KR102271223B1 - Composition for preventing hair loss and promoting hair growth - Google Patents

Abstract

The present invention relates to a composition for preventing hair loss and promoting hair growth. As a means for solving the above problems, the present invention provides a composition for preventing hair loss and promoting hair growth comprising a compound represented by chemical formula 1 as an active ingredient.

Description

Composition for preventing hair loss and promoting hair growth

The present invention relates to a composition for preventing hair loss and promoting hair growth.

In modern society, along with interest in appearance, the importance of hair health is more emphasized, and as the frequency of exposure to new harmful environments increases with the development of industry, the population suffering from hair loss is increasing.

Each hair has a different growth cycle. The growth phase (anagen stage), in which the hair grows most actively, the catagen stage (catagen stage), where hair degeneration begins, and the telogen stage, when hair growth stops or enters a rest period (Telogen stage) It is maintained by repeating hair growth and hair loss in a three-step cycle. Hair loss is a normal phenomenon, but compared to a normal person having a lot of hair in the growth phase, a person with alopecia has an abnormal increase in the number of hair falling out as the proportion of hair in the degenerative or resting phase increases.

Testosterone, a type of male hormone that is one of the main causes of hair loss, is activated into dihydrotestosterone (DHT) by 5-alpha reductase, and DHT binds to androgen receptor (AR) and causes hair loss. Hair loss occurs by inducing a protein that causes Since DHT is more than 10 times more active than testosterone, when 5-alpha reductase is effectively inhibited, the synthesis of DHT, which has strong physiological activity, is reduced, and eventually it can have the effect of preventing hair loss or promoting hair growth.

Currently, hair loss treatments include oral finasteride among 5-alpha reductase inhibitors approved by the Food and Drug Administration of United States (US FDA), and topical minoxidil among vasodilators. , there is Dutasteride approved by the Korea Ministry of Food and Drug Safety (MFDS). However, the main therapeutic agents are known to have a disadvantage that the effect disappears immediately after discontinuation of use. In addition, it has been reported that some patients have side effects of scalp itching and dermatitis when applied for treatment, so development of natural-derived substances that do not have side effects even after long-term use is actively being made.

The present invention overcomes the problems of known hair loss prevention materials, and provides a composition for preventing hair loss and promoting hair growth or hair growth with fewer side effects even when used for a long period of time.

As a means for solving the above problems, the present invention provides a composition for preventing hair loss and promoting hair growth comprising the compound represented by Formula 1 as an active ingredient.

[Formula 1]

According to an embodiment of the present invention, the content of L-tetrahydro palmatin is preferably 0.0001 to 10% by weight of the composition.

In order to achieve another object of the present invention, the present invention provides a cosmetic composition for preventing hair loss or promoting hair growth comprising the composition.

According to one embodiment, the cosmetic composition is a solution, suspension, emulsion, paste, lotion, powder, soap, surfactant-containing cleansing oil, powder foundation, emulsion foundation, wax foundation, shampoo, rinse, tonic and spray. It is preferred to have a formulation selected from

In order to achieve another object of the present invention, the present invention provides a functional food composition for preventing hair loss or promoting hair growth comprising the composition.

In order to achieve another object of the present invention, the present invention provides a pharmaceutical composition for preventing hair loss or promoting hair growth comprising the composition.

The composition according to the present invention exhibits an effect of inhibiting hair loss and promoting hair growth or hair growth, is derived from a natural material, has no harm to the human body and has no side effects even when used for a long period of time, so it can be used in cosmetics, pharmaceuticals, or health food.

Hereinafter, the present invention will be described in more detail.

The present invention provides a composition for preventing hair loss or promoting hair growth containing L-tetrahydropalmatine of Formula 1 below as an active ingredient.

[Formula 1]

The compound name of the compound of Formula 1 used in the present invention is called L-tetrahydropalmatine, and as a kind of plant-derived sapogenin, in relation to the efficacy of L-tetrahydropalmatine It is reported to have anti-allergic and anti-atherosclerotic effects.

