KR102246953B1 - Taqman primer for detecting Edwardsiella tarda - Google Patents

Abstract

As a primer set for amplifying a genetic marker for discrimination or detection of Edwardsiella tarda, a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2; A pair of primers of SEQ ID NO: 3 and SEQ ID NO: 4; A pair of primers of SEQ ID NO: 5 and SEQ ID NO: 6; A pair of primers of SEQ ID NO: 7 and SEQ ID NO: 8; A pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10; And by providing a primer set consisting of a primer pair of SEQ ID NO: 11 and SEQ ID NO: 12 and a probe consisting of SEQ ID NO: 13, there is an effect that can reduce aquaculture damage to a minimum by rapidly and accurately detecting the organism causing Edward's disease for a short period of time.

Description

Edwardsiella tarda detection primer set and identification method using the same {Taqman primer for detecting Edwardsiella tarda}

The present invention relates to a primer set capable of detecting Edwardsiella tarda, which is the causative agent of Edwardian disease in flounder, and to a detection method using the same, and a marker specific for Edward's disease causative bacteria and amplifying the same. It relates to a set of primers that can be made.

Flounder is a major fish species that accounts for the largest production amount among farmed fish in Korea, and a lot of technologies are being developed according to high-density breeding methods and large-scale aquaculture. However, mortality is increasing as various diseases occur due to external factors such as environmental factors, dietary factors, influx of pathogens, and endogenous factors according to the condition of fish species. Major diseases that occur frequently in flounder include various viral diseases including burnavirus that occurs in the fry immediately after hatching, and bacterial diseases such as Edward's disease and streptococci, which occur in the growing season. Parasitic diseases include white spot disease, Ikthiobodosis, scutikaosis, etc. have been reported.

The mortality rate due to bacterial diseases is higher than that of other diseases. In particular, Adword disease is a disease with the greatest damage among bacterial diseases. It is a disease that occurs in all breeding stages, and once an outbreak occurs, cumulative death occurs over a long period of time.

Edwardsiella tarda has been reported as a causative agent in most fish, including flounder. In addition, Streptococcus iniae, S.parauberis, and Lactococcus garvieae have been reported as causative bacteria of various pathogens, and studies have been reported that S.iniae, S.

Representative symptoms that can be seen in disease-infected flounder for accurate causative analysis include changes in body color, eye abnormalities, abdominal distension, and external and internal symptoms such as a hernia. However, it is difficult to accurately diagnose a disease with only these symptoms, and a mixed or secondary infection may occur depending on the farm environment and the condition of the fish, so the disease must be accurately diagnosed.

In the case of currently available disease molecular diagnostic kits, the outer primer (specific primer) other than the probe sequence has no amplification specificity using a universal primer, so if an additional mutant entity appears at the probe site, a false negative result due to non-amplification. Is likely to occur, and the PNA probe used in the past is more than two times more expensive in terms of price than the general Taqman probe.

Therefore, in the present invention, forward/reverse primers are primarily prepared as specific amplification markers for bacterial diseases, viral diseases, and parasitic diseases, and secondly, Edwardsiella tarda (Edwardsiella tarda ) Primers that can identify the causative agent of Edwardian disease in flatfish by improving accuracy and specificity than existing diagnostic markers through quantitative analysis using positive control to make probes at specific sites that only species have in common and confirm carrier status. It is intended to provide a set and a probe and a method of discrimination using the same.

