4.4% by weight.

The xanthan gum is 0.1 to 1.0% by weight, 0.1 to 0.9% by weight, 0.1 to 0.8% by weight, 0.2 to 1.0% by weight, 0.2 to 0.9% by weight, 0.2 to 0.8% by weight, 0.3 to 1.0% by weight based on the total weight of nanoliposomes. , 0.3 to 0.9% by weight, 0.3 to 0.8% by weight, 0.4 to 1.0% by weight, 0.4 to 0.9% by weight, 0.4 to 0.8% by weight, 0.5 to 1.0% by weight, 0.5 to 0.9% by weight, 0.5 to 0.8% by weight, or It may be included in 0.585 to 0.715% by weight.

The nanoliposome may contain 4.0 to 6.0% by weight of deer antler reishi mushroom spore oil, 3.0 to 5.0% by weight of hydrogenated soy lecithin, 0.1 to 1.0% by weight of xanthan gum, and the remaining amount of purified water.

The nanoliposome may be composed essentially of 4.0 to 6.0% by weight of deer antler reishi mushroom spore oil, 3.0 to 5.0% by weight of hydrogenated soy lecithin, 0.1 to 1.0% by weight of xanthan gum, and the remaining amount of purified water.

The nanoliposome may contain ingredients common in the art that do not affect the structure or properties of the nanoliposome. For example, the nanoliposome may further include conventional pH adjusters, preservatives, fragrances, antioxidants, etc.

The nanoliposomes are 100 nm or less, less than 100 nm, 50 to 100 nm, 60 to 100 nm, 70 to 100 nm, 80 to 100 nm, 90 to 100 nm, 95 to 100 nm, 95 to 99 nm, 96 to 100 nm. , may have a diameter of 96 to 99 nm, 97 to 100 nm, 97 to 99 nm, or about 98 nm. Since the deer antler reishi mushroom spore oil nanoliposomes are very small (less than 100 nm in size), they have excellent skin and cell penetration and can maximize all efficacy aspects. Therefore, the deer antler reishi mushroom spore oil nanoliposome has excellent skin and cell penetration and can be very effective in improving skin condition. In one example, the deer antler reishi mushroom spore oil nanoliposome showed little change in size even after storage at -10°C for 5 months, confirming excellent formulation stability.

Another aspect provides a method of preparing the deer antler reishi mushroom spore oil nanoliposomes.

The method includes (1) stirring deer antler reishi mushroom spore oil and hydrogenated soy lecithin;

(2) adding the mixture obtained by stirring purified water and xanthan gum to the mixture of step (1) to homogenize it; and

(3) It may include the step of homogenizing the homogenized product using a homogenizer to obtain nanoliposomes.

In step (1), stirring may be performed at 70 to 90°C.

In step (2), stirring may be performed at 60 to 80°C.

In step (2), homogenization may be performed at 60 to 80°C.

After step (2), a step of additional stirring and homogenization may be further included.

Homogenization in step (3) may be performed at 800 to 1,200 bar, 800 to 1,100 bar, 900 to 1,200 bar, 900 to 1,100 bar, or about 1,000 bar.

Another aspect provides a composition for improving skin condition including the deer antler reishi mushroom spore oil nanoliposome.

Details regarding the deer antler reishi mushroom spore oil nanoliposome and improvement of skin condition are as described above.

The deer antler reishi mushroom spore oil nanoliposome may contain 0.0001% (v/v) or more to less than 1% (v/v) of deer antler reishi mushroom spore oil, which is an active ingredient, based on the total weight of the composition. If the content of deer antler reishi mushroom spore oil exceeds 1% (v/v), cytotoxicity problems may occur.

The composition may be a cosmetic composition, a composition for external application to the skin, a pharmaceutical composition, or a food composition.

Details regarding the cosmetic composition, composition for external skin application, pharmaceutical composition, and food composition are as described above.

Another aspect provides a method of improving the condition of the skin of a subject comprising administering to a subject in need thereof an effective amount of the composition described above.

The subject's skin condition may be a condition associated with inflammation, skin wrinkling, or skin dryness.

The terms “administering,” “introducing,” and “implanting” are used interchangeably and refer to a method or route that results in at least partial localization of the composition according to one embodiment to the desired site. It may refer to the arrangement of the composition according to the example.

Administration can be done by methods known in the art. Administration may be administered directly to the subject by any means, such as, for example, intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. You can. The administration may be administered systemically or locally. The administration may be application to the skin.

The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be an individual in need of skin condition improvement, for example, skin moisturizing, skin inflammation inhibition, and skin wrinkle improvement effects.