As used herein, the term “hair loss” refers to a phenomenon in which hair is completely removed from the scalp.

The term "hair growth" in the present invention means that hair grows from the scalp, and "hair growth" means that the length of the hair becomes longer (ie, hair growth), and is the same as another term "wool" used in the art. used in meaning

The compound of Formula 1 may be synthesized and used, or a commercially available compound may be used.

The content of L-tetrahydro palmatin is preferably 0.0001 to 10% by weight of the composition, more preferably 0.001 to 5% by weight, and even more preferably 0.01 to 1% by weight.

If it is less than 0.0001% by weight, the effect of inducing hair growth and alleviating hair loss is insignificant, and at a concentration of more than 10% by weight, it is not preferable because it is difficult to apply the formulation.

Since the L-tetrahydro palmatin has very little or no toxicity even when administered orally, it can be used as a cosmetic composition, a health functional food composition, a pharmaceutical or a quasi-drug composition.

The formulation of the composition for preventing hair loss and promoting hair growth is not particularly limited, and it can be variously formulated in the form of quasi-drugs known in the art as exhibiting the effect of preventing hair loss and promoting hair growth.

According to one embodiment, the composition for preventing hair loss and promoting hair growth is a solution, suspension, emulsion, paste, lotion, powder, soap, cleansing oil containing surfactant, powder foundation, emulsion foundation, wax foundation, shampoo, conditioner, Scalp tonic, scalp lotion, scalp cream, scalp serum, scalp essence, scalp ampoule, scalp treatment, scalp conditioner, scalp shampoo, scalp pack, hair tonic, hair lotion, hair cream, hair spray, hair mousse, Hair gel, hair conditioner, hair shampoo, hair conditioner, hair pack, hair treatment, eyebrow hair growth agent, eyelash hair growth agent, eyelash nutrition supplement, pet shampoo, pet conditioner, hand sanitizer, detergent soap, soap, disinfectant cleaner, wet wipes, It may be provided as a quasi-drug in a conventional sense such as a mask, ointment, patch or filter filler, for example, a cosmetic composition, but is not limited thereto.

In addition, in each formulation, the quasi-drug composition for preventing hair loss and promoting hair growth may be formulated by selecting other ingredients arbitrarily according to the formulation or purpose of use of other quasi-drugs. The mixing amount of the active ingredient may be suitably determined depending on the intended use, and may include, for example, conventional auxiliary agents such as thickeners, stabilizers, solubilizers, vitamins, pigments and fragrances, and carriers.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystals Adult cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide as carrier components Ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative or ethoxylated glycerol fatty acid ester and the like can be used.

In addition, the present invention provides a health functional food composition for preventing or improving hair loss, or promoting hair growth or hair growth, comprising L-tetrahydro palmatin or a pharmaceutically acceptable salt thereof as an active ingredient.

The food composition according to the present invention can be prepared in various forms according to conventional methods known in the art. Common foods include, but are not limited to, beverages (including alcoholic beverages), fruits and their processed foods (eg, canned fruit, canned fruit, jam, marmalade, etc.), fish, meat and their processed foods (eg, ham, sausages) corn beef, etc.), breads and noodles (eg udon noodles, soba noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (eg butter, cheese, etc.), edible vegetable oils and fats, margarine , vegetable protein, retort food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.) can be prepared by adding L-tetrahydro palmatin of the present invention. In addition, the nutritional supplement is not limited thereto, but it can be prepared by adding L-tetrahydro palmatin of the present invention to capsules, tablets, pills, and the like. In addition, the health functional food is not limited thereto, but for example, the L-tetrahydro palmatin itself of the present invention is prepared in the form of tea, juice, and drink, and liquefied, granulated, and encapsulated so that it can be consumed (health drink). And it can be ingested by powdering. In addition, in order to use the L-tetrahydro palmatin of the present invention in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate. In addition, it can be prepared in the form of a composition by mixing L-tetrahydro palmatin of the present invention with a known active ingredient known to have an effect of preventing hair loss and promoting hair growth.