In Korea Patent Registration No. 10-0318089, Edwardsiella tarda, including 16S rRNA of SEQ ID NO: 10 isolated from Edwardsiella tarda, and oligonucleotides of a specific sequence obtained therefrom. Oligonucleotide probe for detecting (probe) is a probe with significantly reduced cross-reaction, high sensitivity and improved specificity compared to the conventional oligonucleotide probe, and the method of manufacturing a multimeric probe using PCR of the present invention is simple and quick. Disclosed is an economical probe manufacturing method capable of manufacturing a multibody probe having excellent specificity. Korean Patent No. 10-1409493 relates to a peptide that binds to Edwardsiella tarda, a method for manufacturing the same, and a method for detecting Edward bacteria using the same. When using the peptide, it is economical compared to using an antibody. Disclosed is a peptide that binds to the Ed ward bacteria, which can easily detect Ed ward bacteria, a method for producing the same, and a method for detecting Ed ward bacteria using the same. Korean Patent No. 10-1481258 relates to a primer for simultaneous detection of Vibrio and Edward bacteria, a method for detecting pathogenic microorganisms through polymerase chain reaction using the primer, and a detection kit. The primer according to the present invention has a characteristic capable of detecting pathogenic bacteria at trace concentrations, and simultaneous detection of Vibrio and Edward bacteria that can accurately and quickly detect Vibrio and Edward bacteria in a single PCR reaction. It discloses a primer for use and its use. Korean Patent Registration No. 10-1644773 relates to a genetic marker for discrimination and detection of the causative bacteria of fish Ed Ward infection and streptococcal infection, and a method of discriminating and detecting the causative bacteria using the same. Edwardsiella tarda, a streptococcal pathogen, streptococcus streptococcus iniae, Streptococcus parauberis, and Lactococcus garvieae 16 After selecting and amplifying a gene marker containing bacterial-specific single nucleotide polymorphism (SNP) among the DNA nucleotide sequences encoding the gene, peptide nucleic acid (PNA) that specifically recognizes the amplified product is used. A fish edward capable of obtaining a melting curve for each temperature by hybridizing and controlling the temperature of the hybridized product, and determining the bacterial species from the melting temperature through the analysis of the obtained melting curve or detecting the infection of the bacterial species in the fish. Disclosed is a genetic marker for discrimination and detection of infectious diseases and streptococcal infectious bacteria, and a method for discriminating and detecting the causative bacteria using the same.

In the present invention, firstly, forward/reverse primers are prepared as specific amplification markers, and secondly, a probe is provided at a specific site that only Edwardsiella tarda species have in common. Provides a specific detection method of Edwardsiella tarda that can diagnose disease with higher accuracy and specificity than existing diagnostic markers through quantitative analysis using positive control so that it can be manufactured and confirmed carrier status, and its primer set and probe I want to.

In order to achieve the above object, a primer set and a pro for amplifying a genetic marker for discrimination or detection of Edwardsiella tarda according to an embodiment of the present invention include a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2; A pair of primers of SEQ ID NO: 3 and SEQ ID NO: 4; A pair of primers of SEQ ID NO: 5 and SEQ ID NO: 6; A pair of primers of SEQ ID NO: 7 and SEQ ID NO: 8; A pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10; And a primer set consisting of a primer pair of SEQ ID NO: 11 and SEQ ID NO: 12 and a probe consisting of SEQ ID NO: 13, and a primer set and a probe for amplifying a genetic marker for discrimination or detection of Edwardsiella tarda. It may be to include.

The present invention enables detection of Edwardsiella tarda, which is the causative agent of Edwardian disease of flounder, not only for flounder, but also for other species, and improves accuracy and specificity compared to existing diagnostic markers, enabling rapid and precise diagnosis of disease. It works.

FIG. 1 shows a gene position diagram for explaining a nucleotide displacement site contained in a gene-specific peptide nucleic acid for discrimination and detection of Edwardsiella tarda of the present invention.
Figure 2 shows the results of electrophoresis of PCR products for discrimination of Edwardsiella tarda of the present invention.
3 shows the blast results in the NCBI database.
4 shows the results of specific amplification PCR electrophoresis.
5 shows the results of real-time polymerase chain reaction using a primer set specific for Edwardsiella tarda according to the experimental example of the present invention.
6 shows the results of real-time polymerase chain reaction using a primer set specific for Edwardsiella tarda according to the experimental example of the present invention.
7 shows the results of real-time polymerase chain reaction using a probe specific to Edwardsiella tarda according to the experimental example of the present invention.
8 shows the results of real-time polymerase chain reaction using a probe specific for Edwardsiella tarda according to the experimental example of the present invention.
9 shows a graph of the detection limit according to the stepwise dilution of the experimental example of the present invention.

Hereinafter, a primer set capable of specifically detecting Edwardsiella tarda, the causative agent of Adwords disease of the present invention, and an identification method using the same will be described in detail with reference to the drawings.

The present invention provides a primer set and a probe capable of specifically detecting Edwardsiella tarda, the causative agent of Adwords disease, through real-time polymerase chain reaction.