A cosmetic composition or food composition containing spore oil extracted from deer antler reishi mushroom according to one aspect may exhibit significantly improved effects in anti-inflammatory, skin wrinkle improvement, or skin moisturizing ability.

Antler reishi mushroom spore oil nanoliposomes according to different aspects have a small size and stable formulation, so they have excellent skin penetration and can exhibit excellent anti-inflammatory, skin wrinkle improvement, or skin moisturizing effects.

Figure 1 is a diagram showing the results of the NO Assay confirming the anti-inflammatory effect of spore oil extracted from deer antler reishi mushroom.
Figure 2 is a diagram showing the ELISA results of IL-6, a pro-inflammatory cytokine, confirming the anti-inflammatory effect of spore oil extracted from deer antler reishi mushroom.
Figure 3 is a diagram showing the production volume of procollagen confirming the skin wrinkle improvement effect of spore oil extracted from deer antler reishi mushroom.
Figure 4 is a diagram showing the mRNA expression level of Col1a1, a gene related to collagen production, confirming the skin wrinkle improvement effect of spore oil extracted from deer antler reishi mushroom.
Figure 5 is a diagram showing the mRNA expression level of aquaporin-3 (AQP-3), confirming the moisturizing effect of spore oil extracted from deer antler reishi mushroom.
Figure 6 is a diagram showing the results of a cytotoxicity test of deer antler reishi mushroom spore oil.
Figure 7 is a graph showing the size distribution of deer antler reishi mushroom spore oil nanoliposomes. Red line: initial measurement result; Green line: Measurement results after storage at -10℃ for 5 months.

This will be described in more detail through examples below. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1. Preparation of deer antler reishi mushroom spore oil

Spore oil was extracted from deer antler reishi mushroom. Specifically, after drying the deer antler reishi mushroom spores, a mixed fluid containing one or two or more selected from ethanol, methanol, water, ethyl acetate, hexane, and ethyl ether was stirred. Thereafter, the mixture was placed in a supercritical extraction tank and supercritical fluid was supplied. The pressure of the extraction tank was maintained at 330 atmospheres, and the temperature inside the extraction tank was raised to 42°C at a rate of 0.5°C/min. The temperature and pressure of the extraction tank were maintained at 30 to 50°C and 250 to 400 atm for 50 minutes, and then the pressure was reduced to normal pressure to obtain the first mixed extract to prepare deer antler reishi mushroom spore oil.

Example 2. Preparation of deer antler reishi mushroom spore oil nanoliposomes

Antler reishi mushroom spore oil nanoliposomes were prepared using the ingredients and contents (% by weight) listed in Table 1 below.

Specifically, purified water and xanthan gum were added to the main dissolution tank, then heated and stirred at 80°C to completely dissolve them. In a separate dissolution tank, the deer antler reishi mushroom spore oil and hydrogenated soy lecithin prepared in Example 1 were added and dissolved by heating and stirring at 70°C. The lysate dissolved in the separate dissolution tank was added to the main dissolution tank and stirred at 70°C for 5 minutes to homogenize. Distilled water was added and stirred for additional 5 minutes to prepare the first homogenate. The prepared first homogenizer was treated twice at 1,000 bar using a high pressure homogenizer, and then stabilized nanoliposomes were obtained.

ingredient Content (% by weight) Purified water To 100 Antler reishi mushroom spore oil of Example 1 4.5 ~ 5.5 Hydrogenated Soy Lecithin 3.6 ~ 4.4 xanthan gum 0.585 ~ 0.715 Citric Acid q.s. caprylyl glycol q.s. Sum 100.0

^* qs: Appropriate amount

Experimental Example 1. Confirmation of anti-inflammatory effect of deer antler reishi mushroom spore oil

To confirm the anti-inflammatory effect of deer antler reishi mushroom spore oil, NO Assay (Nitric oxide Reduction Assay) was performed at various concentrations of the spore oil prepared in Example 1. Specifically, the effect of suppressing nitric oxide production when treated with antler reishi mushroom spore oil at a concentration of 0.5% (v/v), 0.25% (v/v), or 0.1% (v/v) after LPS (liposaccharides) treatment was investigated. Confirmed. The group not treated with spore oil (MO: media only) was used as a negative control, and the group treated only with LPS was used as a positive control.

As a result, as shown in Figure 1, it was confirmed that treatment with deer antler reishi mushroom spore oil significantly inhibited the production of nitric oxide induced by LPS treatment.