When the L-tetrahydro palmatin of the present invention is used as a health drink, the health drink composition may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional drink. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; It may be a sugar alcohol such as xylitol, sorbitol, or erythritol. Sweeteners include natural sweeteners such as taumatin, stevia extract; A synthetic sweetener such as saccharin or aspartame may be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

In addition, L-tetrahydro palmatin of the present invention may be contained as an active ingredient of a health functional food for preventing hair loss and promoting hair growth, and the amount is particularly limited to an amount effective to achieve the effect of preventing hair loss and promoting hair growth. However, it is preferably 0.01 to 100% by weight based on the total weight of the entire composition. The food composition of the present invention may be prepared by mixing L-tetrahydro palmatin with other active ingredients known to have effects of preventing hair loss and promoting hair growth.

In addition to the above, the health food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, colorants, pectic acid, pectic acid salts, alginic acid, alginic acid salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, It may contain glycerin, alcohol or a carbonation agent and the like. In addition, the health food of the present invention may contain fruit for the production of natural fruit juice, fruit juice beverage, or vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

The pharmaceutical composition for preventing hair loss or promoting hair growth of the present invention may include a pharmaceutically acceptable salt of the compound of Formula 1 above.

The L-tetrahydro palmatin is preferably a composition for external application to the skin, and the external pharmaceutical composition for external use containing L-tetrahydro palmatin of the present invention as an active ingredient is a cream as an external preparation for preventing hair loss and improving and promoting hair growth, Gel, patch, spray, ointment, warning agent, lotion, liniment agent, pasta agent or cataplasma can be prepared and used as a pharmaceutical composition for external use on the skin, but is not limited thereto.

L-tetrahydro palmatin of the present invention can be used in the form of a pharmaceutically acceptable salt, and the organic acid is, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, triple, luoroacetic acid, malic acid, Maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, aminooxyacetic acid, benzenesulfonic acid , p-toluenesulfonic acid and methanesulfonic acid salts, and inorganic acids include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid and boric acid salts. Preferably, it may be in the form of hydrochloride or acetate, and more preferably in the form of hydrochloride. The above-mentioned acid addition salt can be prepared by a) directly mixing the compound of formula 1 and an acid, b) dissolving one of them in a solvent or a hydrous solvent and mixing, or c) dissolving the compound of formula 1 in a solvent or water. It is prepared by a general method of preparing salts by placing them in an acid in a solvent and mixing them. In addition to the above, additional salts available include gaba salt, gabapentin salt, pregabalin salt, nicotinate salt, adipate salt, hemimalonate, cysteine salt, acetylcysteine salt, methionine salt, arginine salt, lysine salt, ornithine salt, Aspartate, etc.

The acid addition salt according to the present invention is prepared by a conventional method, for example, by dissolving the L-tetrahydropalmatine in an aqueous solution of an excess of acid, and dissolving the salt in a water-miscible organic solvent such as methanol, ethanol, acetone or aceto. It can be prepared by precipitation using nitrile. It can also be prepared by heating equal amounts of L-tetrahydropalmatine and an acid or alcohol in water, followed by evaporating the mixture to dryness, or by suction filtration of the precipitated salt.

In addition, a pharmaceutically acceptable metal salt may be prepared using a base. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. In this case, it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt as the metal salt. Also, the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

In addition, the L-tetrahydro palmatin of the present invention includes all salts, hydrates and solvates that can be prepared by conventional methods as well as pharmaceutically acceptable salts.

The addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving L-tetrahydropalmatine in a water-miscible organic solvent, such as acetone, methanol, ethanol, or acetonitrile, and adding an excess of organic acid. Or it can be prepared by adding an acid aqueous solution of an inorganic acid and then precipitating or crystallizing it. Subsequently, after evaporating the solvent or excess acid from this mixture, it can be dried to obtain an addition salt, or it can be prepared by suction filtration of the precipitated salt.

When the composition of the present invention is used as a pharmaceutical, a pharmaceutical composition containing L-tetrahydropalmatine or a pharmaceutically acceptable salt thereof as an active ingredient is formulated into various oral or parenteral dosage forms during clinical administration. and may be administered, but is not limited thereto.

