KR102600558B1 - Composition for promoting hair growth and preventing hair loss comprising atraric acid - Google Patents

Abstract

The present invention relates to a composition for promoting hair growth and preventing hair loss containing atralic acid or a salt thereof as an active ingredient, wherein the atralic acid and its salt not only promote the expression of hair growth-related genes in dermal papilla cells, but also promote hair length. And because it significantly increases the tensile strength, it can be usefully used in pharmaceutical compositions and cosmetic compositions to promote hair growth and prevent, improve, or treat hair loss.

Description

Composition for promoting hair growth and preventing hair loss comprising atraric acid}

The present invention relates to a composition for promoting hair growth and preventing hair loss containing atralic acid or a salt thereof.

Alopecia refers to the absence of hair in areas where hair should normally exist, and generally refers to the loss of hair on the scalp. The main causes of hair loss are genetic causes and androgen, a male hormone. Tissues associated with hair loss include sebaceous glands, keratinocytes of the epidermis and hair follicles, dermal papilla cells, sweat glands, and root sheath of the scalp hair follicle. there is.

It has been reported that tissues in areas with hair loss have higher activity of 5-αreductase than tissues in areas with normal hair. 5-alpha reductase reduces testosterone to dehydrotestosterone (DHT). Testosterone is involved in male secondary sexual characteristics such as increased skeletal muscle and sperm formation, and acne, increased sebum, hair loss, and prostate. It is known that dihydrotestosterone is involved in hypertrophy, etc. in the relevant tissue (J. Invest. Dermatol. 1995; 105(2): 209-14). Therefore, much research is being conducted to find pharmacologically active substances that treat alopecia by inhibiting the activity of 5-alpha reductase, a biological enzyme involved in the reaction of testosterone to dihydrotestosterone.

Conventional 5-alpha reductase inhibitors include compounds such as finasteride, and are used as a prostate treatment and hair loss prevention agent at different dosages. However, finasteride is an excellent drug in terms of convenience and efficacy, but the reagents used to manufacture finasteride are expensive or highly toxic, which puts a burden on manufacturing costs or pollutes the environment. In particular, it is not easy to remove by-products, so the purity of the target product is low. There is a problem that mass production is difficult due to the use of reagents or active derivatives that are easily damaged by moisture or moisture. In addition, steroid hormones themselves play an important role in normal physiological activity, so if steroid hormone production itself is artificially blocked, various types of problems may occur.

In addition, minoxidil, currently on the market, is one of the hair growth promotion drugs approved by the U.S. Food and Drug Administration (FDA). It was initially developed as a vasodilator to treat high blood pressure, but its side effect is hirsutism. As reported, it is currently being used as a hair growth agent. Although the specific mechanism of action regarding the hair growth effect of minoxidil has not yet been clearly revealed, it increases nutrient supply through KATP-channel opening, vasodilation, and increases the nutrient supply through the β-catenin pathway in dermal papilla cells. Activation is thought to induce hair growth. Dermal papilla cells are mesoderm-derived fibroblasts that secrete proteins such as insulin-like growth factor-1 (IGF-1), hepatocyte growth factor (HGF), and fibroblast growth factor-7 (FGF-7). It is reported to affect the hair cycle through minoxidil, which has the effect of proliferating the growth of dermal papilla cells by reducing apoptosis of dermal papilla cells. It is known.

Therefore, rather than substances that inhibit the activity of 5-alpha reductase as described above, substances that promote the proliferation of dermal papilla cells themselves, promote the secretion of growth factors that aid proliferation, or promote the expression of hair growth-related genes in dermal papilla cells. Development is needed.

Accordingly, while conducting research on the physiological activity of natural lichen, the present inventors discovered the hair growth promoting and hair loss inhibiting effects of lichen extracts, and as a result of continuous research, it was found that certain compounds, such as the present invention, significantly increase the expression of hair growth-related genes in dermal papilla cells. After discovering the increase, the present invention was completed.

Korean Patent No. 10-2132009 (announced on July 20, 2020) Korean Patent No. 10-1223359 (announced on January 16, 2013)

One object of the present invention is to provide a pharmaceutical composition for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient.

Another object of the present invention is to provide a cosmetic composition for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient.

Another object of the present invention is to provide a composition for topical skin application for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient.