A probe referred to in the present invention has a nucleotide sequence of SEQ ID NO: 13 capable of binding to a complementary sequence in a nucleic acid of a sample, such as a primer set, in the process of polymerase chain reaction, and a fluorescent substance (fluorescent material) at the 5'end. reporter dye) may be labeled. The probe or primer of the present invention may be further modified to include a detectable label for diagnostic and probe purposes.

These various labels are well known in the art, and the fluorescent material is carboxyfluorescein (FAM), 2,7-dimethoxy-4,5-dichloro-6carboxyfluoroscein (JOE), 6-carboxy-2',4,4',5 ',7,7'-hexachlorofluorescein (HEX), 5-Carboxytetramethylrhodamine (TAMRA), indocarbocyanine-3 (Cy3), indocarbocyanine-5 (Cy5), or 6-Carboxy-X-rhodamine (Rox) can be used. According to an embodiment of the present invention, carboxyfluorescein (FAM) and hexachlorofluorescein (HEX) may be preferably used, but are not limited thereto.

The primers and probes of the present invention are preferably a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair of SEQ ID NO: 3 and SEQ ID NO: 4, a primer pair of SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 Edwardsiella tarda, including a primer set consisting of a primer pair of SEQ ID NO: 9 and SEQ ID NO: 10, a primer pair consisting of SEQ ID NO: 11 and SEQ ID NO: 12, and a probe consisting of SEQ ID NO: 13 It is possible to provide a kit for detecting.

The kit includes an amplification buffer solution, dNTP, control, detection reagent, etc. in addition to the primers or probes of the present invention, and is preferably provided in a dry state, and contains additional components according to the purpose only when there is no effect on the reaction. can do. The kit provided in a dry state can be used for a long period of time due to improved storage stability, and since the manufacturing process of the mixed solution is omitted, accurate quantitative results with high reproducibility can be obtained within a short time regardless of the skill level of the experimenter.

The kit may further include a primer and a probe for an internal control. During the polymerase chain reaction, an internal positive control (internal positive control, hereinafter also referred to as'IPC') template and a suitable primer are prepared and put together, so that whether or not PCR has been performed can be easily checked.

Hereinafter, a specific experimental example will be described.

Experimental Example 1. Preparation of positive control

The powdery bacteria, which were pre-sold from the National Fisheries Research Institute of Pathology, were incubated in 1.5% NaCl-BHIB (BD) at 30° C. for 24 to 48 hours. Cultured bacteria were separated one by one (single colony), and then stored at -80°C with sterile glycerol, and then used for species identification.

Molecular species identification and sequencing were performed to increase the accuracy of the isolated E. tarda strain. Table 1 below shows E.tarda universal primer information for species identification.

Each strain was cultured in 1.5% NaCl-BHIB (BD) to isolate genomic DNA, and molecular species identification was PCR using forward and reverse primer sets that can identify each strain by referring to the paper and NCBI database sequence. Was carried out.

PCR conditions were 94℃ for 5 minutes, 94℃ for 30 seconds, 55℃ for 45 seconds, 72℃ for 45 seconds for 30 cycles, 72℃ for 5 minutes, and the resulting PCR amplification product was electrophoresed on a 1.5% agarose gel. As a result, firstly, the result of the band size was confirmed.

E.tarda general purpose primer information (for follower identification) Pathogen Target gene Sequence (5’-3’) Size (bp) E.tarda gyrB1 TAC TCG CGT GCG TTT CTG G 448 GTC ACC GGT AGC GGA GAT TT

Experimental example 2. Edward Siela Tarda peculiarity Marker making

The production step of Edwardsiella tarda specific marker according to Experimental Example 2 of the present invention includes the steps of culturing Edwardsiella tarda bacteria and extracting DNA from infected flounder 1); Step 2) of performing a polymerase chain reaction (PCR) on the extracted DNA with a general PCR primer; Step 3) of sequencing blast for species identification and verification; Step 4) of preparing a marker for specific detection using the Edwardsiella tarda gene; Specific site selection and marker production, general PCR, SYBR real-time PCR confirmation step 5); It may consist of step 6) of fabricating and analyzing Taqman probes in the Edwardsiella tarda conserved region.

A flatfish object showing external symptoms such as hernia, skin redness, eye abnormalities, and abdominal distension was dissected at farm A located in Geoje Island, and tissues such as the head, gills, epidermis, and tail fin were separated from the blood.