In addition, in order to confirm the anti-inflammatory effect of deer antler reishi mushroom spore oil, ELISA was performed to confirm the level of IL-6, a pro-inflammatory cytokine, according to treatment at various concentrations of the spore oil prepared in Example 1. (enzyme-linked immunosorbent assay) was performed. IL-6 is an activating factor secreted by macrophages and is an important cytokine that promotes immune and inflammatory responses. Specifically, the level of IL-6 was confirmed when treated with deer antler reishi mushroom spore oil at a concentration of 0.5% (v/v), 0.25% (v/v), or 0.1% (v/v) after LPS treatment. The group not treated with spore oil was used as a negative control, and the group treated only with LPS was used as a positive control.

As a result, as shown in Figure 2, it was confirmed that treatment with deer antler reishi mushroom spore oil significantly reduced the level of IL-6 induced by LPS treatment.

From the above results, it can be confirmed that deer antler reishi mushroom spore oil exhibits a significantly excellent anti-inflammatory effect.

Experimental Example 2. Confirmation of the effect of deer antler reishi mushroom spore oil on improving skin wrinkles

In order to confirm the effect of deer antler reishi mushroom spore oil on improving skin wrinkles, procollagen production analysis was performed according to treatment at various concentrations of the spore oil prepared in Example 1. It is generally known that collagen, which is related to wrinkles in skin cells, is synthesized in the form of a precursor called procollagen. By measuring the amount of procollagen peptides, the degree of collagen synthesis within the cell can be determined. Specifically, the relative production rate of procollagen when treated with deer antler reishi mushroom spore oil at a concentration of 0.5% (v/v), 0.25% (v/v), or 0.1% (v/v) was confirmed. The group not treated with spore oil was used as a negative control, and the group treated with TGF-β was used as a positive control.

As a result, as shown in Figure 3, it was confirmed that when treated with deer antler reishi mushroom spore oil, the synthesis of procollagen increased by about 1.5 times. This value corresponds to the positive control group treated with TGF-β, which is known to induce collagen synthesis.

In addition, in order to confirm the effect of deer antler reishi mushroom spore oil on improving skin wrinkles, real-time PCR was performed to check the expression level of Col1a1 mRNA according to treatment at various concentrations of the spore oil prepared in Example 1. Specifically, the expression level of Col1a1 mRNA was confirmed when treated with deer antler reishi mushroom spore oil at a concentration of 0.5% (v/v), 0.25% (v/v), or 0.1% (v/v). The group not treated with spore oil was used as a negative control, and the group treated with TGF-β was used as a positive control. The Col1a1 primer sequences used in the PCR are listed in Table 2.

Primer name order sequence number Col1a1_forward AGGGCCAAGACGAAGACATC One Col1a1_reverse AGATCACGTCATCGCACAACA 2

As a result, as shown in Figure 4, it was confirmed that when treated with deer antler reishi mushroom spore oil, the Col1a1 mRNA expression level increased by about 1.5-fold. This value corresponds to the positive control group treated with TGF-β, which is known to induce collagen synthesis. From the above results, it can be confirmed that deer antler reishi mushroom spore oil shows a significantly excellent skin wrinkle improvement effect.

Experimental Example 3. Confirmation of skin moisturizing effect of deer antler reishi mushroom spore oil

In order to confirm the skin moisturizing effect of deer antler reishi mushroom spore oil, real-time PCR was performed to confirm the expression level of aquaporin-3 (AQP-3) mRNA according to treatment at various concentrations of the spore oil prepared in Example 1. Specifically, after culturing human keratinocytes, they were divided into UVA-irradiated and non-UVA-irradiated groups and treated with Antler Reishi spore oil at concentrations of 0.5% (v/v) and 0.25% (v/v), respectively. mRNA was obtained and the expression level of AQP-3 was compared and analyzed. The group not treated with spore oil was used as a negative control, and the group treated with TGF-β was used as a positive control. The AQP-3 primer sequences used in the PCR are listed in Table 3 below.

Primer name order sequence number AQP3_forward AGACAGCCCCTTCAGGATTT 3 AQP3_reverse TCCCTTGCCCTGAATATCTG 4

As a result, as shown in Figure 5, it was confirmed that in the case where ultraviolet rays were not irradiated, the AQP-3 mRNA expression level was increased by about 25% in the group treated with deer antler reishi mushroom spore oil. Even when irradiated with ultraviolet rays, it was confirmed that the AQP-3 mRNA expression level increased by about 30% in the group treated with deer antler reishi mushroom spore oil. From the above results, it can be seen that deer antler reishi mushroom spore oil has a significantly excellent skin moisturizing effect. , In particular, it can be confirmed that skin moisture lost by ultraviolet irradiation can be restored to normal skin level.