Another object of the present invention is to provide a food composition for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient.

Another object of the present invention is to provide a method of promoting hair growth and preventing hair loss in a subject by administering a composition containing atralic acid or a salt thereof as an active ingredient to the subject.

In order to solve the above technical problem, the present invention provides a composition for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient, and a method for promoting hair growth and preventing, improving, or treating hair loss in a subject by administering the composition to the subject. provides.

In the present invention, atraric acid has an IUPAC name of methyl 2,4-dihydroxy-3,6-dimethylbenzoate and a chemical formula of C ₁₀ H ₁₂ O ₄ is a compound of formula 1 below.

[Formula 1]

In the present invention, the atralic acid may be in the form of a pharmaceutically, cosmetically and/or foodologically acceptable salt, or in a form that becomes atralic acid in the body (e.g., a prodrug). The salt includes an acid addition salt formed by a free acid or a metal salt formed by a base that is pharmaceutically, cosmetically and/or foodologically acceptable. The free acid may be an inorganic acid or an organic acid. Examples of inorganic acids include hydrochloric acid, sulfuric acid, hydrobromic acid, sulfurous acid, or phosphoric acid. Examples of organic acids include citric acid, acetic acid, maleic acid, fumaric acid, gluconic acid, and methanesulfonic acid. The metal salt includes an alkali metal salt or an alkaline earth metal salt, and sodium, potassium, or calcium salts can be usefully used.

The atralic acid or its salt can be extracted, separated and purified from natural sources, biotransformed or synthesized, or commercially available materials can be used. The natural source is not necessarily limited to this, but includes the lichens Stereocaulon japonicum, Pyseum africanum , and Evernia prunastri .

As a specific example, the atralic acid was obtained by vacuum liquid chromatography of 60% methanol in the fractionated layer of hexane, ethyl acetate, and butanol of the methanol extract of the lichen Stereocaulon japonicum . It may be a compound separated by VLC).

The present inventors revealed the effect of methanol extract of the lichen Stereocaulon japonicum on hair growth promotion and hair loss prevention and registered it as Patent No. 10-2132009 (announced on July 20, 2020). Contents described in the patent may be incorporated by reference for understanding the present specification.

Atralic acid and its salts of the present invention significantly promote the expression of hair growth genes such as Shh, Prom1, S100a9, and Ptgfr. Here, among the hair growth genes, the Shh gene is known to be an important hair follicle induction signal generated in the hair follicle placode and plays a role in inducing epithelial cell proliferation of the early hair follicle epithelium. The Prom1 gene contributes to the formation of HDPs in primary and secondary hair follicles and plays an important role in postnatal hair growth by maintaining the growth onset of HDP cells and is known to mediate signal cross-linking in the hair expansion zone. The S100a9 gene is known to be strong in anagen hair follicles and is involved in keratinocyte differentiation. The Ptgfr gene is known to be involved in hair growth regulation (Fuchs E, et al., Genes & Development. 2008;22(8):976-85]; Huntzicker EG, et al., Genes & Development. 2006;20(3):276-81]; Hesse M, et al., European Journal of Cell Biology. 2004;83(1); [Lin KK, et al., Proceedings of the National Academy of Sciences of the United States of America. 2004;101(45):15955-60];[Zhou L, Xu M, Yang Y, Yang K, Wickett RR, Andl T, et al. Activation of β-Catenin Signaling in CD133-Positive Dermal Papilla Cells Drives Postnatal Hair Growth. PLOS ONE. 2016;11(7)]; [J. Z, N. L, K. L, J. H, J. Y, R. B, et al. Identification of genes and proteins associated with anagen wool growth. Animal Genetics. 2017;48(1):67-79]; and [Amlie R, Rachel S, Manon T, Carlos C, Michael R. PDGF signaling in the dermis and in dermal condensates is dispensable for hair follicle induction and formation. Experimental Dermatology. 2015;24(6):468-70]).

In addition, atralic acid and its salts of the present invention exhibit hair length growth effects and hair tensile strength increasing effects at the same level as minoxidil even in much smaller amounts than minoxidil.

Therefore, atralic acid and its salts of the present invention not only have the effect of promoting hair growth, but also have the effect of preventing, improving, and treating hair loss by promoting hair growth.