In addition, for securing the bacteria, tissue fluid and tissue were smeared on SS agar and cultured at 30° C. for 24 to 48 hours. At this time, the cultured Edwardian bacteria use hydrogen sulfide to generate gas so that the red medium turns black in the area where the bacteria grow.

The cultured bacteria are separated by single colony and cultured in 1.5% NaCl-BHIB (BD), and the tissues of the head, gills, and redness area are stored in ethanol and RNA Later, and transported immediately. Total genomic DNA was extracted using a DNA extraction kit.

In order to increase the accuracy of the isolated E. tarda strain, molecular species identification and sequencing were performed. ABI 3730XL (capillary 96ea X 50cm) was used for sequencing, and the reagent used for analysis was BigDye® Terminator v3.1Cycle Sequencing Kit. For the final sequencing result, PCR was performed using a set of forward and reverse primers that can identify each bacteria by referring to the NCBI database sequence.

PCR conditions were 94℃ for 5 minutes, 94℃ for 30 seconds, 55℃ for 45 seconds, 72℃ for 45 seconds for 30 cycles, 72℃ for 5 minutes, and the resulting PCR amplification product was electrophoresed on a 1.5% agarose gel. As a result, firstly, the result of the band size was confirmed. In addition, sequencing was performed on the amplified product to confirm NCBI blast analysis and consistency, and final follower identification was performed.

In order to specifically amplify only E. tarda, 7 sets of infected specific markers were prepared and tested. To increase specificity, the amplification site used the specific gene, gyrB1, and the sequence of the site was used to select the unique consensus sequence that only E.tarda has, and annealing temperature, GC to further increase the amplification efficiency. It was produced in consideration of the ratio and size.

Phtobacterium damselae, Vibrio harveyi, Vibrio ichthyoenteri, Edwardsiella tarda, Streptococcus parauberis, Lactococcus garvieae, and Steptocuccus iniae were used to confirm the specific PCR amplification of E. PCR conditions were 94°C for 5 minutes, 94°C for 30 seconds, 62°C for 30 seconds, 72°C for 30 seconds for 34 cycles, and 72°C for 5 minutes. The resulting PCR amplification product was electrophoresed on a 1.5% agarose gel to confirm the band size and the amplification.

In addition, real-time PCR using SYBR was also conducted simultaneously for precise diagnosis of areas that are difficult to check with the naked eye with normal PCR. PCR conditions were at 94℃ 5 minutes, 94℃ 30 seconds, 62℃ 30 seconds, and 72℃ 30 seconds. It reacted for 5 minutes at 34 cycles and 72°C.

DNA was all diluted to 1 ng/ul and adjusted, and the reagent used was Template 1 ul. Primer (10p) 2ul, SYBr (takara, Japan) 10ul, and Distil water 7ul were added. The device used for real-time PCR is StepOne plus (applied biosystems, USA), and the conditions used for real-time PCR are 95℃ for 30 seconds, 95℃ for 5 seconds, 60℃ for 30 seconds for 40 cycles, and 95℃ for 15 seconds. The reaction was performed at 60° C. for 1 minute and 95° C. for 15 seconds.

A Taqman probe attached with a fluorescent substance (FAM, HEX) was designed to confirm the detection of real-time PCR Edwardosis using a Taqman probe for simultaneous multiplex testing.Since there should not be mutations in Edward tarda individuals, NCBI The nucleotide sequence of various cases for the homogeneous was collected through Blast. The collected E. tarda was aligned through sequence alignment, and the Taqman probe was designed in the preserved area without mutation.

Real-time polymerization chain reaction was performed using the designed Taqman probe. The template was DNA diluted with 1 ng/ul, and the template was 1 ul. Primer (10p) 2ul, Taqman probe (10p) 1ul, Alltaq premix 10ul (self-developed master mix for taqman) Distil water 6ul was added. The device used for real-time PCR was StepOne plus (applied biosystems, USA), and the conditions used for real-time PCR were 95°C for 30 seconds, 95°C for 5 seconds, 60°C for 30 seconds and 40 cycles.

Table 2 below shows gene marker information specific to the above-described Streptococcus (Straptococcus inae, Streptococcus parauberis) and Edwardsiella tarda of the present invention.