Formulations for oral administration include, for example, tablets, pills, hard/soft capsules, solutions, suspensions, emulsifiers, syrups, granules, elixirs, and the like. rose, sucrose, mannitol, sorbitol, cellulose and/or glycine), lubricants (eg silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycol). Tablets may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, optionally starch, agar, alginic acid or its sodium salt. disintegrants or effervescent mixtures and/or absorbents, colorants, flavoring agents, and sweetening agents.

The pharmaceutical composition comprising L-tetrahydro palmatin or a pharmaceutically acceptable salt thereof of the present invention as an active ingredient can be administered parenterally, and parenteral administration is subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. by the injection method. At this time, in order to formulate a formulation for parenteral administration, the L-tetrahydropalmatine or a pharmaceutically acceptable salt thereof is mixed with water together with a stabilizer or buffer to prepare a solution or suspension, and this is an ampoule or vial unit dosage form. can be manufactured with The composition may be sterilized and/or contain adjuvants such as preservatives, stabilizing agents, wetting or emulsifying agents, salts and/or buffers for regulating osmotic pressure, and other therapeutically useful substances, and mixing, granulation, in a conventional manner. It can be formulated according to the method of formulation or coating.

In addition, the dosage of the compound of the present invention to the human body may vary depending on the patient's age, weight, sex, dosage form, health status and disease level, and is generally based on an adult patient weighing 60 kg. 0.001 to 1,000 mg/day, preferably 0.01 to 500 mg/day, may be administered in divided doses once or several times a day at regular time intervals according to the judgment of a doctor or pharmacist.

In addition, the present invention provides a quasi-drug for preventing or improving hair loss, or for promoting hair growth or hair growth, comprising L-tetrahydropalmatine or a pharmaceutically acceptable salt thereof as an active ingredient. Specific details of the L-tetrahydro palmatin are the same as described above.

When the L-tetrahydro palmatin of the present invention is used as an active ingredient in the quasi-drug composition, the L-tetrahydro palmatin, which exhibits the effect of preventing hair loss and promoting hair growth, can be added as it is, or it can be used together with other quasi-drugs or quasi-drug ingredients. , may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use.

L-tetrahydro palmatin according to the present invention can be extracted through water extraction and supercritical extraction using an extract using an organic solvent and water from a namgasae plant. Examples of the extraction solvent used for extraction of the L-tetrahydro palmatin include purified water; lower alcohols such as methanol, ethanol, isopropyl alcohol and butanol; polyhydric alcohols such as glycerol, ethylene glycol, propylene glycol, and 1,3-butylene glycol; and hydrocarbon solvents such as petroleum ether, methyl acetate, ethyl acetate, benzene, hexane, methylene chloride, diethyl ether, and dichloromethane chloroform.

In addition, one or two or more types of solvents may be mixed among them.

Below. The present invention will be described in detail by way of Examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

Reference Example 1: L-tetrahydropalmatine (L-tetrahydropalmatine) material information

[Formula 1]

Cas number: 483-14-7

Where to buy: Sigma-aldrich (USA)

Experimental Example 1: Effect of promoting dermal papilla cell proliferation

Dermal papilla cells are mesodermal-derived fibroblasts located at the base of hair follicles, and are known to play an important role in hair growth through interaction with the matrix cells of the hair follicles. Human dermal papilla cells were mixed with 10% heat-inactivated fetal bovine serum (FBS; Gibco Inc. NY. USA) with 100 units/ml penicillin-100 μg/ml in DMEM (Gibco Inc, NY. USA) medium. Streptomycin (Gibco Inc, NY, USA) was added and cultured at _{37° C., 5% CO 2 incubator.} The proliferation of dermal papilla cells was measured using the MTT assay. The dermal papilla cells were dispensed in a 96-well plate at a concentration of ^{1 x 10 4 cells/well and then cultured for 24 hours.} After removing the culture medium, minoxidil and L-tetrahydro palmatin were diluted by concentration in DMEM medium containing 1% FBS, and the cells were treated and further cultured for 72 hours. After 72 hours, 200 μl of the MTT solution diluted in the medium at a concentration of 0.5 mg/ml per well was treated and reacted for 3 hours. The generated formazan was dissolved in 100 μl of DMSO and the absorbance was measured at 540 nm with a micro-plate reader to determine the degree of cell growth. The proliferation-promoting effect of dermal papilla cells was obtained by calculating the proliferation rate (%) according to Equation 1 below compared to the untreated control group from the measured absorbance values, and the results are shown in Table 1.