In the present invention, the term “prevention” means suppressing the occurrence of hair loss in individuals who have not been diagnosed as having the hair loss, but who are prone to such hair loss.

In the present invention, the term “improvement” or “treatment” means (a) inhibition of hair loss, or (b) alleviation of hair loss in an individual.

In the present invention, the term “individual” refers to mammals, including humans, that can achieve the above purpose by administering a composition containing atralic acid or a salt thereof of the present invention as an active ingredient, for example, monkeys, cows, This means horses, pigs, sheep, dogs, cats, rats, mice, chimpanzees, etc.

In the present invention, the term “administration” means introducing a predetermined substance into an individual by any appropriate method, and the route of administration of the composition of the present invention is oral or parenteral through any general route as long as it can reach the target tissue. may be administered. Additionally, the compositions of the present invention can be administered by any device capable of transporting the active agent to a target object, such as a cell.

The appropriate dosage of the composition of the present invention varies depending on the individual's condition and weight, degree of disease, drug type, and time, but can be appropriately selected by a person skilled in the art. The daily dosage of the atralic acid or its salt is 1.0 ㎖ to 3.0 ㎖ for adults, and can be administered by applying 1 to 5 times a day as needed.

The composition containing atralic acid as an active ingredient may be included in an amount of 0.00001 to 15.0% by weight, preferably 0.0001 to 10% by weight, and more preferably 0.0001 to 5% by weight, based on the total weight of the entire composition. If atralic acid is less than 0.0001% by weight, the efficacy is weak. In addition, if it exceeds 15% by weight, the increase in effect due to an increase in content is minimal, and a problem may occur in which the stability of the formulation is not secured.

In one specific embodiment, the present invention provides a cosmetic composition for promoting hair growth and preventing hair loss comprising the atralic acid or a salt thereof as an active ingredient.

A cosmetic composition according to one specific aspect of the present invention may additionally include ingredients commonly used in cosmetic compositions in addition to a composition containing atralic acid or a salt thereof as an active ingredient. For example, it may include conventional auxiliaries such as antioxidants, stabilizers, solubilizers, vitamins, pigments and perfumes, and carriers.

The cosmetic composition of the present invention can be prepared in any formulation commonly prepared in the art, for example, solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, shampoo, surfactant- It can be formulated as a cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited to this. More specifically, it can be manufactured in formulations such as nutritional cream, astringent lotion, softening lotion, lotion, essence, nutritional gel, or massage cream.

When the formulation of the cosmetic composition is paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide are used as carrier ingredients. It can be.

When the formulation of the cosmetic composition is powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder can be used as the carrier ingredient. In particular, in the case of spray, chlorofluorohydrocarbon, May contain propellants such as propane/butane or dimethyl ether.

When the formulation of the cosmetic composition is a solution or emulsion, a solvent, solubilizing agent, or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, These include 1,3-butyl glycol oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan.

When the formulation of the cosmetic composition is a suspension, the carrier ingredients include water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, and miso. Crystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.

When the formulation of the cosmetic composition is a cleansing agent containing a surfactant, the carrier ingredients include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, and fatty acid. Amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester can be used.

In another specific embodiment, the present invention provides a pharmaceutical composition for promoting hair growth and preventing hair loss containing atralic acid or a salt thereof as an active ingredient.

The pharmaceutical composition may contain a pharmaceutically acceptable carrier in addition to atralic acid or a salt thereof.

Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Includes, but is limited to, calcium silicate, microcrystalline cellulose, polybininpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil. It doesn't work. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered through various routes such as oral or parenteral, and is preferably applied parenterally, more preferably topical application.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. It can be. The oral dosage of the pharmaceutical composition of the present invention is within the range of 0.001-100 mg/kg (body weight) for adults. In addition, in the case of external use, it is recommended to apply 1.0 to 3.0 ml for adults once to 5 times a day and continue for more than 1 month. However, the above dosage does not limit the scope of the present invention.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating it using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by a person skilled in the art. Alternatively, it can be manufactured by placing it in a multi-capacity container. At this time, the formulation may be in the form of a solution, suspension, syrup or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, powder, granule, tablet or capsule, and may additionally contain a dispersant or stabilizer.