Genetic marker Pathogen Target gene Sequence (5’-3’) Size (bp) s.parauberis 23S rRNA GTT CCC TCA GAT TGG TTG GA 103 TCA CTA AGC CCG ACT TTC GT s.iniae 16S rRNA AGG TAA CGG CTC ACC AAG G 127 CTT CCG TCC ATT GCC GAA E.tarda gyrB1 GAA CAA AAC GCC AAT CCA TC 104 TAT TCT CCT GGA AGC CAT CG

Figure 2 shows the results of electrophoresis of PCR products for discrimination of Edwardsiella tarda of the present invention. When PCR was carried out using a universal primer for species identification of E. tarda isolated and identified in a farm, a target band was identified. The band was subjected to gel purification, followed by sequencing, and the sequence is shown in Table 3 below.

Edwardsiella tarda sequencing results >E.tarda TCTGGCTAGCGCCTGCGCGAACTCTCTTTCCTGAACTCCGGCGTCTCCATCCGCCTGCGCGATAAACGCAACGATCGCGAAGATCATTTCCACTATGAGGGTGGGATTAAGGCGTTTGTCGAGTATCTGAACAAGAACAAAACGCCAATCCATCCGAACGTGTTTTACTTTTCGACCATGAAGGATGATATCGGCGTAGAAGTGGCGCTGCAGTGGAACGATGGCTTCCAGGAGAATATCTACTGCTTTACCAATAACATCCCGCAGCGCGACGGCGGGACCCATTTGGCCGGTTTCCGTGCGGCGATGACCCGTACGCTGAACAGCTACATGGAAAACGAAGGCTATACCAAGAAGAGCAAAA

3 shows the blast results in the NCBI database. When blasting was performed in the NCBI database using the above sequence, it was identified as E.tarda with 100% quary cover and 99.7% identity. In order to specifically amplify only E.tarda using the sequence, 6 sets of infected specific markers were prepared. The information on the six markers of SEQ ID NOs: 1 to 12 is shown in Table 4 below. The gene position diagram for explaining the nucleotide displacement site contained in the gene-specific peptide nucleic acid for discrimination and detection of Edwardsiella tarda is shown.

Primer set Sequence number Name FORWARD PRIMER1 (5'-3') One E.tarda_01F AAAGTGGTTGGCGACACC 2 E.tarda_01R ATCCCACCCTCATAGTGGAA 3 E.tarda_02F CGTTTCTGGCCGAGCATG 4 E.tarda_02R ACGTTCGGATGGATTGGC 5 E.tarda_03F GCAACGATCGCGAAGATCA 6 E.tarda_03R AAACCGGCCAAATGGGTC 7 E.tarda_11F GGCGTTTGTCGAGTATCTGA 8 E.tarda_11R GTTCAGCGTACGGGTCATC 9 E.tarda_48F CCCATTTGGCCGGTTTCC 10 E.tarda_48R CGTTCATCAGCGACTCAACG 11 E.tarda_94F CGCTGAACAGCTACATGGAA 12 E.tarda_94R CCAGACGCTCGTTCATCAG

To verify the specificity of the produced specific primers , the PCR specific amplification of E. Implemented. 4 shows the results of specific amplification PCR electrophoresis. Except for E.tarda_02, a set of forward and reverse primers for six species-specific markers, which were amplified only in E.tarda, with no bands identified in other species were first selected.

Real-time polymerization chain reaction was performed to accurately confirm the first selected six specific markers. 5 to 6 show the results of real-time polymerase chain reaction using a primer set specific for Edwardsiella tarda according to the experimental example of the present invention.

Among the six markers, E.tarda_03 and E.tarda_11 markers that can be used as species-specific marker forward/reverse primer sets were finally selected, and the results are as follows. As shown in the figure above, as a result of real-time PCR using Syber green, it was confirmed that no peak appeared in 6 species other than E.

The results of real-time PCR using Taqman probe are as follows. For the simultaneous multiplex test, a Taqman probe with FAM dye was designed to confirm the detection of real-time PCR edwardosis using a Taqman probe to increase the accuracy of detection in addition to the forward and reverse primer sets.The probe information is as follows.

Taqman probe information Sequence number Name Dye 5'->3' sequence Quencher Remark 13 TM_p_ET3 6-FAM ATCCATCCGAACGTGTT TAMRA HPLC purification

Real-time PCR was performed using the probe, and the results are shown in FIGS. 7 to 8. In the case of the final selected E.tarda_3 and 11 primers, as a result of confirming whether amplification using bacteria other than E.tarda was used, no amplification peak appeared, and as a result of quantitative analysis, Cq value did not show any amplification, the two markers were specifically detected. As a marker, it has very high accuracy and is thought to be effective in disease detection.