From the above results, it can be confirmed that the cosmetic composition of the present invention exhibits significantly improved anti-inflammatory, skin wrinkle improvement, and skin moisturizing properties by containing deer antler reishi mushroom spore oil as an active ingredient.

Experimental Example 4. Cytotoxicity test of deer antler reishi mushroom spore oil

To confirm the cytotoxicity of the deer antler reishi mushroom spore oil, a cell viability assay was performed at various concentrations of the spore oil prepared in Example 1 above. Specifically, deer antler reishi mushroom spore oil was used at a concentration of 2% (v/v), 1% (v/v), 0.5% (v/v), 0.25% (v/v), or 0.1% (v/v). Cell survival rate when treated was confirmed. The group not treated with spore oil (MO: media only) was used as a negative control.

Figure 6 shows the cytotoxicity test results of deer antler reishi mushroom spore oil.

As shown in Figure 6, when the deer antler reishi mushroom spore oil was used in an amount of less than 1% (v/v), it was found to be safe as there was no cytotoxicity.

Experimental Example 5. Confirmation of size and formulation stability of deer antler reishi mushroom spore oil nanoliposomes

An experiment was conducted to confirm the size and formulation stability of the deer antler reishi mushroom spore oil nanoliposomes prepared in Example 2. Specifically, the size of nanoliposomes was measured using a nanoparticle size analyzer (Zetasizer Nano (model name: NANO ZS), Malvern Korea, UK).

Figure 7 is a graph showing the size distribution of deer antler reishi mushroom spore oil nanoliposomes. Red line: initial measurement result; Green line: Measurement results after storage at -10℃ for 5 months.

As shown in Figure 7, the antler reishi mushroom spore oil nanoliposomes prepared in Example 2 had an average particle size of 98 nm. In addition, it was confirmed that the nanoliposomes had excellent formulation stability as there was no change in particle size even when stored at -10°C for 5 months.

<110> Intercare Chodang University WEE, hyoun <120> Cosmetic composition comprising spore oil extracted from antler-shaped Ganoderma lucidum and the method for preparing the same <130> PN135716 <150> KR 10-2019-0122502 <151> 2019-10-02 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Col1a1_forward <400> 1 agggccaaga cgaagacatc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Col1a1_reverse <400> 2 agatcacgtc atcgcacaac a 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AQP3_forward <400> 3 agacagcccc ttcaggattt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AQP3_reverse <400> 4 tcccttgccc tgaatatctg 20

Claims (10)

A cosmetic composition for improving skin condition containing deer antler reishi mushroom spore oil or nanoliposomes containing it,
The composition contains 0.1% (v/v) to 0.5% (v/v) of the deer antler reishi mushroom spore oil based on the total weight of the composition,
The deer antler reishi mushroom spore oil is obtained by supplying a supercritical fluid to a mixture of deer antler reishi mushroom spores and at least one selected from ethanol, methanol, water, ethyl acetate, hexane, and ethyl ether at 30 to 50° C. and 250° C. A cosmetic composition for improving skin condition, prepared by supercritical extraction for 10 to 120 minutes under conditions of 400 to 400 atmospheres. The cosmetic composition according to claim 1, wherein the skin condition improvement is anti-inflammatory, skin wrinkle improvement, or skin moisturizing. delete delete The cosmetic composition according to claim 1, wherein the nanoliposome further comprises hydrogenated soy lecithin, xanthan gum, and purified water. The method of claim 5, wherein the nanoliposomes include 4.0 to 6.0% by weight of deer antler reishi mushroom spore oil, 3.0 to 5.0% by weight of hydrogenated soy lecithin, 0.1 to 1.0% by weight of xanthan gum, and the remaining amount of purified water, based on the total weight of the nanoliposomes. A cosmetic composition that does this. delete The cosmetic composition according to claim 1, wherein the nanoliposome has a diameter of 50 to 100 nm. A food composition for improving skin condition containing deer antler reishi mushroom spore oil or nanoliposomes containing it,
The composition contains 0.1% (v/v) to 0.5% (v/v) of the deer antler reishi mushroom spore oil based on the total weight of the composition,
The deer antler reishi mushroom spore oil is obtained by supplying a supercritical fluid to a mixture of deer antler reishi mushroom spores and at least one selected from ethanol, methanol, water, ethyl acetate, hexane, and ethyl ether at 30 to 50° C. and 250° C. A food composition for improving skin condition, prepared by supercritical extraction for 10 to 120 minutes under conditions of 400 to 400 atmospheres. The food composition according to claim 9, wherein the nanoliposome has a diameter of 50 to 100 nm.