In another specific embodiment, the present invention provides a composition for topical skin application for promoting hair growth and preventing hair loss, comprising the atralic acid or a salt thereof as an active ingredient.

The composition for topical skin application according to the present invention may be formulated containing a cosmetically or dermatologically acceptable medium or base. These are all formulations suitable for topical application, such as solutions, gels, solids, pasty anhydrous products, emulsions obtained by dispersing the oil phase in the water phase, suspensions, microemulsions, microcapsules, microgranules or ionic forms (liposomes) and It may be provided in the form of a non-ionic vesicular dispersion, or in the form of a cream, skin, lotion, powder, ointment, spray, pack or concealer stick. It can also be used in the form of foam or in the form of an aerosol composition further containing compressed propellant. These compositions can be prepared according to conventional methods in the art.

In addition, the composition for external application for skin according to the present invention contains fatty substances, organic solvents, solubilizers, thickeners, gelling agents, softeners, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, and ionic types. or non-ionic emulsifiers, fillers, sequestering agents, chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or any other commonly used in cosmetics. It may contain auxiliaries commonly used in the fields of cosmetology or dermatology, such as ingredients. The auxiliaries are introduced in amounts commonly used in the fields of cosmetology or dermatology.

In another specific embodiment, the present invention provides a quasi-drug composition for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient.

The term "quasi-drug" in the present invention refers to products that have a milder effect than pharmaceuticals among products used for the purpose of diagnosing, treating, improving, alleviating, treating, or preventing diseases in humans or animals. For example, quasi-drugs under the Pharmaceutical Affairs Act exclude products used for pharmaceutical purposes and include products used to treat or prevent diseases in humans and animals, and products that have a mild or no direct effect on the human body.

Specifically, the quasi-drugs may include external skin preparations and personal hygiene products. More specifically, it may be a disinfectant cleaner, shower foam, garnish, wet tissue, detergent soap, hand wash, or ointment, but is not limited thereto.

When using the composition according to the present invention as a quasi-drug additive, the composition can be added as is or used together with other quasi-drugs or quasi-drug components, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use.

In another specific embodiment, the present invention provides a food composition for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient.

When using the food composition of the present invention as a food additive, the atralic acid can be added as is or used with other foods or food ingredients, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment), and foodologically acceptable food supplements may be additionally included. The composition of the present invention is not only derived from natural products, but also has been confirmed to be stable through human safety tests, so there is no significant limitation on the mixing amount.

The food composition of the present invention can include all foods in the conventional sense, and can be used interchangeably with terms known in the art such as functional food and health functional food.

The term "functional food" in the present invention refers to food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with Act No. 6727 on Health Functional Food, and "functional" refers to the structure of the human body. It means ingestion for the purpose of controlling nutrients for function or obtaining useful effects for health purposes such as physiological effects.

In addition, the term "health functional food" in the present invention refers to a food manufactured or processed using specific ingredients as raw materials or by extracting, concentrating, refining, or mixing specific ingredients contained in food raw materials for the purpose of health supplementation, It refers to a food designed and processed so that the above ingredients can sufficiently exert bioregulatory functions such as biodefense, regulation of biorhythm, prevention and recovery of disease, etc. to the living body. The composition for health food is used to prevent and treat diseases. It can perform functions related to recovery, etc.

There is no limitation to the types of foods in which the composition of the present invention for hair growth promotion can be used. In addition, the composition containing atralic acid or a salt thereof of the present invention as an active ingredient can be prepared by mixing known additives with other appropriate auxiliary ingredients that may be contained in foods according to the selection of a person skilled in the art. Examples of foods that can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and There are vitamin complexes, etc., and it can be manufactured by adding atralic acid or its salt according to the present invention to juice, tea, jelly, juice, etc.

In addition, foods that can be applied to the present invention include, for example, special nutritional foods (e.g., infant formula, infant and toddler food, etc.), processed meat products, fish products, tofu, jelly, noodles (e.g., ramen, noodles, etc.), and health supplements. , seasoned foods (e.g. soy sauce, soybean paste, red pepper paste, mixed paste, etc.), sauces, confectionery (e.g. snacks), dairy products (e.g. fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various kimchi, pickles, etc.) ), beverages (e.g. fruit, vegetable drinks, soy milk, fermented beverages, etc.), natural seasonings (e.g. ramen soup, etc.), etc.