Experimental Example 3. Minimum detection limit of gene detection method

Bacteria extracted and detected from tissues from gills, head shin, and liver were used in this study from more than 100 poultry fish that are apparently infected with diseases at flounder farms in Geoje and Pohang areas.

General bacteria culture was carried out at 29~30℃ for 24-48 hours after spreading the isolated tissue solution and tissue in 1.5% NaCl-BHIA (BD). Cultured bacteria were separated one by one (single colony), cultured in 1.5% NaCl-BHIB (Brain Heart Infusion Broth, Difco, USA), and then stored at -80°C with sterile glycerol and used for species identification.

In order to isolate Edward bacteria, the separated tissue solution and tissue were smeared on SS agar and incubated at 30° C. for 24 to 48 hours. Cultured Edwardian bacteria use hydrogen sulfide to generate gas, so that the red medium turns black in the area where the bacteria grow. The cultured bacteria were separated one by one (single colony), and then cultured in 1.5% NaCl-BHIB (BD), and then sterile glycerol was added and stored at -80°C and used for species identification.

In order to investigate the maximum detection limit when diagnosing a disease using bacteria detected in the field and bacteria distributed in the National Fisheries Research Institute, DNA concentration was subjected to a serial dilution method and confirmed through a standard curve. A graph of the detection limit according to dilution is shown.

The detection limit in the graph was confirmed to be detectable up to a minimum of 0.001 ng (1 pg), and the cq value for this was found from 19.05 to 34.16, indicating a high R2 value of 0.999, confirming the highly reliable result. This is currently the most widely used for disease testing in humans, and it is believed that the accurate taqman technique can be used to test not only flounder but also aquatic substances disease, to identify bacteria in a more accurate and carrying state, thereby preventing economic damage caused by diseases in the future.

The present invention is capable of quickly and accurately discriminating the causative agent of adword disease of halibut, thereby preventing the spread of disease in halibut farming in a short period of time, thereby minimizing the loss of fishermen related thereto, and thus has industrial applicability.

<110> HAN, Jiseong <120> Taqman primer for detecting Edwardsiella tarda <130> p19-0580121 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_01 foward primer <400> 1 aaagtggttg gcgacacc 18 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_01 reverse primer <400> 2 atcccaccct catagtggaa 20 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_02 foward primer <400> 3 cgtttctggc cgagcatg 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_02 reverse primer <400> 4 acgttcggat ggattggc 18 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_03 foward primer <400> 5 gcaacgatcg cgaagatca 19 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_03 reverse primer <400> 6 aaaccggcca aatgggtc 18 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_11 foward primer <400> 7 ggcgtttgtc gagtatctga 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_11 reverse primer <400> 8 gttcagcgta cgggtcatc 19 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_48 foward primer <400> 9 cccatttggc cggtttcc 18 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_48 reverse primer <400> 10 cgttcatcag cgactcaacg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_94 foward primer <400> 11 cgctgaacag ctacatggaa 20 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> E.tarda_94 reverse primer <400> 12 ccagacgctc gttcatcag 19 <210> 13 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> TM_p_ET3 probe <400> 13 atccatccga acgtgtt 17

Claims (4)

A pair of primers of SEQ ID NO: 1 and SEQ ID NO: 2; A pair of primers of SEQ ID NO: 3 and SEQ ID NO: 4; A pair of primers of SEQ ID NO: 5 and SEQ ID NO: 6; A pair of primers of SEQ ID NO: 7 and SEQ ID NO: 8; A pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10; And a primer set for detecting Edwardsiella tarda, which is a halibut adwords disease causative agent, consisting of a pair of primers of SEQ ID NO: 11 and SEQ ID NO: 12 delete A kit for detecting Edwardsiella tarda comprising a probe consisting of the primer set of claim 1 and SEQ ID NO: 13 (a) extracting genomic DNA from the flounder sample;
(b) Real-Time Polymerase Chain Reaction using the extracted genomic DNA, a primer set of claim 1, and a probe consisting of SEQ ID NO: 13 Performing; And
(c) Edwardsiella tarda detection method consisting of the step of analyzing the result of (b)

Images