[Equation 1]

Growth rate (%) = (absorbance of sample treatment group / absorbance of control group) x 100

Effect of promoting dermal papilla cell proliferation sample density Cell proliferation rate (% compared to control) minoxidil 10 μM 112.51 L-tetrahydro palmatin 6.25 ppm 104.26 12.5 ppm 106.95 25 ppm 120.09

As can be seen from the results of Table 1, L-tetrahydro palmatin was not confirmed in the experimental concentration in the medium condition treated for 72 hours, dermal papilla cytotoxicity, it exhibited a proliferation-promoting effect of up to 20.09%.

Experimental Example 2: 5-alpha reductase gene expression inhibitory effect

Gene expression level by quantitative real-time PCR (qRT-PCR) experiment to determine whether L-tetrahydropalmatine has the effect of inhibiting enzyme expression in dermal papilla cells known to have type 1 and type 2 5-alpha reductase was confirmed. After diluting L-tetrahydro palmatin and dutasteride by concentration in serum-free medium and treating the dermal papilla cells for 72 hours, the culture medium was removed and the cells were extracted from the cells using an easy-spin Total RNA extraction kit (iNtRON biotechology, Korea). RNA was extracted. The extracted RNA was measured for the amount of RNA using a Nanodrop spectrophotometer (Thermo Scientific, USA). After taking a certain amount of RNA, cDNA was synthesized using Maxime RT Premix Oligo dt (iNtRON biotechology, Korea). To measure gene expression, the power SYBR Green PCR master mix (Applied biosystems, USA), each primer, and synthesized cDNA were used for reaction in a 7500 Fast Real-Time PCR System (Applied Biosystems, USA) device. The PCR process was performed for 40 cycles, and the primer sequences for each gene (GAPDH, 5α-R1, 5α-R2) are shown in Table 4. The results were analyzed and quantified using Excel, and the comparative Ct (threshold cycle) method was used as the analysis method.

Table 2 shows the results of confirming the expression changes of two types of 5-alpha reductase. When L-tetrahydro palmatin was treated by concentration, it was confirmed that both types of 5-alpha reductase activity were inhibited. Inhibiting the expression of 5-alpha reductase can reduce the concentration of DHT in the blood that causes hair loss, so it can have the effect of preventing hair loss and promoting hair growth.

5-alpha reductase inhibitory effect sample density
(ppm) 5α-R1
mRNA
Relative expression 5α-R2
mRNA
Relative expression 5α-R1 expression
decrease rate
(% compared to control) 5α-R2 expression
decrease rate
(% compared to control) control - 1.0 1.0 - - Dutasteride 0.5 0.5115 0.2065 48.85 79.35 L-tetrahydro palmatin 12.5 0.6134 0.5961 38.66 40.39 25 0.5992 0.4366 40.08 56.34

Experimental Example 3: Inhibitory effect of testosterone-induced DHT biosynthesis

The amount of DHT biosynthesis induced by testosterone treatment in dermal papilla cells was quantified using a DHT ELISA kit (MyBiosource, San Diego, CA, USA). After diluting 100 μM of testosterone, L-tetrahydropalmatine and dutasteride by concentration in serum-free medium, and simultaneously treating the dermal papilla cells for 72 hours, the culture medium was taken and the degree of DHT biosynthesis was measured with a DHT ELISA kit. The degree of DHT biosynthesis was calculated as a rate of decrease relative to the testosterone-treated control group, and the results are shown in Table 3.