When the food composition of the present invention is used in the form of a beverage, it may contain various sweeteners, flavoring agents, or natural carbohydrates as additional ingredients like conventional beverages. In addition to the above, the food composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, and alcohol. , may contain carbonating agents used in carbonated beverages, etc. In addition, it may contain pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks.

In another aspect, the present invention provides a method for promoting hair growth and preventing, improving, or treating hair loss in an individual, comprising administering a composition for promoting hair growth and preventing hair loss containing atralic acid as an active ingredient. do.

The hair growth promoting effect of atralic acid is as described above. Additionally, the terms “object”, “prevention”, “treatment”, and “improvement” are as described above.

The prevention, treatment, or improvement method of the present invention may specifically include the step of administering the composition in a pharmaceutically, cosmetically, or foodologically effective amount to an individual who has developed or is likely to develop hair loss. . The method of administration is as described above.

The appropriate dosage of the composition of the present invention varies depending on the patient's condition and weight, degree of disease, drug type, and time, but can be appropriately selected by a person skilled in the art.

The composition containing atralic acid and its salt as an active ingredient of the present invention promotes the expression of hair growth-related genes in dermal papilla cells and significantly increases the length and tensile strength of hair, thereby promoting hair growth and preventing, improving, or It can be usefully used as an active ingredient in cosmetic compositions, pharmaceutical compositions, and external skin preparation compositions for treatment.

Figure 1 shows the results of measuring hair length change due to atralic acid according to an embodiment of the present invention (NC: untreated group, MNX: minoxidil-treated group, AA: atralic acid-treated group).
Figure 2 shows the results of measuring the change in hair tensile strength caused by atralic acid according to an embodiment of the present invention (NC: untreated group, MNX: minoxidil-treated group, AA: atralic acid-treated group).
Figure 3 shows the results of a cytotoxicity test of atralic acid according to an embodiment of the present invention.

Hereinafter, to aid understanding of the present invention, it will be described in detail through examples. However, the embodiments according to the present invention may be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

Example 1: Hair growth gene expression experiment of atraric acid

Tofacitinib was used as a positive control in the hair growth gene expression experiment. Tofacitinib is an enzyme inhibitor of janus kinase 1 (JAK1) and janus kinase 3 (JAK3), which interferes with the JAK-STAT signaling pathway, transmits extracellular information to the cell nucleus, and affects DNA transcription. . Recently, in Harel et al. (Harel S, Higgins CA, Cerise JE, Dai Z, Chen JC, Clynes R, et al. Pharmacologic inhibition of JAK-STAT signaling promotes hair growth. Science Advances. 2015;1(9)), tofacity reported that tofacitinib promoted hair follicle growth, induced growth of dermal papillae, and hair growth. A total of four hair growth-related genes were selected as shown in Table 1 below.

Gene name Forward (5’→3’) Reverse (3’→5’) One Shhh CGGAAGGTATGAAGGGAAGATC CTTGTCCTTACACCTCTGAGTC 4 Prom1 AGCGATCAAGGAGACCAAAG AAGCACAGAGGGTCATTGAG 5 S100a9 TTGCAAAATGTCGCAGCTG CCCCAGCTTCACAGAGTATTG 7 Ptgfr CTTTCAAACACAACCTGCCAG ACGATGCCTTGGACTTCTG HK Gapdh AATCCCATCACCATCTTCCAG AAATGAGCCCAGCCTTC

The Shh gene is an important hair follicle induction signal generated in the hair follicle placode and is known to play a role in inducing epithelial cell proliferation of the early hair follicle epithelium. The Prom1 gene contributes to the formation of HDPs in primary and secondary hair follicles and plays an important role in postnatal hair growth by maintaining the growth onset of HDP cells and is known to mediate signal cross-linking in the hair expansion zone. The S100a9 gene is known to be strong in anagen hair follicles and is involved in keratinocyte differentiation. The Ptgfr gene is known to be involved in hair growth regulation.

Specifically, HDP primary cells were purchased from CEFO Co., Ltd. Cells were cultured in DMEM medium (Gen Depot, TX, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin solution. Cells were cultured at 37°C in a humidified atmosphere with 5% CO ₂ and the medium was changed every 3 days. Cells were dissociated using 0.5% trypsin-EDTA (Gibco, Grand Island, New York) at 80% confluence and passaged at a 1:4 ratio every 3 to 4 days. All experiments used cells subcultured five times.