DHT biosynthesis inhibitory effect sample DHT biosynthesis amount (pg/ml) DHT biosynthesis reduction rate
(% compared to testosterone treatment group (T)) Testosterone 100 μM (T) 167.33 - T + Dutasteride 0.5 ppm 42.17 74.8 T+ L-tetrahydro palmatin 12.5 ppm 122.33 26.89 T + L-tetrahydropalmatine 25 ppm 119.17 28.78

As can be seen from the results in Table 3, L-tetrahydro palmatin inhibited testosterone-induced DHT biosynthesis by up to 28.78%, which inhibited the DHT biosynthesis performance by inhibiting the activity of 5-alpha reductase. can From this result, it can be seen that the composition according to the present invention effectively reduces the concentration of DHT in the blood that causes hair loss, thereby preventing hair loss and promoting hair growth.

Primer sequence Gene Name Primer pair (5' -> 3') Size(bp) Tm(℃) GAPDH F: ACCACAGTCCATGCCATCAC
R: TCCACCACCCTGTTGCTGTA 452 60 5α-reductase type 1 (5α-R1) F: ACCACAGTCCATGCCATCAC
R: GGCATAGCCACACCACTCCATGA 380 64 5α-reductase type 2 (5α-R2) F: AACACGGCGCGATGCAGGGTT
R: CCGTGTGCTTCCCGTAGCCG 123 65

Taken together, it can be seen that the composition containing L-tetrahydro palmatin exhibits an excellent hair loss alleviation effect by exhibiting a dermal papilla cell proliferation effect, an inhibitory effect on 5-alpha reductase activity and an effect on DHT production.

Hereinafter, formulation examples of various types of hair and scalp application compositions containing L-tetrahydro palmatin of the present invention will be described, but the present invention is not intended to limit the present invention, but merely to describe them in detail.

shampoo Ingredient name content (wt%) L-tetrahydro palmatin 1.0 Sodium Lauryl Sulfate 10 Cocamidopropyl Betaine 3 carboxyl vinyl polymer 0.3 Polyquaternium-10 0.2 Spices 0.7 methylparaben 0.2 cetyltrimethylammonium chloride 0.1 Purified water remaining amount

Rinse Ingredient name content (wt%) L-tetrahydro palmatin 1.0 cetyl alcohol 2 stearyl alcohol 2.5 behenyl alcohol 0.5 Spices 0.4 silicone emulsion 0.4 cyclomethicone 1.0 Dimethyldistearylammonium chloride 0.1 citric acid Amount that can be adjusted to pH 3-7 Purified water remaining amount

ample Ingredient name content (wt%) L-tetrahydro palmatin 1.0 ethanol 30 propylene glycol 20 1,3-butylene glycol 10 cetyltrimethylammonium chloride 3 Dityldistearylammonium chloride 0.1 lauryl alcohol 3 myristyl alcohol 5 cetyl alcohol One Spices 0.5 dyes appropriate amount Purified water remaining amount

tonic Ingredient name content (wt%) L-tetrahydro palmatin 1.0 ethanol 40 propylene glycol 10 Polysorbate 20 5 Spices 0.5 dyes appropriate amount Purified water remaining amount

Claims (6)

A composition for preventing hair loss or promoting hair growth containing L-tetrahydropalmatine as an active ingredient. According to claim 1,
The content of the L-tetrahydro palmatin is 0.0001 to 10% by weight of the composition for preventing hair loss or promoting hair growth. A cosmetic composition for preventing hair loss or promoting hair growth, comprising the composition according to claim 1 or 2. 4. The method of claim 3,
The composition has a formulation selected from the group consisting of solutions, suspensions, emulsions, pastes, lotions, powders, soaps, cleansing oils containing surfactants, powder foundations, emulsion foundations, wax foundations, shampoos, rinses, tonics and sprays. A cosmetic composition for preventing hair loss or promoting hair growth. A functional food composition for preventing hair loss or promoting hair growth, comprising the composition according to claim 1 or 2. A pharmaceutical composition for preventing hair loss or promoting hair growth, comprising the composition according to claim 1 or 2.