Five sections ( ^2.0x104 cells/well) of HDP cells were inoculated in DMEM (without FBS and antibiotics) in a 6-well plate (Corning, New York, USA) and incubated in a humidified atmosphere at 37°C for 10 hours. Cultured in 5% CO ₂ . Afterwards, they were treated with 5 mg/mL of atralic acid dissolved in DMSO or the positive control tofacitinib at a final concentration of 5 μg/mL and incubated for 18 hours, harvested three times every 6 hours, and qRT-PCR was performed. did. Total RNA was isolated from HDF cells using easy-spinTM (iNtRON Biotechnology, Korea, Korea) according to the manufacturer's instructions. Total RNA (1 μg) from each sample of treated cells was converted to cDNA using the ImProm-IITM reverse transcriptase kit (Promega, WI, USA) and SYBR green (Bio-Rad, CA, USA). This array included seven genes associated with hair growth, the relative expression levels of which were normalized to the endogenous housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). q RT-PCR was performed on CFX (Bio-Rad, Hercules, USA).

As can be seen in Table 2 below, compared to tofacitinib, which is a positive control, atraric acid has a significantly higher expression rate (%) of hair growth genes Shh, Prom1, S100a9, and Ptgfr. I was able to confirm.

Shhh Prom1 S100a9 Ptgfr Tofacitinib 0.54 8.33 0.93 1.99 fr.5-6 1.30 89.99 0.33 1.90

Example 2: Verification of hair growth promotion and hair loss prevention effects of atralic acid

Changes in hair length and tensile strength caused by atralic acid were observed ex vivo. Specifically, minipig skin tissue from Apures Co. was used. Skin tissue with a thickness of 2 × 2 cm ² from which the lipid film was removed was washed with 70% ethanol and PBS, placed on a plastic mesh in a 24-well plate, filled with culture medium below, and placed in a humidified atmosphere at 37°C. and pre-cultured for 24 hours under 5% CO ₂ conditions. Afterwards, for sample processing, the skin tissue was wiped with 30% ethanol and then each sample diluted in 30% ethanol was treated for 20 minutes. After sample processing was completed, the skin tissue was washed with PBS, the culture medium was replaced, and the culture medium was changed every 48 hours. Hair length and hair extension strength of the cultured tissue were measured periodically. Minoxidil (Hanmi Pharmaceutical) was used as the positive control group, and distilled water was used as the negative control group.

As a result, as can be seen in Figures 1 and 2 below, atralic acid increased hair length and hair tensile strength to the same level as minoxidil even when the content was 1/5 of that of minoxidil, the positive control group. It was confirmed that the hair growth effect was more than 5 times more effective than minoxidil, a commercially available hair growth agent.

Example 3: Cytotoxicity test of atralic acid

Cytotoxicity experiments were confirmed using the CCK-8 assay. Specifically, the mouse macrophage cell line (RAW264.7) was distributed in _a ⁹⁶ -well plate at 5 Samples prepared with LPS (lipopolysaccharide) at a concentration of 10 μg/ml were treated with 100 μl each at concentrations of 10, 30, and 100 μg/ml and cultured for 24 hours. Next, 100 μl of the culture supernatant was removed, treated with 10 μl of CCK-8 reagent, incubated for 3 hours, and the absorbance was measured at 450 nm using a micro plate reader. As a result, as can be seen in Figure 3, it was confirmed that atralic acid was not cytotoxic.

Claims (4)

A pharmaceutical composition for promoting hair growth and preventing hair loss containing atralic acid or a pharmaceutically acceptable salt thereof as an active ingredient, wherein the atralic acid is isolated.
A cosmetic composition for promoting hair growth and preventing hair loss containing atralic acid or a cosmetically acceptable salt thereof as an active ingredient, wherein the atralic acid is isolated.
A food composition for promoting hair growth and preventing hair loss containing atralic acid or a food-acceptable salt thereof as an active ingredient, wherein the atralic acid is isolated.
An external skin composition for promoting hair growth and preventing hair loss containing atralic acid or a salt thereof as an active ingredient, wherein the atralic acid is isolated.